>Feature sequence001 176 607 gene locus_tag LOCUS_00010 176 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1860 685 gene locus_tag LOCUS_00020 gene anmK 1860 685 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_00020 3145 2000 gene locus_tag LOCUS_00030 3145 2000 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_00030 4200 3142 gene locus_tag LOCUS_00040 4200 3142 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_00040 4448 7990 gene locus_tag LOCUS_00050 4448 7990 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00050 8070 8930 gene locus_tag LOCUS_00060 8070 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8976 9557 gene locus_tag LOCUS_00070 8976 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9621 10445 gene locus_tag LOCUS_00080 9621 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10432 11127 gene locus_tag LOCUS_00090 10432 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11470 11306 gene locus_tag LOCUS_00100 11470 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11804 11445 gene locus_tag LOCUS_00110 11804 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13379 12021 gene locus_tag LOCUS_00120 13379 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13609 13418 gene locus_tag LOCUS_00130 13609 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14086 13949 gene locus_tag LOCUS_00140 14086 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16869 14200 gene locus_tag LOCUS_00150 gene acnA 16869 14200 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_00150 17858 17082 gene locus_tag LOCUS_00160 17858 17082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18810 18001 gene locus_tag LOCUS_00170 18810 18001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19278 18859 gene locus_tag LOCUS_00180 gene ndk 19278 18859 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846241.1 protein_id gnl|my_center|LOCUS_00180 23489 19743 gene locus_tag LOCUS_00190 23489 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27021 23605 gene locus_tag LOCUS_00200 27021 23605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 27688 27425 gene locus_tag LOCUS_00210 27688 27425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 28004 27726 gene locus_tag LOCUS_00220 28004 27726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28323 28057 gene locus_tag LOCUS_00230 28323 28057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 29146 28403 gene locus_tag LOCUS_00240 29146 28403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 29404 29219 gene locus_tag LOCUS_00250 29404 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30263 29433 gene locus_tag LOCUS_00260 30263 29433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31085 30351 gene locus_tag LOCUS_00270 31085 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31995 31183 gene locus_tag LOCUS_00280 31995 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32867 32028 gene locus_tag LOCUS_00290 32867 32028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 33636 32914 gene locus_tag LOCUS_00300 33636 32914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34311 33697 gene locus_tag LOCUS_00310 34311 33697 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_00310 34533 35321 gene locus_tag LOCUS_00320 34533 35321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36477 35716 gene locus_tag LOCUS_00330 36477 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36662 36465 gene locus_tag LOCUS_00340 36662 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37242 36856 gene locus_tag LOCUS_00350 37242 36856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39291 37267 gene locus_tag LOCUS_00360 39291 37267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 40814 39795 gene locus_tag LOCUS_00370 40814 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 41107 40823 gene locus_tag LOCUS_00380 41107 40823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41730 42053 gene locus_tag LOCUS_00390 41730 42053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 42079 44196 gene locus_tag LOCUS_00400 42079 44196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44965 45687 gene locus_tag LOCUS_00410 44965 45687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 45726 46001 gene locus_tag LOCUS_00420 45726 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 46061 46753 gene locus_tag LOCUS_00430 46061 46753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46773 47516 gene locus_tag LOCUS_00440 46773 47516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47630 48328 gene locus_tag LOCUS_00450 47630 48328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 48328 48834 gene locus_tag LOCUS_00460 48328 48834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48831 49328 gene locus_tag LOCUS_00470 48831 49328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50732 49647 gene locus_tag LOCUS_00480 gene dgoD 50732 49647 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969235.1 protein_id gnl|my_center|LOCUS_00480 50996 52489 gene locus_tag LOCUS_00490 50996 52489 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_00490 52708 53349 gene locus_tag LOCUS_00500 52708 53349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53470 54489 gene locus_tag LOCUS_00510 53470 54489 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_00510 54493 55398 gene locus_tag LOCUS_00520 54493 55398 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_00520 55766 57778 gene locus_tag LOCUS_00530 55766 57778 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_00530 57807 61634 gene locus_tag LOCUS_00540 57807 61634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61658 63865 gene locus_tag LOCUS_00550 61658 63865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_00550 63884 65053 gene locus_tag LOCUS_00560 63884 65053 CDS product DarT ssDNA thymidine ADP-ribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257834.1 protein_id gnl|my_center|LOCUS_00560 65100 68669 gene locus_tag LOCUS_00570 65100 68669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922196.1 protein_id gnl|my_center|LOCUS_00570 68773 69720 gene locus_tag LOCUS_00580 68773 69720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 69742 71451 gene locus_tag LOCUS_00590 69742 71451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71459 72559 gene locus_tag LOCUS_00600 71459 72559 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_00600 72600 75038 gene locus_tag LOCUS_00610 72600 75038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 75672 76850 gene locus_tag LOCUS_00620 75672 76850 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_00620 76929 77696 gene locus_tag LOCUS_00630 76929 77696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77794 78357 gene locus_tag LOCUS_00640 gene hslV 77794 78357 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881090.1 protein_id gnl|my_center|LOCUS_00640 78424 79935 gene locus_tag LOCUS_00650 gene hslU 78424 79935 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_00650 80747 79971 gene locus_tag LOCUS_00660 80747 79971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80826 81662 gene locus_tag LOCUS_00670 80826 81662 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_00670 82228 81659 gene locus_tag LOCUS_00680 82228 81659 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_00680 83731 82298 gene locus_tag LOCUS_00690 83731 82298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 86760 83728 gene locus_tag LOCUS_00700 86760 83728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 87101 86859 gene locus_tag LOCUS_00710 87101 86859 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_00710 87638 87168 gene locus_tag LOCUS_00720 87638 87168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 88394 87975 gene locus_tag LOCUS_00730 88394 87975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89798 88419 gene locus_tag LOCUS_00740 89798 88419 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_00740 91898 90093 gene locus_tag LOCUS_00750 91898 90093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 93487 92054 gene locus_tag LOCUS_00760 93487 92054 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_00760 93876 93565 gene locus_tag LOCUS_00770 93876 93565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 94346 93879 gene locus_tag LOCUS_00780 94346 93879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94787 94401 gene locus_tag LOCUS_00790 94787 94401 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943000.1 protein_id gnl|my_center|LOCUS_00790 95109 97298 gene locus_tag LOCUS_00800 gene katG 95109 97298 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_00800 97484 98914 gene locus_tag LOCUS_00810 97484 98914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 98939 100816 gene locus_tag LOCUS_00820 98939 100816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 102523 101078 gene locus_tag LOCUS_00830 102523 101078 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_00830 104089 102596 gene locus_tag LOCUS_00840 104089 102596 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937338.1 protein_id gnl|my_center|LOCUS_00840 105687 104089 gene locus_tag LOCUS_00850 105687 104089 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_00850 106269 105829 gene locus_tag LOCUS_00860 106269 105829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 107444 106311 gene locus_tag LOCUS_00870 107444 106311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 107626 107441 gene locus_tag LOCUS_00880 107626 107441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 108092 107637 gene locus_tag LOCUS_00890 108092 107637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 110421 108508 gene locus_tag LOCUS_00900 gene nuoL 110421 108508 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_00900 110730 110425 gene locus_tag LOCUS_00910 gene nuoK 110730 110425 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_00910 111280 110759 gene locus_tag LOCUS_00920 111280 110759 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_00920 112533 111292 gene locus_tag LOCUS_00930 gene nuoH 112533 111292 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_00930 114230 112575 gene locus_tag LOCUS_00940 114230 112575 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_00940 115750 114257 gene locus_tag LOCUS_00950 gene nuoF 115750 114257 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_00950 116412 115849 gene locus_tag LOCUS_00960 116412 115849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 117095 116571 gene locus_tag LOCUS_00970 gene nuoE 117095 116571 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_00970 117959 117162 gene locus_tag LOCUS_00980 117959 117162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 118838 118065 gene locus_tag LOCUS_00990 118838 118065 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_00990 119137 118943 gene locus_tag LOCUS_01000 119137 118943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 120055 119213 gene locus_tag LOCUS_01010 120055 119213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121060 120197 gene locus_tag LOCUS_01020 121060 120197 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929296.1 protein_id gnl|my_center|LOCUS_01020 121477 121121 gene locus_tag LOCUS_01030 121477 121121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 122749 121553 gene locus_tag LOCUS_01040 gene nuoD 122749 121553 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_01040 123347 122799 gene locus_tag LOCUS_01050 123347 122799 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_01050 123867 123340 gene locus_tag LOCUS_01060 123867 123340 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_01060 124226 123858 gene locus_tag LOCUS_01070 124226 123858 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_01070 125049 124663 gene locus_tag LOCUS_01080 125049 124663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 125809 125567 gene locus_tag LOCUS_01090 125809 125567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 126554 125913 gene locus_tag LOCUS_01100 gene pdxH 126554 125913 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_01100 128064 126556 gene locus_tag LOCUS_01110 128064 126556 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_01110 130777 128372 gene locus_tag LOCUS_01120 130777 128372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 131597 130938 gene locus_tag LOCUS_01130 131597 130938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 133042 131639 gene locus_tag LOCUS_01140 133042 131639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 133373 133131 gene locus_tag LOCUS_01150 133373 133131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 134370 133345 gene locus_tag LOCUS_01160 134370 133345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 137233 135860 gene locus_tag LOCUS_01170 gene trkA 137233 135860 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_01170 137771 137403 gene locus_tag LOCUS_01180 137771 137403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 138016 137759 gene locus_tag LOCUS_01190 138016 137759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 141104 138237 gene locus_tag LOCUS_01200 gene gcvP 141104 138237 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_01200 141483 141097 gene locus_tag LOCUS_01210 gene gcvH 141483 141097 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_01210 143583 141523 gene locus_tag LOCUS_01220 143583 141523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 144896 143826 gene locus_tag LOCUS_01230 gene gcvT 144896 143826 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_01230 145285 145022 gene locus_tag LOCUS_01240 145285 145022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 145529 145338 gene locus_tag LOCUS_01250 145529 145338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 147426 145615 gene locus_tag LOCUS_01260 147426 145615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 147905 147636 gene locus_tag LOCUS_01270 147905 147636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_01270 148120 147902 gene locus_tag LOCUS_01280 148120 147902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 148525 148223 gene locus_tag LOCUS_01290 148525 148223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 149313 148558 gene locus_tag LOCUS_01300 149313 148558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 150544 149492 gene locus_tag LOCUS_01310 150544 149492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 151170 150547 gene locus_tag LOCUS_01320 151170 150547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 151435 151145 gene locus_tag LOCUS_01330 151435 151145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 153924 151594 gene locus_tag LOCUS_01340 gene pnp 153924 151594 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_01340 154262 153972 gene locus_tag LOCUS_01350 gene rpsO 154262 153972 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence002 4198 2081 gene locus_tag LOCUS_01360 4198 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4369 4668 gene locus_tag LOCUS_01370 4369 4668 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_01370 4725 6113 gene locus_tag LOCUS_01380 4725 6113 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664224.1 protein_id gnl|my_center|LOCUS_01380 6276 6671 gene locus_tag LOCUS_01390 gene higA 6276 6671 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_01390 6748 7974 gene locus_tag LOCUS_01400 6748 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8007 9410 gene locus_tag LOCUS_01410 8007 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9433 11262 gene locus_tag LOCUS_01420 9433 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 11267 11686 gene locus_tag LOCUS_01430 11267 11686 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_01430 11695 12567 gene locus_tag LOCUS_01440 11695 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12592 13785 gene locus_tag LOCUS_01450 12592 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 13807 15894 gene locus_tag LOCUS_01460 13807 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 15942 17117 gene locus_tag LOCUS_01470 15942 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 18832 17213 gene locus_tag LOCUS_01480 18832 17213 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_01480 19036 20007 gene locus_tag LOCUS_01490 19036 20007 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_01490 20033 20860 gene locus_tag LOCUS_01500 20033 20860 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_01500 21339 20872 gene locus_tag LOCUS_01510 21339 20872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 21402 22226 gene locus_tag LOCUS_01520 21402 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 22315 22575 gene locus_tag LOCUS_01530 22315 22575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 23465 22572 gene locus_tag LOCUS_01540 gene prmA 23465 22572 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 protein_id gnl|my_center|LOCUS_01540 24634 23513 gene locus_tag LOCUS_01550 gene dnaJ 24634 23513 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706780.1 protein_id gnl|my_center|LOCUS_01550 25380 24658 gene locus_tag LOCUS_01560 25380 24658 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872625.1 protein_id gnl|my_center|LOCUS_01560 26195 25449 gene locus_tag LOCUS_01570 26195 25449 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_01570 28106 26889 gene locus_tag LOCUS_01580 28106 26889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 28997 28143 gene locus_tag LOCUS_01590 28997 28143 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_01590 30147 29089 gene locus_tag LOCUS_01600 gene lpxD 30147 29089 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_01600 30837 30256 gene locus_tag LOCUS_01610 30837 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 33579 30934 gene locus_tag LOCUS_01620 33579 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 34525 33641 gene locus_tag LOCUS_01630 gene ilvE 34525 33641 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_01630 35272 34565 gene locus_tag LOCUS_01640 35272 34565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_01640 36793 35324 gene locus_tag LOCUS_01650 36793 35324 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_01650 37424 36864 gene locus_tag LOCUS_01660 37424 36864 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_01660 37975 37421 gene locus_tag LOCUS_01670 37975 37421 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_01670 39449 37977 gene locus_tag LOCUS_01680 gene lysS 39449 37977 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_01680 40920 39529 gene locus_tag LOCUS_01690 40920 39529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 42341 40941 gene locus_tag LOCUS_01700 42341 40941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 43755 42367 gene locus_tag LOCUS_01710 43755 42367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 44855 43782 gene locus_tag LOCUS_01720 gene prfB 44855 43782 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_01720 46478 44907 gene locus_tag LOCUS_01730 gene lnt 46478 44907 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_01730 46570 46752 gene locus_tag LOCUS_01740 46570 46752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 47131 48249 gene locus_tag LOCUS_01750 gene porV 47131 48249 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_01750 48275 49078 gene locus_tag LOCUS_01760 48275 49078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 49097 50029 gene locus_tag LOCUS_01770 49097 50029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 50107 51810 gene locus_tag LOCUS_01780 50107 51810 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_01780 52808 52467 gene locus_tag LOCUS_01790 52808 52467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 56198 52965 gene locus_tag LOCUS_01800 56198 52965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 56789 59506 gene locus_tag LOCUS_01810 56789 59506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 59596 62949 gene locus_tag LOCUS_01820 59596 62949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 63320 65068 gene locus_tag LOCUS_01830 63320 65068 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_01830 65122 65754 gene locus_tag LOCUS_01840 65122 65754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 65980 68271 gene locus_tag LOCUS_01850 65980 68271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 68477 71023 gene locus_tag LOCUS_01860 68477 71023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 71840 74473 gene locus_tag LOCUS_01870 71840 74473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 74489 74689 gene locus_tag LOCUS_01880 74489 74689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 74890 75180 gene locus_tag LOCUS_01890 74890 75180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 75149 75367 gene locus_tag LOCUS_01900 75149 75367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 75451 75987 gene locus_tag LOCUS_01910 75451 75987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 76028 76318 gene locus_tag LOCUS_01920 76028 76318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 76381 76548 gene locus_tag LOCUS_01930 76381 76548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 76608 77459 gene locus_tag LOCUS_01940 76608 77459 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_01940 78437 77511 gene locus_tag LOCUS_01950 78437 77511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 79409 78447 gene locus_tag LOCUS_01960 gene rsgA 79409 78447 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_01960 80187 79420 gene locus_tag LOCUS_01970 80187 79420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 80831 80199 gene locus_tag LOCUS_01980 80831 80199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 81340 81080 gene locus_tag LOCUS_01990 81340 81080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 82156 81353 gene locus_tag LOCUS_02000 82156 81353 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480324.1 protein_id gnl|my_center|LOCUS_02000 82389 84341 gene locus_tag LOCUS_02010 82389 84341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 87064 84338 gene locus_tag LOCUS_02020 87064 84338 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_02020 88204 87284 gene locus_tag LOCUS_02030 gene thrB 88204 87284 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_02030 89514 88342 gene locus_tag LOCUS_02040 89514 88342 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_02040 90754 89726 gene locus_tag LOCUS_02050 90754 89726 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140857.1 protein_id gnl|my_center|LOCUS_02050 92294 91194 gene locus_tag LOCUS_02060 92294 91194 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 protein_id gnl|my_center|LOCUS_02060 94194 92791 gene locus_tag LOCUS_02070 94194 92791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 95166 94210 gene locus_tag LOCUS_02080 95166 94210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 95813 95175 gene locus_tag LOCUS_02090 95813 95175 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_02090 98236 95876 gene locus_tag LOCUS_02100 98236 95876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 99144 98326 gene locus_tag LOCUS_02110 99144 98326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 99453 99848 gene locus_tag LOCUS_02120 gene queF 99453 99848 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_02120 100911 99883 gene locus_tag LOCUS_02130 100911 99883 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_02130 101771 100956 gene locus_tag LOCUS_02140 101771 100956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 102778 105285 gene locus_tag LOCUS_02150 102778 105285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_02150 105312 105821 gene locus_tag LOCUS_02160 105312 105821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 105848 106972 gene locus_tag LOCUS_02170 105848 106972 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_02170 106997 107734 gene locus_tag LOCUS_02180 106997 107734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 107861 108730 gene locus_tag LOCUS_02190 107861 108730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 109290 109739 gene locus_tag LOCUS_02200 109290 109739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 109726 110538 gene locus_tag LOCUS_02210 109726 110538 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_02210 110865 111710 gene locus_tag LOCUS_02220 110865 111710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 112015 111632 gene locus_tag LOCUS_02230 112015 111632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 112287 112051 gene locus_tag LOCUS_02240 112287 112051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 113303 112623 gene locus_tag LOCUS_02250 113303 112623 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_02250 115275 115907 gene locus_tag LOCUS_02260 115275 115907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 115964 119266 gene locus_tag LOCUS_02270 115964 119266 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_02270 119263 123006 gene locus_tag LOCUS_02280 119263 123006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 123337 123840 gene locus_tag LOCUS_02290 123337 123840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence003 4216 1535 gene locus_tag LOCUS_02300 4216 1535 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057320.1 protein_id gnl|my_center|LOCUS_02300 5298 4216 gene locus_tag LOCUS_02310 5298 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6082 5459 gene locus_tag LOCUS_02320 6082 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02320 7151 6168 gene locus_tag LOCUS_02330 7151 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7295 9271 gene locus_tag LOCUS_02340 7295 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 9268 11151 gene locus_tag LOCUS_02350 9268 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02350 11193 12236 gene locus_tag LOCUS_02360 11193 12236 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_02360 12236 12952 gene locus_tag LOCUS_02370 12236 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12971 13870 gene locus_tag LOCUS_02380 12971 13870 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 protein_id gnl|my_center|LOCUS_02380 15565 13895 gene locus_tag LOCUS_02390 15565 13895 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_02390 15914 16249 gene locus_tag LOCUS_02400 15914 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 16361 17083 gene locus_tag LOCUS_02410 16361 17083 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_02410 17201 17668 gene locus_tag LOCUS_02420 17201 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17655 19319 gene locus_tag LOCUS_02430 17655 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 19601 20815 gene locus_tag LOCUS_02440 19601 20815 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_02440 20828 22060 gene locus_tag LOCUS_02450 20828 22060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_02450 22070 22771 gene locus_tag LOCUS_02460 22070 22771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_02460 22785 24005 gene locus_tag LOCUS_02470 22785 24005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 25232 24237 gene locus_tag LOCUS_02480 25232 24237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 26392 25337 gene locus_tag LOCUS_02490 26392 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 27265 26477 gene locus_tag LOCUS_02500 27265 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 28275 28988 gene locus_tag LOCUS_02510 28275 28988 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 protein_id gnl|my_center|LOCUS_02510 30258 29011 gene locus_tag LOCUS_02520 30258 29011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 30662 30468 gene locus_tag LOCUS_02530 30662 30468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 31126 30962 gene locus_tag LOCUS_02540 31126 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31333 31145 gene locus_tag LOCUS_02550 31333 31145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 32857 32060 gene locus_tag LOCUS_02560 32857 32060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 33193 34047 gene locus_tag LOCUS_02570 33193 34047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 34051 35367 gene locus_tag LOCUS_02580 34051 35367 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_02580 35360 35611 gene locus_tag LOCUS_02590 35360 35611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 35639 35947 gene locus_tag LOCUS_02600 35639 35947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 36788 36009 gene locus_tag LOCUS_02610 36788 36009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 38620 36878 gene locus_tag LOCUS_02620 38620 36878 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_02620 39975 38665 gene locus_tag LOCUS_02630 gene ftsZ 39975 38665 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02630 41618 40383 gene locus_tag LOCUS_02640 gene ftsA 41618 40383 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_02640 42425 41619 gene locus_tag LOCUS_02650 42425 41619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 43942 42581 gene locus_tag LOCUS_02660 gene murC 43942 42581 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_02660 45232 44009 gene locus_tag LOCUS_02670 gene murG 45232 44009 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_02670 46524 45322 gene locus_tag LOCUS_02680 gene spoVE 46524 45322 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_02680 48053 46575 gene locus_tag LOCUS_02690 gene murD 48053 46575 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02690 49248 48130 gene locus_tag LOCUS_02700 gene mraY 49248 48130 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073903.1 protein_id gnl|my_center|LOCUS_02700 50588 49365 gene locus_tag LOCUS_02710 50588 49365 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_02710 52291 50672 gene locus_tag LOCUS_02720 52291 50672 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_02720 53256 52498 gene locus_tag LOCUS_02730 53256 52498 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_02730 54892 53327 gene locus_tag LOCUS_02740 54892 53327 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_02740 56804 54861 gene locus_tag LOCUS_02750 56804 54861 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02750 57158 56844 gene locus_tag LOCUS_02760 57158 56844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 58199 57231 gene locus_tag LOCUS_02770 gene rsmH 58199 57231 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_02770 58516 59097 gene locus_tag LOCUS_02780 gene nadD 58516 59097 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_02780 59119 59376 gene locus_tag LOCUS_02790 59119 59376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 59465 60112 gene locus_tag LOCUS_02800 gene yqeK 59465 60112 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_02800 60425 60874 gene locus_tag LOCUS_02810 60425 60874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 61657 60923 gene locus_tag LOCUS_02820 61657 60923 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_02820 61743 62882 gene locus_tag LOCUS_02830 61743 62882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 62965 64020 gene locus_tag LOCUS_02840 62965 64020 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_02840 65049 64054 gene locus_tag LOCUS_02850 gene waaF 65049 64054 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_02850 66319 65141 gene locus_tag LOCUS_02860 gene thiI 66319 65141 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_02860 67191 66532 gene locus_tag LOCUS_02870 67191 66532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 67756 67205 gene locus_tag LOCUS_02880 67756 67205 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_02880 69009 67768 gene locus_tag LOCUS_02890 69009 67768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 69956 69174 gene locus_tag LOCUS_02900 69956 69174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 70713 70456 gene locus_tag LOCUS_02910 70713 70456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 71009 71797 gene locus_tag LOCUS_02920 71009 71797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 71886 72674 gene locus_tag LOCUS_02930 71886 72674 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_02930 72689 73474 gene locus_tag LOCUS_02940 gene nagB 72689 73474 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_02940 74937 73498 gene locus_tag LOCUS_02950 74937 73498 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_02950 75334 75519 gene locus_tag LOCUS_02960 75334 75519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 75962 76582 gene locus_tag LOCUS_02970 75962 76582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 77504 76695 gene locus_tag LOCUS_02980 77504 76695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 80752 77516 gene locus_tag LOCUS_02990 gene carB 80752 77516 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_02990 81947 80811 gene locus_tag LOCUS_03000 gene carA 81947 80811 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_03000 83256 81970 gene locus_tag LOCUS_03010 83256 81970 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_03010 83837 83283 gene locus_tag LOCUS_03020 gene pyrR 83837 83283 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_03020 84788 84168 gene locus_tag LOCUS_03030 84788 84168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 85049 84846 gene locus_tag LOCUS_03040 85049 84846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 86585 85173 gene locus_tag LOCUS_03050 86585 85173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 87426 86572 gene locus_tag LOCUS_03060 87426 86572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 87692 87447 gene locus_tag LOCUS_03070 87692 87447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 88343 87738 gene locus_tag LOCUS_03080 88343 87738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 88979 88374 gene locus_tag LOCUS_03090 88979 88374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 89523 89266 gene locus_tag LOCUS_03100 89523 89266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 90390 89611 gene locus_tag LOCUS_03110 90390 89611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 90568 91356 gene locus_tag LOCUS_03120 gene hpaI 90568 91356 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211075.1 protein_id gnl|my_center|LOCUS_03120 92144 91413 gene locus_tag LOCUS_03130 92144 91413 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391476.1 protein_id gnl|my_center|LOCUS_03130 93801 92197 gene locus_tag LOCUS_03140 93801 92197 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_03140 95245 93911 gene locus_tag LOCUS_03150 gene glnT 95245 93911 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_03150 96175 95321 gene locus_tag LOCUS_03160 96175 95321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 97656 96439 gene locus_tag LOCUS_03170 97656 96439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 98570 97800 gene locus_tag LOCUS_03180 98570 97800 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403988.1 protein_id gnl|my_center|LOCUS_03180 98896 98591 gene locus_tag LOCUS_03190 98896 98591 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_03190 99323 98898 gene locus_tag LOCUS_03200 99323 98898 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_03200 99631 99425 gene locus_tag LOCUS_03210 99631 99425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 100782 99634 gene locus_tag LOCUS_03220 gene thiO 100782 99634 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_03220 102350 100782 gene locus_tag LOCUS_03230 102350 100782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 103157 102435 gene locus_tag LOCUS_03240 103157 102435 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 protein_id gnl|my_center|LOCUS_03240 104485 103481 gene locus_tag LOCUS_03250 104485 103481 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_03250 105834 104581 gene locus_tag LOCUS_03260 105834 104581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 107201 105915 gene locus_tag LOCUS_03270 107201 105915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 108473 107250 gene locus_tag LOCUS_03280 108473 107250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 109908 108547 gene locus_tag LOCUS_03290 109908 108547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 111324 109921 gene locus_tag LOCUS_03300 111324 109921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 112885 111596 gene locus_tag LOCUS_03310 112885 111596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 114160 112898 gene locus_tag LOCUS_03320 114160 112898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 115804 114281 gene locus_tag LOCUS_03330 115804 114281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 117517 115922 gene locus_tag LOCUS_03340 117517 115922 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963794.1 protein_id gnl|my_center|LOCUS_03340 118205 117510 gene locus_tag LOCUS_03350 118205 117510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 119576 118296 gene locus_tag LOCUS_03360 119576 118296 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence004 339 920 gene locus_tag LOCUS_03370 339 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 998 2212 gene locus_tag LOCUS_03380 gene dprA 998 2212 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_03380 2226 3206 gene locus_tag LOCUS_03390 2226 3206 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_03390 3203 4333 gene locus_tag LOCUS_03400 3203 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4472 5200 gene locus_tag LOCUS_03410 4472 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5211 6668 gene locus_tag LOCUS_03420 5211 6668 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_03420 6892 8502 gene locus_tag LOCUS_03430 6892 8502 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_03430 8499 8912 gene locus_tag LOCUS_03440 8499 8912 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258928.1 protein_id gnl|my_center|LOCUS_03440 8905 10596 gene locus_tag LOCUS_03450 8905 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 10580 11554 gene locus_tag LOCUS_03460 10580 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11638 11787 gene locus_tag LOCUS_03470 11638 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 11778 12161 gene locus_tag LOCUS_03480 11778 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 12274 13497 gene locus_tag LOCUS_03490 12274 13497 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_03490 13487 14110 gene locus_tag LOCUS_03500 13487 14110 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_03500 14128 17208 gene locus_tag LOCUS_03510 14128 17208 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_03510 17388 17741 gene locus_tag LOCUS_03520 17388 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 17844 19001 gene locus_tag LOCUS_03530 17844 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 19232 20302 gene locus_tag LOCUS_03540 19232 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 20323 21546 gene locus_tag LOCUS_03550 20323 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 21559 22887 gene locus_tag LOCUS_03560 21559 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 22900 24138 gene locus_tag LOCUS_03570 22900 24138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 24151 25440 gene locus_tag LOCUS_03580 24151 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 25468 27096 gene locus_tag LOCUS_03590 gene ggt 25468 27096 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_03590 27305 28363 gene locus_tag LOCUS_03600 27305 28363 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_03600 28452 30116 gene locus_tag LOCUS_03610 28452 30116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 30306 31031 gene locus_tag LOCUS_03620 30306 31031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 31881 31180 gene locus_tag LOCUS_03630 31881 31180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_03630 32443 32096 gene locus_tag LOCUS_03640 32443 32096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 32788 32543 gene locus_tag LOCUS_03650 32788 32543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 33929 32886 gene locus_tag LOCUS_03660 33929 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 35156 33942 gene locus_tag LOCUS_03670 35156 33942 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023718.1 protein_id gnl|my_center|LOCUS_03670 35544 35113 gene locus_tag LOCUS_03680 gene tsaE 35544 35113 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_03680 37072 35528 gene locus_tag LOCUS_03690 37072 35528 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_03690 37240 37426 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttagtcccgtagggacgatatgtttataga 38060 38380 gene locus_tag LOCUS_03700 38060 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 38465 38947 gene locus_tag LOCUS_03710 38465 38947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 39006 40013 gene locus_tag LOCUS_03720 39006 40013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 40291 40560 gene locus_tag LOCUS_03730 40291 40560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 41028 40525 gene locus_tag LOCUS_03740 41028 40525 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772547.1 protein_id gnl|my_center|LOCUS_03740 41273 41004 gene locus_tag LOCUS_03750 41273 41004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 45089 41925 gene locus_tag LOCUS_03760 gene ileS 45089 41925 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_03760 46611 45595 gene locus_tag LOCUS_03770 46611 45595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 47066 48547 gene locus_tag LOCUS_03780 47066 48547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 48568 50550 gene locus_tag LOCUS_03790 48568 50550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 50590 52128 gene locus_tag LOCUS_03800 50590 52128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 52140 53678 gene locus_tag LOCUS_03810 52140 53678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 53715 54926 gene locus_tag LOCUS_03820 53715 54926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 57321 55078 gene locus_tag LOCUS_03830 57321 55078 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_03830 58195 57374 gene locus_tag LOCUS_03840 58195 57374 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140321.1 protein_id gnl|my_center|LOCUS_03840 58433 59293 gene locus_tag LOCUS_03850 58433 59293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 59616 59404 gene locus_tag LOCUS_03860 59616 59404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 60747 60241 gene locus_tag LOCUS_03870 60747 60241 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390240.1 protein_id gnl|my_center|LOCUS_03870 60944 61219 gene locus_tag LOCUS_03880 60944 61219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 61226 61822 gene locus_tag LOCUS_03890 61226 61822 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_03890 61809 62465 gene locus_tag LOCUS_03900 61809 62465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 62840 62493 gene locus_tag LOCUS_03910 62840 62493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 63892 62864 gene locus_tag LOCUS_03920 gene queA 63892 62864 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_03920 64975 63935 gene locus_tag LOCUS_03930 gene ruvB 64975 63935 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227913.1 protein_id gnl|my_center|LOCUS_03930 65590 64994 gene locus_tag LOCUS_03940 gene ruvA 65590 64994 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_03940 66141 65641 gene locus_tag LOCUS_03950 gene ruvC 66141 65641 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_03950 66906 66160 gene locus_tag LOCUS_03960 66906 66160 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_03960 67242 67084 gene locus_tag LOCUS_03970 67242 67084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 69199 67253 gene locus_tag LOCUS_03980 69199 67253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 70339 69728 gene locus_tag LOCUS_03990 70339 69728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 70551 70339 gene locus_tag LOCUS_04000 70551 70339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 71091 70672 gene locus_tag LOCUS_04010 71091 70672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04010 71358 71122 gene locus_tag LOCUS_04020 71358 71122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 72367 71504 gene locus_tag LOCUS_04030 72367 71504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 73339 72389 gene locus_tag LOCUS_04040 73339 72389 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861974.1 protein_id gnl|my_center|LOCUS_04040 73515 73877 gene locus_tag LOCUS_04050 73515 73877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 74032 74499 gene locus_tag LOCUS_04060 74032 74499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 76245 74611 gene locus_tag LOCUS_04070 gene groL 76245 74611 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_04070 76989 76489 gene locus_tag LOCUS_04080 76989 76489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 78350 77313 gene locus_tag LOCUS_04090 78350 77313 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529902.1 protein_id gnl|my_center|LOCUS_04090 78695 78402 gene locus_tag LOCUS_04100 78695 78402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 79627 78698 gene locus_tag LOCUS_04110 79627 78698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 80784 79747 gene locus_tag LOCUS_04120 80784 79747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 81953 80910 gene locus_tag LOCUS_04130 81953 80910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 83336 82299 gene locus_tag LOCUS_04140 83336 82299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 84619 83582 gene locus_tag LOCUS_04150 84619 83582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 85717 84683 gene locus_tag LOCUS_04160 85717 84683 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_04160 86939 85746 gene locus_tag LOCUS_04170 86939 85746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_04170 87189 88247 gene locus_tag LOCUS_04180 87189 88247 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965454.1 protein_id gnl|my_center|LOCUS_04180 89083 88322 gene locus_tag LOCUS_04190 89083 88322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 91123 89189 gene locus_tag LOCUS_04200 91123 89189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 92500 91724 gene locus_tag LOCUS_04210 92500 91724 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_04210 92427 92687 gene locus_tag LOCUS_04220 92427 92687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 92701 93501 gene locus_tag LOCUS_04230 92701 93501 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_04230 95155 93515 gene locus_tag LOCUS_04240 95155 93515 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_04240 96016 95228 gene locus_tag LOCUS_04250 96016 95228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 96644 96138 gene locus_tag LOCUS_04260 96644 96138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 97811 96708 gene locus_tag LOCUS_04270 97811 96708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 98929 98264 gene locus_tag LOCUS_04280 98929 98264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 99750 98935 gene locus_tag LOCUS_04290 99750 98935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 100224 99775 gene locus_tag LOCUS_04300 gene dtd 100224 99775 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_04300 101456 100515 gene locus_tag LOCUS_04310 101456 100515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 102539 101490 gene locus_tag LOCUS_04320 102539 101490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 103211 102675 gene locus_tag LOCUS_04330 103211 102675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 103497 104195 gene locus_tag LOCUS_04340 103497 104195 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_04340 104329 106080 gene locus_tag LOCUS_04350 104329 106080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 107385 106132 gene locus_tag LOCUS_04360 gene larC 107385 106132 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_04360 109202 107526 gene locus_tag LOCUS_04370 109202 107526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 109462 110037 gene locus_tag LOCUS_04380 109462 110037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence005 1 177 gene locus_tag LOCUS_04390 1 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 266 2461 gene locus_tag LOCUS_04400 266 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2627 5299 gene locus_tag LOCUS_04410 2627 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6082 5432 gene locus_tag LOCUS_04420 6082 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7348 6476 gene locus_tag LOCUS_04430 gene sucD 7348 6476 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_04430 8266 7577 gene locus_tag LOCUS_04440 8266 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 10761 8665 gene locus_tag LOCUS_04450 10761 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 11279 10827 gene locus_tag LOCUS_04460 11279 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 11655 11269 gene locus_tag LOCUS_04470 11655 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 11994 11815 gene locus_tag LOCUS_04480 11994 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 12831 12058 gene locus_tag LOCUS_04490 12831 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14274 14540 gene locus_tag LOCUS_04500 14274 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 14611 14781 gene locus_tag LOCUS_04510 14611 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17489 14859 gene locus_tag LOCUS_04520 17489 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 18051 17662 gene locus_tag LOCUS_04530 18051 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 18827 18216 gene locus_tag LOCUS_04540 18827 18216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19810 19361 gene locus_tag LOCUS_04550 19810 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 21505 20069 gene locus_tag LOCUS_04560 gene proS 21505 20069 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_04560 22714 21524 gene locus_tag LOCUS_04570 22714 21524 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_04570 23751 22789 gene locus_tag LOCUS_04580 23751 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 24944 23760 gene locus_tag LOCUS_04590 gene sucC 24944 23760 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_04590 25166 26230 gene locus_tag LOCUS_04600 gene crtE 25166 26230 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_04600 26249 27319 gene locus_tag LOCUS_04610 26249 27319 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_04610 27893 27414 gene locus_tag LOCUS_04620 27893 27414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 28133 29341 gene locus_tag LOCUS_04630 gene lptF 28133 29341 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_04630 29366 30427 gene locus_tag LOCUS_04640 gene lptF 29366 30427 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938951.1 protein_id gnl|my_center|LOCUS_04640 30514 31086 gene locus_tag LOCUS_04650 gene lmtA 30514 31086 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_04650 31366 32193 gene locus_tag LOCUS_04660 31366 32193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 32777 33463 gene locus_tag LOCUS_04670 32777 33463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 33651 34163 gene locus_tag LOCUS_04680 33651 34163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 35140 35970 gene locus_tag LOCUS_04690 35140 35970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 36261 36803 gene locus_tag LOCUS_04700 36261 36803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 36859 38430 gene locus_tag LOCUS_04710 36859 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 38489 39004 gene locus_tag LOCUS_04720 38489 39004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 39120 39806 gene locus_tag LOCUS_04730 39120 39806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 40686 42620 gene locus_tag LOCUS_04740 40686 42620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 42648 43493 gene locus_tag LOCUS_04750 gene fdhD 42648 43493 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876561.1 protein_id gnl|my_center|LOCUS_04750 43620 43907 gene locus_tag LOCUS_04760 43620 43907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 43972 45024 gene locus_tag LOCUS_04770 43972 45024 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_04770 45058 46077 gene locus_tag LOCUS_04780 45058 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 46099 46857 gene locus_tag LOCUS_04790 46099 46857 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_04790 46860 47603 gene locus_tag LOCUS_04800 46860 47603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 47667 49664 gene locus_tag LOCUS_04810 47667 49664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 50237 52183 gene locus_tag LOCUS_04820 50237 52183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 52432 52190 gene locus_tag LOCUS_04830 52432 52190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 53549 52437 gene locus_tag LOCUS_04840 53549 52437 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_04840 53848 53549 gene locus_tag LOCUS_04850 53848 53549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 54151 53876 gene locus_tag LOCUS_04860 54151 53876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 54659 54357 gene locus_tag LOCUS_04870 54659 54357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 55475 54687 gene locus_tag LOCUS_04880 55475 54687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 56191 55889 gene locus_tag LOCUS_04890 56191 55889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 56995 56219 gene locus_tag LOCUS_04900 56995 56219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 58204 57407 gene locus_tag LOCUS_04910 58204 57407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 59016 58222 gene locus_tag LOCUS_04920 59016 58222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 59473 60645 gene locus_tag LOCUS_04930 59473 60645 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_04930 60705 61703 gene locus_tag LOCUS_04940 60705 61703 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405248.1 protein_id gnl|my_center|LOCUS_04940 61922 63016 gene locus_tag LOCUS_04950 61922 63016 CDS product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 protein_id gnl|my_center|LOCUS_04950 63308 63949 gene locus_tag LOCUS_04960 63308 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 64036 65232 gene locus_tag LOCUS_04970 64036 65232 CDS product DarT ssDNA thymidine ADP-ribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257834.1 protein_id gnl|my_center|LOCUS_04970 65468 66859 gene locus_tag LOCUS_04980 65468 66859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 67002 67838 gene locus_tag LOCUS_04990 67002 67838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 67843 68871 gene locus_tag LOCUS_05000 67843 68871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014888.1 protein_id gnl|my_center|LOCUS_05000 68882 69820 gene locus_tag LOCUS_05010 gene uxuA 68882 69820 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_05010 72119 70140 gene locus_tag LOCUS_05020 72119 70140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 72840 72217 gene locus_tag LOCUS_05030 72840 72217 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_05030 74237 72834 gene locus_tag LOCUS_05040 74237 72834 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 protein_id gnl|my_center|LOCUS_05040 74527 75666 gene locus_tag LOCUS_05050 74527 75666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 76300 76869 gene locus_tag LOCUS_05060 76300 76869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 76974 77393 gene locus_tag LOCUS_05070 76974 77393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 78196 77801 gene locus_tag LOCUS_05080 78196 77801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 78946 79674 gene locus_tag LOCUS_05090 78946 79674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 79671 80642 gene locus_tag LOCUS_05100 79671 80642 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_05100 81795 80644 gene locus_tag LOCUS_05110 81795 80644 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_05110 82753 83208 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcggaaacaccttcccgtttgaagggaattgaa 83278 83850 gene locus_tag LOCUS_05120 83278 83850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 85003 84296 gene locus_tag LOCUS_05130 85003 84296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 85774 85496 gene locus_tag LOCUS_05140 85774 85496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 86410 85784 gene locus_tag LOCUS_05150 86410 85784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 86659 86853 gene locus_tag LOCUS_05160 86659 86853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 86837 87328 gene locus_tag LOCUS_05170 86837 87328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 87408 88334 gene locus_tag LOCUS_05180 87408 88334 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_05180 88707 89987 gene locus_tag LOCUS_05190 88707 89987 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_05190 89988 90578 gene locus_tag LOCUS_05200 89988 90578 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_05200 90583 91434 gene locus_tag LOCUS_05210 90583 91434 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_05210 91473 92297 gene locus_tag LOCUS_05220 91473 92297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 93911 92793 gene locus_tag LOCUS_05230 93911 92793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 96098 94023 gene locus_tag LOCUS_05240 gene fusA 96098 94023 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_05240 96463 96831 gene locus_tag LOCUS_05250 96463 96831 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_05250 98929 96854 gene locus_tag LOCUS_05260 98929 96854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 101502 99061 gene locus_tag LOCUS_05270 gene pbpC 101502 99061 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 protein_id gnl|my_center|LOCUS_05270 107045 101607 gene locus_tag LOCUS_05280 107045 101607 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994092.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence006 1003 233 gene locus_tag LOCUS_05290 1003 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3045 2041 gene locus_tag LOCUS_05300 3045 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9524 3108 gene locus_tag LOCUS_05310 9524 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 10633 9653 gene locus_tag LOCUS_05320 10633 9653 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_05320 10783 11259 gene locus_tag LOCUS_05330 10783 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 12236 11472 gene locus_tag LOCUS_05340 12236 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13715 12735 gene locus_tag LOCUS_05350 13715 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 15526 13802 gene locus_tag LOCUS_05360 15526 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 17074 15539 gene locus_tag LOCUS_05370 17074 15539 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_05370 19552 17102 gene locus_tag LOCUS_05380 gene gyrA 19552 17102 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_05380 22296 19759 gene locus_tag LOCUS_05390 gene gyrB 22296 19759 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072047.1 protein_id gnl|my_center|LOCUS_05390 23282 22731 gene locus_tag LOCUS_05400 23282 22731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 24585 23413 gene locus_tag LOCUS_05410 gene recF 24585 23413 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 protein_id gnl|my_center|LOCUS_05410 26280 24943 gene locus_tag LOCUS_05420 gene dnaA 26280 24943 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05420 27434 26793 gene locus_tag LOCUS_05430 27434 26793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 27954 27625 gene locus_tag LOCUS_05440 27954 27625 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 protein_id gnl|my_center|LOCUS_05440 28754 28071 gene locus_tag LOCUS_05450 28754 28071 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_05450 29305 28778 gene locus_tag LOCUS_05460 gene purE 29305 28778 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817242.1 protein_id gnl|my_center|LOCUS_05460 30169 29375 gene locus_tag LOCUS_05470 30169 29375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 30583 30203 gene locus_tag LOCUS_05480 30583 30203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 32573 30606 gene locus_tag LOCUS_05490 gene yagF 32573 30606 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_05490 33065 32604 gene locus_tag LOCUS_05500 33065 32604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 33435 33058 gene locus_tag LOCUS_05510 33435 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 34061 33672 gene locus_tag LOCUS_05520 34061 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 34459 34079 gene locus_tag LOCUS_05530 34459 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 35053 34487 gene locus_tag LOCUS_05540 35053 34487 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_05540 37768 35081 gene locus_tag LOCUS_05550 37768 35081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 37961 38350 gene locus_tag LOCUS_05560 37961 38350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 38902 39201 gene locus_tag LOCUS_05570 38902 39201 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_05570 39413 40837 gene locus_tag LOCUS_05580 39413 40837 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075647.1 protein_id gnl|my_center|LOCUS_05580 40993 42999 gene locus_tag LOCUS_05590 gene ligA 40993 42999 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_05590 42999 43310 gene locus_tag LOCUS_05600 42999 43310 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_05600 43300 43659 gene locus_tag LOCUS_05610 43300 43659 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_05610 43887 44825 gene locus_tag LOCUS_05620 43887 44825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 45693 44836 gene locus_tag LOCUS_05630 45693 44836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 46045 45704 gene locus_tag LOCUS_05640 46045 45704 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 protein_id gnl|my_center|LOCUS_05640 46441 53709 gene locus_tag LOCUS_05650 46441 53709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 53745 53936 gene locus_tag LOCUS_05660 53745 53936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 54029 56017 gene locus_tag LOCUS_05670 54029 56017 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_05670 56047 56994 gene locus_tag LOCUS_05680 56047 56994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 57194 57658 gene locus_tag LOCUS_05690 57194 57658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 57749 58555 gene locus_tag LOCUS_05700 57749 58555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_05700 58564 59685 gene locus_tag LOCUS_05710 58564 59685 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_05710 59682 60392 gene locus_tag LOCUS_05720 59682 60392 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_05720 61298 60384 gene locus_tag LOCUS_05730 gene galU 61298 60384 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_05730 62189 61332 gene locus_tag LOCUS_05740 62189 61332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 63233 62382 gene locus_tag LOCUS_05750 63233 62382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 64472 65545 gene locus_tag LOCUS_05760 gene aroC 64472 65545 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_05760 65755 67143 gene locus_tag LOCUS_05770 gene mgtE 65755 67143 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_05770 67194 67679 gene locus_tag LOCUS_05780 67194 67679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05780 67672 68145 gene locus_tag LOCUS_05790 67672 68145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05790 68322 69431 gene locus_tag LOCUS_05800 68322 69431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 69493 70467 gene locus_tag LOCUS_05810 69493 70467 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_05810 70606 72285 gene locus_tag LOCUS_05820 70606 72285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 72405 73589 gene locus_tag LOCUS_05830 72405 73589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_05830 73570 73809 gene locus_tag LOCUS_05840 73570 73809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 73846 74673 gene locus_tag LOCUS_05850 73846 74673 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_05850 74681 75700 gene locus_tag LOCUS_05860 74681 75700 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_05860 76819 75725 gene locus_tag LOCUS_05870 gene ugpC 76819 75725 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_05870 77397 76828 gene locus_tag LOCUS_05880 77397 76828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 77864 77499 gene locus_tag LOCUS_05890 77864 77499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 80368 78056 gene locus_tag LOCUS_05900 80368 78056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 80484 80696 gene locus_tag LOCUS_05910 80484 80696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 81060 80785 gene locus_tag LOCUS_05920 81060 80785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 81611 81177 gene locus_tag LOCUS_05930 81611 81177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 82755 81751 gene locus_tag LOCUS_05940 82755 81751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 83386 82796 gene locus_tag LOCUS_05950 83386 82796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 83652 83488 gene locus_tag LOCUS_05960 83652 83488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 83995 84351 gene locus_tag LOCUS_05970 83995 84351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 84654 85121 gene locus_tag LOCUS_05980 gene infC 84654 85121 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_05980 85338 85529 gene locus_tag LOCUS_05990 gene rpmI 85338 85529 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125540.1 protein_id gnl|my_center|LOCUS_05990 85539 85886 gene locus_tag LOCUS_06000 gene rplT 85539 85886 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_06000 86177 87193 gene locus_tag LOCUS_06010 gene pheS 86177 87193 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_06010 87346 89739 gene locus_tag LOCUS_06020 gene pheT 87346 89739 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_06020 89920 90621 gene locus_tag LOCUS_06030 gene ubiE 89920 90621 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_06030 91592 90654 gene locus_tag LOCUS_06040 91592 90654 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_06040 92813 91605 gene locus_tag LOCUS_06050 92813 91605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 93100 92831 gene locus_tag LOCUS_06060 93100 92831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 97723 93113 gene locus_tag LOCUS_06070 97723 93113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 99109 98009 gene locus_tag LOCUS_06080 gene iolG 99109 98009 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_06080 99802 99167 gene locus_tag LOCUS_06090 99802 99167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 100312 99854 gene locus_tag LOCUS_06100 100312 99854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 101457 100309 gene locus_tag LOCUS_06110 101457 100309 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259192.1 protein_id gnl|my_center|LOCUS_06110 102703 101486 gene locus_tag LOCUS_06120 102703 101486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence007 270 2312 gene locus_tag LOCUS_06130 270 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2520 4436 gene locus_tag LOCUS_06140 2520 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5261 4497 gene locus_tag LOCUS_06150 5261 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6229 5441 gene locus_tag LOCUS_06160 6229 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6817 7611 gene locus_tag LOCUS_06170 6817 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7867 8715 gene locus_tag LOCUS_06180 7867 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9761 8748 gene locus_tag LOCUS_06190 9761 8748 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_06190 10211 11368 gene locus_tag LOCUS_06200 10211 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11384 13663 gene locus_tag LOCUS_06210 11384 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 13848 15956 gene locus_tag LOCUS_06220 13848 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16055 18310 gene locus_tag LOCUS_06230 16055 18310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 20231 18303 gene locus_tag LOCUS_06240 20231 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 22123 20243 gene locus_tag LOCUS_06250 22123 20243 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_06250 23844 22231 gene locus_tag LOCUS_06260 23844 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 24598 23888 gene locus_tag LOCUS_06270 24598 23888 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_06270 25488 24697 gene locus_tag LOCUS_06280 25488 24697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_06280 26352 26579 gene locus_tag LOCUS_06290 26352 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 26611 27549 gene locus_tag LOCUS_06300 26611 27549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 27628 29016 gene locus_tag LOCUS_06310 27628 29016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 29400 30446 gene locus_tag LOCUS_06320 gene rfaE1 29400 30446 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_06320 30433 31218 gene locus_tag LOCUS_06330 30433 31218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 32247 31228 gene locus_tag LOCUS_06340 32247 31228 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_06340 33846 32251 gene locus_tag LOCUS_06350 33846 32251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 37827 34180 gene locus_tag LOCUS_06360 37827 34180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 37955 38374 gene locus_tag LOCUS_06370 37955 38374 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_06370 40014 38416 gene locus_tag LOCUS_06380 40014 38416 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_06380 40866 40180 gene locus_tag LOCUS_06390 40866 40180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 44339 40911 gene locus_tag LOCUS_06400 44339 40911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 45450 44380 gene locus_tag LOCUS_06410 45450 44380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_06410 46386 45646 gene locus_tag LOCUS_06420 46386 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 47899 46472 gene locus_tag LOCUS_06430 gene selA 47899 46472 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 protein_id gnl|my_center|LOCUS_06430 48454 49830 gene locus_tag LOCUS_06440 48454 49830 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_06440 49856 50695 gene locus_tag LOCUS_06450 49856 50695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 50789 51547 gene locus_tag LOCUS_06460 50789 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 51639 52520 gene locus_tag LOCUS_06470 51639 52520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 52586 52936 gene locus_tag LOCUS_06480 52586 52936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 52958 53935 gene locus_tag LOCUS_06490 52958 53935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 55293 53941 gene locus_tag LOCUS_06500 55293 53941 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_06500 55986 55339 gene locus_tag LOCUS_06510 55986 55339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 56706 56005 gene locus_tag LOCUS_06520 56706 56005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 58079 56910 gene locus_tag LOCUS_06530 58079 56910 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_06530 58831 60054 gene locus_tag LOCUS_06540 58831 60054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 60313 61551 gene locus_tag LOCUS_06550 60313 61551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 61640 62806 gene locus_tag LOCUS_06560 gene dgoD 61640 62806 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_06560 62851 63945 gene locus_tag LOCUS_06570 gene mnmA 62851 63945 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_06570 63963 64523 gene locus_tag LOCUS_06580 63963 64523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 64534 65454 gene locus_tag LOCUS_06590 gene miaA 64534 65454 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_06590 65588 66709 gene locus_tag LOCUS_06600 65588 66709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 67786 70047 gene locus_tag LOCUS_06610 67786 70047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 70200 71441 gene locus_tag LOCUS_06620 70200 71441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 71535 73361 gene locus_tag LOCUS_06630 71535 73361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 73365 74858 gene locus_tag LOCUS_06640 73365 74858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093039140.1 protein_id gnl|my_center|LOCUS_06640 75466 74873 gene locus_tag LOCUS_06650 75466 74873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 76416 78539 gene locus_tag LOCUS_06660 76416 78539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 78880 82389 gene locus_tag LOCUS_06670 78880 82389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 82794 83621 gene locus_tag LOCUS_06680 82794 83621 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_06680 83991 84770 gene locus_tag LOCUS_06690 83991 84770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 84840 85637 gene locus_tag LOCUS_06700 84840 85637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 85694 86485 gene locus_tag LOCUS_06710 85694 86485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 86591 87442 gene locus_tag LOCUS_06720 86591 87442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 87435 88250 gene locus_tag LOCUS_06730 87435 88250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 89852 88341 gene locus_tag LOCUS_06740 89852 88341 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_06740 91209 89899 gene locus_tag LOCUS_06750 91209 89899 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_06750 92821 91358 gene locus_tag LOCUS_06760 92821 91358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 93031 94530 gene locus_tag LOCUS_06770 gene glpK 93031 94530 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175870.1 protein_id gnl|my_center|LOCUS_06770 94533 96296 gene locus_tag LOCUS_06780 94533 96296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 96652 98046 gene locus_tag LOCUS_06790 96652 98046 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence008 2975 234 gene locus_tag LOCUS_06800 2975 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4199 3210 gene locus_tag LOCUS_06810 4199 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4617 4276 gene locus_tag LOCUS_06820 4617 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 5465 5250 gene locus_tag LOCUS_06830 5465 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5767 5546 gene locus_tag LOCUS_06840 5767 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 8611 5798 gene locus_tag LOCUS_06850 8611 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 9481 8648 gene locus_tag LOCUS_06860 9481 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9846 10052 gene locus_tag LOCUS_06870 9846 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10030 10347 gene locus_tag LOCUS_06880 10030 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 11614 10631 gene locus_tag LOCUS_06890 11614 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 12093 15041 gene locus_tag LOCUS_06900 12093 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 15474 15731 gene locus_tag LOCUS_06910 15474 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 16700 16452 gene locus_tag LOCUS_06920 16700 16452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 17335 16697 gene locus_tag LOCUS_06930 17335 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 18540 17512 gene locus_tag LOCUS_06940 18540 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 19107 18874 gene locus_tag LOCUS_06950 19107 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19351 19064 gene locus_tag LOCUS_06960 19351 19064 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_06960 20075 20572 gene locus_tag LOCUS_06970 20075 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 21830 21552 gene locus_tag LOCUS_06980 21830 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 22440 23588 gene locus_tag LOCUS_06990 22440 23588 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_06990 23628 27587 gene locus_tag LOCUS_07000 23628 27587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 27708 28046 gene locus_tag LOCUS_07010 27708 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 28116 28925 gene locus_tag LOCUS_07020 28116 28925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 29084 30079 gene locus_tag LOCUS_07030 29084 30079 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936854.1 protein_id gnl|my_center|LOCUS_07030 30190 30864 gene locus_tag LOCUS_07040 30190 30864 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204953.1 protein_id gnl|my_center|LOCUS_07040 30861 31913 gene locus_tag LOCUS_07050 30861 31913 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_07050 32918 32025 gene locus_tag LOCUS_07060 32918 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 33743 32940 gene locus_tag LOCUS_07070 gene rfaD 33743 32940 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088669.1 protein_id gnl|my_center|LOCUS_07070 34657 34382 gene locus_tag LOCUS_07080 34657 34382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35004 34654 gene locus_tag LOCUS_07090 35004 34654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 35195 35031 gene locus_tag LOCUS_07100 35195 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 36458 35349 gene locus_tag LOCUS_07110 36458 35349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 37441 36602 gene locus_tag LOCUS_07120 37441 36602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 38426 37584 gene locus_tag LOCUS_07130 38426 37584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 39302 38484 gene locus_tag LOCUS_07140 gene lpxA 39302 38484 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_07140 40684 39374 gene locus_tag LOCUS_07150 40684 39374 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_07150 42086 41034 gene locus_tag LOCUS_07160 gene mltG 42086 41034 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_07160 42584 42162 gene locus_tag LOCUS_07170 gene ruvX 42584 42162 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_07170 42800 43675 gene locus_tag LOCUS_07180 42800 43675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 43877 44548 gene locus_tag LOCUS_07190 43877 44548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 44541 45296 gene locus_tag LOCUS_07200 44541 45296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_07200 45464 47104 gene locus_tag LOCUS_07210 45464 47104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 47283 47798 gene locus_tag LOCUS_07220 47283 47798 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_07220 48422 48820 gene locus_tag LOCUS_07230 48422 48820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 49115 50155 gene locus_tag LOCUS_07240 49115 50155 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_07240 50159 50458 gene locus_tag LOCUS_07250 50159 50458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 50487 51857 gene locus_tag LOCUS_07260 50487 51857 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949164.1 protein_id gnl|my_center|LOCUS_07260 51869 52219 gene locus_tag LOCUS_07270 51869 52219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 52235 52495 gene locus_tag LOCUS_07280 52235 52495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07280 54325 52442 gene locus_tag LOCUS_07290 54325 52442 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_07290 54921 54484 gene locus_tag LOCUS_07300 54921 54484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 55740 54961 gene locus_tag LOCUS_07310 55740 54961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 58667 56355 gene locus_tag LOCUS_07320 58667 56355 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_07320 60031 58739 gene locus_tag LOCUS_07330 60031 58739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 61460 60084 gene locus_tag LOCUS_07340 61460 60084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 62217 61504 gene locus_tag LOCUS_07350 62217 61504 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_07350 62722 62396 gene locus_tag LOCUS_07360 62722 62396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 63110 62772 gene locus_tag LOCUS_07370 63110 62772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 64629 63244 gene locus_tag LOCUS_07380 64629 63244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 66010 64649 gene locus_tag LOCUS_07390 66010 64649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 67627 66692 gene locus_tag LOCUS_07400 67627 66692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 68497 67859 gene locus_tag LOCUS_07410 68497 67859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 69408 68494 gene locus_tag LOCUS_07420 69408 68494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 69967 70713 gene locus_tag LOCUS_07430 69967 70713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 72531 70720 gene locus_tag LOCUS_07440 72531 70720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_07440 74237 72546 gene locus_tag LOCUS_07450 74237 72546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_07450 74545 75009 gene locus_tag LOCUS_07460 74545 75009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 75296 76759 gene locus_tag LOCUS_07470 gene gndA 75296 76759 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_07470 76817 77710 gene locus_tag LOCUS_07480 76817 77710 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_07480 77747 78694 gene locus_tag LOCUS_07490 77747 78694 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_07490 78697 79047 gene locus_tag LOCUS_07500 78697 79047 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_07500 79157 80803 gene locus_tag LOCUS_07510 79157 80803 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_07510 80815 82410 gene locus_tag LOCUS_07520 80815 82410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 84624 82513 gene locus_tag LOCUS_07530 84624 82513 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_07530 86070 84715 gene locus_tag LOCUS_07540 86070 84715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_07540 87726 86176 gene locus_tag LOCUS_07550 87726 86176 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_07550 88511 87912 gene locus_tag LOCUS_07560 88511 87912 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_07560 89569 88856 gene locus_tag LOCUS_07570 89569 88856 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_07570 90056 89580 gene locus_tag LOCUS_07580 90056 89580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 91070 90087 gene locus_tag LOCUS_07590 91070 90087 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_07590 93254 91107 gene locus_tag LOCUS_07600 93254 91107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 95046 93577 gene locus_tag LOCUS_07610 95046 93577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 96518 95076 gene locus_tag LOCUS_07620 96518 95076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence009 774 142 gene locus_tag LOCUS_07630 774 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2030 801 gene locus_tag LOCUS_07640 2030 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2539 2042 gene locus_tag LOCUS_07650 2539 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2854 2606 gene locus_tag LOCUS_07660 2854 2606 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_07660 4541 3087 gene locus_tag LOCUS_07670 4541 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5168 5602 gene locus_tag LOCUS_07680 5168 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5657 5869 gene locus_tag LOCUS_07690 5657 5869 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_07690 5866 6051 gene locus_tag LOCUS_07700 5866 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6277 8463 gene locus_tag LOCUS_07710 6277 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10225 8852 gene locus_tag LOCUS_07720 10225 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 13809 10354 gene locus_tag LOCUS_07730 13809 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07730 14774 13698 gene locus_tag LOCUS_07740 14774 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07740 15408 15238 gene locus_tag LOCUS_07750 15408 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 15598 16797 gene locus_tag LOCUS_07760 15598 16797 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_07760 16820 17692 gene locus_tag LOCUS_07770 16820 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 17866 18075 gene locus_tag LOCUS_07780 17866 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 18081 18329 gene locus_tag LOCUS_07790 18081 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 18394 19593 gene locus_tag LOCUS_07800 18394 19593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 20121 19633 gene locus_tag LOCUS_07810 20121 19633 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_07810 20740 20006 gene locus_tag LOCUS_07820 20740 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20924 21874 gene locus_tag LOCUS_07830 20924 21874 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_07830 21879 23486 gene locus_tag LOCUS_07840 21879 23486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 23726 24367 gene locus_tag LOCUS_07850 23726 24367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 25786 24860 gene locus_tag LOCUS_07860 25786 24860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 26804 25956 gene locus_tag LOCUS_07870 26804 25956 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_07870 27929 26829 gene locus_tag LOCUS_07880 27929 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 29100 28075 gene locus_tag LOCUS_07890 gene yiaK 29100 28075 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 protein_id gnl|my_center|LOCUS_07890 30144 29287 gene locus_tag LOCUS_07900 30144 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 30418 30185 gene locus_tag LOCUS_07910 30418 30185 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678786.1 protein_id gnl|my_center|LOCUS_07910 30626 31999 gene locus_tag LOCUS_07920 30626 31999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_07920 32031 33479 gene locus_tag LOCUS_07930 32031 33479 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_07930 33547 34908 gene locus_tag LOCUS_07940 33547 34908 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_07940 34988 37270 gene locus_tag LOCUS_07950 34988 37270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 37319 39502 gene locus_tag LOCUS_07960 37319 39502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 39551 41989 gene locus_tag LOCUS_07970 39551 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 42020 42706 gene locus_tag LOCUS_07980 42020 42706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 42707 43498 gene locus_tag LOCUS_07990 42707 43498 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_07990 43854 44297 gene locus_tag LOCUS_08000 43854 44297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 44300 45157 gene locus_tag LOCUS_08010 44300 45157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 46018 45161 gene locus_tag LOCUS_08020 46018 45161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 46803 46036 gene locus_tag LOCUS_08030 46803 46036 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888848.1 protein_id gnl|my_center|LOCUS_08030 46968 48155 gene locus_tag LOCUS_08040 46968 48155 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_08040 49832 48495 gene locus_tag LOCUS_08050 49832 48495 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_08050 50414 51559 gene locus_tag LOCUS_08060 gene dgoD 50414 51559 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_08060 52215 51604 gene locus_tag LOCUS_08070 52215 51604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 53151 52405 gene locus_tag LOCUS_08080 53151 52405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 53494 53171 gene locus_tag LOCUS_08090 53494 53171 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226613.1 protein_id gnl|my_center|LOCUS_08090 53792 53508 gene locus_tag LOCUS_08100 53792 53508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 54444 53794 gene locus_tag LOCUS_08110 54444 53794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 54877 54581 gene locus_tag LOCUS_08120 54877 54581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 58504 55139 gene locus_tag LOCUS_08130 58504 55139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 62385 58531 gene locus_tag LOCUS_08140 62385 58531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 63721 62462 gene locus_tag LOCUS_08150 63721 62462 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_08150 66770 63735 gene locus_tag LOCUS_08160 66770 63735 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892217.1 protein_id gnl|my_center|LOCUS_08160 67049 66822 gene locus_tag LOCUS_08170 67049 66822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 67233 67361 gene locus_tag LOCUS_08180 67233 67361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 70022 67773 gene locus_tag LOCUS_08190 70022 67773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 71194 70028 gene locus_tag LOCUS_08200 71194 70028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 72004 71228 gene locus_tag LOCUS_08210 72004 71228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 73556 72156 gene locus_tag LOCUS_08220 73556 72156 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_08220 76454 73776 gene locus_tag LOCUS_08230 76454 73776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 77763 76618 gene locus_tag LOCUS_08240 gene porV 77763 76618 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_08240 80798 77775 gene locus_tag LOCUS_08250 80798 77775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 82921 80975 gene locus_tag LOCUS_08260 82921 80975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 83657 83040 gene locus_tag LOCUS_08270 83657 83040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 84732 83731 gene locus_tag LOCUS_08280 84732 83731 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_08280 85578 84751 gene locus_tag LOCUS_08290 85578 84751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 86012 85752 gene locus_tag LOCUS_08300 86012 85752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 86227 86015 gene locus_tag LOCUS_08310 86227 86015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 86756 86220 gene locus_tag LOCUS_08320 86756 86220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 89778 86776 gene locus_tag LOCUS_08330 89778 86776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 90629 89850 gene locus_tag LOCUS_08340 gene recO 90629 89850 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230055.1 protein_id gnl|my_center|LOCUS_08340 90742 90668 gene locus_tag LOCUS_t00010 90742 90668 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 92066 90792 gene locus_tag LOCUS_08350 92066 90792 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_08350 92571 92122 gene locus_tag LOCUS_08360 gene ybeY 92571 92122 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_08360 93584 92577 gene locus_tag LOCUS_08370 93584 92577 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_08370 94194 93871 gene locus_tag LOCUS_08380 94194 93871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence010 832 176 gene locus_tag LOCUS_08390 832 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2474 918 gene locus_tag LOCUS_08400 2474 918 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_08400 4294 2954 gene locus_tag LOCUS_08410 4294 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5197 4319 gene locus_tag LOCUS_08420 5197 4319 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_08420 5550 7439 gene locus_tag LOCUS_08430 5550 7439 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_08430 7496 9607 gene locus_tag LOCUS_08440 7496 9607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11015 9657 gene locus_tag LOCUS_08450 gene bioA 11015 9657 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_08450 12288 10996 gene locus_tag LOCUS_08460 12288 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12536 15184 gene locus_tag LOCUS_08470 12536 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15181 19992 gene locus_tag LOCUS_08480 15181 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 20181 25031 gene locus_tag LOCUS_08490 20181 25031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 25171 26010 gene locus_tag LOCUS_08500 25171 26010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 26055 26849 gene locus_tag LOCUS_08510 26055 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 27817 26912 gene locus_tag LOCUS_08520 27817 26912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 28049 28726 gene locus_tag LOCUS_08530 gene tenA 28049 28726 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_08530 30513 28723 gene locus_tag LOCUS_08540 gene phoR 30513 28723 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_08540 30642 31541 gene locus_tag LOCUS_08550 30642 31541 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_08550 31560 32831 gene locus_tag LOCUS_08560 gene aroA 31560 32831 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_08560 33003 33317 gene locus_tag LOCUS_08570 33003 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 33346 33597 gene locus_tag LOCUS_08580 33346 33597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 33632 34249 gene locus_tag LOCUS_08590 33632 34249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 34937 34398 gene locus_tag LOCUS_08600 34937 34398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 35283 34927 gene locus_tag LOCUS_08610 35283 34927 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023352.1 protein_id gnl|my_center|LOCUS_08610 36169 35315 gene locus_tag LOCUS_08620 36169 35315 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928717.1 protein_id gnl|my_center|LOCUS_08620 39556 36476 gene locus_tag LOCUS_08630 39556 36476 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_08630 41032 39608 gene locus_tag LOCUS_08640 41032 39608 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_08640 41365 41033 gene locus_tag LOCUS_08650 41365 41033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 42045 41362 gene locus_tag LOCUS_08660 gene tsaB 42045 41362 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_08660 43113 43188 gene locus_tag LOCUS_t00020 43113 43188 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43680 43192 gene locus_tag LOCUS_08670 43680 43192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 43921 45075 gene locus_tag LOCUS_08680 43921 45075 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025381298.1 protein_id gnl|my_center|LOCUS_08680 45317 46468 gene locus_tag LOCUS_08690 45317 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 46471 47472 gene locus_tag LOCUS_08700 46471 47472 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_08700 47506 48267 gene locus_tag LOCUS_08710 47506 48267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 48267 48626 gene locus_tag LOCUS_08720 48267 48626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 48630 49517 gene locus_tag LOCUS_08730 48630 49517 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_08730 49529 50281 gene locus_tag LOCUS_08740 gene fabG 49529 50281 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_08740 50835 53927 gene locus_tag LOCUS_08750 50835 53927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 54277 54846 gene locus_tag LOCUS_08760 54277 54846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 56177 54912 gene locus_tag LOCUS_08770 56177 54912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_08770 56963 56184 gene locus_tag LOCUS_08780 56963 56184 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048193.1 protein_id gnl|my_center|LOCUS_08780 57421 56990 gene locus_tag LOCUS_08790 57421 56990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 57836 57411 gene locus_tag LOCUS_08800 57836 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 58688 57957 gene locus_tag LOCUS_08810 58688 57957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 59420 58713 gene locus_tag LOCUS_08820 59420 58713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 59865 59458 gene locus_tag LOCUS_08830 59865 59458 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_08830 60018 60362 gene locus_tag LOCUS_08840 60018 60362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 60391 60837 gene locus_tag LOCUS_08850 60391 60837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 61994 60834 gene locus_tag LOCUS_08860 61994 60834 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075445.1 protein_id gnl|my_center|LOCUS_08860 62379 61984 gene locus_tag LOCUS_08870 62379 61984 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330483.1 protein_id gnl|my_center|LOCUS_08870 64753 62525 gene locus_tag LOCUS_08880 64753 62525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 65585 64824 gene locus_tag LOCUS_08890 65585 64824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 65971 65606 gene locus_tag LOCUS_08900 65971 65606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 66357 66010 gene locus_tag LOCUS_08910 66357 66010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 66771 67361 gene locus_tag LOCUS_08920 66771 67361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 67345 67731 gene locus_tag LOCUS_08930 67345 67731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 67788 68444 gene locus_tag LOCUS_08940 67788 68444 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_08940 68459 69268 gene locus_tag LOCUS_08950 68459 69268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 69855 69289 gene locus_tag LOCUS_08960 69855 69289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 71246 69861 gene locus_tag LOCUS_08970 71246 69861 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_08970 72526 71273 gene locus_tag LOCUS_08980 72526 71273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 74687 72615 gene locus_tag LOCUS_08990 74687 72615 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_08990 74854 74780 gene locus_tag LOCUS_t00030 74854 74780 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 75342 74908 gene locus_tag LOCUS_09000 75342 74908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 75464 75394 gene locus_tag LOCUS_t00040 75464 75394 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 77006 75531 gene locus_tag LOCUS_09010 77006 75531 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_09010 78535 77021 gene locus_tag LOCUS_09020 78535 77021 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_09020 80804 78600 gene locus_tag LOCUS_09030 gene nuoL 80804 78600 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_09030 81151 80819 gene locus_tag LOCUS_09040 gene nuoK 81151 80819 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_09040 81694 81176 gene locus_tag LOCUS_09050 81694 81176 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_09050 82450 81731 gene locus_tag LOCUS_09060 82450 81731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 82792 82502 gene locus_tag LOCUS_09070 82792 82502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 84102 82861 gene locus_tag LOCUS_09080 84102 82861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 85335 84130 gene locus_tag LOCUS_09090 85335 84130 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_09090 85868 85383 gene locus_tag LOCUS_09100 85868 85383 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_09100 86526 85900 gene locus_tag LOCUS_09110 86526 85900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 86926 86516 gene locus_tag LOCUS_09120 gene ndhC 86926 86516 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_09120 87454 88224 gene locus_tag LOCUS_09130 87454 88224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 89465 88719 gene locus_tag LOCUS_09140 89465 88719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 90612 89524 gene locus_tag LOCUS_09150 gene dgoD 90612 89524 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_09150 91265 90618 gene locus_tag LOCUS_09160 91265 90618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence011 745 485 gene locus_tag LOCUS_09170 745 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1777 986 gene locus_tag LOCUS_09180 1777 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3275 2295 gene locus_tag LOCUS_09190 3275 2295 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_09190 3468 4043 gene locus_tag LOCUS_09200 3468 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4170 4565 gene locus_tag LOCUS_09210 4170 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5768 4710 gene locus_tag LOCUS_09220 5768 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6786 5761 gene locus_tag LOCUS_09230 6786 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 9758 6879 gene locus_tag LOCUS_09240 9758 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 10677 11891 gene locus_tag LOCUS_09250 10677 11891 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_09250 12005 12355 gene locus_tag LOCUS_09260 12005 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 14008 14442 gene locus_tag LOCUS_09270 14008 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 14877 15926 gene locus_tag LOCUS_09280 14877 15926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 15944 17155 gene locus_tag LOCUS_09290 15944 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 17159 18073 gene locus_tag LOCUS_09300 17159 18073 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_09300 19047 18127 gene locus_tag LOCUS_09310 19047 18127 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_09310 19892 19089 gene locus_tag LOCUS_09320 19892 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 20261 20542 gene locus_tag LOCUS_09330 gene infA 20261 20542 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_09330 21100 21474 gene locus_tag LOCUS_09340 21100 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 21903 23090 gene locus_tag LOCUS_09350 21903 23090 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_09350 23091 24398 gene locus_tag LOCUS_09360 23091 24398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_09360 25520 24411 gene locus_tag LOCUS_09370 25520 24411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26300 25566 gene locus_tag LOCUS_09380 26300 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27219 26341 gene locus_tag LOCUS_09390 27219 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 27463 28410 gene locus_tag LOCUS_09400 27463 28410 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256322.1 protein_id gnl|my_center|LOCUS_09400 28445 28768 gene locus_tag LOCUS_09410 28445 28768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 29172 30140 gene locus_tag LOCUS_09420 29172 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 30165 32390 gene locus_tag LOCUS_09430 30165 32390 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_09430 32390 35752 gene locus_tag LOCUS_09440 32390 35752 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_09440 35857 38349 gene locus_tag LOCUS_09450 35857 38349 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_09450 38340 38525 gene locus_tag LOCUS_09460 38340 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 38576 41380 gene locus_tag LOCUS_09470 38576 41380 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_09470 42339 41323 gene locus_tag LOCUS_09480 gene waaF 42339 41323 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_09480 43580 42336 gene locus_tag LOCUS_09490 43580 42336 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_09490 44641 43577 gene locus_tag LOCUS_09500 gene waaF 44641 43577 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_09500 44769 46769 gene locus_tag LOCUS_09510 44769 46769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 47115 46771 gene locus_tag LOCUS_09520 47115 46771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 48194 47250 gene locus_tag LOCUS_09530 48194 47250 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764146.1 protein_id gnl|my_center|LOCUS_09530 48744 49109 gene locus_tag LOCUS_09540 48744 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 50785 49508 gene locus_tag LOCUS_09550 50785 49508 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_09550 51590 50850 gene locus_tag LOCUS_09560 51590 50850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 51687 52859 gene locus_tag LOCUS_09570 51687 52859 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038876.1 protein_id gnl|my_center|LOCUS_09570 52856 56500 gene locus_tag LOCUS_09580 52856 56500 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816917.1 protein_id gnl|my_center|LOCUS_09580 56566 57324 gene locus_tag LOCUS_09590 56566 57324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 57723 57394 gene locus_tag LOCUS_09600 gene iscA 57723 57394 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951096.1 protein_id gnl|my_center|LOCUS_09600 58133 57735 gene locus_tag LOCUS_09610 58133 57735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 58956 58723 gene locus_tag LOCUS_09620 58956 58723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 59185 58928 gene locus_tag LOCUS_09630 59185 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 60878 61441 gene locus_tag LOCUS_09640 60878 61441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 61438 62646 gene locus_tag LOCUS_09650 61438 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 62688 65726 gene locus_tag LOCUS_09660 62688 65726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 65736 66185 gene locus_tag LOCUS_09670 65736 66185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 66182 67036 gene locus_tag LOCUS_09680 66182 67036 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986810.1 protein_id gnl|my_center|LOCUS_09680 67183 67332 gene locus_tag LOCUS_09690 67183 67332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 68074 67568 gene locus_tag LOCUS_09700 68074 67568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 69095 68601 gene locus_tag LOCUS_09710 69095 68601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 69176 70120 gene locus_tag LOCUS_09720 69176 70120 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_09720 71143 70133 gene locus_tag LOCUS_09730 71143 70133 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_09730 71870 71145 gene locus_tag LOCUS_09740 71870 71145 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_09740 72083 71925 gene locus_tag LOCUS_09750 72083 71925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 73808 72222 gene locus_tag LOCUS_09760 73808 72222 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110588.1 protein_id gnl|my_center|LOCUS_09760 74223 76991 gene locus_tag LOCUS_09770 74223 76991 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_09770 77187 78257 gene locus_tag LOCUS_09780 77187 78257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 78789 79352 gene locus_tag LOCUS_09790 78789 79352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 79407 80471 gene locus_tag LOCUS_09800 79407 80471 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_09800 80474 81175 gene locus_tag LOCUS_09810 80474 81175 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_09810 81218 82072 gene locus_tag LOCUS_09820 81218 82072 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_09820 82101 82907 gene locus_tag LOCUS_09830 82101 82907 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969653.1 protein_id gnl|my_center|LOCUS_09830 82945 83658 gene locus_tag LOCUS_09840 82945 83658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 83667 84926 gene locus_tag LOCUS_09850 83667 84926 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_09850 85433 84936 gene locus_tag LOCUS_09860 85433 84936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 86856 85417 gene locus_tag LOCUS_09870 86856 85417 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_09870 87214 88719 gene locus_tag LOCUS_09880 gene xylB 87214 88719 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 protein_id gnl|my_center|LOCUS_09880 88749 89702 gene locus_tag LOCUS_09890 88749 89702 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_09890 89730 90293 gene locus_tag LOCUS_09900 89730 90293 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence012 1826 129 gene locus_tag LOCUS_09910 1826 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3796 5232 gene locus_tag LOCUS_09920 3796 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5553 6323 gene locus_tag LOCUS_09930 5553 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6336 7667 gene locus_tag LOCUS_09940 gene hisS 6336 7667 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142552.1 protein_id gnl|my_center|LOCUS_09940 9274 7670 gene locus_tag LOCUS_09950 9274 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 9448 10683 gene locus_tag LOCUS_09960 9448 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 10778 11551 gene locus_tag LOCUS_09970 10778 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 12535 11717 gene locus_tag LOCUS_09980 12535 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 13458 12637 gene locus_tag LOCUS_09990 13458 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 14342 13509 gene locus_tag LOCUS_10000 14342 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 15179 14391 gene locus_tag LOCUS_10010 15179 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 15747 16202 gene locus_tag LOCUS_10020 15747 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 16719 17765 gene locus_tag LOCUS_10030 gene pelA 16719 17765 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427768.1 protein_id gnl|my_center|LOCUS_10030 19050 17992 gene locus_tag LOCUS_10040 19050 17992 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_10040 21250 19511 gene locus_tag LOCUS_10050 21250 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 21941 21276 gene locus_tag LOCUS_10060 21941 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 24467 21969 gene locus_tag LOCUS_10070 24467 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 25110 24460 gene locus_tag LOCUS_10080 25110 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 25568 26479 gene locus_tag LOCUS_10090 25568 26479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 27330 26494 gene locus_tag LOCUS_10100 27330 26494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 27493 29445 gene locus_tag LOCUS_10110 27493 29445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 29651 30106 gene locus_tag LOCUS_10120 29651 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 30111 30470 gene locus_tag LOCUS_10130 30111 30470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 30724 31449 gene locus_tag LOCUS_10140 gene rpe 30724 31449 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_10140 31449 32510 gene locus_tag LOCUS_10150 31449 32510 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384594.1 protein_id gnl|my_center|LOCUS_10150 32535 33587 gene locus_tag LOCUS_10160 32535 33587 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_10160 33620 34135 gene locus_tag LOCUS_10170 33620 34135 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 protein_id gnl|my_center|LOCUS_10170 34204 34277 gene locus_tag LOCUS_t00050 34204 34277 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34532 36478 gene locus_tag LOCUS_10180 gene secD 34532 36478 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_10180 36506 37846 gene locus_tag LOCUS_10190 36506 37846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 37851 38594 gene locus_tag LOCUS_10200 37851 38594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 38607 39299 gene locus_tag LOCUS_10210 38607 39299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 39341 40831 gene locus_tag LOCUS_10220 39341 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 40840 42594 gene locus_tag LOCUS_10230 40840 42594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 43033 43551 gene locus_tag LOCUS_10240 43033 43551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 43563 45116 gene locus_tag LOCUS_10250 43563 45116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 45106 46617 gene locus_tag LOCUS_10260 45106 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 46628 47665 gene locus_tag LOCUS_10270 46628 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 47684 49063 gene locus_tag LOCUS_10280 47684 49063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10280 50010 49120 gene locus_tag LOCUS_10290 50010 49120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 50473 50078 gene locus_tag LOCUS_10300 50473 50078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 50913 50644 gene locus_tag LOCUS_10310 50913 50644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 51977 50964 gene locus_tag LOCUS_10320 51977 50964 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_10320 53147 52095 gene locus_tag LOCUS_10330 53147 52095 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_10330 53723 53439 gene locus_tag LOCUS_10340 53723 53439 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_10340 54256 55257 gene locus_tag LOCUS_10350 54256 55257 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_10350 55288 56424 gene locus_tag LOCUS_10360 gene mtnK 55288 56424 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542687.1 protein_id gnl|my_center|LOCUS_10360 56481 57344 gene locus_tag LOCUS_10370 56481 57344 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 protein_id gnl|my_center|LOCUS_10370 57341 58312 gene locus_tag LOCUS_10380 57341 58312 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393567.1 protein_id gnl|my_center|LOCUS_10380 58331 58603 gene locus_tag LOCUS_10390 58331 58603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 58631 58867 gene locus_tag LOCUS_10400 58631 58867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 58898 60085 gene locus_tag LOCUS_10410 58898 60085 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_10410 60241 60690 gene locus_tag LOCUS_10420 60241 60690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 60722 61618 gene locus_tag LOCUS_10430 60722 61618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 61654 63363 gene locus_tag LOCUS_10440 61654 63363 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_10440 64239 63481 gene locus_tag LOCUS_10450 64239 63481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 64482 65519 gene locus_tag LOCUS_10460 64482 65519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 65573 66727 gene locus_tag LOCUS_10470 65573 66727 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_10470 66828 67400 gene locus_tag LOCUS_10480 66828 67400 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_10480 68302 67406 gene locus_tag LOCUS_10490 68302 67406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 69127 68312 gene locus_tag LOCUS_10500 69127 68312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 69702 69154 gene locus_tag LOCUS_10510 69702 69154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 70099 73317 gene locus_tag LOCUS_10520 70099 73317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 73499 75811 gene locus_tag LOCUS_10530 73499 75811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 76021 79254 gene locus_tag LOCUS_10540 76021 79254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 79486 82689 gene locus_tag LOCUS_10550 79486 82689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 83005 84510 gene locus_tag LOCUS_10560 83005 84510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 85266 88223 gene locus_tag LOCUS_10570 85266 88223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence013 548 1429 gene locus_tag LOCUS_10580 gene rpsB 548 1429 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080936.1 protein_id gnl|my_center|LOCUS_10580 1595 2188 gene locus_tag LOCUS_10590 gene tsf 1595 2188 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869491.1 protein_id gnl|my_center|LOCUS_10590 2253 2840 gene locus_tag LOCUS_10600 gene frr 2253 2840 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_10600 2843 3697 gene locus_tag LOCUS_10610 2843 3697 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_10610 3790 4956 gene locus_tag LOCUS_10620 3790 4956 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_10620 5000 6709 gene locus_tag LOCUS_10630 5000 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6733 7434 gene locus_tag LOCUS_10640 6733 7434 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_10640 7501 10017 gene locus_tag LOCUS_10650 gene priA 7501 10017 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 protein_id gnl|my_center|LOCUS_10650 10085 11041 gene locus_tag LOCUS_10660 10085 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11182 12435 gene locus_tag LOCUS_10670 11182 12435 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_10670 12578 13453 gene locus_tag LOCUS_10680 12578 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 13524 13760 gene locus_tag LOCUS_10690 13524 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 14007 14246 gene locus_tag LOCUS_10700 14007 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 15141 14779 gene locus_tag LOCUS_10710 15141 14779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 15229 15789 gene locus_tag LOCUS_10720 15229 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 15918 17447 gene locus_tag LOCUS_10730 15918 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 18504 17503 gene locus_tag LOCUS_10740 18504 17503 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290900.1 protein_id gnl|my_center|LOCUS_10740 19425 18559 gene locus_tag LOCUS_10750 19425 18559 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_10750 20290 19454 gene locus_tag LOCUS_10760 20290 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 20381 21547 gene locus_tag LOCUS_10770 gene mqnE 20381 21547 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_10770 21598 22353 gene locus_tag LOCUS_10780 21598 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 22623 23132 gene locus_tag LOCUS_10790 22623 23132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 23914 25755 gene locus_tag LOCUS_10800 gene ilvB 23914 25755 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_10800 25830 26327 gene locus_tag LOCUS_10810 gene ilvN 25830 26327 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_10810 27015 27392 gene locus_tag LOCUS_10820 27015 27392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 27379 27927 gene locus_tag LOCUS_10830 27379 27927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 28093 33087 gene locus_tag LOCUS_10840 28093 33087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 33342 34334 gene locus_tag LOCUS_10850 gene ilvC 33342 34334 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_10850 34440 35618 gene locus_tag LOCUS_10860 34440 35618 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_10860 35707 35620 gene locus_tag LOCUS_t00060 35707 35620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37226 36450 gene locus_tag LOCUS_10870 37226 36450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 37688 37239 gene locus_tag LOCUS_10880 37688 37239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 38202 39305 gene locus_tag LOCUS_10890 38202 39305 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_10890 39474 41918 gene locus_tag LOCUS_10900 39474 41918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 42094 42432 gene locus_tag LOCUS_10910 42094 42432 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_10910 42429 42821 gene locus_tag LOCUS_10920 42429 42821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 42873 43091 gene locus_tag LOCUS_10930 42873 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 43116 43535 gene locus_tag LOCUS_10940 43116 43535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 43600 44319 gene locus_tag LOCUS_10950 43600 44319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 44307 44564 gene locus_tag LOCUS_10960 44307 44564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 44727 46211 gene locus_tag LOCUS_10970 44727 46211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 46231 47805 gene locus_tag LOCUS_10980 46231 47805 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_10980 48192 49739 gene locus_tag LOCUS_10990 gene rng 48192 49739 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10990 49896 50351 gene locus_tag LOCUS_11000 49896 50351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 50700 51062 gene locus_tag LOCUS_11010 gene rplU 50700 51062 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_11010 51052 51318 gene locus_tag LOCUS_11020 gene rpmA 51052 51318 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_11020 51685 52089 gene locus_tag LOCUS_11030 51685 52089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 52086 53747 gene locus_tag LOCUS_11040 52086 53747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 53887 54171 gene locus_tag LOCUS_11050 53887 54171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 54265 55806 gene locus_tag LOCUS_11060 gene guaA 54265 55806 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_11060 55812 56606 gene locus_tag LOCUS_11070 55812 56606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 57969 56788 gene locus_tag LOCUS_11080 57969 56788 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_11080 62763 58054 gene locus_tag LOCUS_11090 62763 58054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 63869 62946 gene locus_tag LOCUS_11100 63869 62946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 64551 63961 gene locus_tag LOCUS_11110 gene rpoE 64551 63961 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420724.1 protein_id gnl|my_center|LOCUS_11110 65642 64998 gene locus_tag LOCUS_11120 65642 64998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 67122 66127 gene locus_tag LOCUS_11130 gene dprA 67122 66127 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_11130 67323 68105 gene locus_tag LOCUS_11140 67323 68105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_11140 68098 68802 gene locus_tag LOCUS_11150 68098 68802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_11150 68809 69657 gene locus_tag LOCUS_11160 gene lgt 68809 69657 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693254.1 protein_id gnl|my_center|LOCUS_11160 70063 69749 gene locus_tag LOCUS_11170 70063 69749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 71546 70284 gene locus_tag LOCUS_11180 71546 70284 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_11180 71770 72408 gene locus_tag LOCUS_11190 71770 72408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 72949 72494 gene locus_tag LOCUS_11200 72949 72494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 73826 73056 gene locus_tag LOCUS_11210 73826 73056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229088.1 protein_id gnl|my_center|LOCUS_11210 74845 73880 gene locus_tag LOCUS_11220 74845 73880 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229087.1 protein_id gnl|my_center|LOCUS_11220 75851 74859 gene locus_tag LOCUS_11230 75851 74859 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_11230 76745 76059 gene locus_tag LOCUS_11240 76745 76059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 77027 76797 gene locus_tag LOCUS_11250 77027 76797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 77705 77058 gene locus_tag LOCUS_11260 77705 77058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 78599 77808 gene locus_tag LOCUS_11270 78599 77808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 79745 78762 gene locus_tag LOCUS_11280 79745 78762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11280 80323 79967 gene locus_tag LOCUS_11290 80323 79967 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_11290 80915 82075 gene locus_tag LOCUS_11300 80915 82075 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_11300 82114 82782 gene locus_tag LOCUS_11310 82114 82782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 82862 83089 gene locus_tag LOCUS_11320 82862 83089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 83851 83249 gene locus_tag LOCUS_11330 83851 83249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 85237 83996 gene locus_tag LOCUS_11340 85237 83996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_11340 86333 85266 gene locus_tag LOCUS_11350 86333 85266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence014 601 407 gene locus_tag LOCUS_11360 601 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1809 1099 gene locus_tag LOCUS_11370 1809 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2975 1797 gene locus_tag LOCUS_11380 2975 1797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_11380 4455 3049 gene locus_tag LOCUS_11390 4455 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4528 4878 gene locus_tag LOCUS_11400 4528 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5874 4969 gene locus_tag LOCUS_11410 5874 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8553 6058 gene locus_tag LOCUS_11420 8553 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 8800 8609 gene locus_tag LOCUS_11430 8800 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 10226 9057 gene locus_tag LOCUS_11440 10226 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 11407 10247 gene locus_tag LOCUS_11450 11407 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 11728 14799 gene locus_tag LOCUS_11460 11728 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 15055 15357 gene locus_tag LOCUS_11470 15055 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 15400 15534 gene locus_tag LOCUS_11480 15400 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 17242 15764 gene locus_tag LOCUS_11490 17242 15764 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_11490 18471 17311 gene locus_tag LOCUS_11500 18471 17311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 20425 18947 gene locus_tag LOCUS_11510 20425 18947 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_11510 23433 20473 gene locus_tag LOCUS_11520 23433 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11520 25167 23509 gene locus_tag LOCUS_11530 25167 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11530 25921 25181 gene locus_tag LOCUS_11540 25921 25181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11540 30128 26085 gene locus_tag LOCUS_11550 30128 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 30385 30795 gene locus_tag LOCUS_11560 30385 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 30771 30992 gene locus_tag LOCUS_11570 30771 30992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 31351 31632 gene locus_tag LOCUS_11580 31351 31632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 32482 31673 gene locus_tag LOCUS_11590 32482 31673 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_11590 33529 32486 gene locus_tag LOCUS_11600 33529 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 34411 33572 gene locus_tag LOCUS_11610 34411 33572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 35238 34423 gene locus_tag LOCUS_11620 35238 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 36178 35336 gene locus_tag LOCUS_11630 36178 35336 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261708.1 protein_id gnl|my_center|LOCUS_11630 37406 36465 gene locus_tag LOCUS_11640 37406 36465 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_11640 37605 38519 gene locus_tag LOCUS_11650 37605 38519 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_11650 38524 39696 gene locus_tag LOCUS_11660 gene bioF 38524 39696 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_11660 39839 40252 gene locus_tag LOCUS_11670 39839 40252 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 protein_id gnl|my_center|LOCUS_11670 40282 41520 gene locus_tag LOCUS_11680 40282 41520 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_11680 41737 43788 gene locus_tag LOCUS_11690 41737 43788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 43920 45074 gene locus_tag LOCUS_11700 43920 45074 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_11700 45071 45667 gene locus_tag LOCUS_11710 45071 45667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 45671 45967 gene locus_tag LOCUS_11720 45671 45967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 45969 46883 gene locus_tag LOCUS_11730 45969 46883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 47730 46933 gene locus_tag LOCUS_11740 47730 46933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 48410 47736 gene locus_tag LOCUS_11750 gene rpiA 48410 47736 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_11750 49381 48407 gene locus_tag LOCUS_11760 49381 48407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 50595 49378 gene locus_tag LOCUS_11770 gene rhaI 50595 49378 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_11770 50929 50708 gene locus_tag LOCUS_11780 50929 50708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 51162 50983 gene locus_tag LOCUS_11790 51162 50983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 53553 51292 gene locus_tag LOCUS_11800 53553 51292 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_11800 56290 53822 gene locus_tag LOCUS_11810 gene lon 56290 53822 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_11810 57494 56448 gene locus_tag LOCUS_11820 57494 56448 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_11820 58018 57548 gene locus_tag LOCUS_11830 58018 57548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 59248 58172 gene locus_tag LOCUS_11840 59248 58172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 60000 59593 gene locus_tag LOCUS_11850 60000 59593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 60140 61531 gene locus_tag LOCUS_11860 gene fumC 60140 61531 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225106.1 protein_id gnl|my_center|LOCUS_11860 61606 62457 gene locus_tag LOCUS_11870 61606 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 63276 62446 gene locus_tag LOCUS_11880 63276 62446 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_11880 63464 63751 gene locus_tag LOCUS_11890 63464 63751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 63927 64259 gene locus_tag LOCUS_11900 63927 64259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 64284 64994 gene locus_tag LOCUS_11910 64284 64994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 66079 65120 gene locus_tag LOCUS_11920 66079 65120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 67124 66084 gene locus_tag LOCUS_11930 gene rfbB 67124 66084 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_11930 67436 68374 gene locus_tag LOCUS_11940 67436 68374 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_11940 68384 68689 gene locus_tag LOCUS_11950 68384 68689 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_11950 68792 69490 gene locus_tag LOCUS_11960 68792 69490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 69648 70910 gene locus_tag LOCUS_11970 69648 70910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 71734 72531 gene locus_tag LOCUS_11980 71734 72531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 72550 73782 gene locus_tag LOCUS_11990 72550 73782 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_11990 74004 75257 gene locus_tag LOCUS_12000 74004 75257 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_12000 75290 76462 gene locus_tag LOCUS_12010 75290 76462 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_12010 76550 77164 gene locus_tag LOCUS_12020 76550 77164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 77270 78280 gene locus_tag LOCUS_12030 gene galM 77270 78280 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_12030 78301 79248 gene locus_tag LOCUS_12040 78301 79248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 79255 83283 gene locus_tag LOCUS_12050 79255 83283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 83335 84231 gene locus_tag LOCUS_12060 83335 84231 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_12060 84409 85536 gene locus_tag LOCUS_12070 84409 85536 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence015 225 2507 gene locus_tag LOCUS_12080 225 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3489 4448 gene locus_tag LOCUS_12090 3489 4448 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_12090 4507 4755 gene locus_tag LOCUS_12100 4507 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5150 6661 gene locus_tag LOCUS_12110 5150 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6687 7853 gene locus_tag LOCUS_12120 6687 7853 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021436.1 protein_id gnl|my_center|LOCUS_12120 7881 10181 gene locus_tag LOCUS_12130 7881 10181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10205 11869 gene locus_tag LOCUS_12140 10205 11869 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_12140 11930 12688 gene locus_tag LOCUS_12150 11930 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 12823 13587 gene locus_tag LOCUS_12160 12823 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13602 15554 gene locus_tag LOCUS_12170 13602 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 15584 15832 gene locus_tag LOCUS_12180 15584 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 15889 16782 gene locus_tag LOCUS_12190 15889 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 16840 18762 gene locus_tag LOCUS_12200 16840 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 18935 19945 gene locus_tag LOCUS_12210 18935 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19974 20189 gene locus_tag LOCUS_12220 19974 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 20197 21339 gene locus_tag LOCUS_12230 20197 21339 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_12230 21448 22455 gene locus_tag LOCUS_12240 21448 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 22629 23909 gene locus_tag LOCUS_12250 22629 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 23946 25529 gene locus_tag LOCUS_12260 gene purH 23946 25529 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_12260 25755 25543 gene locus_tag LOCUS_12270 25755 25543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 25646 27826 gene locus_tag LOCUS_12280 25646 27826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 27912 30620 gene locus_tag LOCUS_12290 27912 30620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 30856 32034 gene locus_tag LOCUS_12300 30856 32034 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_12300 32045 33580 gene locus_tag LOCUS_12310 32045 33580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_12310 33672 34091 gene locus_tag LOCUS_12320 33672 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 34101 34940 gene locus_tag LOCUS_12330 34101 34940 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_12330 35030 37069 gene locus_tag LOCUS_12340 35030 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 37069 38061 gene locus_tag LOCUS_12350 37069 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 38125 38997 gene locus_tag LOCUS_12360 38125 38997 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280038.1 protein_id gnl|my_center|LOCUS_12360 39393 39109 gene locus_tag LOCUS_12370 39393 39109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 39672 39433 gene locus_tag LOCUS_12380 39672 39433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 39841 40839 gene locus_tag LOCUS_12390 39841 40839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 41996 40836 gene locus_tag LOCUS_12400 41996 40836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_12400 43225 41978 gene locus_tag LOCUS_12410 43225 41978 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_12410 44086 43304 gene locus_tag LOCUS_12420 44086 43304 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267037.1 protein_id gnl|my_center|LOCUS_12420 44350 44117 gene locus_tag LOCUS_12430 44350 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 44680 44829 gene locus_tag LOCUS_12440 44680 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 44826 46028 gene locus_tag LOCUS_12450 44826 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 47966 46017 gene locus_tag LOCUS_12460 47966 46017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 49762 48236 gene locus_tag LOCUS_12470 gene gatB 49762 48236 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_12470 50634 49861 gene locus_tag LOCUS_12480 50634 49861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004889.1 protein_id gnl|my_center|LOCUS_12480 51016 53262 gene locus_tag LOCUS_12490 51016 53262 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_12490 54949 53276 gene locus_tag LOCUS_12500 gene nadB 54949 53276 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_12500 55412 54996 gene locus_tag LOCUS_12510 55412 54996 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_12510 58103 55446 gene locus_tag LOCUS_12520 58103 55446 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_12520 58781 58224 gene locus_tag LOCUS_12530 gene raiA 58781 58224 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_12530 60644 58857 gene locus_tag LOCUS_12540 60644 58857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 61389 60739 gene locus_tag LOCUS_12550 gene lptB 61389 60739 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051163.1 protein_id gnl|my_center|LOCUS_12550 62555 61569 gene locus_tag LOCUS_12560 62555 61569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 63234 62545 gene locus_tag LOCUS_12570 63234 62545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 63928 63128 gene locus_tag LOCUS_12580 63928 63128 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948626.1 protein_id gnl|my_center|LOCUS_12580 64161 65465 gene locus_tag LOCUS_12590 64161 65465 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_12590 67057 65648 gene locus_tag LOCUS_12600 67057 65648 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120134.1 protein_id gnl|my_center|LOCUS_12600 67442 68173 gene locus_tag LOCUS_12610 67442 68173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 68338 69189 gene locus_tag LOCUS_12620 68338 69189 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_12620 69252 72230 gene locus_tag LOCUS_12630 69252 72230 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_12630 73465 72299 gene locus_tag LOCUS_12640 73465 72299 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_12640 73892 74332 gene locus_tag LOCUS_12650 73892 74332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 75622 74807 gene locus_tag LOCUS_12660 75622 74807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 77243 75777 gene locus_tag LOCUS_12670 77243 75777 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_12670 77823 77419 gene locus_tag LOCUS_12680 77823 77419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 78384 77977 gene locus_tag LOCUS_12690 78384 77977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 79553 78654 gene locus_tag LOCUS_12700 79553 78654 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_12700 80258 80040 gene locus_tag LOCUS_12710 80258 80040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 80589 80293 gene locus_tag LOCUS_12720 80589 80293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 82193 80721 gene locus_tag LOCUS_12730 82193 80721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 83607 82207 gene locus_tag LOCUS_12740 83607 82207 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261952.1 protein_id gnl|my_center|LOCUS_12740 83806 84477 gene locus_tag LOCUS_12750 83806 84477 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_12750 85010 84480 gene locus_tag LOCUS_12760 85010 84480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence016 874 209 gene locus_tag LOCUS_12770 874 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1851 1039 gene locus_tag LOCUS_12780 1851 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4944 1861 gene locus_tag LOCUS_12790 4944 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5170 5970 gene locus_tag LOCUS_12800 5170 5970 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098362.1 protein_id gnl|my_center|LOCUS_12800 6056 7060 gene locus_tag LOCUS_12810 6056 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 7117 7395 gene locus_tag LOCUS_12820 7117 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 7433 8383 gene locus_tag LOCUS_12830 gene era 7433 8383 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921969.1 protein_id gnl|my_center|LOCUS_12830 8414 14137 gene locus_tag LOCUS_12840 8414 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 14744 16069 gene locus_tag LOCUS_12850 14744 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 16312 17223 gene locus_tag LOCUS_12860 16312 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 18023 18424 gene locus_tag LOCUS_12870 18023 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18572 18958 gene locus_tag LOCUS_12880 18572 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 20187 22421 gene locus_tag LOCUS_12890 20187 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 22581 23048 gene locus_tag LOCUS_12900 22581 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 23268 24296 gene locus_tag LOCUS_12910 23268 24296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 24309 25331 gene locus_tag LOCUS_12920 24309 25331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 25427 26125 gene locus_tag LOCUS_12930 25427 26125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 26728 28086 gene locus_tag LOCUS_12940 26728 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 28229 29224 gene locus_tag LOCUS_12950 28229 29224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 29482 30198 gene locus_tag LOCUS_12960 29482 30198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_12960 30217 31863 gene locus_tag LOCUS_12970 gene gldG 30217 31863 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_12970 31891 32889 gene locus_tag LOCUS_12980 31891 32889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 33352 34068 gene locus_tag LOCUS_12990 33352 34068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 34202 34984 gene locus_tag LOCUS_13000 34202 34984 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_13000 35431 36198 gene locus_tag LOCUS_13010 35431 36198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 37710 36514 gene locus_tag LOCUS_13020 37710 36514 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_13020 38902 37790 gene locus_tag LOCUS_13030 38902 37790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 39054 40349 gene locus_tag LOCUS_13040 39054 40349 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_13040 41480 42226 gene locus_tag LOCUS_13050 41480 42226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 42241 42738 gene locus_tag LOCUS_13060 42241 42738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 43842 44873 gene locus_tag LOCUS_13070 gene bdhA 43842 44873 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645827.1 protein_id gnl|my_center|LOCUS_13070 44887 45522 gene locus_tag LOCUS_13080 44887 45522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 46466 45543 gene locus_tag LOCUS_13090 gene ribF 46466 45543 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946671.1 protein_id gnl|my_center|LOCUS_13090 47655 46675 gene locus_tag LOCUS_13100 47655 46675 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_13100 48041 47652 gene locus_tag LOCUS_13110 gene rbfA 48041 47652 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_13110 48381 48097 gene locus_tag LOCUS_13120 48381 48097 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_13120 51094 48980 gene locus_tag LOCUS_13130 51094 48980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 51374 51087 gene locus_tag LOCUS_13140 51374 51087 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_13140 52816 51587 gene locus_tag LOCUS_13150 52816 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 53322 52861 gene locus_tag LOCUS_13160 53322 52861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 53699 54298 gene locus_tag LOCUS_13170 53699 54298 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403271.1 protein_id gnl|my_center|LOCUS_13170 54295 55605 gene locus_tag LOCUS_13180 54295 55605 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545891.1 protein_id gnl|my_center|LOCUS_13180 56274 55600 gene locus_tag LOCUS_13190 56274 55600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 57733 56264 gene locus_tag LOCUS_13200 57733 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 58746 57706 gene locus_tag LOCUS_13210 58746 57706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 58822 59550 gene locus_tag LOCUS_13220 58822 59550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 59665 60879 gene locus_tag LOCUS_13230 59665 60879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 60977 61717 gene locus_tag LOCUS_13240 60977 61717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 62186 64054 gene locus_tag LOCUS_13250 62186 64054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 64250 64888 gene locus_tag LOCUS_13260 64250 64888 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_13260 64929 65183 gene locus_tag LOCUS_13270 64929 65183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 65227 65820 gene locus_tag LOCUS_13280 65227 65820 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272614.1 protein_id gnl|my_center|LOCUS_13280 65825 66364 gene locus_tag LOCUS_13290 65825 66364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 66956 67390 gene locus_tag LOCUS_13300 66956 67390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 67429 67773 gene locus_tag LOCUS_13310 67429 67773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 67901 69775 gene locus_tag LOCUS_13320 67901 69775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 69788 70750 gene locus_tag LOCUS_13330 69788 70750 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_13330 70798 72909 gene locus_tag LOCUS_13340 70798 72909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 73078 74010 gene locus_tag LOCUS_13350 73078 74010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 74007 74210 gene locus_tag LOCUS_13360 74007 74210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 74888 75265 gene locus_tag LOCUS_13370 74888 75265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 75332 76471 gene locus_tag LOCUS_13380 75332 76471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 76578 77372 gene locus_tag LOCUS_13390 gene rph 76578 77372 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_13390 77401 77937 gene locus_tag LOCUS_13400 77401 77937 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_13400 78016 78573 gene locus_tag LOCUS_13410 gene efp 78016 78573 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_13410 78577 79065 gene locus_tag LOCUS_13420 gene accB 78577 79065 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_13420 79070 80428 gene locus_tag LOCUS_13430 gene accC 79070 80428 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_13430 80488 82134 gene locus_tag LOCUS_13440 80488 82134 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_13440 82151 83560 gene locus_tag LOCUS_13450 82151 83560 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence017 132 3107 gene locus_tag LOCUS_13460 132 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3739 4287 gene locus_tag LOCUS_13470 3739 4287 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_13470 4491 5075 gene locus_tag LOCUS_13480 4491 5075 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_13480 5298 8081 gene locus_tag LOCUS_13490 5298 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 8093 9016 gene locus_tag LOCUS_13500 8093 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 9102 10202 gene locus_tag LOCUS_13510 9102 10202 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_13510 10214 10555 gene locus_tag LOCUS_13520 10214 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 10628 11524 gene locus_tag LOCUS_13530 10628 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11853 12680 gene locus_tag LOCUS_13540 11853 12680 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_13540 13024 23202 gene locus_tag LOCUS_13550 13024 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 23463 24251 gene locus_tag LOCUS_13560 23463 24251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 24338 25387 gene locus_tag LOCUS_13570 24338 25387 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_13570 25397 26533 gene locus_tag LOCUS_13580 25397 26533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 26615 28648 gene locus_tag LOCUS_13590 26615 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 30266 28677 gene locus_tag LOCUS_13600 30266 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 30934 30395 gene locus_tag LOCUS_13610 gene msrA 30934 30395 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_13610 32002 31022 gene locus_tag LOCUS_13620 32002 31022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 32792 31989 gene locus_tag LOCUS_13630 32792 31989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 33691 32927 gene locus_tag LOCUS_13640 33691 32927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 34256 35143 gene locus_tag LOCUS_13650 34256 35143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 36005 35109 gene locus_tag LOCUS_13660 36005 35109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 36774 36977 gene locus_tag LOCUS_13670 36774 36977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 36991 37320 gene locus_tag LOCUS_13680 36991 37320 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_13680 37487 38584 gene locus_tag LOCUS_13690 37487 38584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 38728 40311 gene locus_tag LOCUS_13700 38728 40311 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_13700 40352 41137 gene locus_tag LOCUS_13710 40352 41137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 41233 42009 gene locus_tag LOCUS_13720 41233 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 42118 42867 gene locus_tag LOCUS_13730 42118 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 43003 43404 gene locus_tag LOCUS_13740 43003 43404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 43555 44385 gene locus_tag LOCUS_13750 43555 44385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 44382 45221 gene locus_tag LOCUS_13760 44382 45221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 45267 46223 gene locus_tag LOCUS_13770 gene trxB 45267 46223 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_13770 46446 46985 gene locus_tag LOCUS_13780 46446 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 47024 47332 gene locus_tag LOCUS_13790 47024 47332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 47465 47764 gene locus_tag LOCUS_13800 47465 47764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 47844 48119 gene locus_tag LOCUS_13810 47844 48119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 48271 49908 gene locus_tag LOCUS_13820 gene xylB 48271 49908 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_13820 49930 50418 gene locus_tag LOCUS_13830 gene moaC 49930 50418 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_13830 50571 53468 gene locus_tag LOCUS_13840 50571 53468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 53531 54538 gene locus_tag LOCUS_13850 53531 54538 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_13850 54623 55309 gene locus_tag LOCUS_13860 54623 55309 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_13860 55350 56048 gene locus_tag LOCUS_13870 55350 56048 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267037.1 protein_id gnl|my_center|LOCUS_13870 56186 57133 gene locus_tag LOCUS_13880 56186 57133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 57167 58168 gene locus_tag LOCUS_13890 57167 58168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 58271 59224 gene locus_tag LOCUS_13900 58271 59224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 59422 60798 gene locus_tag LOCUS_13910 59422 60798 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_13910 60857 62293 gene locus_tag LOCUS_13920 60857 62293 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_13920 62381 63103 gene locus_tag LOCUS_13930 62381 63103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 63270 66767 gene locus_tag LOCUS_13940 63270 66767 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_13940 66764 67624 gene locus_tag LOCUS_13950 66764 67624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 67650 70049 gene locus_tag LOCUS_13960 67650 70049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 73742 70419 gene locus_tag LOCUS_13970 73742 70419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 73935 74948 gene locus_tag LOCUS_13980 gene trpD 73935 74948 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_13980 74955 75728 gene locus_tag LOCUS_13990 gene trpC 74955 75728 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_13990 76169 75732 gene locus_tag LOCUS_14000 76169 75732 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635494.1 protein_id gnl|my_center|LOCUS_14000 76828 76169 gene locus_tag LOCUS_14010 76828 76169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 80106 77233 gene locus_tag LOCUS_14020 80106 77233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence018 1367 312 gene locus_tag LOCUS_14030 1367 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3350 1377 gene locus_tag LOCUS_14040 3350 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4916 3450 gene locus_tag LOCUS_14050 gene galK 4916 3450 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367650.1 protein_id gnl|my_center|LOCUS_14050 6775 5168 gene locus_tag LOCUS_14060 6775 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8140 6842 gene locus_tag LOCUS_14070 8140 6842 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_14070 10154 8268 gene locus_tag LOCUS_14080 10154 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 9621 9542 gene locus_tag LOCUS_t00070 9621 9542 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 10459 11586 gene locus_tag LOCUS_14090 gene ogl 10459 11586 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210841.1 protein_id gnl|my_center|LOCUS_14090 12314 11625 gene locus_tag LOCUS_14100 12314 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 12381 13436 gene locus_tag LOCUS_14110 12381 13436 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_14110 14439 13474 gene locus_tag LOCUS_14120 14439 13474 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_14120 15469 14486 gene locus_tag LOCUS_14130 15469 14486 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_14130 18070 15494 gene locus_tag LOCUS_14140 18070 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 18697 18137 gene locus_tag LOCUS_14150 gene rsmD 18697 18137 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14150 20395 19088 gene locus_tag LOCUS_14160 20395 19088 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_14160 20726 21595 gene locus_tag LOCUS_14170 20726 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 21701 21982 gene locus_tag LOCUS_14180 21701 21982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 21972 23057 gene locus_tag LOCUS_14190 21972 23057 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_14190 23148 23858 gene locus_tag LOCUS_14200 23148 23858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_14200 23860 24627 gene locus_tag LOCUS_14210 23860 24627 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_14210 24646 25761 gene locus_tag LOCUS_14220 gene gguB 24646 25761 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_14220 26340 28100 gene locus_tag LOCUS_14230 26340 28100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 28659 28417 gene locus_tag LOCUS_14240 28659 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 28728 29345 gene locus_tag LOCUS_14250 28728 29345 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14250 29462 33049 gene locus_tag LOCUS_14260 gene smc 29462 33049 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_14260 33090 34052 gene locus_tag LOCUS_14270 33090 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 36965 34224 gene locus_tag LOCUS_14280 gene recG 36965 34224 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_14280 38280 36949 gene locus_tag LOCUS_14290 38280 36949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 38843 38346 gene locus_tag LOCUS_14300 38843 38346 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263523.1 protein_id gnl|my_center|LOCUS_14300 40069 39059 gene locus_tag LOCUS_14310 40069 39059 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 protein_id gnl|my_center|LOCUS_14310 41330 40194 gene locus_tag LOCUS_14320 gene solA 41330 40194 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_14320 42148 41387 gene locus_tag LOCUS_14330 42148 41387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 43049 42162 gene locus_tag LOCUS_14340 43049 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 44663 43107 gene locus_tag LOCUS_14350 44663 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 46783 44660 gene locus_tag LOCUS_14360 46783 44660 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_14360 47201 46854 gene locus_tag LOCUS_14370 47201 46854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 47664 47194 gene locus_tag LOCUS_14380 47664 47194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 47850 47698 gene locus_tag LOCUS_14390 47850 47698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 48308 47868 gene locus_tag LOCUS_14400 48308 47868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 48828 48292 gene locus_tag LOCUS_14410 48828 48292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 51705 49024 gene locus_tag LOCUS_14420 51705 49024 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_14420 51814 52164 gene locus_tag LOCUS_14430 51814 52164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 53088 52750 gene locus_tag LOCUS_14440 53088 52750 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_14440 54802 53387 gene locus_tag LOCUS_14450 gene glnA 54802 53387 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_14450 55703 55110 gene locus_tag LOCUS_14460 gene dcd 55703 55110 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_14460 56981 55806 gene locus_tag LOCUS_14470 56981 55806 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085032097.1 protein_id gnl|my_center|LOCUS_14470 57590 57183 gene locus_tag LOCUS_14480 57590 57183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 58425 57592 gene locus_tag LOCUS_14490 gene larE 58425 57592 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_14490 59033 58443 gene locus_tag LOCUS_14500 gene def 59033 58443 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_14500 60833 59250 gene locus_tag LOCUS_14510 60833 59250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994508.1 protein_id gnl|my_center|LOCUS_14510 61895 60843 gene locus_tag LOCUS_14520 61895 60843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 62559 62840 gene locus_tag LOCUS_14530 62559 62840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 62837 63169 gene locus_tag LOCUS_14540 62837 63169 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973340.1 protein_id gnl|my_center|LOCUS_14540 63201 64130 gene locus_tag LOCUS_14550 63201 64130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 64164 64973 gene locus_tag LOCUS_14560 64164 64973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 64988 66091 gene locus_tag LOCUS_14570 64988 66091 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_14570 66130 66918 gene locus_tag LOCUS_14580 66130 66918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031328.1 protein_id gnl|my_center|LOCUS_14580 67753 66923 gene locus_tag LOCUS_14590 67753 66923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 67900 68127 gene locus_tag LOCUS_14600 67900 68127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 69766 68294 gene locus_tag LOCUS_14610 69766 68294 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_14610 70922 69804 gene locus_tag LOCUS_14620 70922 69804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 71894 71037 gene locus_tag LOCUS_14630 71894 71037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 73294 72236 gene locus_tag LOCUS_14640 73294 72236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence019 1206 202 gene locus_tag LOCUS_14650 1206 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1872 1270 gene locus_tag LOCUS_14660 1872 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3153 1876 gene locus_tag LOCUS_14670 3153 1876 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_14670 6476 3249 gene locus_tag LOCUS_14680 6476 3249 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_14680 7471 6692 gene locus_tag LOCUS_14690 7471 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7688 8962 gene locus_tag LOCUS_14700 7688 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 9381 9698 gene locus_tag LOCUS_14710 9381 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 9692 10063 gene locus_tag LOCUS_14720 gene mazF 9692 10063 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_14720 10267 10968 gene locus_tag LOCUS_14730 10267 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14730 10952 12451 gene locus_tag LOCUS_14740 10952 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 12696 13016 gene locus_tag LOCUS_14750 12696 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 13020 14897 gene locus_tag LOCUS_14760 13020 14897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 15678 14908 gene locus_tag LOCUS_14770 15678 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 16826 15690 gene locus_tag LOCUS_14780 16826 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 17562 16837 gene locus_tag LOCUS_14790 17562 16837 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105010.1 protein_id gnl|my_center|LOCUS_14790 17790 20123 gene locus_tag LOCUS_14800 17790 20123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 20272 22191 gene locus_tag LOCUS_14810 20272 22191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 26069 22209 gene locus_tag LOCUS_14820 26069 22209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 27265 26087 gene locus_tag LOCUS_14830 27265 26087 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_14830 28027 27284 gene locus_tag LOCUS_14840 28027 27284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 30106 28040 gene locus_tag LOCUS_14850 30106 28040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 30881 30072 gene locus_tag LOCUS_14860 gene dapB 30881 30072 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_14860 31896 31006 gene locus_tag LOCUS_14870 gene lipA 31896 31006 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_14870 32019 31926 gene locus_tag LOCUS_t00080 32019 31926 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 33988 32054 gene locus_tag LOCUS_14880 gene selB 33988 32054 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_14880 34767 33988 gene locus_tag LOCUS_14890 gene lepB 34767 33988 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_14890 35369 35067 gene locus_tag LOCUS_14900 35369 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 36629 35397 gene locus_tag LOCUS_14910 36629 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 37218 36658 gene locus_tag LOCUS_14920 gene lepB 37218 36658 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_14920 39013 37391 gene locus_tag LOCUS_14930 39013 37391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 40682 39243 gene locus_tag LOCUS_14940 40682 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 42202 40829 gene locus_tag LOCUS_14950 42202 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 44057 42252 gene locus_tag LOCUS_14960 gene lepA 44057 42252 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_14960 44766 44164 gene locus_tag LOCUS_14970 44766 44164 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_14970 45942 44800 gene locus_tag LOCUS_14980 gene phnA 45942 44800 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061791.1 protein_id gnl|my_center|LOCUS_14980 46256 47362 gene locus_tag LOCUS_14990 46256 47362 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 protein_id gnl|my_center|LOCUS_14990 48826 47729 gene locus_tag LOCUS_15000 48826 47729 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_15000 49096 49974 gene locus_tag LOCUS_15010 gene argB 49096 49974 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_15010 49978 51159 gene locus_tag LOCUS_15020 49978 51159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 51186 51575 gene locus_tag LOCUS_15030 51186 51575 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_15030 51986 52612 gene locus_tag LOCUS_15040 51986 52612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 52650 53588 gene locus_tag LOCUS_15050 52650 53588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15050 53560 54594 gene locus_tag LOCUS_15060 53560 54594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15060 54587 57193 gene locus_tag LOCUS_15070 54587 57193 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_15070 57262 58281 gene locus_tag LOCUS_15080 57262 58281 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_15080 58294 58500 gene locus_tag LOCUS_15090 58294 58500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 59878 61827 gene locus_tag LOCUS_15100 59878 61827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15100 61885 63951 gene locus_tag LOCUS_15110 61885 63951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 64007 66118 gene locus_tag LOCUS_15120 64007 66118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 66176 68389 gene locus_tag LOCUS_15130 66176 68389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 68541 70517 gene locus_tag LOCUS_15140 68541 70517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 70537 71451 gene locus_tag LOCUS_15150 70537 71451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence020 1223 171 gene locus_tag LOCUS_15160 1223 171 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_15160 1456 3156 gene locus_tag LOCUS_15170 gene shc 1456 3156 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_15170 3301 3972 gene locus_tag LOCUS_15180 3301 3972 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_15180 4901 4029 gene locus_tag LOCUS_15190 4901 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8953 6089 gene locus_tag LOCUS_15200 8953 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 12315 9454 gene locus_tag LOCUS_15210 12315 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 13805 12447 gene locus_tag LOCUS_15220 13805 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 15637 13865 gene locus_tag LOCUS_15230 15637 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 17291 15678 gene locus_tag LOCUS_15240 17291 15678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 18182 17304 gene locus_tag LOCUS_15250 18182 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 18634 18227 gene locus_tag LOCUS_15260 18634 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 19313 18642 gene locus_tag LOCUS_15270 19313 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 19761 19303 gene locus_tag LOCUS_15280 gene gspG 19761 19303 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_15280 21112 19889 gene locus_tag LOCUS_15290 21112 19889 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_15290 23059 21179 gene locus_tag LOCUS_15300 23059 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 23648 24616 gene locus_tag LOCUS_15310 gene rpoD 23648 24616 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_15310 24639 25253 gene locus_tag LOCUS_15320 gene nfuA 24639 25253 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_15320 25301 25813 gene locus_tag LOCUS_15330 25301 25813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 26926 25925 gene locus_tag LOCUS_15340 26926 25925 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065872.1 protein_id gnl|my_center|LOCUS_15340 27590 26910 gene locus_tag LOCUS_15350 27590 26910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_15350 29805 27847 gene locus_tag LOCUS_15360 29805 27847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 31142 29808 gene locus_tag LOCUS_15370 31142 29808 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_15370 32014 33681 gene locus_tag LOCUS_15380 32014 33681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 33674 35122 gene locus_tag LOCUS_15390 33674 35122 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_15390 35150 35752 gene locus_tag LOCUS_15400 35150 35752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 35852 36058 gene locus_tag LOCUS_15410 35852 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 36055 36327 gene locus_tag LOCUS_15420 36055 36327 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414602.1 protein_id gnl|my_center|LOCUS_15420 37899 36409 gene locus_tag LOCUS_15430 37899 36409 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_15430 38255 37911 gene locus_tag LOCUS_15440 38255 37911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 38701 38327 gene locus_tag LOCUS_15450 38701 38327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 40053 39094 gene locus_tag LOCUS_15460 gene hflC 40053 39094 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_15460 41042 40095 gene locus_tag LOCUS_15470 gene hflK 41042 40095 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_15470 42057 41074 gene locus_tag LOCUS_15480 42057 41074 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_15480 43751 42129 gene locus_tag LOCUS_15490 43751 42129 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_15490 45055 43796 gene locus_tag LOCUS_15500 45055 43796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 46428 45082 gene locus_tag LOCUS_15510 46428 45082 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_15510 47047 48396 gene locus_tag LOCUS_15520 47047 48396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 48576 49103 gene locus_tag LOCUS_15530 48576 49103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 49428 49871 gene locus_tag LOCUS_15540 gene rplM 49428 49871 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_15540 49880 50275 gene locus_tag LOCUS_15550 gene rpsI 49880 50275 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943504.1 protein_id gnl|my_center|LOCUS_15550 50335 51615 gene locus_tag LOCUS_15560 50335 51615 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_15560 51712 51787 gene locus_tag LOCUS_t00090 51712 51787 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 51796 51870 gene locus_tag LOCUS_t00100 51796 51870 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 52416 51958 gene locus_tag LOCUS_15570 52416 51958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 54830 52440 gene locus_tag LOCUS_15580 54830 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 57336 54913 gene locus_tag LOCUS_15590 57336 54913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 57979 57500 gene locus_tag LOCUS_15600 57979 57500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 59891 58200 gene locus_tag LOCUS_15610 59891 58200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 60941 60204 gene locus_tag LOCUS_15620 60941 60204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 62844 61357 gene locus_tag LOCUS_15630 gene gltX 62844 61357 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_15630 64574 62841 gene locus_tag LOCUS_15640 64574 62841 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_15640 64753 64956 gene locus_tag LOCUS_15650 64753 64956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 66282 65032 gene locus_tag LOCUS_15660 66282 65032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 67843 66428 gene locus_tag LOCUS_15670 gene glmM 67843 66428 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_15670 68663 67872 gene locus_tag LOCUS_15680 68663 67872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 69321 68665 gene locus_tag LOCUS_15690 69321 68665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 69476 70546 gene locus_tag LOCUS_15700 69476 70546 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_15700 70583 71419 gene locus_tag LOCUS_15710 70583 71419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence021 397 3267 gene locus_tag LOCUS_15720 397 3267 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_15720 3702 4334 gene locus_tag LOCUS_15730 3702 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4457 5083 gene locus_tag LOCUS_15740 4457 5083 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_15740 5285 7948 gene locus_tag LOCUS_15750 gene alaS 5285 7948 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_15750 8019 8669 gene locus_tag LOCUS_15760 8019 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8805 9215 gene locus_tag LOCUS_15770 8805 9215 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546034.1 protein_id gnl|my_center|LOCUS_15770 9379 10182 gene locus_tag LOCUS_15780 gene larB 9379 10182 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964094.1 protein_id gnl|my_center|LOCUS_15780 10364 11914 gene locus_tag LOCUS_15790 10364 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11944 12144 gene locus_tag LOCUS_15800 11944 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 12155 13738 gene locus_tag LOCUS_15810 12155 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 13766 14500 gene locus_tag LOCUS_15820 13766 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 14675 15400 gene locus_tag LOCUS_15830 14675 15400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_15830 15403 16974 gene locus_tag LOCUS_15840 15403 16974 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_15840 16971 18827 gene locus_tag LOCUS_15850 16971 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 18890 20098 gene locus_tag LOCUS_15860 18890 20098 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762377.1 protein_id gnl|my_center|LOCUS_15860 20259 20669 gene locus_tag LOCUS_15870 gene msrB 20259 20669 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144007.1 protein_id gnl|my_center|LOCUS_15870 20758 21978 gene locus_tag LOCUS_15880 20758 21978 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_15880 22015 22878 gene locus_tag LOCUS_15890 22015 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 23237 23470 gene locus_tag LOCUS_15900 23237 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 23517 24482 gene locus_tag LOCUS_15910 23517 24482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 24484 24804 gene locus_tag LOCUS_15920 24484 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 24801 25034 gene locus_tag LOCUS_15930 24801 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 25070 26206 gene locus_tag LOCUS_15940 25070 26206 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_15940 27246 26203 gene locus_tag LOCUS_15950 27246 26203 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_15950 27513 27250 gene locus_tag LOCUS_15960 27513 27250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 27733 29919 gene locus_tag LOCUS_15970 27733 29919 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_15970 30090 30452 gene locus_tag LOCUS_15980 30090 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 30427 30624 gene locus_tag LOCUS_15990 30427 30624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 31611 30760 gene locus_tag LOCUS_16000 31611 30760 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_16000 32200 32997 gene locus_tag LOCUS_16010 32200 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 33271 34098 gene locus_tag LOCUS_16020 33271 34098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 35030 34242 gene locus_tag LOCUS_16030 35030 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 36021 35230 gene locus_tag LOCUS_16040 36021 35230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 36418 36071 gene locus_tag LOCUS_16050 36418 36071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 36844 37866 gene locus_tag LOCUS_16060 gene tsaD 36844 37866 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_16060 37881 38507 gene locus_tag LOCUS_16070 37881 38507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 38477 39061 gene locus_tag LOCUS_16080 38477 39061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 39196 39954 gene locus_tag LOCUS_16090 39196 39954 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392722.1 protein_id gnl|my_center|LOCUS_16090 40088 42001 gene locus_tag LOCUS_16100 40088 42001 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_16100 42027 43019 gene locus_tag LOCUS_16110 42027 43019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 43003 43539 gene locus_tag LOCUS_16120 43003 43539 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867677.1 protein_id gnl|my_center|LOCUS_16120 43541 44749 gene locus_tag LOCUS_16130 43541 44749 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_16130 45220 44948 gene locus_tag LOCUS_16140 45220 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 46818 45364 gene locus_tag LOCUS_16150 46818 45364 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_16150 48020 46848 gene locus_tag LOCUS_16160 48020 46848 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968364.1 protein_id gnl|my_center|LOCUS_16160 48954 48040 gene locus_tag LOCUS_16170 48954 48040 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_16170 49477 49025 gene locus_tag LOCUS_16180 49477 49025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 50077 49511 gene locus_tag LOCUS_16190 50077 49511 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_16190 50745 50179 gene locus_tag LOCUS_16200 50745 50179 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_16200 53553 50920 gene locus_tag LOCUS_16210 gene ppdK 53553 50920 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_16210 53872 53726 gene locus_tag LOCUS_16220 53872 53726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 53906 54178 gene locus_tag LOCUS_16230 53906 54178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 55093 54653 gene locus_tag LOCUS_16240 55093 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 55363 55094 gene locus_tag LOCUS_16250 55363 55094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 56866 55505 gene locus_tag LOCUS_16260 gene pafA 56866 55505 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_16260 57566 56856 gene locus_tag LOCUS_16270 gene prcA 57566 56856 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895345.1 protein_id gnl|my_center|LOCUS_16270 58391 57606 gene locus_tag LOCUS_16280 gene prcB 58391 57606 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_16280 58591 58394 gene locus_tag LOCUS_16290 58591 58394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 60155 58674 gene locus_tag LOCUS_16300 gene dop 60155 58674 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_16300 62002 60206 gene locus_tag LOCUS_16310 gene arc 62002 60206 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_16310 63314 62166 gene locus_tag LOCUS_16320 gene recA 63314 62166 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_16320 63897 63304 gene locus_tag LOCUS_16330 gene thpR 63897 63304 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_16330 64521 63934 gene locus_tag LOCUS_16340 gene pgsA 64521 63934 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_16340 65242 64526 gene locus_tag LOCUS_16350 65242 64526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 65725 65333 gene locus_tag LOCUS_16360 65725 65333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 65876 69550 gene locus_tag LOCUS_16370 gene metH 65876 69550 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence022 1051 119 gene locus_tag LOCUS_16380 1051 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2679 2242 gene locus_tag LOCUS_16390 2679 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3198 2722 gene locus_tag LOCUS_16400 3198 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4024 6141 gene locus_tag LOCUS_16410 4024 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 10183 6155 gene locus_tag LOCUS_16420 10183 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11103 10204 gene locus_tag LOCUS_16430 11103 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11753 11136 gene locus_tag LOCUS_16440 11753 11136 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_16440 12037 14292 gene locus_tag LOCUS_16450 12037 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 14289 15731 gene locus_tag LOCUS_16460 14289 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 16822 15854 gene locus_tag LOCUS_16470 16822 15854 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_16470 17117 18541 gene locus_tag LOCUS_16480 17117 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 18560 18712 gene locus_tag LOCUS_16490 18560 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 18722 20176 gene locus_tag LOCUS_16500 18722 20176 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_16500 20266 21087 gene locus_tag LOCUS_16510 20266 21087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 21171 23648 gene locus_tag LOCUS_16520 21171 23648 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_16520 23719 25164 gene locus_tag LOCUS_16530 23719 25164 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_16530 25478 26389 gene locus_tag LOCUS_16540 25478 26389 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_16540 26515 28998 gene locus_tag LOCUS_16550 26515 28998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 29456 31297 gene locus_tag LOCUS_16560 29456 31297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_16560 31549 32049 gene locus_tag LOCUS_16570 31549 32049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 32104 32877 gene locus_tag LOCUS_16580 32104 32877 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_16580 32957 33823 gene locus_tag LOCUS_16590 32957 33823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 33907 37050 gene locus_tag LOCUS_16600 33907 37050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 37087 37443 gene locus_tag LOCUS_16610 37087 37443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 37544 38308 gene locus_tag LOCUS_16620 37544 38308 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922236.1 protein_id gnl|my_center|LOCUS_16620 38438 40294 gene locus_tag LOCUS_16630 38438 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 40310 41845 gene locus_tag LOCUS_16640 40310 41845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 41874 42656 gene locus_tag LOCUS_16650 41874 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 42659 44389 gene locus_tag LOCUS_16660 42659 44389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 44505 45302 gene locus_tag LOCUS_16670 44505 45302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 45309 46226 gene locus_tag LOCUS_16680 45309 46226 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123496.1 protein_id gnl|my_center|LOCUS_16680 46240 47019 gene locus_tag LOCUS_16690 46240 47019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_16690 47101 48006 gene locus_tag LOCUS_16700 47101 48006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 48082 50043 gene locus_tag LOCUS_16710 gene ctaD 48082 50043 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_16710 50101 51036 gene locus_tag LOCUS_16720 50101 51036 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_16720 51047 51982 gene locus_tag LOCUS_16730 gene cyoE 51047 51982 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_16730 51993 52247 gene locus_tag LOCUS_16740 51993 52247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 52268 52864 gene locus_tag LOCUS_16750 52268 52864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 52876 53094 gene locus_tag LOCUS_16760 52876 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 53269 54138 gene locus_tag LOCUS_16770 53269 54138 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_16770 54251 54901 gene locus_tag LOCUS_16780 54251 54901 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394318.1 protein_id gnl|my_center|LOCUS_16780 54914 55252 gene locus_tag LOCUS_16790 54914 55252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 55292 55921 gene locus_tag LOCUS_16800 55292 55921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 56216 58126 gene locus_tag LOCUS_16810 56216 58126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 58231 58707 gene locus_tag LOCUS_16820 58231 58707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 58759 59187 gene locus_tag LOCUS_16830 58759 59187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 59209 60483 gene locus_tag LOCUS_16840 59209 60483 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_16840 60480 61361 gene locus_tag LOCUS_16850 60480 61361 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_16850 61399 61917 gene locus_tag LOCUS_16860 61399 61917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 61972 62385 gene locus_tag LOCUS_16870 61972 62385 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_16870 62391 62726 gene locus_tag LOCUS_16880 62391 62726 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_16880 62747 63205 gene locus_tag LOCUS_16890 62747 63205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 63206 64510 gene locus_tag LOCUS_16900 gene ahbD 63206 64510 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_16900 64562 65281 gene locus_tag LOCUS_16910 64562 65281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 65291 65704 gene locus_tag LOCUS_16920 65291 65704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 65844 66032 gene locus_tag LOCUS_16930 65844 66032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 66051 66425 gene locus_tag LOCUS_16940 66051 66425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16940 66460 66834 gene locus_tag LOCUS_16950 66460 66834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 66831 67265 gene locus_tag LOCUS_16960 66831 67265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 67278 67904 gene locus_tag LOCUS_16970 67278 67904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16970 67909 68256 gene locus_tag LOCUS_16980 67909 68256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence023 217 1245 gene locus_tag LOCUS_16990 217 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1261 2043 gene locus_tag LOCUS_17000 1261 2043 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_17000 3106 2048 gene locus_tag LOCUS_17010 3106 2048 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_17010 3698 3147 gene locus_tag LOCUS_17020 3698 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4185 5528 gene locus_tag LOCUS_17030 4185 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 5541 6947 gene locus_tag LOCUS_17040 5541 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7268 7681 gene locus_tag LOCUS_17050 7268 7681 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_17050 7686 8093 gene locus_tag LOCUS_17060 7686 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 10198 8099 gene locus_tag LOCUS_17070 gene fusA 10198 8099 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_17070 12936 10231 gene locus_tag LOCUS_17080 12936 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 13296 13063 gene locus_tag LOCUS_17090 13296 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 15701 13473 gene locus_tag LOCUS_17100 15701 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15895 15698 gene locus_tag LOCUS_17110 15895 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 17422 16421 gene locus_tag LOCUS_17120 17422 16421 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404258.1 protein_id gnl|my_center|LOCUS_17120 19096 17558 gene locus_tag LOCUS_17130 gene htrA 19096 17558 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872209.1 protein_id gnl|my_center|LOCUS_17130 19562 19209 gene locus_tag LOCUS_17140 19562 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 19691 20458 gene locus_tag LOCUS_17150 19691 20458 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_17150 20610 20683 gene locus_tag LOCUS_t00110 20610 20683 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20769 22091 gene locus_tag LOCUS_17160 20769 22091 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_17160 22109 22732 gene locus_tag LOCUS_17170 22109 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 23001 23990 gene locus_tag LOCUS_17180 23001 23990 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_17180 24112 24999 gene locus_tag LOCUS_17190 gene fabD 24112 24999 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_17190 25000 25776 gene locus_tag LOCUS_17200 gene fabG 25000 25776 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_17200 25947 26180 gene locus_tag LOCUS_17210 gene acpP 25947 26180 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_17210 26260 27498 gene locus_tag LOCUS_17220 gene fabF 26260 27498 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_17220 27539 28048 gene locus_tag LOCUS_17230 gene folK 27539 28048 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948528.1 protein_id gnl|my_center|LOCUS_17230 28113 29714 gene locus_tag LOCUS_17240 28113 29714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 29821 30474 gene locus_tag LOCUS_17250 29821 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 30555 31412 gene locus_tag LOCUS_17260 gene legD1 30555 31412 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_17260 31435 32412 gene locus_tag LOCUS_17270 31435 32412 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_17270 32444 33307 gene locus_tag LOCUS_17280 32444 33307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 33307 34158 gene locus_tag LOCUS_17290 33307 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 34496 36247 gene locus_tag LOCUS_17300 34496 36247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 37687 36611 gene locus_tag LOCUS_17310 37687 36611 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_17310 37823 39010 gene locus_tag LOCUS_17320 37823 39010 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_17320 39518 40186 gene locus_tag LOCUS_17330 39518 40186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 40282 41112 gene locus_tag LOCUS_17340 40282 41112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 41189 42226 gene locus_tag LOCUS_17350 41189 42226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 42307 43332 gene locus_tag LOCUS_17360 42307 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 43405 45660 gene locus_tag LOCUS_17370 43405 45660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 45671 46720 gene locus_tag LOCUS_17380 45671 46720 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_17380 47851 46766 gene locus_tag LOCUS_17390 47851 46766 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_17390 49034 47949 gene locus_tag LOCUS_17400 49034 47949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_17400 51074 49167 gene locus_tag LOCUS_17410 51074 49167 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_17410 52291 51122 gene locus_tag LOCUS_17420 gene xylA 52291 51122 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_17420 53683 52361 gene locus_tag LOCUS_17430 gene thrC 53683 52361 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_17430 54312 53683 gene locus_tag LOCUS_17440 gene scpB 54312 53683 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_17440 55111 54335 gene locus_tag LOCUS_17450 55111 54335 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_17450 55834 55145 gene locus_tag LOCUS_17460 55834 55145 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_17460 57322 55868 gene locus_tag LOCUS_17470 57322 55868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 58050 57370 gene locus_tag LOCUS_17480 58050 57370 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_17480 58362 61163 gene locus_tag LOCUS_17490 58362 61163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 61288 62325 gene locus_tag LOCUS_17500 61288 62325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_17500 62353 62688 gene locus_tag LOCUS_17510 62353 62688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 63050 63934 gene locus_tag LOCUS_17520 63050 63934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 64749 63976 gene locus_tag LOCUS_17530 gene hisN 64749 63976 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 protein_id gnl|my_center|LOCUS_17530 65202 64768 gene locus_tag LOCUS_17540 65202 64768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 66418 65189 gene locus_tag LOCUS_17550 66418 65189 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_17550 67241 66525 gene locus_tag LOCUS_17560 67241 66525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence024 223 618 gene locus_tag LOCUS_17570 223 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 694 2097 gene locus_tag LOCUS_17580 gene leuC 694 2097 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_17580 2174 2380 gene locus_tag LOCUS_17590 2174 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2380 2784 gene locus_tag LOCUS_17600 2380 2784 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_17600 2849 3439 gene locus_tag LOCUS_17610 gene leuD 2849 3439 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_17610 3534 3794 gene locus_tag LOCUS_17620 3534 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3976 4776 gene locus_tag LOCUS_17630 3976 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4792 5661 gene locus_tag LOCUS_17640 4792 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5809 6093 gene locus_tag LOCUS_17650 5809 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 6307 7101 gene locus_tag LOCUS_17660 6307 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 7117 7923 gene locus_tag LOCUS_17670 7117 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 7886 8677 gene locus_tag LOCUS_17680 7886 8677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8693 9124 gene locus_tag LOCUS_17690 8693 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 9197 9859 gene locus_tag LOCUS_17700 9197 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 9861 10646 gene locus_tag LOCUS_17710 9861 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 10662 11399 gene locus_tag LOCUS_17720 10662 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 11401 12174 gene locus_tag LOCUS_17730 11401 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 12232 12987 gene locus_tag LOCUS_17740 12232 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 12995 13744 gene locus_tag LOCUS_17750 12995 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 13760 14542 gene locus_tag LOCUS_17760 13760 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 14616 15074 gene locus_tag LOCUS_17770 14616 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 15091 15747 gene locus_tag LOCUS_17780 gene gmk 15091 15747 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_17780 15763 16962 gene locus_tag LOCUS_17790 gene coaBC 15763 16962 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_17790 17036 17872 gene locus_tag LOCUS_17800 gene rsmA 17036 17872 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_17800 18895 17855 gene locus_tag LOCUS_17810 18895 17855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 18971 19186 gene locus_tag LOCUS_17820 gene rpmB 18971 19186 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_17820 21322 19190 gene locus_tag LOCUS_17830 21322 19190 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_17830 23855 21288 gene locus_tag LOCUS_17840 23855 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 26393 24243 gene locus_tag LOCUS_17850 26393 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 30387 27391 gene locus_tag LOCUS_17860 30387 27391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 31571 30621 gene locus_tag LOCUS_17870 31571 30621 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_17870 33178 31658 gene locus_tag LOCUS_17880 33178 31658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 34286 33204 gene locus_tag LOCUS_17890 34286 33204 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_17890 35172 34276 gene locus_tag LOCUS_17900 35172 34276 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_17900 35945 35292 gene locus_tag LOCUS_17910 35945 35292 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_17910 36726 35869 gene locus_tag LOCUS_17920 36726 35869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 38046 36784 gene locus_tag LOCUS_17930 38046 36784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 38061 38270 gene locus_tag LOCUS_17940 38061 38270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 38662 39291 gene locus_tag LOCUS_17950 gene tmk 38662 39291 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_17950 39328 40290 gene locus_tag LOCUS_17960 gene holB 39328 40290 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_17960 40316 41266 gene locus_tag LOCUS_17970 40316 41266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 41267 43645 gene locus_tag LOCUS_17980 41267 43645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 43662 44195 gene locus_tag LOCUS_17990 43662 44195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 44281 45309 gene locus_tag LOCUS_18000 44281 45309 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224004.1 protein_id gnl|my_center|LOCUS_18000 45405 46331 gene locus_tag LOCUS_18010 45405 46331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 46310 48094 gene locus_tag LOCUS_18020 46310 48094 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_18020 48209 49087 gene locus_tag LOCUS_18030 48209 49087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 49150 49767 gene locus_tag LOCUS_18040 gene rpoE 49150 49767 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_18040 50891 49890 gene locus_tag LOCUS_18050 gene ftsY 50891 49890 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_18050 51685 51020 gene locus_tag LOCUS_18060 51685 51020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 52096 52449 gene locus_tag LOCUS_18070 52096 52449 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_18070 52446 55169 gene locus_tag LOCUS_18080 52446 55169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 55324 56928 gene locus_tag LOCUS_18090 55324 56928 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_18090 57227 57733 gene locus_tag LOCUS_18100 57227 57733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 58900 57803 gene locus_tag LOCUS_18110 58900 57803 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_18110 60531 58927 gene locus_tag LOCUS_18120 60531 58927 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_18120 60672 61475 gene locus_tag LOCUS_18130 60672 61475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 61705 62598 gene locus_tag LOCUS_18140 61705 62598 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_18140 62894 63670 gene locus_tag LOCUS_18150 62894 63670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 63995 64627 gene locus_tag LOCUS_18160 63995 64627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 65293 64700 gene locus_tag LOCUS_18170 65293 64700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence025 2142 535 gene locus_tag LOCUS_18180 gene rpoD 2142 535 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_18180 2986 2450 gene locus_tag LOCUS_18190 2986 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4853 3009 gene locus_tag LOCUS_18200 gene dnaG 4853 3009 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_18200 7330 4901 gene locus_tag LOCUS_18210 7330 4901 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_18210 8905 7880 gene locus_tag LOCUS_18220 8905 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 10055 8898 gene locus_tag LOCUS_18230 10055 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 10156 10083 gene locus_tag LOCUS_t00120 10156 10083 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10719 10255 gene locus_tag LOCUS_18240 10719 10255 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_18240 11475 12776 gene locus_tag LOCUS_18250 11475 12776 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_18250 12790 14106 gene locus_tag LOCUS_18260 12790 14106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_18260 14352 16241 gene locus_tag LOCUS_18270 14352 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 17198 16404 gene locus_tag LOCUS_18280 17198 16404 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_18280 17164 17988 gene locus_tag LOCUS_18290 17164 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 19277 18018 gene locus_tag LOCUS_18300 19277 18018 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870020.1 protein_id gnl|my_center|LOCUS_18300 19494 20072 gene locus_tag LOCUS_18310 19494 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 20094 21932 gene locus_tag LOCUS_18320 20094 21932 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_18320 22031 22300 gene locus_tag LOCUS_18330 22031 22300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_18330 22349 22675 gene locus_tag LOCUS_18340 22349 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 22702 23070 gene locus_tag LOCUS_18350 22702 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 23067 23555 gene locus_tag LOCUS_18360 23067 23555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 23658 24140 gene locus_tag LOCUS_18370 23658 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 25142 24252 gene locus_tag LOCUS_18380 25142 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 26361 25153 gene locus_tag LOCUS_18390 26361 25153 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_18390 26632 27639 gene locus_tag LOCUS_18400 26632 27639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 27593 28372 gene locus_tag LOCUS_18410 27593 28372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 28652 29485 gene locus_tag LOCUS_18420 28652 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 30282 29482 gene locus_tag LOCUS_18430 30282 29482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 30480 31694 gene locus_tag LOCUS_18440 30480 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 31861 32664 gene locus_tag LOCUS_18450 31861 32664 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969658.1 protein_id gnl|my_center|LOCUS_18450 33516 32719 gene locus_tag LOCUS_18460 33516 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 35862 33952 gene locus_tag LOCUS_18470 35862 33952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 37486 36026 gene locus_tag LOCUS_18480 37486 36026 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_18480 37814 40792 gene locus_tag LOCUS_18490 37814 40792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 42294 44873 gene locus_tag LOCUS_18500 42294 44873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 44893 46791 gene locus_tag LOCUS_18510 44893 46791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 47498 47671 gene locus_tag LOCUS_18520 47498 47671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 47715 55106 gene locus_tag LOCUS_18530 47715 55106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 56103 56825 gene locus_tag LOCUS_18540 56103 56825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 57141 58136 gene locus_tag LOCUS_18550 57141 58136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 58296 60218 gene locus_tag LOCUS_18560 gene dnaK 58296 60218 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_18560 60258 60551 gene locus_tag LOCUS_18570 60258 60551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 60544 60861 gene locus_tag LOCUS_18580 60544 60861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 60950 61504 gene locus_tag LOCUS_18590 60950 61504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence026 961 2106 gene locus_tag LOCUS_18600 961 2106 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_18600 3268 2198 gene locus_tag LOCUS_18610 3268 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4651 3341 gene locus_tag LOCUS_18620 gene mtaB 4651 3341 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_18620 5384 4665 gene locus_tag LOCUS_18630 5384 4665 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_18630 6086 5415 gene locus_tag LOCUS_18640 gene rpe 6086 5415 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_18640 7094 6111 gene locus_tag LOCUS_18650 7094 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 8095 7094 gene locus_tag LOCUS_18660 gene fmt 8095 7094 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_18660 8769 8206 gene locus_tag LOCUS_18670 8769 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 9341 8853 gene locus_tag LOCUS_18680 gene lspA 9341 8853 CDS product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642185.1 protein_id gnl|my_center|LOCUS_18680 11966 9366 gene locus_tag LOCUS_18690 gene ileS 11966 9366 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020930.1 protein_id gnl|my_center|LOCUS_18690 12314 12048 gene locus_tag LOCUS_18700 12314 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 13151 12336 gene locus_tag LOCUS_18710 gene proC 13151 12336 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404307.1 protein_id gnl|my_center|LOCUS_18710 13912 13190 gene locus_tag LOCUS_18720 13912 13190 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_18720 14255 13944 gene locus_tag LOCUS_18730 14255 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 15351 14578 gene locus_tag LOCUS_18740 gene pgeF 15351 14578 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_18740 15674 15348 gene locus_tag LOCUS_18750 15674 15348 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_18750 16454 15711 gene locus_tag LOCUS_18760 16454 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 17275 16454 gene locus_tag LOCUS_18770 17275 16454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 17502 17296 gene locus_tag LOCUS_18780 17502 17296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 17757 18539 gene locus_tag LOCUS_18790 17757 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 19703 18819 gene locus_tag LOCUS_18800 19703 18819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 20133 19693 gene locus_tag LOCUS_18810 20133 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 20846 20127 gene locus_tag LOCUS_18820 20846 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 21324 20905 gene locus_tag LOCUS_18830 21324 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 22451 21438 gene locus_tag LOCUS_18840 22451 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 23127 22801 gene locus_tag LOCUS_18850 23127 22801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 23622 23263 gene locus_tag LOCUS_18860 23622 23263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 23961 23641 gene locus_tag LOCUS_18870 23961 23641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 25113 24067 gene locus_tag LOCUS_18880 25113 24067 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_18880 25233 26726 gene locus_tag LOCUS_18890 25233 26726 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_18890 26758 27804 gene locus_tag LOCUS_18900 26758 27804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 27842 28321 gene locus_tag LOCUS_18910 27842 28321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136622812.1 protein_id gnl|my_center|LOCUS_18910 28337 29356 gene locus_tag LOCUS_18920 28337 29356 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974245.1 protein_id gnl|my_center|LOCUS_18920 29523 31568 gene locus_tag LOCUS_18930 29523 31568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 31587 32798 gene locus_tag LOCUS_18940 31587 32798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_18940 32862 33578 gene locus_tag LOCUS_18950 32862 33578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528117.1 protein_id gnl|my_center|LOCUS_18950 33616 34719 gene locus_tag LOCUS_18960 33616 34719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 34810 36021 gene locus_tag LOCUS_18970 34810 36021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_18970 36033 36878 gene locus_tag LOCUS_18980 36033 36878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 38121 36907 gene locus_tag LOCUS_18990 38121 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 39338 38274 gene locus_tag LOCUS_19000 39338 38274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 40118 39399 gene locus_tag LOCUS_19010 40118 39399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 41893 40406 gene locus_tag LOCUS_19020 41893 40406 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839239.1 protein_id gnl|my_center|LOCUS_19020 42555 41920 gene locus_tag LOCUS_19030 gene thiE 42555 41920 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 protein_id gnl|my_center|LOCUS_19030 42668 43303 gene locus_tag LOCUS_19040 42668 43303 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_19040 44047 43553 gene locus_tag LOCUS_19050 44047 43553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 45360 44353 gene locus_tag LOCUS_19060 45360 44353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 46144 45503 gene locus_tag LOCUS_19070 46144 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 46799 46182 gene locus_tag LOCUS_19080 46799 46182 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466608.1 protein_id gnl|my_center|LOCUS_19080 49239 47209 gene locus_tag LOCUS_19090 49239 47209 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_19090 50233 49274 gene locus_tag LOCUS_19100 50233 49274 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_19100 51251 50238 gene locus_tag LOCUS_19110 51251 50238 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_19110 51931 52176 gene locus_tag LOCUS_19120 51931 52176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 52360 53004 gene locus_tag LOCUS_19130 52360 53004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 53192 54637 gene locus_tag LOCUS_19140 53192 54637 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_19140 54706 55779 gene locus_tag LOCUS_19150 gene trxB 54706 55779 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722610.1 protein_id gnl|my_center|LOCUS_19150 55840 58668 gene locus_tag LOCUS_19160 gene polA 55840 58668 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922564.1 protein_id gnl|my_center|LOCUS_19160 59059 59352 gene locus_tag LOCUS_19170 59059 59352 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028883.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence027 124 2199 gene locus_tag LOCUS_19180 124 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 5893 2246 gene locus_tag LOCUS_19190 5893 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 6888 5920 gene locus_tag LOCUS_19200 6888 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 7708 7031 gene locus_tag LOCUS_19210 7708 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 8696 7731 gene locus_tag LOCUS_19220 8696 7731 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_19220 10013 8763 gene locus_tag LOCUS_19230 gene galK 10013 8763 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097521.1 protein_id gnl|my_center|LOCUS_19230 10821 10057 gene locus_tag LOCUS_19240 gene accD 10821 10057 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873705.1 protein_id gnl|my_center|LOCUS_19240 11204 10860 gene locus_tag LOCUS_19250 gene spoIIAA 11204 10860 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_19250 12420 12007 gene locus_tag LOCUS_19260 gene rsbW 12420 12007 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829903.1 protein_id gnl|my_center|LOCUS_19260 13905 12655 gene locus_tag LOCUS_19270 13905 12655 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_19270 14579 13983 gene locus_tag LOCUS_19280 14579 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 17328 14770 gene locus_tag LOCUS_19290 17328 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 17708 17373 gene locus_tag LOCUS_19300 17708 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 18477 17794 gene locus_tag LOCUS_19310 gene rsmG 18477 17794 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_19310 20391 18517 gene locus_tag LOCUS_19320 gene mnmG 20391 18517 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_19320 20852 20466 gene locus_tag LOCUS_19330 20852 20466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 21368 21183 gene locus_tag LOCUS_19340 21368 21183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 22441 21536 gene locus_tag LOCUS_19350 22441 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 23446 22487 gene locus_tag LOCUS_19360 23446 22487 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_19360 24112 23549 gene locus_tag LOCUS_19370 gene recR 24112 23549 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_19370 24474 24166 gene locus_tag LOCUS_19380 24474 24166 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_19380 26314 24554 gene locus_tag LOCUS_19390 gene dnaX 26314 24554 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_19390 26864 26773 gene locus_tag LOCUS_t00130 26864 26773 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26952 26880 gene locus_tag LOCUS_t00140 26952 26880 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 27078 26991 gene locus_tag LOCUS_t00150 27078 26991 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27526 27110 gene locus_tag LOCUS_19400 gene tadA 27526 27110 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_19400 27705 27632 gene locus_tag LOCUS_t00160 27705 27632 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27873 27787 gene locus_tag LOCUS_t00170 27873 27787 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27968 27881 gene locus_tag LOCUS_t00180 27968 27881 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29156 28131 gene locus_tag LOCUS_19410 29156 28131 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_19410 29307 29507 gene locus_tag LOCUS_19420 29307 29507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 31710 29827 gene locus_tag LOCUS_19430 31710 29827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_19430 31905 32192 gene locus_tag LOCUS_19440 31905 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 32189 32671 gene locus_tag LOCUS_19450 32189 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 32708 33250 gene locus_tag LOCUS_19460 32708 33250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 33372 34010 gene locus_tag LOCUS_19470 33372 34010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 35519 34080 gene locus_tag LOCUS_19480 35519 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 35989 35519 gene locus_tag LOCUS_19490 35989 35519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 37712 35967 gene locus_tag LOCUS_19500 37712 35967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 38707 37712 gene locus_tag LOCUS_19510 38707 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 38995 39798 gene locus_tag LOCUS_19520 38995 39798 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_19520 39779 40372 gene locus_tag LOCUS_19530 39779 40372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 40541 41569 gene locus_tag LOCUS_19540 40541 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 41621 42520 gene locus_tag LOCUS_19550 gene iolE 41621 42520 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192432.1 protein_id gnl|my_center|LOCUS_19550 42517 43539 gene locus_tag LOCUS_19560 gene iolG 42517 43539 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_19560 44283 43552 gene locus_tag LOCUS_19570 44283 43552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_19570 44997 44320 gene locus_tag LOCUS_19580 44997 44320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 45861 46778 gene locus_tag LOCUS_19590 45861 46778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 48539 46815 gene locus_tag LOCUS_19600 48539 46815 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_19600 49605 48580 gene locus_tag LOCUS_19610 49605 48580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 52177 49622 gene locus_tag LOCUS_19620 gene leuS 52177 49622 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 protein_id gnl|my_center|LOCUS_19620 52516 53961 gene locus_tag LOCUS_19630 52516 53961 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_19630 54353 53994 gene locus_tag LOCUS_19640 54353 53994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 55149 55919 gene locus_tag LOCUS_19650 55149 55919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 56159 56413 gene locus_tag LOCUS_19660 56159 56413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 56719 57093 gene locus_tag LOCUS_19670 56719 57093 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_19670 57118 57474 gene locus_tag LOCUS_19680 57118 57474 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_19680 57569 57931 gene locus_tag LOCUS_19690 57569 57931 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227761.1 protein_id gnl|my_center|LOCUS_19690 57976 58356 gene locus_tag LOCUS_19700 57976 58356 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_19700 58396 58785 gene locus_tag LOCUS_19710 58396 58785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 58903 59259 gene locus_tag LOCUS_19720 58903 59259 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence028 <1 1204 gene locus_tag LOCUS_19730 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 1428 2015 gene locus_tag LOCUS_19740 gene hisB 1428 2015 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_19740 2034 3326 gene locus_tag LOCUS_19750 2034 3326 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_19750 3427 3702 gene locus_tag LOCUS_19760 3427 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3702 4520 gene locus_tag LOCUS_19770 3702 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5403 4648 gene locus_tag LOCUS_19780 5403 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 7066 5567 gene locus_tag LOCUS_19790 7066 5567 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19790 8885 7251 gene locus_tag LOCUS_19800 8885 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 9619 8891 gene locus_tag LOCUS_19810 9619 8891 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_19810 10572 9766 gene locus_tag LOCUS_19820 10572 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 11404 10577 gene locus_tag LOCUS_19830 11404 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 13299 12316 gene locus_tag LOCUS_19840 13299 12316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19840 13951 13442 gene locus_tag LOCUS_19850 13951 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 15059 14166 gene locus_tag LOCUS_19860 15059 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 16457 15111 gene locus_tag LOCUS_19870 16457 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 18032 16494 gene locus_tag LOCUS_19880 18032 16494 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_19880 19298 18273 gene locus_tag LOCUS_19890 19298 18273 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_19890 19774 19373 gene locus_tag LOCUS_19900 19774 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 20221 19853 gene locus_tag LOCUS_19910 20221 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 20914 20282 gene locus_tag LOCUS_19920 20914 20282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 21455 20892 gene locus_tag LOCUS_19930 21455 20892 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_19930 22248 21475 gene locus_tag LOCUS_19940 22248 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 22466 23581 gene locus_tag LOCUS_19950 22466 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 23941 25971 gene locus_tag LOCUS_19960 23941 25971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 25973 26863 gene locus_tag LOCUS_19970 25973 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 26868 27935 gene locus_tag LOCUS_19980 26868 27935 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_19980 29011 27950 gene locus_tag LOCUS_19990 29011 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 29628 29065 gene locus_tag LOCUS_20000 29628 29065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 30233 29625 gene locus_tag LOCUS_20010 30233 29625 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_20010 30502 31071 gene locus_tag LOCUS_20020 30502 31071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 31081 33741 gene locus_tag LOCUS_20030 31081 33741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 34091 35020 gene locus_tag LOCUS_20040 34091 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 35100 35711 gene locus_tag LOCUS_20050 35100 35711 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_20050 35865 36890 gene locus_tag LOCUS_20060 35865 36890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 39558 36877 gene locus_tag LOCUS_20070 39558 36877 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681132.1 protein_id gnl|my_center|LOCUS_20070 40126 41304 gene locus_tag LOCUS_20080 40126 41304 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_20080 44817 41311 gene locus_tag LOCUS_20090 44817 41311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 45105 44824 gene locus_tag LOCUS_20100 45105 44824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 48589 45446 gene locus_tag LOCUS_20110 48589 45446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 50687 48858 gene locus_tag LOCUS_20120 50687 48858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 50901 50752 gene locus_tag LOCUS_20130 50901 50752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 51420 50914 gene locus_tag LOCUS_20140 51420 50914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 53860 51587 gene locus_tag LOCUS_20150 53860 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 55405 57348 gene locus_tag LOCUS_20160 55405 57348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 58197 57358 gene locus_tag LOCUS_20170 58197 57358 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence029 1431 328 gene locus_tag LOCUS_20180 1431 328 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_20180 2114 1434 gene locus_tag LOCUS_20190 2114 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4399 2552 gene locus_tag LOCUS_20200 4399 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5558 4680 gene locus_tag LOCUS_20210 5558 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 7892 6018 gene locus_tag LOCUS_20220 7892 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 8132 8365 gene locus_tag LOCUS_20230 8132 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 9378 8752 gene locus_tag LOCUS_20240 9378 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 11456 9375 gene locus_tag LOCUS_20250 11456 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 11906 11733 gene locus_tag LOCUS_20260 11906 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 14371 12716 gene locus_tag LOCUS_20270 14371 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 15399 14422 gene locus_tag LOCUS_20280 15399 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 16634 15630 gene locus_tag LOCUS_20290 16634 15630 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_20290 17386 18444 gene locus_tag LOCUS_20300 17386 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 20542 18560 gene locus_tag LOCUS_20310 20542 18560 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_20310 21914 20586 gene locus_tag LOCUS_20320 21914 20586 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_20320 23507 22179 gene locus_tag LOCUS_20330 23507 22179 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_20330 24627 23728 gene locus_tag LOCUS_20340 24627 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 24951 25622 gene locus_tag LOCUS_20350 24951 25622 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_20350 25664 26803 gene locus_tag LOCUS_20360 25664 26803 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_20360 26808 27734 gene locus_tag LOCUS_20370 26808 27734 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_20370 27727 28479 gene locus_tag LOCUS_20380 27727 28479 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_20380 28936 29874 gene locus_tag LOCUS_20390 28936 29874 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 protein_id gnl|my_center|LOCUS_20390 29880 30989 gene locus_tag LOCUS_20400 29880 30989 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_20400 31078 31668 gene locus_tag LOCUS_20410 31078 31668 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_20410 31894 32433 gene locus_tag LOCUS_20420 31894 32433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 32578 34959 gene locus_tag LOCUS_20430 32578 34959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 36226 35036 gene locus_tag LOCUS_20440 36226 35036 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_20440 37656 36259 gene locus_tag LOCUS_20450 37656 36259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20450 40207 37670 gene locus_tag LOCUS_20460 40207 37670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 42898 40235 gene locus_tag LOCUS_20470 42898 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 43308 45521 gene locus_tag LOCUS_20480 43308 45521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 45602 46102 gene locus_tag LOCUS_20490 45602 46102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 47515 46334 gene locus_tag LOCUS_20500 47515 46334 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939677.1 protein_id gnl|my_center|LOCUS_20500 48364 47534 gene locus_tag LOCUS_20510 48364 47534 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546167.1 protein_id gnl|my_center|LOCUS_20510 48802 51057 gene locus_tag LOCUS_20520 48802 51057 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_20520 52057 51041 gene locus_tag LOCUS_20530 52057 51041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 52876 52133 gene locus_tag LOCUS_20540 52876 52133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 54591 53953 gene locus_tag LOCUS_20550 54591 53953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20550 54993 54622 gene locus_tag LOCUS_20560 54993 54622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20560 56274 55132 gene locus_tag LOCUS_20570 56274 55132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 57523 56396 gene locus_tag LOCUS_20580 57523 56396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence030 223 540 gene locus_tag LOCUS_20590 223 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 569 1252 gene locus_tag LOCUS_20600 569 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 1249 2835 gene locus_tag LOCUS_20610 1249 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3275 4135 gene locus_tag LOCUS_20620 3275 4135 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_20620 4339 5754 gene locus_tag LOCUS_20630 4339 5754 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_20630 5786 6538 gene locus_tag LOCUS_20640 5786 6538 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_20640 6535 7170 gene locus_tag LOCUS_20650 6535 7170 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_20650 7190 7936 gene locus_tag LOCUS_20660 7190 7936 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_20660 8529 7933 gene locus_tag LOCUS_20670 8529 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 8985 8764 gene locus_tag LOCUS_20680 8985 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 10623 9235 gene locus_tag LOCUS_20690 gene mnmE 10623 9235 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_20690 11341 10715 gene locus_tag LOCUS_20700 11341 10715 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990093.1 protein_id gnl|my_center|LOCUS_20700 13277 11436 gene locus_tag LOCUS_20710 gene yidC 13277 11436 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_20710 14071 13724 gene locus_tag LOCUS_20720 gene rnpA 14071 13724 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_20720 14649 14137 gene locus_tag LOCUS_20730 14649 14137 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_20730 14955 14761 gene locus_tag LOCUS_20740 14955 14761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 16206 15100 gene locus_tag LOCUS_20750 gene thiO 16206 15100 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333314.1 protein_id gnl|my_center|LOCUS_20750 16347 16634 gene locus_tag LOCUS_20760 16347 16634 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_20760 16649 18397 gene locus_tag LOCUS_20770 16649 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 18420 19766 gene locus_tag LOCUS_20780 18420 19766 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_20780 19778 20368 gene locus_tag LOCUS_20790 19778 20368 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964405.1 protein_id gnl|my_center|LOCUS_20790 20613 21170 gene locus_tag LOCUS_20800 20613 21170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 21238 22260 gene locus_tag LOCUS_20810 21238 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 22471 23922 gene locus_tag LOCUS_20820 22471 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 24404 23991 gene locus_tag LOCUS_20830 24404 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 24960 24418 gene locus_tag LOCUS_20840 24960 24418 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_20840 25004 26350 gene locus_tag LOCUS_20850 25004 26350 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_20850 26805 26509 gene locus_tag LOCUS_20860 26805 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 27594 26839 gene locus_tag LOCUS_20870 gene hpaI 27594 26839 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446592.1 protein_id gnl|my_center|LOCUS_20870 28939 27608 gene locus_tag LOCUS_20880 28939 27608 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_20880 29930 29010 gene locus_tag LOCUS_20890 29930 29010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_20890 31053 29932 gene locus_tag LOCUS_20900 gene alr 31053 29932 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_20900 31714 31070 gene locus_tag LOCUS_20910 31714 31070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 32634 31858 gene locus_tag LOCUS_20920 32634 31858 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_20920 33523 32675 gene locus_tag LOCUS_20930 gene potB 33523 32675 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_20930 36521 33513 gene locus_tag LOCUS_20940 36521 33513 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_20940 37054 36536 gene locus_tag LOCUS_20950 37054 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_20950 38403 37054 gene locus_tag LOCUS_20960 38403 37054 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_20960 38947 38429 gene locus_tag LOCUS_20970 38947 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_20970 40281 38947 gene locus_tag LOCUS_20980 40281 38947 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_20980 43012 40331 gene locus_tag LOCUS_20990 43012 40331 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_20990 43548 43303 gene locus_tag LOCUS_21000 43548 43303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21000 44490 43570 gene locus_tag LOCUS_21010 44490 43570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21010 44866 45609 gene locus_tag LOCUS_21020 44866 45609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 46681 45869 gene locus_tag LOCUS_21030 46681 45869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 47879 46644 gene locus_tag LOCUS_21040 47879 46644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 48492 50111 gene locus_tag LOCUS_21050 gene gpmI 48492 50111 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_21050 50182 51174 gene locus_tag LOCUS_21060 50182 51174 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_21060 51853 52749 gene locus_tag LOCUS_21070 51853 52749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 52873 53733 gene locus_tag LOCUS_21080 52873 53733 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_21080 54474 53743 gene locus_tag LOCUS_21090 54474 53743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 55253 54474 gene locus_tag LOCUS_21100 gene mazG 55253 54474 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_21100 55969 55268 gene locus_tag LOCUS_21110 55969 55268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 <57635 56631 gene locus_tag LOCUS_21120 <57635 56631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence031 299 1096 gene locus_tag LOCUS_21130 299 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1729 1475 gene locus_tag LOCUS_21140 1729 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2004 1726 gene locus_tag LOCUS_21150 2004 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 2847 3197 gene locus_tag LOCUS_21160 2847 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3618 3845 gene locus_tag LOCUS_21170 3618 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 4873 3983 gene locus_tag LOCUS_21180 4873 3983 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_21180 5484 6425 gene locus_tag LOCUS_21190 5484 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 7258 6422 gene locus_tag LOCUS_21200 7258 6422 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205539.1 protein_id gnl|my_center|LOCUS_21200 8344 7337 gene locus_tag LOCUS_21210 8344 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 9057 8341 gene locus_tag LOCUS_21220 9057 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9982 9146 gene locus_tag LOCUS_21230 9982 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 11208 10039 gene locus_tag LOCUS_21240 11208 10039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_21240 13916 11307 gene locus_tag LOCUS_21250 13916 11307 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 protein_id gnl|my_center|LOCUS_21250 17093 14340 gene locus_tag LOCUS_21260 17093 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 17489 18244 gene locus_tag LOCUS_21270 17489 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 18657 19121 gene locus_tag LOCUS_21280 18657 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 19244 21745 gene locus_tag LOCUS_21290 19244 21745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 22126 24450 gene locus_tag LOCUS_21300 22126 24450 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_21300 24782 25147 gene locus_tag LOCUS_21310 24782 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 25193 25795 gene locus_tag LOCUS_21320 25193 25795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 25814 27172 gene locus_tag LOCUS_21330 25814 27172 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_21330 27294 29480 gene locus_tag LOCUS_21340 27294 29480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 29588 30580 gene locus_tag LOCUS_21350 29588 30580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_21350 31086 33503 gene locus_tag LOCUS_21360 31086 33503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 33715 34842 gene locus_tag LOCUS_21370 gene metK 33715 34842 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_21370 34851 36113 gene locus_tag LOCUS_21380 gene ahcY 34851 36113 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_21380 36392 37297 gene locus_tag LOCUS_21390 36392 37297 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_21390 37799 37449 gene locus_tag LOCUS_21400 37799 37449 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023352.1 protein_id gnl|my_center|LOCUS_21400 39263 37887 gene locus_tag LOCUS_21410 gene lpdA 39263 37887 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_21410 39643 40572 gene locus_tag LOCUS_21420 39643 40572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 41252 45733 gene locus_tag LOCUS_21430 gene gltB 41252 45733 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_21430 46506 46069 gene locus_tag LOCUS_21440 46506 46069 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_21440 47004 46555 gene locus_tag LOCUS_21450 47004 46555 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_21450 48128 47061 gene locus_tag LOCUS_21460 48128 47061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 51795 48451 gene locus_tag LOCUS_21470 51795 48451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 53449 52280 gene locus_tag LOCUS_21480 53449 52280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 54309 53749 gene locus_tag LOCUS_21490 54309 53749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 54880 54329 gene locus_tag LOCUS_21500 54880 54329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence032 1709 159 gene locus_tag LOCUS_21510 1709 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2461 1706 gene locus_tag LOCUS_21520 2461 1706 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_21520 4422 2461 gene locus_tag LOCUS_21530 gene zorA 4422 2461 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_21530 5035 4817 gene locus_tag LOCUS_21540 5035 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 5336 5085 gene locus_tag LOCUS_21550 5336 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6106 5366 gene locus_tag LOCUS_21560 6106 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6788 6429 gene locus_tag LOCUS_21570 6788 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7051 6794 gene locus_tag LOCUS_21580 7051 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 7987 7118 gene locus_tag LOCUS_21590 7987 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_21590 8964 8005 gene locus_tag LOCUS_21600 8964 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 9900 9016 gene locus_tag LOCUS_21610 gene murQ 9900 9016 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_21610 10836 9928 gene locus_tag LOCUS_21620 10836 9928 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_21620 10972 11919 gene locus_tag LOCUS_21630 10972 11919 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140857.1 protein_id gnl|my_center|LOCUS_21630 12358 11963 gene locus_tag LOCUS_21640 12358 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 12790 12407 gene locus_tag LOCUS_21650 12790 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 13169 12783 gene locus_tag LOCUS_21660 13169 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 14281 13232 gene locus_tag LOCUS_21670 14281 13232 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_21670 14780 14331 gene locus_tag LOCUS_21680 14780 14331 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400443.1 protein_id gnl|my_center|LOCUS_21680 16546 15110 gene locus_tag LOCUS_21690 16546 15110 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_21690 17209 16670 gene locus_tag LOCUS_21700 17209 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 17558 17193 gene locus_tag LOCUS_21710 17558 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 20915 17829 gene locus_tag LOCUS_21720 20915 17829 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_21720 21930 23357 gene locus_tag LOCUS_21730 21930 23357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_21730 24791 23373 gene locus_tag LOCUS_21740 gene betC 24791 23373 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171724.1 protein_id gnl|my_center|LOCUS_21740 25619 24861 gene locus_tag LOCUS_21750 25619 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 26206 28752 gene locus_tag LOCUS_21760 26206 28752 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_21760 28765 29835 gene locus_tag LOCUS_21770 28765 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 29842 30606 gene locus_tag LOCUS_21780 29842 30606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 30755 31762 gene locus_tag LOCUS_21790 30755 31762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 31776 33134 gene locus_tag LOCUS_21800 31776 33134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 33139 34404 gene locus_tag LOCUS_21810 33139 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 34841 34425 gene locus_tag LOCUS_21820 34841 34425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 34935 35450 gene locus_tag LOCUS_21830 34935 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 35979 35497 gene locus_tag LOCUS_21840 35979 35497 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_21840 37337 35994 gene locus_tag LOCUS_21850 37337 35994 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_21850 39168 37330 gene locus_tag LOCUS_21860 39168 37330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 40133 39639 gene locus_tag LOCUS_21870 40133 39639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 40686 40120 gene locus_tag LOCUS_21880 40686 40120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 41461 40661 gene locus_tag LOCUS_21890 41461 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 45037 42017 gene locus_tag LOCUS_21900 45037 42017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 46074 45220 gene locus_tag LOCUS_21910 46074 45220 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_21910 46571 46377 gene locus_tag LOCUS_21920 46571 46377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 47396 46599 gene locus_tag LOCUS_21930 47396 46599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 48323 47499 gene locus_tag LOCUS_21940 48323 47499 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_21940 49076 48360 gene locus_tag LOCUS_21950 49076 48360 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444927.1 protein_id gnl|my_center|LOCUS_21950 49453 49091 gene locus_tag LOCUS_21960 49453 49091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 51787 49484 gene locus_tag LOCUS_21970 51787 49484 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_21970 52097 51825 gene locus_tag LOCUS_21980 52097 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 52658 52128 gene locus_tag LOCUS_21990 52658 52128 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_21990 53570 52722 gene locus_tag LOCUS_22000 53570 52722 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_22000 53842 54123 gene locus_tag LOCUS_22010 53842 54123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 54604 54894 gene locus_tag LOCUS_22020 54604 54894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence033 707 2623 gene locus_tag LOCUS_22030 707 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3232 4143 gene locus_tag LOCUS_22040 3232 4143 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_22040 4162 5439 gene locus_tag LOCUS_22050 4162 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 5463 6380 gene locus_tag LOCUS_22060 gene pstA 5463 6380 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_22060 6470 7228 gene locus_tag LOCUS_22070 6470 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 7209 7538 gene locus_tag LOCUS_22080 7209 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7704 8459 gene locus_tag LOCUS_22090 gene pstB 7704 8459 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_22090 8480 9253 gene locus_tag LOCUS_22100 gene pstB 8480 9253 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_22100 9332 10063 gene locus_tag LOCUS_22110 9332 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 10232 11002 gene locus_tag LOCUS_22120 gene pstB 10232 11002 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880655.1 protein_id gnl|my_center|LOCUS_22120 11164 11823 gene locus_tag LOCUS_22130 gene phoU 11164 11823 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_22130 13097 11865 gene locus_tag LOCUS_22140 13097 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 15446 13134 gene locus_tag LOCUS_22150 15446 13134 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_22150 16274 15513 gene locus_tag LOCUS_22160 16274 15513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 16805 16314 gene locus_tag LOCUS_22170 16805 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 17629 16922 gene locus_tag LOCUS_22180 17629 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 20423 18600 gene locus_tag LOCUS_22190 20423 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 21436 20465 gene locus_tag LOCUS_22200 21436 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 23084 21627 gene locus_tag LOCUS_22210 23084 21627 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_22210 24560 23151 gene locus_tag LOCUS_22220 24560 23151 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_22220 25095 24598 gene locus_tag LOCUS_22230 25095 24598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 26573 25098 gene locus_tag LOCUS_22240 gene gatA 26573 25098 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_22240 26898 26587 gene locus_tag LOCUS_22250 gene gatC 26898 26587 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_22250 29087 26910 gene locus_tag LOCUS_22260 gene pcrA 29087 26910 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_22260 29281 30921 gene locus_tag LOCUS_22270 29281 30921 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393174.1 protein_id gnl|my_center|LOCUS_22270 30977 35362 gene locus_tag LOCUS_22280 30977 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 35365 35721 gene locus_tag LOCUS_22290 35365 35721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 36094 37047 gene locus_tag LOCUS_22300 36094 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 37337 37933 gene locus_tag LOCUS_22310 37337 37933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 38308 38589 gene locus_tag LOCUS_22320 38308 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 38582 39901 gene locus_tag LOCUS_22330 38582 39901 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393173.1 protein_id gnl|my_center|LOCUS_22330 40044 40601 gene locus_tag LOCUS_22340 40044 40601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 41733 41188 gene locus_tag LOCUS_22350 41733 41188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 42430 41828 gene locus_tag LOCUS_22360 42430 41828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 43015 42458 gene locus_tag LOCUS_22370 43015 42458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 43369 46290 gene locus_tag LOCUS_22380 43369 46290 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393172.1 protein_id gnl|my_center|LOCUS_22380 46287 46631 gene locus_tag LOCUS_22390 46287 46631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 47248 48021 gene locus_tag LOCUS_22400 47248 48021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 49111 48248 gene locus_tag LOCUS_22410 49111 48248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 49618 50274 gene locus_tag LOCUS_22420 49618 50274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 50267 50905 gene locus_tag LOCUS_22430 50267 50905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 50898 51332 gene locus_tag LOCUS_22440 50898 51332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 54403 51533 gene locus_tag LOCUS_22450 gene uvrA 54403 51533 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence034 1354 374 gene locus_tag LOCUS_22460 1354 374 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_22460 2447 1344 gene locus_tag LOCUS_22470 2447 1344 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_22470 3215 2598 gene locus_tag LOCUS_22480 3215 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 4131 3196 gene locus_tag LOCUS_22490 4131 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 6438 4366 gene locus_tag LOCUS_22500 6438 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 6808 7764 gene locus_tag LOCUS_22510 6808 7764 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_22510 7768 8487 gene locus_tag LOCUS_22520 7768 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 8596 9081 gene locus_tag LOCUS_22530 8596 9081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639884.1 protein_id gnl|my_center|LOCUS_22530 9643 10410 gene locus_tag LOCUS_22540 9643 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 10513 10833 gene locus_tag LOCUS_22550 10513 10833 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113114.1 protein_id gnl|my_center|LOCUS_22550 10901 11671 gene locus_tag LOCUS_22560 10901 11671 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_22560 11661 12374 gene locus_tag LOCUS_22570 11661 12374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 12394 13101 gene locus_tag LOCUS_22580 12394 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 13114 13911 gene locus_tag LOCUS_22590 13114 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 13928 15250 gene locus_tag LOCUS_22600 13928 15250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141489.1 protein_id gnl|my_center|LOCUS_22600 15243 15791 gene locus_tag LOCUS_22610 15243 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 17496 15880 gene locus_tag LOCUS_22620 17496 15880 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_22620 18409 17558 gene locus_tag LOCUS_22630 18409 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 20129 21007 gene locus_tag LOCUS_22640 20129 21007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_22640 21089 22153 gene locus_tag LOCUS_22650 21089 22153 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 protein_id gnl|my_center|LOCUS_22650 22206 22877 gene locus_tag LOCUS_22660 22206 22877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 22897 23691 gene locus_tag LOCUS_22670 22897 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 23897 24475 gene locus_tag LOCUS_22680 23897 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 24490 25926 gene locus_tag LOCUS_22690 24490 25926 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_22690 26783 25938 gene locus_tag LOCUS_22700 26783 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 27923 26784 gene locus_tag LOCUS_22710 27923 26784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 28279 28082 gene locus_tag LOCUS_22720 28279 28082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 28645 28298 gene locus_tag LOCUS_22730 28645 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 29132 28974 gene locus_tag LOCUS_22740 29132 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 29250 29846 gene locus_tag LOCUS_22750 29250 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 31016 30732 gene locus_tag LOCUS_22760 31016 30732 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_22760 31176 31568 gene locus_tag LOCUS_22770 31176 31568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 31616 32605 gene locus_tag LOCUS_22780 31616 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 32664 33725 gene locus_tag LOCUS_22790 32664 33725 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_22790 33964 33791 gene locus_tag LOCUS_22800 33964 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 34325 35104 gene locus_tag LOCUS_22810 34325 35104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 35166 36686 gene locus_tag LOCUS_22820 35166 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 36873 39029 gene locus_tag LOCUS_22830 36873 39029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 39211 40218 gene locus_tag LOCUS_22840 39211 40218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 41396 40338 gene locus_tag LOCUS_22850 41396 40338 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 protein_id gnl|my_center|LOCUS_22850 41953 42675 gene locus_tag LOCUS_22860 41953 42675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_22860 42675 46238 gene locus_tag LOCUS_22870 42675 46238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 46251 46865 gene locus_tag LOCUS_22880 46251 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 46897 47796 gene locus_tag LOCUS_22890 46897 47796 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_22890 49510 48065 gene locus_tag LOCUS_22900 49510 48065 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_22900 51081 49534 gene locus_tag LOCUS_22910 51081 49534 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227856.1 protein_id gnl|my_center|LOCUS_22910 52534 51488 gene locus_tag LOCUS_22920 52534 51488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 53456 52677 gene locus_tag LOCUS_22930 gene hisF 53456 52677 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_22930 54486 53527 gene locus_tag LOCUS_22940 54486 53527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence035 328 1734 gene locus_tag LOCUS_22950 328 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 8334 1840 gene locus_tag LOCUS_22960 8334 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 9404 8334 gene locus_tag LOCUS_22970 gene pdxA 9404 8334 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_22970 9790 9527 gene locus_tag LOCUS_22980 9790 9527 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900912.1 protein_id gnl|my_center|LOCUS_22980 12345 9832 gene locus_tag LOCUS_22990 gene lon 12345 9832 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389427.1 protein_id gnl|my_center|LOCUS_22990 13649 12357 gene locus_tag LOCUS_23000 gene clpX 13649 12357 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_23000 14466 13876 gene locus_tag LOCUS_23010 gene clpP 14466 13876 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_23010 15922 14615 gene locus_tag LOCUS_23020 gene tig 15922 14615 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_23020 16158 16072 gene locus_tag LOCUS_t00190 16158 16072 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16301 16226 gene locus_tag LOCUS_t00200 16301 16226 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16375 16301 gene locus_tag LOCUS_t00210 16375 16301 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16458 16385 gene locus_tag LOCUS_t00220 16458 16385 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 16542 16467 gene locus_tag LOCUS_t00230 16542 16467 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16626 16550 gene locus_tag LOCUS_t00240 16626 16550 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16720 16896 gene locus_tag LOCUS_23030 16720 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 16883 18919 gene locus_tag LOCUS_23040 16883 18919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 18950 23152 gene locus_tag LOCUS_23050 18950 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 23374 25512 gene locus_tag LOCUS_23060 23374 25512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 26045 32947 gene locus_tag LOCUS_23070 26045 32947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 32958 33836 gene locus_tag LOCUS_23080 32958 33836 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_23080 33869 34411 gene locus_tag LOCUS_23090 33869 34411 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_23090 35167 35361 gene locus_tag LOCUS_23100 35167 35361 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_23100 35363 35878 gene locus_tag LOCUS_23110 35363 35878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 36032 37483 gene locus_tag LOCUS_23120 36032 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 38065 37622 gene locus_tag LOCUS_23130 38065 37622 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932613.1 protein_id gnl|my_center|LOCUS_23130 39163 38099 gene locus_tag LOCUS_23140 39163 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 40216 39416 gene locus_tag LOCUS_23150 40216 39416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 41417 40290 gene locus_tag LOCUS_23160 41417 40290 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_23160 41565 41407 gene locus_tag LOCUS_23170 41565 41407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 41606 42676 gene locus_tag LOCUS_23180 41606 42676 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215065.1 protein_id gnl|my_center|LOCUS_23180 42911 49324 gene locus_tag LOCUS_23190 42911 49324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 50368 49331 gene locus_tag LOCUS_23200 50368 49331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 50576 50373 gene locus_tag LOCUS_23210 50576 50373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 51347 51275 gene locus_tag LOCUS_t00250 51347 51275 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51432 51360 gene locus_tag LOCUS_t00260 51432 51360 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 52293 51829 gene locus_tag LOCUS_23220 52293 51829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence036 397 993 gene locus_tag LOCUS_23230 397 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1055 2599 gene locus_tag LOCUS_23240 1055 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 3569 2901 gene locus_tag LOCUS_23250 3569 2901 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_23250 4706 3663 gene locus_tag LOCUS_23260 gene xylA 4706 3663 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_23260 5002 8658 gene locus_tag LOCUS_23270 5002 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 9289 10377 gene locus_tag LOCUS_23280 9289 10377 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_23280 10565 11404 gene locus_tag LOCUS_23290 10565 11404 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880637.1 protein_id gnl|my_center|LOCUS_23290 11445 12353 gene locus_tag LOCUS_23300 11445 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 12353 13402 gene locus_tag LOCUS_23310 12353 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 16497 13471 gene locus_tag LOCUS_23320 16497 13471 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_23320 16935 16540 gene locus_tag LOCUS_23330 gene vapC 16935 16540 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651560.1 protein_id gnl|my_center|LOCUS_23330 17149 16919 gene locus_tag LOCUS_23340 17149 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 19750 17246 gene locus_tag LOCUS_23350 19750 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 20568 19747 gene locus_tag LOCUS_23360 20568 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 22090 20636 gene locus_tag LOCUS_23370 22090 20636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 23609 22365 gene locus_tag LOCUS_23380 23609 22365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 24397 23615 gene locus_tag LOCUS_23390 24397 23615 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529495.1 protein_id gnl|my_center|LOCUS_23390 26085 24769 gene locus_tag LOCUS_23400 26085 24769 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_23400 27072 29015 gene locus_tag LOCUS_23410 gene acs 27072 29015 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_23410 29097 29591 gene locus_tag LOCUS_23420 29097 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 29644 30846 gene locus_tag LOCUS_23430 29644 30846 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_23430 30866 31591 gene locus_tag LOCUS_23440 30866 31591 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026973.1 protein_id gnl|my_center|LOCUS_23440 32427 31729 gene locus_tag LOCUS_23450 32427 31729 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404293.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23450 33818 32466 gene locus_tag LOCUS_23460 33818 32466 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_23460 33994 34764 gene locus_tag LOCUS_23470 33994 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 35228 34806 gene locus_tag LOCUS_23480 gene gloA 35228 34806 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_23480 38003 35343 gene locus_tag LOCUS_23490 38003 35343 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_23490 39009 38254 gene locus_tag LOCUS_23500 39009 38254 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_23500 39956 39006 gene locus_tag LOCUS_23510 39956 39006 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_23510 40356 41549 gene locus_tag LOCUS_23520 40356 41549 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963737.1 protein_id gnl|my_center|LOCUS_23520 41640 42389 gene locus_tag LOCUS_23530 41640 42389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 42417 44081 gene locus_tag LOCUS_23540 42417 44081 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23540 44389 49911 gene locus_tag LOCUS_23550 44389 49911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence037 1831 293 gene locus_tag LOCUS_23560 1831 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4213 1889 gene locus_tag LOCUS_23570 4213 1889 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_23570 4789 4226 gene locus_tag LOCUS_23580 4789 4226 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_23580 6071 4839 gene locus_tag LOCUS_23590 gene thrC 6071 4839 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_23590 7625 6237 gene locus_tag LOCUS_23600 7625 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 8341 7634 gene locus_tag LOCUS_23610 8341 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 8551 9576 gene locus_tag LOCUS_23620 8551 9576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 9563 12766 gene locus_tag LOCUS_23630 9563 12766 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_23630 12786 13529 gene locus_tag LOCUS_23640 12786 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:13254..13256,aa:Sec) note codon on position 157 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23640 13522 14583 gene locus_tag LOCUS_23650 13522 14583 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_23650 16046 14844 gene locus_tag LOCUS_23660 16046 14844 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_23660 17691 16132 gene locus_tag LOCUS_23670 17691 16132 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_23670 19938 17746 gene locus_tag LOCUS_23680 19938 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 20309 21184 gene locus_tag LOCUS_23690 20309 21184 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_23690 21322 22233 gene locus_tag LOCUS_23700 gene waaF 21322 22233 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_23700 22282 23025 gene locus_tag LOCUS_23710 22282 23025 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_23710 23106 23729 gene locus_tag LOCUS_23720 23106 23729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 23781 26282 gene locus_tag LOCUS_23730 23781 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 26341 28503 gene locus_tag LOCUS_23740 26341 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 28767 29192 gene locus_tag LOCUS_23750 28767 29192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 29365 31428 gene locus_tag LOCUS_23760 gene uvrB 29365 31428 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_23760 31553 33478 gene locus_tag LOCUS_23770 31553 33478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 33617 37477 gene locus_tag LOCUS_23780 33617 37477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 37645 37902 gene locus_tag LOCUS_23790 37645 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 38011 39546 gene locus_tag LOCUS_23800 38011 39546 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_23800 39543 41696 gene locus_tag LOCUS_23810 39543 41696 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840110.1 protein_id gnl|my_center|LOCUS_23810 41693 42466 gene locus_tag LOCUS_23820 41693 42466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 42459 43739 gene locus_tag LOCUS_23830 42459 43739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 43799 45424 gene locus_tag LOCUS_23840 43799 45424 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_23840 45789 46574 gene locus_tag LOCUS_23850 45789 46574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 47692 46868 gene locus_tag LOCUS_23860 47692 46868 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253736.1 protein_id gnl|my_center|LOCUS_23860 47982 49889 gene locus_tag LOCUS_23870 47982 49889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence038 143 613 gene locus_tag LOCUS_23880 143 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1240 1419 gene locus_tag LOCUS_23890 1240 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1434 2291 gene locus_tag LOCUS_23900 1434 2291 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_23900 2820 2302 gene locus_tag LOCUS_23910 2820 2302 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_23910 4079 2853 gene locus_tag LOCUS_23920 4079 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 5061 4066 gene locus_tag LOCUS_23930 5061 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 5896 6651 gene locus_tag LOCUS_23940 5896 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 6749 7609 gene locus_tag LOCUS_23950 6749 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 7733 9640 gene locus_tag LOCUS_23960 7733 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 9842 10582 gene locus_tag LOCUS_23970 9842 10582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 10652 12835 gene locus_tag LOCUS_23980 10652 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 13302 14003 gene locus_tag LOCUS_23990 13302 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 13987 14193 gene locus_tag LOCUS_24000 13987 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 14275 15072 gene locus_tag LOCUS_24010 14275 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_24010 15101 16918 gene locus_tag LOCUS_24020 15101 16918 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_24020 16945 17691 gene locus_tag LOCUS_24030 16945 17691 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_24030 17699 17929 gene locus_tag LOCUS_24040 17699 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 17976 19109 gene locus_tag LOCUS_24050 17976 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 19694 21631 gene locus_tag LOCUS_24060 19694 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 22239 23567 gene locus_tag LOCUS_24070 gene rho 22239 23567 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_24070 23730 23945 gene locus_tag LOCUS_24080 gene rpmE 23730 23945 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933240.1 protein_id gnl|my_center|LOCUS_24080 24010 25083 gene locus_tag LOCUS_24090 gene prfA 24010 25083 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_24090 25213 26085 gene locus_tag LOCUS_24100 gene prmC 25213 26085 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_24100 27656 26250 gene locus_tag LOCUS_24110 27656 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 28654 27704 gene locus_tag LOCUS_24120 28654 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_24120 29086 28664 gene locus_tag LOCUS_24130 29086 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 30402 29089 gene locus_tag LOCUS_24140 30402 29089 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183193.1 protein_id gnl|my_center|LOCUS_24140 33089 30633 gene locus_tag LOCUS_24150 33089 30633 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_24150 34151 33228 gene locus_tag LOCUS_24160 34151 33228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 35286 34663 gene locus_tag LOCUS_24170 35286 34663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 36428 35295 gene locus_tag LOCUS_24180 36428 35295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 36516 36591 gene locus_tag LOCUS_t00270 36516 36591 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36698 37570 gene locus_tag LOCUS_24190 36698 37570 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_24190 37570 38001 gene locus_tag LOCUS_24200 gene dut 37570 38001 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_24200 38065 38862 gene locus_tag LOCUS_24210 38065 38862 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_24210 38876 39652 gene locus_tag LOCUS_24220 38876 39652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 39689 40441 gene locus_tag LOCUS_24230 39689 40441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 40502 41251 gene locus_tag LOCUS_24240 40502 41251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 41826 42329 gene locus_tag LOCUS_24250 gene dfrA 41826 42329 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_24250 42475 43107 gene locus_tag LOCUS_24260 42475 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 43143 44111 gene locus_tag LOCUS_24270 43143 44111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 44104 44610 gene locus_tag LOCUS_24280 44104 44610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 44705 45937 gene locus_tag LOCUS_24290 gene nagA 44705 45937 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 protein_id gnl|my_center|LOCUS_24290 47048 47266 gene locus_tag LOCUS_24300 47048 47266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 47279 48058 gene locus_tag LOCUS_24310 47279 48058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 48212 49681 gene locus_tag LOCUS_24320 48212 49681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence039 661 1071 gene locus_tag LOCUS_24330 661 1071 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_24330 1147 2064 gene locus_tag LOCUS_24340 1147 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2042 2680 gene locus_tag LOCUS_24350 2042 2680 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770497.1 protein_id gnl|my_center|LOCUS_24350 3412 2747 gene locus_tag LOCUS_24360 3412 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 3822 3454 gene locus_tag LOCUS_24370 3822 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4116 5018 gene locus_tag LOCUS_24380 gene moaA 4116 5018 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230243.1 protein_id gnl|my_center|LOCUS_24380 5057 5428 gene locus_tag LOCUS_24390 5057 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 5469 6278 gene locus_tag LOCUS_24400 gene sufC 5469 6278 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_24400 6418 8451 gene locus_tag LOCUS_24410 6418 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 8517 10814 gene locus_tag LOCUS_24420 8517 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 10879 12096 gene locus_tag LOCUS_24430 10879 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 12164 12298 gene locus_tag LOCUS_24440 12164 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 12585 14003 gene locus_tag LOCUS_24450 gene sufB 12585 14003 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_24450 14017 15366 gene locus_tag LOCUS_24460 gene sufD 14017 15366 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_24460 15575 15916 gene locus_tag LOCUS_24470 15575 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 15985 16353 gene locus_tag LOCUS_24480 15985 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 16426 16584 gene locus_tag LOCUS_24490 16426 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 16600 16908 gene locus_tag LOCUS_24500 16600 16908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 17076 18110 gene locus_tag LOCUS_24510 17076 18110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 18228 18737 gene locus_tag LOCUS_24520 18228 18737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 18771 19538 gene locus_tag LOCUS_24530 18771 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 19564 20820 gene locus_tag LOCUS_24540 19564 20820 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_24540 20820 21209 gene locus_tag LOCUS_24550 20820 21209 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_24550 21293 21616 gene locus_tag LOCUS_24560 21293 21616 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_24560 21717 22064 gene locus_tag LOCUS_24570 21717 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 22374 22589 gene locus_tag LOCUS_24580 22374 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 22615 22914 gene locus_tag LOCUS_24590 22615 22914 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326213.1 protein_id gnl|my_center|LOCUS_24590 22930 23175 gene locus_tag LOCUS_24600 22930 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 23172 23384 gene locus_tag LOCUS_24610 23172 23384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 23416 23778 gene locus_tag LOCUS_24620 23416 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 23802 24137 gene locus_tag LOCUS_24630 23802 24137 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_24630 24142 24333 gene locus_tag LOCUS_24640 24142 24333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 25418 24330 gene locus_tag LOCUS_24650 25418 24330 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_24650 25599 27011 gene locus_tag LOCUS_24660 25599 27011 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_24660 28058 27030 gene locus_tag LOCUS_24670 28058 27030 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_24670 28233 29093 gene locus_tag LOCUS_24680 28233 29093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 29575 29285 gene locus_tag LOCUS_24690 29575 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 29899 31080 gene locus_tag LOCUS_24700 29899 31080 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_24700 31819 30968 gene locus_tag LOCUS_24710 31819 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 32301 32062 gene locus_tag LOCUS_24720 32301 32062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 32523 32609 gene locus_tag LOCUS_t00280 32523 32609 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33439 32648 gene locus_tag LOCUS_24730 33439 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 33689 33444 gene locus_tag LOCUS_24740 33689 33444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 35042 33735 gene locus_tag LOCUS_24750 gene hflX 35042 33735 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_24750 35563 36024 gene locus_tag LOCUS_24760 gene smpB 35563 36024 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_24760 36043 36393 gene locus_tag LOCUS_tm00010 36043 36393 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 36899 37681 gene locus_tag LOCUS_24770 36899 37681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 37731 39584 gene locus_tag LOCUS_24780 37731 39584 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087242.1 protein_id gnl|my_center|LOCUS_24780 39695 40117 gene locus_tag LOCUS_24790 39695 40117 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_24790 40110 40604 gene locus_tag LOCUS_24800 40110 40604 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_24800 40635 41552 gene locus_tag LOCUS_24810 gene yhdJ 40635 41552 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258939.1 protein_id gnl|my_center|LOCUS_24810 41595 42752 gene locus_tag LOCUS_24820 41595 42752 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_24820 42773 44476 gene locus_tag LOCUS_24830 42773 44476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 44679 46082 gene locus_tag LOCUS_24840 44679 46082 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963534.1 protein_id gnl|my_center|LOCUS_24840 46085 47659 gene locus_tag LOCUS_24850 46085 47659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 47656 48720 gene locus_tag LOCUS_24860 47656 48720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence040 182 961 gene locus_tag LOCUS_24870 182 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 1053 1952 gene locus_tag LOCUS_24880 1053 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3846 2152 gene locus_tag LOCUS_24890 3846 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 6235 3851 gene locus_tag LOCUS_24900 6235 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 6480 7763 gene locus_tag LOCUS_24910 6480 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 7804 9069 gene locus_tag LOCUS_24920 7804 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 9223 10149 gene locus_tag LOCUS_24930 9223 10149 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688976.1 protein_id gnl|my_center|LOCUS_24930 10146 10787 gene locus_tag LOCUS_24940 10146 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 10874 11254 gene locus_tag LOCUS_24950 10874 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 11495 12466 gene locus_tag LOCUS_24960 11495 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 12803 13168 gene locus_tag LOCUS_24970 12803 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 14208 15032 gene locus_tag LOCUS_24980 14208 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 15183 24356 gene locus_tag LOCUS_24990 15183 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 24843 26993 gene locus_tag LOCUS_25000 24843 26993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 27022 30279 gene locus_tag LOCUS_25010 27022 30279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 30339 33413 gene locus_tag LOCUS_25020 30339 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 33430 35511 gene locus_tag LOCUS_25030 33430 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 35616 37121 gene locus_tag LOCUS_25040 35616 37121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 37335 38318 gene locus_tag LOCUS_25050 37335 38318 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_25050 38408 39298 gene locus_tag LOCUS_25060 38408 39298 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_25060 39450 41384 gene locus_tag LOCUS_25070 39450 41384 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_25070 42962 43690 gene locus_tag LOCUS_25080 42962 43690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 43705 44493 gene locus_tag LOCUS_25090 43705 44493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 44647 46956 gene locus_tag LOCUS_25100 44647 46956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence041 192 1982 gene locus_tag LOCUS_25110 192 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2096 5122 gene locus_tag LOCUS_25120 2096 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 6697 7749 gene locus_tag LOCUS_25130 6697 7749 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_25130 8526 7762 gene locus_tag LOCUS_25140 8526 7762 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_25140 8916 8527 gene locus_tag LOCUS_25150 8916 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 9014 10186 gene locus_tag LOCUS_25160 gene ychF 9014 10186 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_25160 10814 10245 gene locus_tag LOCUS_25170 10814 10245 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_25170 11622 10957 gene locus_tag LOCUS_25180 gene cmk 11622 10957 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_25180 12556 11630 gene locus_tag LOCUS_25190 12556 11630 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_25190 13484 12714 gene locus_tag LOCUS_25200 13484 12714 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_25200 14251 15909 gene locus_tag LOCUS_25210 14251 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 15950 17779 gene locus_tag LOCUS_25220 15950 17779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 17797 18705 gene locus_tag LOCUS_25230 17797 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25230 18769 20757 gene locus_tag LOCUS_25240 18769 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 22203 20767 gene locus_tag LOCUS_25250 22203 20767 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_25250 22921 22208 gene locus_tag LOCUS_25260 gene pyrF 22921 22208 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_25260 24434 22944 gene locus_tag LOCUS_25270 gene argH 24434 22944 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_25270 24796 24476 gene locus_tag LOCUS_25280 24796 24476 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267587.1 protein_id gnl|my_center|LOCUS_25280 25156 24908 gene locus_tag LOCUS_25290 25156 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 25648 25283 gene locus_tag LOCUS_25300 25648 25283 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25300 25975 25715 gene locus_tag LOCUS_25310 25975 25715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 26468 26040 gene locus_tag LOCUS_25320 26468 26040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 27556 26702 gene locus_tag LOCUS_25330 27556 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 28430 27627 gene locus_tag LOCUS_25340 28430 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 28644 29120 gene locus_tag LOCUS_25350 28644 29120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 29681 30439 gene locus_tag LOCUS_25360 29681 30439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 31174 31362 gene locus_tag LOCUS_25370 31174 31362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 31387 32127 gene locus_tag LOCUS_25380 31387 32127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 32138 33181 gene locus_tag LOCUS_25390 32138 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 33383 33949 gene locus_tag LOCUS_25400 33383 33949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 36012 34105 gene locus_tag LOCUS_25410 36012 34105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 37800 36034 gene locus_tag LOCUS_25420 37800 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 39232 38156 gene locus_tag LOCUS_25430 39232 38156 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_25430 41478 39400 gene locus_tag LOCUS_25440 41478 39400 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_25440 43029 41536 gene locus_tag LOCUS_25450 43029 41536 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_25450 43655 43083 gene locus_tag LOCUS_25460 43655 43083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870396.1 protein_id gnl|my_center|LOCUS_25460 44630 43671 gene locus_tag LOCUS_25470 44630 43671 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_25470 45939 44683 gene locus_tag LOCUS_25480 45939 44683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 46762 46295 gene locus_tag LOCUS_25490 46762 46295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 47134 46766 gene locus_tag LOCUS_25500 47134 46766 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986781.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence042 846 1487 gene locus_tag LOCUS_25510 846 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1475 2206 gene locus_tag LOCUS_25520 1475 2206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_25520 2378 3595 gene locus_tag LOCUS_25530 2378 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 4413 3619 gene locus_tag LOCUS_25540 4413 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 4751 5227 gene locus_tag LOCUS_25550 4751 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5196 5858 gene locus_tag LOCUS_25560 5196 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 5896 6435 gene locus_tag LOCUS_25570 5896 6435 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_25570 6558 9161 gene locus_tag LOCUS_25580 6558 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 9158 10000 gene locus_tag LOCUS_25590 9158 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 10008 11249 gene locus_tag LOCUS_25600 10008 11249 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_25600 12184 11306 gene locus_tag LOCUS_25610 12184 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 13793 12213 gene locus_tag LOCUS_25620 13793 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 14791 13865 gene locus_tag LOCUS_25630 14791 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 16618 14816 gene locus_tag LOCUS_25640 16618 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 18310 16823 gene locus_tag LOCUS_25650 18310 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 19776 18373 gene locus_tag LOCUS_25660 19776 18373 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_25660 20366 21433 gene locus_tag LOCUS_25670 20366 21433 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_25670 21793 23157 gene locus_tag LOCUS_25680 21793 23157 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 protein_id gnl|my_center|LOCUS_25680 23141 23965 gene locus_tag LOCUS_25690 23141 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 23993 26500 gene locus_tag LOCUS_25700 23993 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 26604 29492 gene locus_tag LOCUS_25710 26604 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 30310 32835 gene locus_tag LOCUS_25720 30310 32835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 32846 35422 gene locus_tag LOCUS_25730 32846 35422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 35565 37508 gene locus_tag LOCUS_25740 35565 37508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 38221 37523 gene locus_tag LOCUS_25750 38221 37523 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815479.1 protein_id gnl|my_center|LOCUS_25750 39299 38274 gene locus_tag LOCUS_25760 39299 38274 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_25760 40066 39332 gene locus_tag LOCUS_25770 40066 39332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 40303 41457 gene locus_tag LOCUS_25780 40303 41457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_25780 41781 42899 gene locus_tag LOCUS_25790 gene waaF 41781 42899 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_25790 43292 44773 gene locus_tag LOCUS_25800 43292 44773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 44991 44791 gene locus_tag LOCUS_25810 44991 44791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 44956 45780 gene locus_tag LOCUS_25820 44956 45780 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_25820 46918 45806 gene locus_tag LOCUS_25830 46918 45806 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence043 985 542 gene locus_tag LOCUS_25840 985 542 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_25840 1232 978 gene locus_tag LOCUS_25850 gene moaD 1232 978 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880693.1 protein_id gnl|my_center|LOCUS_25850 1373 1732 gene locus_tag LOCUS_25860 gene folB 1373 1732 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_25860 1735 2937 gene locus_tag LOCUS_25870 1735 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2957 4000 gene locus_tag LOCUS_25880 2957 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 5486 4200 gene locus_tag LOCUS_25890 5486 4200 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_25890 5919 5593 gene locus_tag LOCUS_25900 gene trxA 5919 5593 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_25900 6240 6875 gene locus_tag LOCUS_25910 6240 6875 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762712.1 protein_id gnl|my_center|LOCUS_25910 6946 9063 gene locus_tag LOCUS_25920 6946 9063 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_25920 9075 10055 gene locus_tag LOCUS_25930 9075 10055 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_25930 10067 10306 gene locus_tag LOCUS_25940 10067 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 10873 11691 gene locus_tag LOCUS_25950 10873 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 12695 11688 gene locus_tag LOCUS_25960 12695 11688 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_25960 13449 12718 gene locus_tag LOCUS_25970 gene fabG 13449 12718 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_25970 13650 14663 gene locus_tag LOCUS_25980 13650 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 14922 17216 gene locus_tag LOCUS_25990 14922 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 17366 18202 gene locus_tag LOCUS_26000 17366 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 19748 18207 gene locus_tag LOCUS_26010 19748 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 20608 19799 gene locus_tag LOCUS_26020 20608 19799 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_26020 21520 20684 gene locus_tag LOCUS_26030 gene fabG 21520 20684 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_26030 22382 21594 gene locus_tag LOCUS_26040 22382 21594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 23478 22723 gene locus_tag LOCUS_26050 23478 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 24270 23518 gene locus_tag LOCUS_26060 24270 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 25298 24417 gene locus_tag LOCUS_26070 25298 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 25719 27335 gene locus_tag LOCUS_26080 25719 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 27496 27630 gene locus_tag LOCUS_26090 27496 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 27835 28143 gene locus_tag LOCUS_26100 27835 28143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 28160 28333 gene locus_tag LOCUS_26110 28160 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 28321 28806 gene locus_tag LOCUS_26120 28321 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 29680 28889 gene locus_tag LOCUS_26130 29680 28889 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_26130 30209 29739 gene locus_tag LOCUS_26140 gene rimI 30209 29739 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367197.1 protein_id gnl|my_center|LOCUS_26140 30717 30938 gene locus_tag LOCUS_26150 gene rpsU 30717 30938 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874014.1 protein_id gnl|my_center|LOCUS_26150 30960 31502 gene locus_tag LOCUS_26160 30960 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 31687 32337 gene locus_tag LOCUS_26170 31687 32337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 33762 32497 gene locus_tag LOCUS_26180 33762 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 37123 33944 gene locus_tag LOCUS_26190 37123 33944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 37987 38925 gene locus_tag LOCUS_26200 37987 38925 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_26200 39760 38996 gene locus_tag LOCUS_26210 39760 38996 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_26210 40719 39910 gene locus_tag LOCUS_26220 40719 39910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 41906 40833 gene locus_tag LOCUS_26230 41906 40833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 42339 41941 gene locus_tag LOCUS_26240 42339 41941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 43128 42508 gene locus_tag LOCUS_26250 43128 42508 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_26250 45746 43260 gene locus_tag LOCUS_26260 45746 43260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 46274 45804 gene locus_tag LOCUS_26270 46274 45804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence044 416 1153 gene locus_tag LOCUS_26280 gene truA 416 1153 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_26280 1170 2183 gene locus_tag LOCUS_26290 1170 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2195 3070 gene locus_tag LOCUS_26300 2195 3070 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_26300 4190 3141 gene locus_tag LOCUS_26310 4190 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4457 5728 gene locus_tag LOCUS_26320 gene murA 4457 5728 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723459.1 protein_id gnl|my_center|LOCUS_26320 5761 7059 gene locus_tag LOCUS_26330 gene hisD 5761 7059 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_26330 7136 7807 gene locus_tag LOCUS_26340 7136 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 8155 9465 gene locus_tag LOCUS_26350 8155 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 10046 9558 gene locus_tag LOCUS_26360 10046 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 10838 10068 gene locus_tag LOCUS_26370 10838 10068 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_26370 11454 11038 gene locus_tag LOCUS_26380 11454 11038 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_26380 12455 11598 gene locus_tag LOCUS_26390 12455 11598 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_26390 12664 13692 gene locus_tag LOCUS_26400 12664 13692 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_26400 13696 15210 gene locus_tag LOCUS_26410 13696 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 16758 15247 gene locus_tag LOCUS_26420 gene cobA 16758 15247 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_26420 17681 16755 gene locus_tag LOCUS_26430 gene hemC 17681 16755 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_26430 18979 17678 gene locus_tag LOCUS_26440 gene hemA 18979 17678 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_26440 20190 19348 gene locus_tag LOCUS_26450 gene ccsB 20190 19348 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_26450 21367 20207 gene locus_tag LOCUS_26460 21367 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 22380 21400 gene locus_tag LOCUS_26470 22380 21400 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_26470 23676 22393 gene locus_tag LOCUS_26480 gene hemL 23676 22393 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_26480 24711 23734 gene locus_tag LOCUS_26490 gene hemB 24711 23734 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_26490 25601 24708 gene locus_tag LOCUS_26500 25601 24708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 26532 25636 gene locus_tag LOCUS_26510 26532 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 27462 26566 gene locus_tag LOCUS_26520 27462 26566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 28541 27579 gene locus_tag LOCUS_26530 28541 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 30333 28588 gene locus_tag LOCUS_26540 30333 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 31421 30540 gene locus_tag LOCUS_26550 31421 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 31711 32502 gene locus_tag LOCUS_26560 31711 32502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 32486 33088 gene locus_tag LOCUS_26570 32486 33088 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_26570 33602 33300 gene locus_tag LOCUS_26580 33602 33300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 33921 33721 gene locus_tag LOCUS_26590 33921 33721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 34336 33944 gene locus_tag LOCUS_26600 34336 33944 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_26600 35385 34312 gene locus_tag LOCUS_26610 35385 34312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 36325 35735 gene locus_tag LOCUS_26620 36325 35735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 36536 36309 gene locus_tag LOCUS_26630 36536 36309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 37149 36847 gene locus_tag LOCUS_26640 37149 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 37487 37146 gene locus_tag LOCUS_26650 37487 37146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 38102 37692 gene locus_tag LOCUS_26660 38102 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 39919 38702 gene locus_tag LOCUS_26670 39919 38702 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_26670 43175 40548 gene locus_tag LOCUS_26680 43175 40548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 44407 43349 gene locus_tag LOCUS_26690 44407 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 46532 44637 gene locus_tag LOCUS_26700 46532 44637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence045 297 2408 gene locus_tag LOCUS_26710 297 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26710 2598 3692 gene locus_tag LOCUS_26720 2598 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3958 7389 gene locus_tag LOCUS_26730 3958 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 7552 8115 gene locus_tag LOCUS_26740 7552 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 8178 8459 gene locus_tag LOCUS_26750 8178 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 10467 9292 gene locus_tag LOCUS_26760 10467 9292 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_26760 11930 10506 gene locus_tag LOCUS_26770 11930 10506 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_26770 12718 11927 gene locus_tag LOCUS_26780 12718 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 13495 12803 gene locus_tag LOCUS_26790 gene nfi 13495 12803 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405504.1 protein_id gnl|my_center|LOCUS_26790 13743 13606 gene locus_tag LOCUS_26800 13743 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 15325 16113 gene locus_tag LOCUS_26810 15325 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 16131 17318 gene locus_tag LOCUS_26820 16131 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 17391 17549 gene locus_tag LOCUS_26830 17391 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 17986 19785 gene locus_tag LOCUS_26840 17986 19785 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930368.1 protein_id gnl|my_center|LOCUS_26840 19853 21793 gene locus_tag LOCUS_26850 19853 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 21818 22405 gene locus_tag LOCUS_26860 gene gmhA 21818 22405 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_26860 22489 22767 gene locus_tag LOCUS_26870 22489 22767 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_26870 22770 24461 gene locus_tag LOCUS_26880 22770 24461 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354544.1 protein_id gnl|my_center|LOCUS_26880 24477 26159 gene locus_tag LOCUS_26890 24477 26159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 26172 26444 gene locus_tag LOCUS_26900 26172 26444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 26596 27408 gene locus_tag LOCUS_26910 26596 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 27441 28430 gene locus_tag LOCUS_26920 27441 28430 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229937.1 protein_id gnl|my_center|LOCUS_26920 28469 29548 gene locus_tag LOCUS_26930 28469 29548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 29628 30338 gene locus_tag LOCUS_26940 29628 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 30366 31076 gene locus_tag LOCUS_26950 30366 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 31382 32092 gene locus_tag LOCUS_26960 31382 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 32166 33125 gene locus_tag LOCUS_26970 32166 33125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 33266 33469 gene locus_tag LOCUS_26980 33266 33469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 33478 34239 gene locus_tag LOCUS_26990 33478 34239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 34646 34299 gene locus_tag LOCUS_27000 34646 34299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 35317 34643 gene locus_tag LOCUS_27010 gene ccsA 35317 34643 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_27010 36090 35302 gene locus_tag LOCUS_27020 gene map 36090 35302 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_27020 37576 36152 gene locus_tag LOCUS_27030 gene miaB 37576 36152 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_27030 38398 37589 gene locus_tag LOCUS_27040 38398 37589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 40708 38870 gene locus_tag LOCUS_27050 40708 38870 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_27050 41601 40810 gene locus_tag LOCUS_27060 41601 40810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 41763 42728 gene locus_tag LOCUS_27070 41763 42728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 43086 43769 gene locus_tag LOCUS_27080 43086 43769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 43901 44656 gene locus_tag LOCUS_27090 43901 44656 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_27090 44723 46582 gene locus_tag LOCUS_27100 44723 46582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence046 341 1879 gene locus_tag LOCUS_27110 341 1879 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_27110 1913 2392 gene locus_tag LOCUS_27120 1913 2392 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_27120 2457 3374 gene locus_tag LOCUS_27130 gene floA 2457 3374 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_27130 3377 4408 gene locus_tag LOCUS_27140 gene floA 3377 4408 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_27140 4431 4916 gene locus_tag LOCUS_27150 4431 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6669 5641 gene locus_tag LOCUS_27160 6669 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 7495 6722 gene locus_tag LOCUS_27170 7495 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 7908 9179 gene locus_tag LOCUS_27180 7908 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 10494 9877 gene locus_tag LOCUS_27190 10494 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 10713 11870 gene locus_tag LOCUS_27200 10713 11870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_27200 11964 12770 gene locus_tag LOCUS_27210 11964 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 12811 13944 gene locus_tag LOCUS_27220 gene dgoD 12811 13944 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_27220 14006 14242 gene locus_tag LOCUS_27230 14006 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 14860 15012 gene locus_tag LOCUS_27240 14860 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 14978 15244 gene locus_tag LOCUS_27250 14978 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 15330 15770 gene locus_tag LOCUS_27260 15330 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 16019 17209 gene locus_tag LOCUS_27270 16019 17209 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_27270 17210 18076 gene locus_tag LOCUS_27280 17210 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 18073 18963 gene locus_tag LOCUS_27290 gene ispE 18073 18963 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_27290 18964 19035 gene locus_tag LOCUS_t00290 18964 19035 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19069 19794 gene locus_tag LOCUS_27300 19069 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 19808 20968 gene locus_tag LOCUS_27310 19808 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 21198 21785 gene locus_tag LOCUS_27320 21198 21785 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392053.1 protein_id gnl|my_center|LOCUS_27320 21826 22434 gene locus_tag LOCUS_27330 gene pth 21826 22434 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_27330 22436 23545 gene locus_tag LOCUS_27340 22436 23545 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_27340 23850 23599 gene locus_tag LOCUS_27350 23850 23599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 24950 23901 gene locus_tag LOCUS_27360 24950 23901 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_27360 25871 24984 gene locus_tag LOCUS_27370 25871 24984 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_27370 25915 26592 gene locus_tag LOCUS_27380 25915 26592 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_27380 26772 27740 gene locus_tag LOCUS_27390 gene wlbA 26772 27740 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_27390 28805 27858 gene locus_tag LOCUS_27400 28805 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 31617 28936 gene locus_tag LOCUS_27410 gene mutS 31617 28936 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_27410 31912 32946 gene locus_tag LOCUS_27420 31912 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 33288 34100 gene locus_tag LOCUS_27430 33288 34100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 34135 34941 gene locus_tag LOCUS_27440 34135 34941 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_27440 34962 36596 gene locus_tag LOCUS_27450 34962 36596 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_27450 36641 37411 gene locus_tag LOCUS_27460 36641 37411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 37633 38421 gene locus_tag LOCUS_27470 37633 38421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 38471 39298 gene locus_tag LOCUS_27480 38471 39298 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_27480 39333 40133 gene locus_tag LOCUS_27490 39333 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 40154 41272 gene locus_tag LOCUS_27500 40154 41272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529498.1 protein_id gnl|my_center|LOCUS_27500 41296 42096 gene locus_tag LOCUS_27510 41296 42096 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_27510 42402 42145 gene locus_tag LOCUS_27520 42402 42145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 43206 42415 gene locus_tag LOCUS_27530 gene minD 43206 42415 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_27530 43895 43224 gene locus_tag LOCUS_27540 gene minC 43895 43224 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_27540 45253 43985 gene locus_tag LOCUS_27550 gene larA 45253 43985 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence047 1618 923 gene locus_tag LOCUS_27560 1618 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2359 1631 gene locus_tag LOCUS_27570 gene queC 2359 1631 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_27570 3083 2556 gene locus_tag LOCUS_27580 3083 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 4276 3080 gene locus_tag LOCUS_27590 4276 3080 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_27590 6085 4460 gene locus_tag LOCUS_27600 6085 4460 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_27600 7741 6689 gene locus_tag LOCUS_27610 7741 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 8207 9388 gene locus_tag LOCUS_27620 gene ugpC 8207 9388 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_27620 9523 11157 gene locus_tag LOCUS_27630 9523 11157 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_27630 12264 11338 gene locus_tag LOCUS_27640 12264 11338 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_27640 13022 12261 gene locus_tag LOCUS_27650 13022 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 13117 12956 gene locus_tag LOCUS_27660 13117 12956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 13995 13171 gene locus_tag LOCUS_27670 13995 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 14167 14095 gene locus_tag LOCUS_t00300 14167 14095 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14648 14259 gene locus_tag LOCUS_27680 14648 14259 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_27680 15419 14655 gene locus_tag LOCUS_27690 15419 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 16199 15441 gene locus_tag LOCUS_27700 16199 15441 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253736.1 protein_id gnl|my_center|LOCUS_27700 16778 16209 gene locus_tag LOCUS_27710 16778 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 17395 16820 gene locus_tag LOCUS_27720 17395 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 17493 18317 gene locus_tag LOCUS_27730 17493 18317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 18448 19395 gene locus_tag LOCUS_27740 18448 19395 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_27740 19392 20246 gene locus_tag LOCUS_27750 19392 20246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_27750 21395 20280 gene locus_tag LOCUS_27760 21395 20280 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_27760 24416 21414 gene locus_tag LOCUS_27770 24416 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 27759 24754 gene locus_tag LOCUS_27780 27759 24754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 28836 27862 gene locus_tag LOCUS_27790 28836 27862 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737366.1 protein_id gnl|my_center|LOCUS_27790 31392 28897 gene locus_tag LOCUS_27800 31392 28897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 33219 31591 gene locus_tag LOCUS_27810 33219 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27810 36337 33188 gene locus_tag LOCUS_27820 36337 33188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27820 37353 36553 gene locus_tag LOCUS_27830 37353 36553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 37871 37596 gene locus_tag LOCUS_27840 37871 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 38142 37858 gene locus_tag LOCUS_27850 38142 37858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 39196 38201 gene locus_tag LOCUS_27860 39196 38201 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_27860 39994 39221 gene locus_tag LOCUS_27870 39994 39221 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_27870 40764 39994 gene locus_tag LOCUS_27880 40764 39994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640390.1 protein_id gnl|my_center|LOCUS_27880 41827 40826 gene locus_tag LOCUS_27890 41827 40826 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_27890 42208 42915 gene locus_tag LOCUS_27900 gene bioD 42208 42915 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496780.1 protein_id gnl|my_center|LOCUS_27900 42944 44314 gene locus_tag LOCUS_27910 42944 44314 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_27910 44718 44329 gene locus_tag LOCUS_27920 44718 44329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence048 171 1925 gene locus_tag LOCUS_27930 171 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2243 2998 gene locus_tag LOCUS_27940 2243 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3010 3750 gene locus_tag LOCUS_27950 3010 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 4891 4034 gene locus_tag LOCUS_27960 4891 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 5123 7564 gene locus_tag LOCUS_27970 5123 7564 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944365.1 protein_id gnl|my_center|LOCUS_27970 7557 8087 gene locus_tag LOCUS_27980 7557 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 8149 9048 gene locus_tag LOCUS_27990 8149 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 9213 10637 gene locus_tag LOCUS_28000 9213 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 10738 11586 gene locus_tag LOCUS_28010 10738 11586 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583057.1 protein_id gnl|my_center|LOCUS_28010 11612 11971 gene locus_tag LOCUS_28020 11612 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 11980 12669 gene locus_tag LOCUS_28030 11980 12669 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_28030 13082 13849 gene locus_tag LOCUS_28040 13082 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 15311 13890 gene locus_tag LOCUS_28050 15311 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 15625 16356 gene locus_tag LOCUS_28060 15625 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 16537 17928 gene locus_tag LOCUS_28070 16537 17928 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_28070 18269 19717 gene locus_tag LOCUS_28080 18269 19717 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_28080 21802 19793 gene locus_tag LOCUS_28090 21802 19793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_28090 22462 21806 gene locus_tag LOCUS_28100 22462 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 22643 22482 gene locus_tag LOCUS_28110 22643 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 23719 22808 gene locus_tag LOCUS_28120 23719 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 24443 23775 gene locus_tag LOCUS_28130 24443 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 26712 24532 gene locus_tag LOCUS_28140 26712 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 26826 27197 gene locus_tag LOCUS_28150 26826 27197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 27252 27932 gene locus_tag LOCUS_28160 27252 27932 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_28160 27936 28949 gene locus_tag LOCUS_28170 27936 28949 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28170 29056 29463 gene locus_tag LOCUS_28180 29056 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 30559 29489 gene locus_tag LOCUS_28190 30559 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 31372 31821 gene locus_tag LOCUS_28200 31372 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 31889 32365 gene locus_tag LOCUS_28210 31889 32365 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_28210 32441 32641 gene locus_tag LOCUS_28220 32441 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 32729 33178 gene locus_tag LOCUS_28230 gene rplI 32729 33178 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_28230 33233 34573 gene locus_tag LOCUS_28240 gene dnaB 33233 34573 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_28240 34600 35424 gene locus_tag LOCUS_28250 34600 35424 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_28250 35790 36578 gene locus_tag LOCUS_28260 35790 36578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_28260 36575 38146 gene locus_tag LOCUS_28270 36575 38146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 38337 39698 gene locus_tag LOCUS_28280 gene radA 38337 39698 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_28280 39951 40985 gene locus_tag LOCUS_28290 39951 40985 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919677.1 protein_id gnl|my_center|LOCUS_28290 40997 41692 gene locus_tag LOCUS_28300 gene ispD 40997 41692 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_28300 41715 42224 gene locus_tag LOCUS_28310 gene ispF 41715 42224 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_28310 42228 43691 gene locus_tag LOCUS_28320 gene cysS 42228 43691 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence049 451 1410 gene locus_tag LOCUS_28330 451 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1942 1451 gene locus_tag LOCUS_28340 1942 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 3362 1929 gene locus_tag LOCUS_28350 3362 1929 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_28350 4755 3385 gene locus_tag LOCUS_28360 4755 3385 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_28360 5293 4805 gene locus_tag LOCUS_28370 5293 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 5434 6594 gene locus_tag LOCUS_28380 gene tuf 5434 6594 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869930.1 protein_id gnl|my_center|LOCUS_28380 6654 7121 gene locus_tag LOCUS_28390 6654 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 7172 7924 gene locus_tag LOCUS_28400 7172 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 8375 9037 gene locus_tag LOCUS_28410 8375 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 10147 9440 gene locus_tag LOCUS_28420 gene hisA 10147 9440 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_28420 11060 10161 gene locus_tag LOCUS_28430 11060 10161 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_28430 12418 11060 gene locus_tag LOCUS_28440 12418 11060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_28440 12499 12660 gene locus_tag LOCUS_28450 12499 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 12728 13051 gene locus_tag LOCUS_28460 12728 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 13243 14031 gene locus_tag LOCUS_28470 13243 14031 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_28470 14617 14039 gene locus_tag LOCUS_28480 14617 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 14968 14663 gene locus_tag LOCUS_28490 14968 14663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 16555 15518 gene locus_tag LOCUS_28500 16555 15518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_28500 17180 16899 gene locus_tag LOCUS_28510 17180 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 17540 17328 gene locus_tag LOCUS_28520 17540 17328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 20865 18115 gene locus_tag LOCUS_28530 20865 18115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 21143 21787 gene locus_tag LOCUS_28540 gene coaE 21143 21787 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_28540 22867 21782 gene locus_tag LOCUS_28550 gene modC 22867 21782 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_28550 23210 22911 gene locus_tag LOCUS_28560 23210 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 24727 24062 gene locus_tag LOCUS_28570 gene modB 24727 24062 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_28570 25542 24748 gene locus_tag LOCUS_28580 gene modA 25542 24748 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949046.1 protein_id gnl|my_center|LOCUS_28580 25700 26506 gene locus_tag LOCUS_28590 gene asbF 25700 26506 CDS product petrobactin biosynthesis 3-dehydroshikimate dehydratase AsbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877695.1 protein_id gnl|my_center|LOCUS_28590 26528 27142 gene locus_tag LOCUS_28600 26528 27142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 27167 28096 gene locus_tag LOCUS_28610 27167 28096 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_28610 28149 29411 gene locus_tag LOCUS_28620 28149 29411 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_28620 29950 29774 gene locus_tag LOCUS_28630 29950 29774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 30236 29961 gene locus_tag LOCUS_28640 30236 29961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 30332 31372 gene locus_tag LOCUS_28650 30332 31372 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_28650 31385 32182 gene locus_tag LOCUS_28660 31385 32182 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_28660 32251 32628 gene locus_tag LOCUS_28670 32251 32628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 32669 33487 gene locus_tag LOCUS_28680 32669 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 33663 34397 gene locus_tag LOCUS_28690 gene fabG 33663 34397 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_28690 36349 34403 gene locus_tag LOCUS_28700 36349 34403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 37707 36655 gene locus_tag LOCUS_28710 37707 36655 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868854.1 protein_id gnl|my_center|LOCUS_28710 38207 37707 gene locus_tag LOCUS_28720 38207 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 38536 38210 gene locus_tag LOCUS_28730 38536 38210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 40179 38551 gene locus_tag LOCUS_28740 40179 38551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 41616 40660 gene locus_tag LOCUS_28750 41616 40660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 42653 41721 gene locus_tag LOCUS_28760 42653 41721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence050 2171 819 gene locus_tag LOCUS_28770 2171 819 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_28770 2452 2192 gene locus_tag LOCUS_28780 2452 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3146 2649 gene locus_tag LOCUS_28790 3146 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4092 3166 gene locus_tag LOCUS_28800 4092 3166 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_28800 4516 4118 gene locus_tag LOCUS_28810 4516 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 6775 4583 gene locus_tag LOCUS_28820 6775 4583 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_28820 7469 6861 gene locus_tag LOCUS_28830 7469 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 9174 8224 gene locus_tag LOCUS_28840 9174 8224 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_28840 11701 9242 gene locus_tag LOCUS_28850 11701 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 12909 11842 gene locus_tag LOCUS_28860 12909 11842 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_28860 13445 14389 gene locus_tag LOCUS_28870 13445 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 14666 15655 gene locus_tag LOCUS_28880 14666 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 15969 17057 gene locus_tag LOCUS_28890 15969 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 17832 17059 gene locus_tag LOCUS_28900 17832 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 17948 19138 gene locus_tag LOCUS_28910 17948 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 20282 19206 gene locus_tag LOCUS_28920 20282 19206 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_28920 21767 20598 gene locus_tag LOCUS_28930 21767 20598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 22899 21757 gene locus_tag LOCUS_28940 22899 21757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28940 24079 22889 gene locus_tag LOCUS_28950 24079 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 26737 24632 gene locus_tag LOCUS_28960 26737 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 27918 27115 gene locus_tag LOCUS_28970 gene lpxI 27918 27115 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930695.1 protein_id gnl|my_center|LOCUS_28970 29220 27979 gene locus_tag LOCUS_28980 29220 27979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_28980 31165 29711 gene locus_tag LOCUS_28990 31165 29711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 31960 31214 gene locus_tag LOCUS_29000 31960 31214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 32788 31964 gene locus_tag LOCUS_29010 32788 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 34874 32880 gene locus_tag LOCUS_29020 34874 32880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 35952 35005 gene locus_tag LOCUS_29030 35952 35005 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_29030 36752 35964 gene locus_tag LOCUS_29040 36752 35964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 37349 36900 gene locus_tag LOCUS_29050 37349 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 37894 38661 gene locus_tag LOCUS_29060 37894 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 41822 38892 gene locus_tag LOCUS_29070 41822 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 42226 42489 gene locus_tag LOCUS_29080 42226 42489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29080 >Feature sequence051 421 624 gene locus_tag LOCUS_29090 421 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 875 1636 gene locus_tag LOCUS_29100 gene kdsB 875 1636 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_29100 1633 3258 gene locus_tag LOCUS_29110 1633 3258 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_29110 3258 4514 gene locus_tag LOCUS_29120 3258 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 4818 5942 gene locus_tag LOCUS_29130 4818 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 6032 7291 gene locus_tag LOCUS_29140 gene larA 6032 7291 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_29140 7501 8577 gene locus_tag LOCUS_29150 7501 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 8577 9863 gene locus_tag LOCUS_29160 8577 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 10096 9911 gene locus_tag LOCUS_29170 10096 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 10695 10231 gene locus_tag LOCUS_29180 10695 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 10996 12144 gene locus_tag LOCUS_29190 10996 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29190 12335 13459 gene locus_tag LOCUS_29200 12335 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29200 13452 14615 gene locus_tag LOCUS_29210 13452 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 14711 14785 gene locus_tag LOCUS_t00310 14711 14785 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15520 15840 gene locus_tag LOCUS_29220 15520 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29220 16000 17028 gene locus_tag LOCUS_29230 16000 17028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 17028 17642 gene locus_tag LOCUS_29240 17028 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 17777 18838 gene locus_tag LOCUS_29250 17777 18838 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_29250 21375 19750 gene locus_tag LOCUS_29260 gene groL 21375 19750 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_29260 21686 21396 gene locus_tag LOCUS_29270 gene groES 21686 21396 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804491.1 protein_id gnl|my_center|LOCUS_29270 22981 21998 gene locus_tag LOCUS_29280 22981 21998 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_29280 23306 24940 gene locus_tag LOCUS_29290 23306 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 24944 25435 gene locus_tag LOCUS_29300 24944 25435 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_29300 26151 25471 gene locus_tag LOCUS_29310 26151 25471 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529133.1 protein_id gnl|my_center|LOCUS_29310 27502 26336 gene locus_tag LOCUS_29320 27502 26336 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_29320 28028 27480 gene locus_tag LOCUS_29330 28028 27480 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_29330 28839 32864 gene locus_tag LOCUS_29340 gene rpoB 28839 32864 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725157.1 protein_id gnl|my_center|LOCUS_29340 32990 38596 gene locus_tag LOCUS_29350 32990 38596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence052 361 2247 gene locus_tag LOCUS_29360 361 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 2989 4854 gene locus_tag LOCUS_29370 2989 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 5053 5280 gene locus_tag LOCUS_29380 5053 5280 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_29380 5277 5654 gene locus_tag LOCUS_29390 5277 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 6708 5722 gene locus_tag LOCUS_29400 6708 5722 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_29400 7699 6719 gene locus_tag LOCUS_29410 7699 6719 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_29410 8570 7800 gene locus_tag LOCUS_29420 8570 7800 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532752.1 protein_id gnl|my_center|LOCUS_29420 9040 9321 gene locus_tag LOCUS_29430 9040 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 11162 9483 gene locus_tag LOCUS_29440 gene ilvD 11162 9483 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_29440 11772 11251 gene locus_tag LOCUS_29450 11772 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 12327 11803 gene locus_tag LOCUS_29460 12327 11803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 15070 12689 gene locus_tag LOCUS_29470 15070 12689 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_29470 15869 15144 gene locus_tag LOCUS_29480 15869 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 17022 15859 gene locus_tag LOCUS_29490 17022 15859 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_29490 18649 17261 gene locus_tag LOCUS_29500 18649 17261 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_29500 18909 18718 gene locus_tag LOCUS_29510 18909 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 20207 18954 gene locus_tag LOCUS_29520 20207 18954 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_29520 21681 20818 gene locus_tag LOCUS_29530 21681 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 23207 21693 gene locus_tag LOCUS_29540 23207 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 23635 23204 gene locus_tag LOCUS_29550 23635 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 29759 25665 gene locus_tag LOCUS_29560 29759 25665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 30125 31054 gene locus_tag LOCUS_29570 30125 31054 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_29570 32663 31068 gene locus_tag LOCUS_29580 32663 31068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 34196 32799 gene locus_tag LOCUS_29590 34196 32799 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_29590 35558 34206 gene locus_tag LOCUS_29600 35558 34206 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_29600 36690 35581 gene locus_tag LOCUS_29610 36690 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 36996 38639 gene locus_tag LOCUS_29620 36996 38639 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887905.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence053 <1 877 gene locus_tag LOCUS_29630 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817098.1:Rpn family recombination-promoting nuclease/putative transposase 1144 2424 gene locus_tag LOCUS_29640 gene purD 1144 2424 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_29640 2455 3636 gene locus_tag LOCUS_29650 2455 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3702 4217 gene locus_tag LOCUS_29660 3702 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 4252 5442 gene locus_tag LOCUS_29670 4252 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 5703 6533 gene locus_tag LOCUS_29680 gene kduD 5703 6533 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_29680 6535 6759 gene locus_tag LOCUS_29690 6535 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 7997 9091 gene locus_tag LOCUS_29700 7997 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 9344 10195 gene locus_tag LOCUS_29710 gene uppP 9344 10195 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_29710 10860 10132 gene locus_tag LOCUS_29720 10860 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 11732 10824 gene locus_tag LOCUS_29730 11732 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 12831 11722 gene locus_tag LOCUS_29740 12831 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 14309 12909 gene locus_tag LOCUS_29750 14309 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 15626 14658 gene locus_tag LOCUS_29760 15626 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 16643 17374 gene locus_tag LOCUS_29770 16643 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 17380 17862 gene locus_tag LOCUS_29780 17380 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 17853 18038 gene locus_tag LOCUS_29790 17853 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 18254 18487 gene locus_tag LOCUS_29800 18254 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 19047 19814 gene locus_tag LOCUS_29810 19047 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 21123 20008 gene locus_tag LOCUS_29820 gene ispG 21123 20008 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903303.1 protein_id gnl|my_center|LOCUS_29820 21749 21294 gene locus_tag LOCUS_29830 21749 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 23151 22042 gene locus_tag LOCUS_29840 gene hisC 23151 22042 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_29840 28025 23238 gene locus_tag LOCUS_29850 28025 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 30668 28062 gene locus_tag LOCUS_29860 30668 28062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 35609 30867 gene locus_tag LOCUS_29870 35609 30867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 38167 35606 gene locus_tag LOCUS_29880 38167 35606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence054 1438 1511 gene locus_tag LOCUS_t00320 1438 1511 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1937 2554 gene locus_tag LOCUS_29890 1937 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3033 5027 gene locus_tag LOCUS_29900 3033 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 5122 7317 gene locus_tag LOCUS_29910 5122 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 7452 9506 gene locus_tag LOCUS_29920 7452 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9607 11772 gene locus_tag LOCUS_29930 9607 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29930 11808 13844 gene locus_tag LOCUS_29940 11808 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29940 13980 16154 gene locus_tag LOCUS_29950 13980 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 16189 18177 gene locus_tag LOCUS_29960 16189 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 18281 20455 gene locus_tag LOCUS_29970 18281 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 20587 22629 gene locus_tag LOCUS_29980 20587 22629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 22665 24725 gene locus_tag LOCUS_29990 22665 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29990 24761 26728 gene locus_tag LOCUS_30000 24761 26728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30000 26874 27065 gene locus_tag LOCUS_30010 26874 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 28552 27152 gene locus_tag LOCUS_30020 28552 27152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 29199 28615 gene locus_tag LOCUS_30030 29199 28615 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_30030 29518 29844 gene locus_tag LOCUS_30040 29518 29844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 30587 30348 gene locus_tag LOCUS_30050 30587 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 30724 31278 gene locus_tag LOCUS_30060 30724 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 31356 32336 gene locus_tag LOCUS_30070 31356 32336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 32952 32452 gene locus_tag LOCUS_30080 32952 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921838.1 protein_id gnl|my_center|LOCUS_30080 34278 32989 gene locus_tag LOCUS_30090 34278 32989 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_30090 35796 34336 gene locus_tag LOCUS_30100 35796 34336 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_30100 35987 35793 gene locus_tag LOCUS_30110 35987 35793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 37890 35971 gene locus_tag LOCUS_30120 37890 35971 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30120 >Feature sequence055 438 1724 gene locus_tag LOCUS_30130 438 1724 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 protein_id gnl|my_center|LOCUS_30130 2104 2625 gene locus_tag LOCUS_30140 2104 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4956 2644 gene locus_tag LOCUS_30150 4956 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 5247 5008 gene locus_tag LOCUS_30160 5247 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 5719 5249 gene locus_tag LOCUS_30170 5719 5249 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_30170 6885 5758 gene locus_tag LOCUS_30180 6885 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 7420 6965 gene locus_tag LOCUS_30190 7420 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 8304 7552 gene locus_tag LOCUS_30200 8304 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 8914 8639 gene locus_tag LOCUS_30210 8914 8639 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_30210 9759 9001 gene locus_tag LOCUS_30220 9759 9001 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_30220 10735 9785 gene locus_tag LOCUS_30230 gene cysK 10735 9785 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_30230 11169 10732 gene locus_tag LOCUS_30240 11169 10732 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_30240 14726 11553 gene locus_tag LOCUS_30250 14726 11553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 15597 14734 gene locus_tag LOCUS_30260 15597 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 17807 16152 gene locus_tag LOCUS_30270 17807 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 18443 17922 gene locus_tag LOCUS_30280 18443 17922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30280 21089 18519 gene locus_tag LOCUS_30290 21089 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 21374 21138 gene locus_tag LOCUS_30300 21374 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 21583 21374 gene locus_tag LOCUS_30310 21583 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 22578 22033 gene locus_tag LOCUS_30320 22578 22033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 25636 22616 gene locus_tag LOCUS_30330 25636 22616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 26900 25692 gene locus_tag LOCUS_30340 26900 25692 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_30340 28657 26936 gene locus_tag LOCUS_30350 28657 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 30485 29025 gene locus_tag LOCUS_30360 gene betC 30485 29025 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_30360 30777 30511 gene locus_tag LOCUS_30370 30777 30511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 31040 30780 gene locus_tag LOCUS_30380 31040 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 33289 31265 gene locus_tag LOCUS_30390 33289 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 34713 33676 gene locus_tag LOCUS_30400 34713 33676 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_30400 36630 34801 gene locus_tag LOCUS_30410 36630 34801 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_30410 37247 36708 gene locus_tag LOCUS_30420 37247 36708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 37687 37250 gene locus_tag LOCUS_30430 37687 37250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence056 43 4431 gene locus_tag LOCUS_30440 43 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 4473 5468 gene locus_tag LOCUS_30450 4473 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 6682 5564 gene locus_tag LOCUS_30460 gene nadA 6682 5564 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_30460 6855 7337 gene locus_tag LOCUS_30470 6855 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 7941 7264 gene locus_tag LOCUS_30480 7941 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 8691 8041 gene locus_tag LOCUS_30490 8691 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 10781 9453 gene locus_tag LOCUS_30500 10781 9453 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403605.1 protein_id gnl|my_center|LOCUS_30500 12233 10812 gene locus_tag LOCUS_30510 12233 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219770990.1 protein_id gnl|my_center|LOCUS_30510 13731 12421 gene locus_tag LOCUS_30520 13731 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036676.1 protein_id gnl|my_center|LOCUS_30520 16355 13848 gene locus_tag LOCUS_30530 16355 13848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403608.1 protein_id gnl|my_center|LOCUS_30530 16619 16374 gene locus_tag LOCUS_30540 16619 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 18010 16646 gene locus_tag LOCUS_30550 18010 16646 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_30550 19214 18111 gene locus_tag LOCUS_30560 19214 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 20527 19268 gene locus_tag LOCUS_30570 20527 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_30570 22025 20904 gene locus_tag LOCUS_30580 22025 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 22241 23476 gene locus_tag LOCUS_30590 gene tyrS 22241 23476 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_30590 24234 25250 gene locus_tag LOCUS_30600 gene aroF 24234 25250 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_30600 25338 26891 gene locus_tag LOCUS_30610 25338 26891 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583551.1 protein_id gnl|my_center|LOCUS_30610 27078 28031 gene locus_tag LOCUS_30620 27078 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 29900 28437 gene locus_tag LOCUS_30630 29900 28437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 30664 29921 gene locus_tag LOCUS_30640 30664 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 32147 30963 gene locus_tag LOCUS_30650 32147 30963 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444448.1 protein_id gnl|my_center|LOCUS_30650 33050 32148 gene locus_tag LOCUS_30660 gene rimK 33050 32148 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_30660 34422 33391 gene locus_tag LOCUS_30670 34422 33391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_30670 34687 34908 gene locus_tag LOCUS_30680 34687 34908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 35848 35045 gene locus_tag LOCUS_30690 35848 35045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 38002 35924 gene locus_tag LOCUS_30700 38002 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence057 1299 1132 gene locus_tag LOCUS_30710 1299 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1352 1654 gene locus_tag LOCUS_30720 1352 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1737 3476 gene locus_tag LOCUS_30730 1737 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3481 5859 gene locus_tag LOCUS_30740 3481 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 6532 7128 gene locus_tag LOCUS_30750 6532 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 8097 8915 gene locus_tag LOCUS_30760 8097 8915 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_30760 8971 10248 gene locus_tag LOCUS_30770 8971 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 10288 11031 gene locus_tag LOCUS_30780 10288 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 11094 12338 gene locus_tag LOCUS_30790 11094 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 12423 13454 gene locus_tag LOCUS_30800 12423 13454 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_30800 13772 14671 gene locus_tag LOCUS_30810 13772 14671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812851.1 protein_id gnl|my_center|LOCUS_30810 15699 14680 gene locus_tag LOCUS_30820 15699 14680 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_30820 17140 15713 gene locus_tag LOCUS_30830 17140 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 17643 18608 gene locus_tag LOCUS_30840 17643 18608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_30840 18605 19447 gene locus_tag LOCUS_30850 18605 19447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_30850 21837 19468 gene locus_tag LOCUS_30860 21837 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 23112 21937 gene locus_tag LOCUS_30870 23112 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 24614 23508 gene locus_tag LOCUS_30880 24614 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 26505 24691 gene locus_tag LOCUS_30890 26505 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 28373 27045 gene locus_tag LOCUS_30900 28373 27045 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_30900 28792 30417 gene locus_tag LOCUS_30910 28792 30417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 31498 30440 gene locus_tag LOCUS_30920 31498 30440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_30920 32692 31550 gene locus_tag LOCUS_30930 32692 31550 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_30930 34074 33865 gene locus_tag LOCUS_30940 34074 33865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 36491 34260 gene locus_tag LOCUS_30950 36491 34260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 36802 36575 gene locus_tag LOCUS_30960 36802 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 37113 36925 gene locus_tag LOCUS_30970 37113 36925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 37499 37362 gene locus_tag LOCUS_30980 37499 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence058 517 38 gene locus_tag LOCUS_30990 517 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1224 1553 gene locus_tag LOCUS_31000 1224 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1994 5143 gene locus_tag LOCUS_31010 gene glnE 1994 5143 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_31010 5188 6246 gene locus_tag LOCUS_31020 5188 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7099 6482 gene locus_tag LOCUS_31030 gene thiE 7099 6482 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_31030 8475 7105 gene locus_tag LOCUS_31040 gene rsmB 8475 7105 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_31040 8831 8568 gene locus_tag LOCUS_31050 gene rpsT 8831 8568 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533694.1 protein_id gnl|my_center|LOCUS_31050 10609 8993 gene locus_tag LOCUS_31060 10609 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 11388 12152 gene locus_tag LOCUS_31070 11388 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 12447 12244 gene locus_tag LOCUS_31080 12447 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 12643 13911 gene locus_tag LOCUS_31090 12643 13911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924694.1 protein_id gnl|my_center|LOCUS_31090 13911 14759 gene locus_tag LOCUS_31100 13911 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 14805 15572 gene locus_tag LOCUS_31110 gene accD 14805 15572 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_31110 15785 18061 gene locus_tag LOCUS_31120 gene topA 15785 18061 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_31120 18128 18799 gene locus_tag LOCUS_31130 gene ftsE 18128 18799 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_31130 19037 18837 gene locus_tag LOCUS_31140 19037 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 19149 19880 gene locus_tag LOCUS_31150 19149 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 19907 21658 gene locus_tag LOCUS_31160 gene polX 19907 21658 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_31160 21670 23601 gene locus_tag LOCUS_31170 21670 23601 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_31170 24988 23639 gene locus_tag LOCUS_31180 24988 23639 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_31180 26753 25182 gene locus_tag LOCUS_31190 26753 25182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 28277 26907 gene locus_tag LOCUS_31200 28277 26907 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_31200 28942 28382 gene locus_tag LOCUS_31210 gene gmhB 28942 28382 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_31210 30025 28976 gene locus_tag LOCUS_31220 gene rfaE1 30025 28976 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_31220 31517 30141 gene locus_tag LOCUS_31230 31517 30141 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_31230 32351 31797 gene locus_tag LOCUS_31240 32351 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 34082 33240 gene locus_tag LOCUS_31250 34082 33240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 35059 34127 gene locus_tag LOCUS_31260 35059 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 35492 36844 gene locus_tag LOCUS_31270 35492 36844 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence059 185 478 gene locus_tag LOCUS_31280 185 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 549 926 gene locus_tag LOCUS_31290 549 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 2716 929 gene locus_tag LOCUS_31300 2716 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3197 2784 gene locus_tag LOCUS_31310 gene nusB 3197 2784 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_31310 3655 3449 gene locus_tag LOCUS_31320 3655 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3711 5312 gene locus_tag LOCUS_31330 gene ggt 3711 5312 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_31330 5398 5733 gene locus_tag LOCUS_31340 5398 5733 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_31340 5791 6744 gene locus_tag LOCUS_31350 5791 6744 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174325.1 protein_id gnl|my_center|LOCUS_31350 7313 6747 gene locus_tag LOCUS_31360 7313 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 8280 7558 gene locus_tag LOCUS_31370 8280 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 9125 8415 gene locus_tag LOCUS_31380 9125 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 9799 10650 gene locus_tag LOCUS_31390 9799 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 10651 12243 gene locus_tag LOCUS_31400 10651 12243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_31400 12365 13330 gene locus_tag LOCUS_31410 12365 13330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_31410 13379 14338 gene locus_tag LOCUS_31420 13379 14338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_31420 17413 14348 gene locus_tag LOCUS_31430 17413 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 23852 17478 gene locus_tag LOCUS_31440 23852 17478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 24693 23872 gene locus_tag LOCUS_31450 24693 23872 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_31450 26613 24751 gene locus_tag LOCUS_31460 gene dxs 26613 24751 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_31460 26845 26594 gene locus_tag LOCUS_31470 gene xseB 26845 26594 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428410.1 protein_id gnl|my_center|LOCUS_31470 28163 26943 gene locus_tag LOCUS_31480 gene xseA 28163 26943 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_31480 29014 28214 gene locus_tag LOCUS_31490 29014 28214 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_31490 29691 29176 gene locus_tag LOCUS_31500 gene pyrE 29691 29176 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_31500 30483 29716 gene locus_tag LOCUS_31510 30483 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 31446 30838 gene locus_tag LOCUS_31520 31446 30838 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_31520 31655 33109 gene locus_tag LOCUS_31530 31655 33109 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_31530 33217 33543 gene locus_tag LOCUS_31540 33217 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 33562 33849 gene locus_tag LOCUS_31550 33562 33849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 33871 34089 gene locus_tag LOCUS_31560 33871 34089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 36744 34156 gene locus_tag LOCUS_31570 gene clpB 36744 34156 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence060 285 1082 gene locus_tag LOCUS_31580 285 1082 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_31580 1105 2253 gene locus_tag LOCUS_31590 gene bioB 1105 2253 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002111813.1 protein_id gnl|my_center|LOCUS_31590 3254 2283 gene locus_tag LOCUS_31600 3254 2283 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_31600 3752 3375 gene locus_tag LOCUS_31610 3752 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 4276 3794 gene locus_tag LOCUS_31620 4276 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5626 4337 gene locus_tag LOCUS_31630 gene serS 5626 4337 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 protein_id gnl|my_center|LOCUS_31630 6414 5713 gene locus_tag LOCUS_31640 6414 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6610 6534 gene locus_tag LOCUS_t00330 6610 6534 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6702 6628 gene locus_tag LOCUS_t00340 6702 6628 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7088 6885 gene locus_tag LOCUS_31650 7088 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 7531 7094 gene locus_tag LOCUS_31660 7531 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 8096 7503 gene locus_tag LOCUS_31670 8096 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937351.1 protein_id gnl|my_center|LOCUS_31670 8864 8133 gene locus_tag LOCUS_31680 8864 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 10129 8963 gene locus_tag LOCUS_31690 10129 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 10934 10200 gene locus_tag LOCUS_31700 10934 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 11765 11031 gene locus_tag LOCUS_31710 11765 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 12344 13093 gene locus_tag LOCUS_31720 12344 13093 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_31720 13096 14181 gene locus_tag LOCUS_31730 gene mutY 13096 14181 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_31730 15120 14167 gene locus_tag LOCUS_31740 15120 14167 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_31740 16171 15614 gene locus_tag LOCUS_31750 16171 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 17080 16460 gene locus_tag LOCUS_31760 17080 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 17917 17165 gene locus_tag LOCUS_31770 17917 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 18385 18053 gene locus_tag LOCUS_31780 18385 18053 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_31780 20001 18391 gene locus_tag LOCUS_31790 20001 18391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 20968 20081 gene locus_tag LOCUS_31800 20968 20081 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_31800 21627 21004 gene locus_tag LOCUS_31810 21627 21004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 22590 21631 gene locus_tag LOCUS_31820 22590 21631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 23309 22626 gene locus_tag LOCUS_31830 23309 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 23473 24438 gene locus_tag LOCUS_31840 23473 24438 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_31840 24957 24445 gene locus_tag LOCUS_31850 24957 24445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 26480 24972 gene locus_tag LOCUS_31860 26480 24972 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_31860 27864 27253 gene locus_tag LOCUS_31870 27864 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 28410 27895 gene locus_tag LOCUS_31880 28410 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 28940 28407 gene locus_tag LOCUS_31890 28940 28407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 30923 28971 gene locus_tag LOCUS_31900 30923 28971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 32447 31863 gene locus_tag LOCUS_31910 32447 31863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 33878 32448 gene locus_tag LOCUS_31920 33878 32448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 34568 34293 gene locus_tag LOCUS_31930 34568 34293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 35125 34601 gene locus_tag LOCUS_31940 35125 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 35808 35227 gene locus_tag LOCUS_31950 35808 35227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence061 615 397 gene locus_tag LOCUS_31960 615 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1253 795 gene locus_tag LOCUS_31970 1253 795 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155237.1 protein_id gnl|my_center|LOCUS_31970 2527 1601 gene locus_tag LOCUS_31980 2527 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3629 2691 gene locus_tag LOCUS_31990 gene xerD 3629 2691 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_31990 4410 3640 gene locus_tag LOCUS_32000 4410 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 4922 5893 gene locus_tag LOCUS_32010 4922 5893 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807348.1 protein_id gnl|my_center|LOCUS_32010 5906 6709 gene locus_tag LOCUS_32020 5906 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 6731 7609 gene locus_tag LOCUS_32030 6731 7609 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_32030 7624 8043 gene locus_tag LOCUS_32040 7624 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 8060 10237 gene locus_tag LOCUS_32050 8060 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 10726 11916 gene locus_tag LOCUS_32060 10726 11916 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_32060 11916 12512 gene locus_tag LOCUS_32070 11916 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 12567 13607 gene locus_tag LOCUS_32080 12567 13607 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_32080 15191 13782 gene locus_tag LOCUS_32090 15191 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 16095 15640 gene locus_tag LOCUS_32100 16095 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 17338 16220 gene locus_tag LOCUS_32110 17338 16220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 19127 17544 gene locus_tag LOCUS_32120 gene serA 19127 17544 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142136.1 protein_id gnl|my_center|LOCUS_32120 20184 21698 gene locus_tag LOCUS_32130 20184 21698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 21782 22681 gene locus_tag LOCUS_32140 21782 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 22713 23351 gene locus_tag LOCUS_32150 22713 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 23361 24404 gene locus_tag LOCUS_32160 23361 24404 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_32160 24635 25402 gene locus_tag LOCUS_32170 24635 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 26851 25805 gene locus_tag LOCUS_32180 26851 25805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 27066 28568 gene locus_tag LOCUS_32190 gene guaB 27066 28568 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_32190 29379 28894 gene locus_tag LOCUS_32200 29379 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 29873 30883 gene locus_tag LOCUS_32210 29873 30883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 30961 31899 gene locus_tag LOCUS_32220 30961 31899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 32000 32860 gene locus_tag LOCUS_32230 32000 32860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 32936 33961 gene locus_tag LOCUS_32240 32936 33961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 34072 34482 gene locus_tag LOCUS_32250 34072 34482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 34536 34961 gene locus_tag LOCUS_32260 34536 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 35043 36032 gene locus_tag LOCUS_32270 35043 36032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence062 5602 4598 gene locus_tag LOCUS_32280 5602 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 6638 5676 gene locus_tag LOCUS_32290 gene comC 6638 5676 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_32290 6762 7169 gene locus_tag LOCUS_32300 6762 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 7166 8722 gene locus_tag LOCUS_32310 7166 8722 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_32310 8741 9157 gene locus_tag LOCUS_32320 8741 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 9914 10501 gene locus_tag LOCUS_32330 9914 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 13398 10600 gene locus_tag LOCUS_32340 13398 10600 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_32340 15173 13473 gene locus_tag LOCUS_32350 15173 13473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 16447 15176 gene locus_tag LOCUS_32360 16447 15176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_32360 17554 16508 gene locus_tag LOCUS_32370 17554 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 17975 18556 gene locus_tag LOCUS_32380 17975 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 18581 19108 gene locus_tag LOCUS_32390 18581 19108 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_32390 19152 19379 gene locus_tag LOCUS_32400 19152 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 20483 19536 gene locus_tag LOCUS_32410 20483 19536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_32410 20902 20645 gene locus_tag LOCUS_32420 20902 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 21761 21108 gene locus_tag LOCUS_32430 21761 21108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 23055 21748 gene locus_tag LOCUS_32440 23055 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 24627 23233 gene locus_tag LOCUS_32450 24627 23233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 24890 26119 gene locus_tag LOCUS_32460 24890 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 27313 26132 gene locus_tag LOCUS_32470 27313 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 27992 31378 gene locus_tag LOCUS_32480 27992 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 32001 34178 gene locus_tag LOCUS_32490 32001 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence063 <1 2488 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgcaccaatttggaattgaaac 3135 2728 gene locus_tag LOCUS_32500 3135 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 3751 4377 gene locus_tag LOCUS_32510 3751 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 4652 4392 gene locus_tag LOCUS_32520 4652 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 5004 4828 gene locus_tag LOCUS_32530 5004 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 5986 5063 gene locus_tag LOCUS_32540 5986 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 6466 6738 gene locus_tag LOCUS_32550 6466 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 7187 7447 gene locus_tag LOCUS_32560 7187 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 7579 9893 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgcaccaatttggaattgaaac 9898 9974 gene locus_tag LOCUS_t00350 9898 9974 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10742 10455 gene locus_tag LOCUS_32570 10742 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 11043 11894 gene locus_tag LOCUS_32580 11043 11894 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_32580 11901 13169 gene locus_tag LOCUS_32590 11901 13169 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_32590 13166 13762 gene locus_tag LOCUS_32600 13166 13762 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117923.1 protein_id gnl|my_center|LOCUS_32600 13815 15218 gene locus_tag LOCUS_32610 13815 15218 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_32610 15814 17361 gene locus_tag LOCUS_32620 15814 17361 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_32620 17819 18664 gene locus_tag LOCUS_32630 17819 18664 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_32630 18715 20670 gene locus_tag LOCUS_32640 18715 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 20718 21653 gene locus_tag LOCUS_32650 20718 21653 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_32650 21676 22605 gene locus_tag LOCUS_32660 21676 22605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_32660 22725 25520 gene locus_tag LOCUS_32670 22725 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 27436 26273 gene locus_tag LOCUS_32680 gene tgt 27436 26273 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_32680 27686 29242 gene locus_tag LOCUS_32690 27686 29242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 29327 30574 gene locus_tag LOCUS_32700 gene icd 29327 30574 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_32700 30558 30746 gene locus_tag LOCUS_32710 30558 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 30797 31720 gene locus_tag LOCUS_32720 30797 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 31858 33345 gene locus_tag LOCUS_32730 31858 33345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 33347 34435 gene locus_tag LOCUS_32740 33347 34435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 34546 35703 gene locus_tag LOCUS_32750 34546 35703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 35657 36034 gene locus_tag LOCUS_32760 35657 36034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence064 800 336 gene locus_tag LOCUS_32770 800 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1042 2070 gene locus_tag LOCUS_32780 gene iolW 1042 2070 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968169.1 protein_id gnl|my_center|LOCUS_32780 2150 3166 gene locus_tag LOCUS_32790 2150 3166 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_32790 4009 4854 gene locus_tag LOCUS_32800 4009 4854 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_32800 5252 6097 gene locus_tag LOCUS_32810 5252 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 6112 7737 gene locus_tag LOCUS_32820 6112 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 6947 7107 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaaatgacaacgaaaataatggt 7784 9067 gene locus_tag LOCUS_32830 gene obgE 7784 9067 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_32830 9079 10275 gene locus_tag LOCUS_32840 gene proB 9079 10275 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_32840 11323 10298 gene locus_tag LOCUS_32850 gene xylF 11323 10298 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_32850 12688 11438 gene locus_tag LOCUS_32860 12688 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 13347 13153 gene locus_tag LOCUS_32870 13347 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 13390 14343 gene locus_tag LOCUS_32880 13390 14343 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_32880 14350 15705 gene locus_tag LOCUS_32890 14350 15705 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259740.1 protein_id gnl|my_center|LOCUS_32890 16677 15736 gene locus_tag LOCUS_32900 16677 15736 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_32900 17373 17753 gene locus_tag LOCUS_32910 17373 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 19711 17792 gene locus_tag LOCUS_32920 19711 17792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32920 20860 19745 gene locus_tag LOCUS_32930 20860 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32930 21018 21842 gene locus_tag LOCUS_32940 21018 21842 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_32940 21851 22654 gene locus_tag LOCUS_32950 21851 22654 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463673.1 protein_id gnl|my_center|LOCUS_32950 22658 23662 gene locus_tag LOCUS_32960 22658 23662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 24792 23659 gene locus_tag LOCUS_32970 gene queG 24792 23659 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294212.1 protein_id gnl|my_center|LOCUS_32970 25917 24853 gene locus_tag LOCUS_32980 gene pheA 25917 24853 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_32980 26292 26167 gene locus_tag LOCUS_32990 26292 26167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 27049 26363 gene locus_tag LOCUS_33000 27049 26363 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_33000 30662 27246 gene locus_tag LOCUS_33010 30662 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 33654 30742 gene locus_tag LOCUS_33020 33654 30742 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_33020 34636 33983 gene locus_tag LOCUS_33030 34636 33983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 35173 34763 gene locus_tag LOCUS_33040 35173 34763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence065 540 992 gene locus_tag LOCUS_33050 540 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 2220 1024 gene locus_tag LOCUS_33060 2220 1024 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_33060 2730 2230 gene locus_tag LOCUS_33070 2730 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3056 2727 gene locus_tag LOCUS_33080 3056 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 6763 3479 gene locus_tag LOCUS_33090 6763 3479 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_33090 9959 6966 gene locus_tag LOCUS_33100 9959 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 11067 10018 gene locus_tag LOCUS_33110 11067 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 12577 11264 gene locus_tag LOCUS_33120 12577 11264 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_33120 13176 12964 gene locus_tag LOCUS_33130 13176 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 14600 13140 gene locus_tag LOCUS_33140 14600 13140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 15385 14615 gene locus_tag LOCUS_33150 15385 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 16242 15385 gene locus_tag LOCUS_33160 gene prcB 16242 15385 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_33160 16439 16242 gene locus_tag LOCUS_33170 16439 16242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 18022 16502 gene locus_tag LOCUS_33180 gene dop 18022 16502 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_33180 19861 18086 gene locus_tag LOCUS_33190 gene arc 19861 18086 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_33190 21069 20341 gene locus_tag LOCUS_33200 21069 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 21377 21036 gene locus_tag LOCUS_33210 21377 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 22075 21374 gene locus_tag LOCUS_33220 22075 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 23310 22648 gene locus_tag LOCUS_33230 23310 22648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 23777 23523 gene locus_tag LOCUS_33240 23777 23523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 24025 25263 gene locus_tag LOCUS_33250 24025 25263 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_33250 25370 27106 gene locus_tag LOCUS_33260 25370 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 27113 28402 gene locus_tag LOCUS_33270 27113 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 28465 29025 gene locus_tag LOCUS_33280 28465 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 29164 30912 gene locus_tag LOCUS_33290 29164 30912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 31153 32262 gene locus_tag LOCUS_33300 31153 32262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 32452 33564 gene locus_tag LOCUS_33310 32452 33564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 33554 34060 gene locus_tag LOCUS_33320 33554 34060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 34730 35212 gene locus_tag LOCUS_33330 34730 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 35316 35510 gene locus_tag LOCUS_33340 35316 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 >Feature sequence066 1316 198 gene locus_tag LOCUS_33350 1316 198 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_33350 2977 1451 gene locus_tag LOCUS_33360 2977 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 4821 3118 gene locus_tag LOCUS_33370 4821 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33370 7307 5211 gene locus_tag LOCUS_33380 7307 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 9379 7304 gene locus_tag LOCUS_33390 9379 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 10414 9413 gene locus_tag LOCUS_33400 10414 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 11463 10453 gene locus_tag LOCUS_33410 11463 10453 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_33410 13103 11475 gene locus_tag LOCUS_33420 13103 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 14449 13100 gene locus_tag LOCUS_33430 14449 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 15381 14488 gene locus_tag LOCUS_33440 15381 14488 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_33440 16385 15396 gene locus_tag LOCUS_33450 16385 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 17719 16436 gene locus_tag LOCUS_33460 17719 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 18206 17805 gene locus_tag LOCUS_33470 gene rfaE2 18206 17805 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_33470 19198 18203 gene locus_tag LOCUS_33480 19198 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 21931 19304 gene locus_tag LOCUS_33490 21931 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 23846 22158 gene locus_tag LOCUS_33500 23846 22158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 25948 23873 gene locus_tag LOCUS_33510 25948 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 26779 26117 gene locus_tag LOCUS_33520 26779 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 28067 26865 gene locus_tag LOCUS_33530 28067 26865 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140466.1 protein_id gnl|my_center|LOCUS_33530 28976 28074 gene locus_tag LOCUS_33540 28976 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 31596 29032 gene locus_tag LOCUS_33550 31596 29032 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_33550 33034 31643 gene locus_tag LOCUS_33560 33034 31643 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_33560 33403 34860 gene locus_tag LOCUS_33570 33403 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 35123 34872 gene locus_tag LOCUS_33580 35123 34872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence067 564 181 gene locus_tag LOCUS_33590 564 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255945.1 protein_id gnl|my_center|LOCUS_33590 613 1215 gene locus_tag LOCUS_33600 613 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 1196 2422 gene locus_tag LOCUS_33610 gene megL 1196 2422 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_33610 4106 2775 gene locus_tag LOCUS_33620 4106 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 4864 6060 gene locus_tag LOCUS_33630 4864 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 6136 7158 gene locus_tag LOCUS_33640 6136 7158 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_33640 7566 8765 gene locus_tag LOCUS_33650 7566 8765 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_33650 8787 10037 gene locus_tag LOCUS_33660 8787 10037 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_33660 10095 10850 gene locus_tag LOCUS_33670 10095 10850 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_33670 10875 11078 gene locus_tag LOCUS_33680 10875 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 11451 11101 gene locus_tag LOCUS_33690 11451 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 11665 12423 gene locus_tag LOCUS_33700 11665 12423 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_33700 12443 13210 gene locus_tag LOCUS_33710 gene cas6 12443 13210 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_33710 14918 16612 gene locus_tag LOCUS_33720 14918 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 16605 17555 gene locus_tag LOCUS_33730 16605 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 17610 18278 gene locus_tag LOCUS_33740 17610 18278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 18262 20709 gene locus_tag LOCUS_33750 gene cas3 18262 20709 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869875.1 protein_id gnl|my_center|LOCUS_33750 20860 21543 gene locus_tag LOCUS_33760 20860 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 21739 24066 gene locus_tag LOCUS_33770 gene cas10 21739 24066 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256465.1 protein_id gnl|my_center|LOCUS_33770 24120 24689 gene locus_tag LOCUS_33780 24120 24689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 24700 25530 gene locus_tag LOCUS_33790 gene csm3 24700 25530 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256463.1 protein_id gnl|my_center|LOCUS_33790 25619 26674 gene locus_tag LOCUS_33800 gene csm4 25619 26674 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_33800 26671 27825 gene locus_tag LOCUS_33810 gene csm5 26671 27825 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_33810 27840 28967 gene locus_tag LOCUS_33820 27840 28967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 29043 29552 gene locus_tag LOCUS_33830 gene cas4 29043 29552 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545751.1 protein_id gnl|my_center|LOCUS_33830 29783 30778 gene locus_tag LOCUS_33840 gene cas1b 29783 30778 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_33840 30858 31121 gene locus_tag LOCUS_33850 gene cas2 30858 31121 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249400.1 protein_id gnl|my_center|LOCUS_33850 31690 34312 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgcaccaatttggaattgaaac >Feature sequence068 947 471 gene locus_tag LOCUS_33860 947 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 1964 1182 gene locus_tag LOCUS_33870 1964 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 2799 2230 gene locus_tag LOCUS_33880 gene hpt 2799 2230 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582585.1 protein_id gnl|my_center|LOCUS_33880 4189 2774 gene locus_tag LOCUS_33890 gene tilS 4189 2774 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_33890 4284 4211 gene locus_tag LOCUS_t00360 4284 4211 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4568 5809 gene locus_tag LOCUS_33900 4568 5809 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_33900 6818 5835 gene locus_tag LOCUS_33910 6818 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 7471 6851 gene locus_tag LOCUS_33920 7471 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 9811 7724 gene locus_tag LOCUS_33930 9811 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 10955 9897 gene locus_tag LOCUS_33940 10955 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 13533 11467 gene locus_tag LOCUS_33950 13533 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 14989 13571 gene locus_tag LOCUS_33960 14989 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 15254 16051 gene locus_tag LOCUS_33970 15254 16051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 16256 16053 gene locus_tag LOCUS_33980 16256 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 17148 16312 gene locus_tag LOCUS_33990 17148 16312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_33990 17203 18138 gene locus_tag LOCUS_34000 17203 18138 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048526434.1 protein_id gnl|my_center|LOCUS_34000 18563 18132 gene locus_tag LOCUS_34010 18563 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 20009 18852 gene locus_tag LOCUS_34020 20009 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 20506 20111 gene locus_tag LOCUS_34030 20506 20111 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_34030 21358 20531 gene locus_tag LOCUS_34040 21358 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 23265 21355 gene locus_tag LOCUS_34050 gene ftsH 23265 21355 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_34050 23672 24376 gene locus_tag LOCUS_34060 23672 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 24384 24635 gene locus_tag LOCUS_34070 24384 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 25716 24757 gene locus_tag LOCUS_34080 25716 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 25947 26675 gene locus_tag LOCUS_34090 25947 26675 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_34090 26672 28903 gene locus_tag LOCUS_34100 26672 28903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 29243 31546 gene locus_tag LOCUS_34110 29243 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 31605 32702 gene locus_tag LOCUS_34120 31605 32702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 >Feature sequence069 512 360 gene locus_tag LOCUS_34130 512 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 1954 635 gene locus_tag LOCUS_34140 1954 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2461 2267 gene locus_tag LOCUS_34150 2461 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 4810 2633 gene locus_tag LOCUS_34160 4810 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 5466 4813 gene locus_tag LOCUS_34170 5466 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109928.1 protein_id gnl|my_center|LOCUS_34170 7179 5752 gene locus_tag LOCUS_34180 7179 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 9539 7254 gene locus_tag LOCUS_34190 9539 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 10392 9574 gene locus_tag LOCUS_34200 10392 9574 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_34200 10571 10416 gene locus_tag LOCUS_34210 10571 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 14505 11023 gene locus_tag LOCUS_34220 14505 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_34220 15433 14498 gene locus_tag LOCUS_34230 15433 14498 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_34230 15586 18294 gene locus_tag LOCUS_34240 gene glnD 15586 18294 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_34240 18307 19068 gene locus_tag LOCUS_34250 18307 19068 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_34250 19065 19763 gene locus_tag LOCUS_34260 gene trmB 19065 19763 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266083.1 protein_id gnl|my_center|LOCUS_34260 19776 20354 gene locus_tag LOCUS_34270 19776 20354 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_34270 20360 22231 gene locus_tag LOCUS_34280 gene uvrC 20360 22231 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_34280 22976 25603 gene locus_tag LOCUS_34290 22976 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 27122 25962 gene locus_tag LOCUS_34300 gene nifS 27122 25962 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_34300 28025 27222 gene locus_tag LOCUS_34310 28025 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 29576 28224 gene locus_tag LOCUS_34320 29576 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481819.1 protein_id gnl|my_center|LOCUS_34320 30808 30206 gene locus_tag LOCUS_34330 30808 30206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 32636 30849 gene locus_tag LOCUS_34340 gene thrS 32636 30849 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663074.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence070 2305 554 gene locus_tag LOCUS_34350 gene msbA 2305 554 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_34350 3570 2446 gene locus_tag LOCUS_34360 3570 2446 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496787.1 protein_id gnl|my_center|LOCUS_34360 4455 3583 gene locus_tag LOCUS_34370 gene sppA 4455 3583 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_34370 5188 4508 gene locus_tag LOCUS_34380 5188 4508 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_34380 7403 5424 gene locus_tag LOCUS_34390 7403 5424 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_34390 8691 7477 gene locus_tag LOCUS_34400 8691 7477 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259616.1 protein_id gnl|my_center|LOCUS_34400 8924 8727 gene locus_tag LOCUS_34410 8924 8727 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_34410 11690 8994 gene locus_tag LOCUS_34420 gene secA 11690 8994 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_34420 12912 11785 gene locus_tag LOCUS_34430 12912 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 13279 14211 gene locus_tag LOCUS_34440 gene porV 13279 14211 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_34440 14930 14223 gene locus_tag LOCUS_34450 14930 14223 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_34450 15868 16770 gene locus_tag LOCUS_34460 gene yihU 15868 16770 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718883.1 protein_id gnl|my_center|LOCUS_34460 16835 17578 gene locus_tag LOCUS_34470 16835 17578 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_34470 17581 18804 gene locus_tag LOCUS_34480 17581 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 18788 19924 gene locus_tag LOCUS_34490 18788 19924 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_34490 20041 21393 gene locus_tag LOCUS_34500 20041 21393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 21411 22010 gene locus_tag LOCUS_34510 21411 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 22035 22931 gene locus_tag LOCUS_34520 22035 22931 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_34520 23746 22946 gene locus_tag LOCUS_34530 gene trpA 23746 22946 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_34530 24140 23862 gene locus_tag LOCUS_34540 24140 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 24797 24195 gene locus_tag LOCUS_34550 24797 24195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 26103 24910 gene locus_tag LOCUS_34560 gene trpB 26103 24910 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_34560 27162 26152 gene locus_tag LOCUS_34570 27162 26152 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_34570 28585 27200 gene locus_tag LOCUS_34580 28585 27200 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_34580 29249 28659 gene locus_tag LOCUS_34590 29249 28659 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_34590 30452 29325 gene locus_tag LOCUS_34600 30452 29325 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_34600 31774 30725 gene locus_tag LOCUS_34610 31774 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 >Feature sequence071 458 673 gene locus_tag LOCUS_34620 458 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 922 1518 gene locus_tag LOCUS_34630 922 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 1491 1829 gene locus_tag LOCUS_34640 1491 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1930 2373 gene locus_tag LOCUS_34650 1930 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 2622 5561 gene locus_tag LOCUS_34660 2622 5561 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_34660 5573 7003 gene locus_tag LOCUS_34670 5573 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 7007 7828 gene locus_tag LOCUS_34680 7007 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 7851 8645 gene locus_tag LOCUS_34690 7851 8645 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_34690 9089 8673 gene locus_tag LOCUS_34700 9089 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 9854 9105 gene locus_tag LOCUS_34710 9854 9105 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_34710 10051 10311 gene locus_tag LOCUS_34720 10051 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 10648 11691 gene locus_tag LOCUS_34730 gene argC 10648 11691 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_34730 11748 12893 gene locus_tag LOCUS_34740 gene lpxB 11748 12893 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_34740 12890 13990 gene locus_tag LOCUS_34750 gene lpxK 12890 13990 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_34750 14897 13992 gene locus_tag LOCUS_34760 14897 13992 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_34760 16934 15003 gene locus_tag LOCUS_34770 16934 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 17252 18373 gene locus_tag LOCUS_34780 gene dnaN 17252 18373 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_34780 18567 19676 gene locus_tag LOCUS_34790 gene dnaN 18567 19676 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_34790 19758 20225 gene locus_tag LOCUS_34800 19758 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 23051 20301 gene locus_tag LOCUS_34810 23051 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 24265 23348 gene locus_tag LOCUS_34820 24265 23348 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_34820 25474 24392 gene locus_tag LOCUS_34830 25474 24392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 26485 25646 gene locus_tag LOCUS_34840 gene nadC 26485 25646 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_34840 27181 26726 gene locus_tag LOCUS_34850 27181 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 28294 27380 gene locus_tag LOCUS_34860 28294 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 29599 28385 gene locus_tag LOCUS_34870 29599 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 30779 29673 gene locus_tag LOCUS_34880 30779 29673 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_34880 31419 32594 gene locus_tag LOCUS_34890 31419 32594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence072 2210 360 gene locus_tag LOCUS_34900 2210 360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_34900 2699 3343 gene locus_tag LOCUS_34910 gene udk 2699 3343 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 protein_id gnl|my_center|LOCUS_34910 3694 4146 gene locus_tag LOCUS_34920 3694 4146 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_34920 4237 4692 gene locus_tag LOCUS_34930 4237 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 4838 5476 gene locus_tag LOCUS_34940 4838 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 6193 5549 gene locus_tag LOCUS_34950 6193 5549 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728175.1 protein_id gnl|my_center|LOCUS_34950 7860 6502 gene locus_tag LOCUS_34960 7860 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 9328 7955 gene locus_tag LOCUS_34970 9328 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 9950 9342 gene locus_tag LOCUS_34980 9950 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 11061 10186 gene locus_tag LOCUS_34990 11061 10186 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_34990 11240 12613 gene locus_tag LOCUS_35000 11240 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 12957 12625 gene locus_tag LOCUS_35010 12957 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 13963 13040 gene locus_tag LOCUS_35020 gene aroE 13963 13040 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_35020 17818 14135 gene locus_tag LOCUS_35030 17818 14135 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_35030 19535 17844 gene locus_tag LOCUS_35040 gene recN 19535 17844 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678799.1 protein_id gnl|my_center|LOCUS_35040 20491 19628 gene locus_tag LOCUS_35050 20491 19628 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_35050 21507 20488 gene locus_tag LOCUS_35060 21507 20488 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 protein_id gnl|my_center|LOCUS_35060 22451 24004 gene locus_tag LOCUS_35070 22451 24004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 24231 25640 gene locus_tag LOCUS_35080 24231 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 25791 27215 gene locus_tag LOCUS_35090 25791 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 27380 28888 gene locus_tag LOCUS_35100 27380 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 28973 30379 gene locus_tag LOCUS_35110 28973 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 30505 31617 gene locus_tag LOCUS_35120 30505 31617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence073 406 1446 gene locus_tag LOCUS_35130 gene dusB 406 1446 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_35130 1494 2327 gene locus_tag LOCUS_35140 gene dapF 1494 2327 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_35140 2376 3251 gene locus_tag LOCUS_35150 gene dapA 2376 3251 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_35150 3360 4448 gene locus_tag LOCUS_35160 3360 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 5343 4423 gene locus_tag LOCUS_35170 5343 4423 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110609.1 protein_id gnl|my_center|LOCUS_35170 6319 5360 gene locus_tag LOCUS_35180 6319 5360 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_35180 6504 7832 gene locus_tag LOCUS_35190 6504 7832 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_35190 8173 7808 gene locus_tag LOCUS_35200 8173 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 8508 8170 gene locus_tag LOCUS_35210 8508 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 8887 8561 gene locus_tag LOCUS_35220 8887 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9222 8884 gene locus_tag LOCUS_35230 9222 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35230 9601 9275 gene locus_tag LOCUS_35240 9601 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 9936 9598 gene locus_tag LOCUS_35250 9936 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 10312 9989 gene locus_tag LOCUS_35260 10312 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 10647 10309 gene locus_tag LOCUS_35270 10647 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35270 10910 11716 gene locus_tag LOCUS_35280 10910 11716 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_35280 11777 13171 gene locus_tag LOCUS_35290 11777 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 13283 14104 gene locus_tag LOCUS_35300 13283 14104 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_35300 14290 17124 gene locus_tag LOCUS_35310 14290 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 17136 17264 gene locus_tag LOCUS_35320 17136 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 17411 20098 gene locus_tag LOCUS_35330 17411 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 20405 20698 gene locus_tag LOCUS_35340 20405 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 20670 20963 gene locus_tag LOCUS_35350 20670 20963 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_35350 21058 23454 gene locus_tag LOCUS_35360 gene purL 21058 23454 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_35360 23497 24297 gene locus_tag LOCUS_35370 23497 24297 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_35370 24294 24728 gene locus_tag LOCUS_35380 24294 24728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 24785 26500 gene locus_tag LOCUS_35390 24785 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 26560 28302 gene locus_tag LOCUS_35400 26560 28302 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_35400 28378 31683 gene locus_tag LOCUS_35410 28378 31683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 31695 32579 gene locus_tag LOCUS_35420 31695 32579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence074 9061 9801 gene locus_tag LOCUS_35430 9061 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 11055 10243 gene locus_tag LOCUS_35440 11055 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 12682 11258 gene locus_tag LOCUS_35450 gene hemY 12682 11258 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740655.1 protein_id gnl|my_center|LOCUS_35450 13674 12730 gene locus_tag LOCUS_35460 13674 12730 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_35460 15141 13684 gene locus_tag LOCUS_35470 15141 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 16154 15150 gene locus_tag LOCUS_35480 gene hemE 16154 15150 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_35480 16977 16234 gene locus_tag LOCUS_35490 16977 16234 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258373.1 protein_id gnl|my_center|LOCUS_35490 17815 17024 gene locus_tag LOCUS_35500 17815 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 18256 17912 gene locus_tag LOCUS_35510 18256 17912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 19340 18270 gene locus_tag LOCUS_35520 19340 18270 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_35520 20824 20426 gene locus_tag LOCUS_35530 gene rplL 20824 20426 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_35530 21419 20859 gene locus_tag LOCUS_35540 gene rplJ 21419 20859 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 protein_id gnl|my_center|LOCUS_35540 22658 21960 gene locus_tag LOCUS_35550 gene rplA 22658 21960 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_35550 23108 22686 gene locus_tag LOCUS_35560 gene rplK 23108 22686 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_35560 23717 23139 gene locus_tag LOCUS_35570 gene nusG 23717 23139 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_35570 24091 23714 gene locus_tag LOCUS_35580 24091 23714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 24174 24098 gene locus_tag LOCUS_t00370 24174 24098 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 24442 24367 gene locus_tag LOCUS_t00380 24442 24367 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 24532 24460 gene locus_tag LOCUS_t00390 24532 24460 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24626 24543 gene locus_tag LOCUS_t00400 24626 24543 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 24703 24632 gene locus_tag LOCUS_t00410 24703 24632 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25227 24838 gene locus_tag LOCUS_35590 25227 24838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 25370 26437 gene locus_tag LOCUS_35600 gene mqnC 25370 26437 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_35600 28413 26434 gene locus_tag LOCUS_35610 28413 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 28533 29432 gene locus_tag LOCUS_35620 28533 29432 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_35620 29529 29891 gene locus_tag LOCUS_35630 29529 29891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 29944 31041 gene locus_tag LOCUS_35640 29944 31041 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_35640 31170 31748 gene locus_tag LOCUS_35650 31170 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 32147 32063 gene locus_tag LOCUS_t00420 32147 32063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 467 1042 gene locus_tag LOCUS_35660 467 1042 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033837886.1 protein_id gnl|my_center|LOCUS_35660 1795 4413 gene locus_tag LOCUS_35670 1795 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4433 6490 gene locus_tag LOCUS_35680 4433 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35680 6509 8659 gene locus_tag LOCUS_35690 6509 8659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35690 8846 11455 gene locus_tag LOCUS_35700 8846 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 11564 14173 gene locus_tag LOCUS_35710 11564 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 14263 16959 gene locus_tag LOCUS_35720 14263 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 17192 16965 gene locus_tag LOCUS_35730 17192 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 17196 17813 gene locus_tag LOCUS_35740 gene cysC 17196 17813 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 protein_id gnl|my_center|LOCUS_35740 17905 18858 gene locus_tag LOCUS_35750 17905 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 18871 19980 gene locus_tag LOCUS_35760 18871 19980 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_35760 19980 20300 gene locus_tag LOCUS_35770 19980 20300 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173319.1 protein_id gnl|my_center|LOCUS_35770 20335 21516 gene locus_tag LOCUS_35780 20335 21516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 21533 23053 gene locus_tag LOCUS_35790 21533 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 23096 23944 gene locus_tag LOCUS_35800 23096 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 24111 24959 gene locus_tag LOCUS_35810 24111 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 26061 25036 gene locus_tag LOCUS_35820 26061 25036 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_35820 26718 27299 gene locus_tag LOCUS_35830 26718 27299 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789731.1 protein_id gnl|my_center|LOCUS_35830 27311 27928 gene locus_tag LOCUS_35840 27311 27928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 27965 29941 gene locus_tag LOCUS_35850 27965 29941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 30126 30965 gene locus_tag LOCUS_35860 gene folD 30126 30965 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_35860 31039 31803 gene locus_tag LOCUS_35870 31039 31803 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence076 320 93 gene locus_tag LOCUS_35880 320 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1889 480 gene locus_tag LOCUS_35890 1889 480 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_35890 2598 1897 gene locus_tag LOCUS_35900 2598 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 2927 2613 gene locus_tag LOCUS_35910 2927 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 3737 2943 gene locus_tag LOCUS_35920 3737 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 4882 3809 gene locus_tag LOCUS_35930 4882 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_35930 6713 5184 gene locus_tag LOCUS_35940 6713 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 7670 6717 gene locus_tag LOCUS_35950 7670 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35950 8986 7670 gene locus_tag LOCUS_35960 8986 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 9963 9121 gene locus_tag LOCUS_35970 9963 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 11085 10153 gene locus_tag LOCUS_35980 11085 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 11625 11359 gene locus_tag LOCUS_35990 11625 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 11785 12516 gene locus_tag LOCUS_36000 11785 12516 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_36000 12884 14311 gene locus_tag LOCUS_36010 12884 14311 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_36010 14329 15708 gene locus_tag LOCUS_36020 14329 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 16522 15713 gene locus_tag LOCUS_36030 16522 15713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 17384 16893 gene locus_tag LOCUS_36040 17384 16893 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919089.1 protein_id gnl|my_center|LOCUS_36040 17665 17459 gene locus_tag LOCUS_36050 17665 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 18049 18921 gene locus_tag LOCUS_36060 18049 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 18980 20017 gene locus_tag LOCUS_36070 18980 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 20604 22418 gene locus_tag LOCUS_36080 20604 22418 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_36080 22583 23269 gene locus_tag LOCUS_36090 22583 23269 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841351.1 protein_id gnl|my_center|LOCUS_36090 23346 24149 gene locus_tag LOCUS_36100 23346 24149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 24225 24800 gene locus_tag LOCUS_36110 24225 24800 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963846.1 protein_id gnl|my_center|LOCUS_36110 24819 25622 gene locus_tag LOCUS_36120 24819 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 25644 26579 gene locus_tag LOCUS_36130 25644 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 26602 28242 gene locus_tag LOCUS_36140 26602 28242 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_36140 29423 28266 gene locus_tag LOCUS_36150 gene rhmD 29423 28266 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_36150 29901 30653 gene locus_tag LOCUS_36160 29901 30653 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 protein_id gnl|my_center|LOCUS_36160 31343 30705 gene locus_tag LOCUS_36170 31343 30705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence077 183 3911 gene locus_tag LOCUS_36180 183 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 5964 4060 gene locus_tag LOCUS_36190 5964 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 6369 8027 gene locus_tag LOCUS_36200 6369 8027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_36200 8029 9741 gene locus_tag LOCUS_36210 8029 9741 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_36210 9772 10803 gene locus_tag LOCUS_36220 9772 10803 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_36220 11023 12144 gene locus_tag LOCUS_36230 11023 12144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 12838 13254 gene locus_tag LOCUS_36240 12838 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 13573 14277 gene locus_tag LOCUS_36250 13573 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 14291 15409 gene locus_tag LOCUS_36260 14291 15409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 15827 16564 gene locus_tag LOCUS_36270 15827 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 17421 16861 gene locus_tag LOCUS_36280 17421 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 17866 17423 gene locus_tag LOCUS_36290 17866 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 18362 18075 gene locus_tag LOCUS_36300 18362 18075 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_36300 18484 19710 gene locus_tag LOCUS_36310 18484 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 19714 20460 gene locus_tag LOCUS_36320 19714 20460 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_36320 21990 20572 gene locus_tag LOCUS_36330 21990 20572 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_36330 23425 22028 gene locus_tag LOCUS_36340 23425 22028 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_36340 26523 23506 gene locus_tag LOCUS_36350 26523 23506 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_36350 29595 26584 gene locus_tag LOCUS_36360 29595 26584 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_36360 >Feature sequence078 308 1135 gene locus_tag LOCUS_36370 308 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 1210 1818 gene locus_tag LOCUS_36380 1210 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 1893 2726 gene locus_tag LOCUS_36390 1893 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 2833 6426 gene locus_tag LOCUS_36400 gene mfd 2833 6426 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_36400 6485 7459 gene locus_tag LOCUS_36410 6485 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 7493 8470 gene locus_tag LOCUS_36420 7493 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 8569 9900 gene locus_tag LOCUS_36430 8569 9900 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_36430 9907 13716 gene locus_tag LOCUS_36440 9907 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 13744 14526 gene locus_tag LOCUS_36450 gene fabG 13744 14526 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_36450 14550 15101 gene locus_tag LOCUS_36460 14550 15101 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765863.1 protein_id gnl|my_center|LOCUS_36460 15098 16267 gene locus_tag LOCUS_36470 15098 16267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_36470 16752 16270 gene locus_tag LOCUS_36480 16752 16270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 17091 17552 gene locus_tag LOCUS_36490 17091 17552 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_36490 17576 18769 gene locus_tag LOCUS_36500 17576 18769 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_36500 18928 19152 gene locus_tag LOCUS_36510 18928 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 19156 19419 gene locus_tag LOCUS_36520 19156 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 19473 20195 gene locus_tag LOCUS_36530 19473 20195 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_36530 20299 22326 gene locus_tag LOCUS_36540 20299 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 22696 26508 gene locus_tag LOCUS_36550 22696 26508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 26864 27919 gene locus_tag LOCUS_36560 26864 27919 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_36560 27998 28639 gene locus_tag LOCUS_36570 27998 28639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 28737 29249 gene locus_tag LOCUS_36580 28737 29249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence079 1203 70 gene locus_tag LOCUS_36590 1203 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 2024 1221 gene locus_tag LOCUS_36600 2024 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 2440 2045 gene locus_tag LOCUS_36610 2440 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 2641 2453 gene locus_tag LOCUS_36620 2641 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 3077 2628 gene locus_tag LOCUS_36630 3077 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 3788 3408 gene locus_tag LOCUS_36640 3788 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 4123 3785 gene locus_tag LOCUS_36650 4123 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4950 4147 gene locus_tag LOCUS_36660 4950 4147 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_36660 6775 4955 gene locus_tag LOCUS_36670 gene sppA 6775 4955 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_36670 9166 6896 gene locus_tag LOCUS_36680 9166 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36680 10495 9203 gene locus_tag LOCUS_36690 10495 9203 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_36690 11922 10723 gene locus_tag LOCUS_36700 11922 10723 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_36700 12390 11923 gene locus_tag LOCUS_36710 gene qcrA 12390 11923 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 protein_id gnl|my_center|LOCUS_36710 12586 14292 gene locus_tag LOCUS_36720 gene argS 12586 14292 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_36720 14316 15659 gene locus_tag LOCUS_36730 14316 15659 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_36730 16499 15636 gene locus_tag LOCUS_36740 gene mtnP 16499 15636 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_36740 16550 17371 gene locus_tag LOCUS_36750 16550 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_36750 19066 17663 gene locus_tag LOCUS_36760 19066 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 20760 19738 gene locus_tag LOCUS_36770 20760 19738 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_36770 21986 20763 gene locus_tag LOCUS_36780 21986 20763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_36780 23761 22109 gene locus_tag LOCUS_36790 23761 22109 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020917.1 protein_id gnl|my_center|LOCUS_36790 25727 23808 gene locus_tag LOCUS_36800 25727 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 27211 25913 gene locus_tag LOCUS_36810 27211 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence080 1290 277 gene locus_tag LOCUS_36820 1290 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 1785 1348 gene locus_tag LOCUS_36830 1785 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 3211 1859 gene locus_tag LOCUS_36840 3211 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_36840 6345 3454 gene locus_tag LOCUS_36850 6345 3454 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680902.1 protein_id gnl|my_center|LOCUS_36850 6547 7152 gene locus_tag LOCUS_36860 6547 7152 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023081.1 protein_id gnl|my_center|LOCUS_36860 7231 8055 gene locus_tag LOCUS_36870 7231 8055 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_36870 8103 9701 gene locus_tag LOCUS_36880 8103 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 9819 13085 gene locus_tag LOCUS_36890 9819 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 13106 15118 gene locus_tag LOCUS_36900 gene aspS 13106 15118 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_36900 15214 16806 gene locus_tag LOCUS_36910 15214 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 16925 19210 gene locus_tag LOCUS_36920 16925 19210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 19210 20556 gene locus_tag LOCUS_36930 gene der 19210 20556 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_36930 20635 21609 gene locus_tag LOCUS_36940 20635 21609 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_36940 21643 22962 gene locus_tag LOCUS_36950 21643 22962 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940840.1 protein_id gnl|my_center|LOCUS_36950 22964 23515 gene locus_tag LOCUS_36960 22964 23515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940841.1 protein_id gnl|my_center|LOCUS_36960 24388 23516 gene locus_tag LOCUS_36970 24388 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 25025 28420 gene locus_tag LOCUS_36980 25025 28420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence081 669 394 gene locus_tag LOCUS_36990 669 394 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_36990 2147 714 gene locus_tag LOCUS_37000 gene gnfM 2147 714 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_37000 3761 2208 gene locus_tag LOCUS_37010 3761 2208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940955.1 protein_id gnl|my_center|LOCUS_37010 4400 3798 gene locus_tag LOCUS_37020 gene hisH 4400 3798 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_37020 5350 4652 gene locus_tag LOCUS_37030 5350 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 6654 5890 gene locus_tag LOCUS_37040 6654 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 6817 6647 gene locus_tag LOCUS_37050 6817 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 7098 6817 gene locus_tag LOCUS_37060 7098 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 7794 7240 gene locus_tag LOCUS_37070 7794 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 9103 7949 gene locus_tag LOCUS_37080 9103 7949 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_37080 9645 9166 gene locus_tag LOCUS_37090 gene ribE 9645 9166 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_37090 11094 9877 gene locus_tag LOCUS_37100 11094 9877 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_37100 11762 11118 gene locus_tag LOCUS_37110 11762 11118 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_37110 12864 11743 gene locus_tag LOCUS_37120 gene ribD 12864 11743 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_37120 13262 12900 gene locus_tag LOCUS_37130 13262 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 13585 14673 gene locus_tag LOCUS_37140 13585 14673 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_37140 15762 14761 gene locus_tag LOCUS_37150 gene hemW 15762 14761 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_37150 16260 15934 gene locus_tag LOCUS_37160 16260 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 17371 16253 gene locus_tag LOCUS_37170 17371 16253 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_37170 17843 17433 gene locus_tag LOCUS_37180 17843 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 19200 17848 gene locus_tag LOCUS_37190 19200 17848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 19904 19617 gene locus_tag LOCUS_37200 19904 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 21264 19963 gene locus_tag LOCUS_37210 gene eno 21264 19963 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_37210 22429 21413 gene locus_tag LOCUS_37220 22429 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 23350 22505 gene locus_tag LOCUS_37230 23350 22505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 24383 23943 gene locus_tag LOCUS_37240 24383 23943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 25143 25006 gene locus_tag LOCUS_37250 25143 25006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 26526 26350 gene locus_tag LOCUS_37260 26526 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 26559 27086 gene locus_tag LOCUS_37270 26559 27086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 27224 28075 gene locus_tag LOCUS_37280 27224 28075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence082 516 983 gene locus_tag LOCUS_37290 516 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1043 2170 gene locus_tag LOCUS_37300 1043 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 2460 3191 gene locus_tag LOCUS_37310 2460 3191 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_37310 4072 3248 gene locus_tag LOCUS_37320 4072 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 4911 4087 gene locus_tag LOCUS_37330 4911 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 6300 4969 gene locus_tag LOCUS_37340 6300 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 8531 6318 gene locus_tag LOCUS_37350 8531 6318 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_37350 9904 8546 gene locus_tag LOCUS_37360 9904 8546 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_37360 11812 9917 gene locus_tag LOCUS_37370 11812 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 13917 11881 gene locus_tag LOCUS_37380 13917 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 18174 13945 gene locus_tag LOCUS_37390 18174 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 19632 18280 gene locus_tag LOCUS_37400 19632 18280 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_37400 22842 19828 gene locus_tag LOCUS_37410 22842 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 25299 22957 gene locus_tag LOCUS_37420 25299 22957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 25617 26006 gene locus_tag LOCUS_37430 25617 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 26098 27732 gene locus_tag LOCUS_37440 26098 27732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence083 2172 157 gene locus_tag LOCUS_37450 2172 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 2589 2197 gene locus_tag LOCUS_37460 2589 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4691 2859 gene locus_tag LOCUS_37470 4691 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37470 7136 4752 gene locus_tag LOCUS_37480 7136 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37480 9881 7473 gene locus_tag LOCUS_37490 9881 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 10277 10477 gene locus_tag LOCUS_37500 10277 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 10610 11494 gene locus_tag LOCUS_37510 10610 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 11551 11799 gene locus_tag LOCUS_37520 11551 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 11809 12177 gene locus_tag LOCUS_37530 11809 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 12223 12687 gene locus_tag LOCUS_37540 gene aroQ 12223 12687 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_37540 12684 13850 gene locus_tag LOCUS_37550 gene pseC 12684 13850 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_37550 13878 14432 gene locus_tag LOCUS_37560 13878 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 14593 15321 gene locus_tag LOCUS_37570 14593 15321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 15296 16018 gene locus_tag LOCUS_37580 15296 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 16977 16015 gene locus_tag LOCUS_37590 16977 16015 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_37590 17367 19676 gene locus_tag LOCUS_37600 17367 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_37600 19643 20365 gene locus_tag LOCUS_37610 19643 20365 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_37610 20409 24020 gene locus_tag LOCUS_37620 20409 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 24157 25815 gene locus_tag LOCUS_37630 gene nagZ 24157 25815 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_37630 26904 25915 gene locus_tag LOCUS_37640 26904 25915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 27374 26994 gene locus_tag LOCUS_37650 27374 26994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 >Feature sequence084 987 1715 gene locus_tag LOCUS_37660 987 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1736 2287 gene locus_tag LOCUS_37670 1736 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2723 2391 gene locus_tag LOCUS_37680 2723 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 4437 3190 gene locus_tag LOCUS_37690 4437 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 5881 4505 gene locus_tag LOCUS_37700 5881 4505 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_37700 8022 5998 gene locus_tag LOCUS_37710 8022 5998 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_37710 9052 8186 gene locus_tag LOCUS_37720 9052 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 9260 10009 gene locus_tag LOCUS_37730 gene radC 9260 10009 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_37730 10739 10002 gene locus_tag LOCUS_37740 gene rlmB 10739 10002 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_37740 11029 10790 gene locus_tag LOCUS_37750 11029 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 12944 11076 gene locus_tag LOCUS_37760 gene iolD 12944 11076 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_37760 14060 13050 gene locus_tag LOCUS_37770 14060 13050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 16118 14127 gene locus_tag LOCUS_37780 16118 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 16992 16351 gene locus_tag LOCUS_37790 gene eda 16992 16351 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_37790 17356 18699 gene locus_tag LOCUS_37800 17356 18699 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_37800 18714 20039 gene locus_tag LOCUS_37810 18714 20039 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_37810 20857 20111 gene locus_tag LOCUS_37820 20857 20111 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_37820 21681 21100 gene locus_tag LOCUS_37830 gene folE 21681 21100 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_37830 22518 21685 gene locus_tag LOCUS_37840 22518 21685 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_37840 22842 22555 gene locus_tag LOCUS_37850 22842 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 23752 22904 gene locus_tag LOCUS_37860 23752 22904 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_37860 24615 24151 gene locus_tag LOCUS_37870 24615 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 26123 24705 gene locus_tag LOCUS_37880 26123 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 26611 26318 gene locus_tag LOCUS_37890 26611 26318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence085 2143 74 gene locus_tag LOCUS_37900 2143 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 3008 2202 gene locus_tag LOCUS_37910 3008 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3209 3015 gene locus_tag LOCUS_37920 3209 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 4249 3251 gene locus_tag LOCUS_37930 4249 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4443 4258 gene locus_tag LOCUS_37940 4443 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 4730 4413 gene locus_tag LOCUS_37950 4730 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 5401 4730 gene locus_tag LOCUS_37960 5401 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 6614 5766 gene locus_tag LOCUS_37970 6614 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 9040 7520 gene locus_tag LOCUS_37980 9040 7520 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_37980 10958 9063 gene locus_tag LOCUS_37990 10958 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 11322 11849 gene locus_tag LOCUS_38000 11322 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 12767 11931 gene locus_tag LOCUS_38010 12767 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 13714 13004 gene locus_tag LOCUS_38020 13714 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 15620 14565 gene locus_tag LOCUS_38030 15620 14565 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_38030 16366 15617 gene locus_tag LOCUS_38040 16366 15617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 18614 16626 gene locus_tag LOCUS_38050 18614 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 19231 18950 gene locus_tag LOCUS_38060 19231 18950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 20684 19314 gene locus_tag LOCUS_38070 20684 19314 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_38070 22665 20869 gene locus_tag LOCUS_38080 22665 20869 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_38080 24853 22985 gene locus_tag LOCUS_38090 24853 22985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 25257 24928 gene locus_tag LOCUS_38100 25257 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 25448 25281 gene locus_tag LOCUS_38110 25448 25281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 25652 25476 gene locus_tag LOCUS_38120 25652 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 26304 25681 gene locus_tag LOCUS_38130 26304 25681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 >Feature sequence086 1182 142 gene locus_tag LOCUS_38140 1182 142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_38140 1423 1668 gene locus_tag LOCUS_38150 1423 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1744 2322 gene locus_tag LOCUS_38160 1744 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2324 3130 gene locus_tag LOCUS_38170 gene thiF 2324 3130 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_38170 3242 3430 gene locus_tag LOCUS_38180 3242 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3853 4992 gene locus_tag LOCUS_38190 gene thiO 3853 4992 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_38190 6057 5296 gene locus_tag LOCUS_38200 gene fabG 6057 5296 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_38200 6286 7269 gene locus_tag LOCUS_38210 6286 7269 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_38210 7777 9075 gene locus_tag LOCUS_38220 gene pepP 7777 9075 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_38220 9112 9399 gene locus_tag LOCUS_38230 9112 9399 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583654.1 protein_id gnl|my_center|LOCUS_38230 9396 9752 gene locus_tag LOCUS_38240 9396 9752 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_38240 9824 10369 gene locus_tag LOCUS_38250 9824 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 10454 11011 gene locus_tag LOCUS_38260 gene rpoE 10454 11011 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005346.1 protein_id gnl|my_center|LOCUS_38260 11068 11751 gene locus_tag LOCUS_38270 11068 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 11829 13004 gene locus_tag LOCUS_38280 11829 13004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_38280 12988 13986 gene locus_tag LOCUS_38290 12988 13986 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082545.1 protein_id gnl|my_center|LOCUS_38290 13989 14936 gene locus_tag LOCUS_38300 13989 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 14949 15776 gene locus_tag LOCUS_38310 gene fabG 14949 15776 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_38310 16702 15773 gene locus_tag LOCUS_38320 16702 15773 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_38320 19129 17063 gene locus_tag LOCUS_38330 19129 17063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 20218 19208 gene locus_tag LOCUS_38340 20218 19208 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_38340 20763 21752 gene locus_tag LOCUS_38350 20763 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 21965 22957 gene locus_tag LOCUS_38360 21965 22957 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_38360 22976 23785 gene locus_tag LOCUS_38370 22976 23785 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_38370 23868 25643 gene locus_tag LOCUS_38380 23868 25643 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_38380 >Feature sequence087 527 333 gene locus_tag LOCUS_38390 527 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 1050 1466 gene locus_tag LOCUS_38400 1050 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 1707 1474 gene locus_tag LOCUS_38410 1707 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 2242 1655 gene locus_tag LOCUS_38420 2242 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 2448 2239 gene locus_tag LOCUS_38430 2448 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 3442 6318 gene locus_tag LOCUS_38440 3442 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 8170 6944 gene locus_tag LOCUS_38450 gene betC 8170 6944 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_38450 10094 8406 gene locus_tag LOCUS_38460 10094 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 10785 10087 gene locus_tag LOCUS_38470 10785 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 10961 11269 gene locus_tag LOCUS_38480 10961 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 12652 11336 gene locus_tag LOCUS_38490 12652 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 14721 13234 gene locus_tag LOCUS_38500 14721 13234 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_38500 15099 14791 gene locus_tag LOCUS_38510 15099 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 17838 15127 gene locus_tag LOCUS_38520 gene fdhF 17838 15127 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(16768..16770),aa:Sec) note codon on position 357 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_38520 18917 17877 gene locus_tag LOCUS_38530 18917 17877 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_38530 19777 19043 gene locus_tag LOCUS_38540 19777 19043 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_38540 22915 19829 gene locus_tag LOCUS_38550 22915 19829 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_38550 23540 23004 gene locus_tag LOCUS_38560 23540 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 25189 23630 gene locus_tag LOCUS_38570 25189 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 25709 25299 gene locus_tag LOCUS_38580 25709 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 >Feature sequence088 1455 517 gene locus_tag LOCUS_38590 1455 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 1883 1491 gene locus_tag LOCUS_38600 1883 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 11812 2267 gene locus_tag LOCUS_38610 11812 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 12523 11825 gene locus_tag LOCUS_38620 12523 11825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 13805 14077 gene locus_tag LOCUS_38630 13805 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 14398 14470 gene locus_tag LOCUS_t00430 14398 14470 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14567 17600 gene locus_tag LOCUS_r00010 14567 17600 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 17665 17775 gene locus_tag LOCUS_r00020 17665 17775 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 19104 18133 gene locus_tag LOCUS_38640 19104 18133 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583191.1 protein_id gnl|my_center|LOCUS_38640 20181 19231 gene locus_tag LOCUS_38650 20181 19231 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067939.1 protein_id gnl|my_center|LOCUS_38650 20864 20184 gene locus_tag LOCUS_38660 20864 20184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 21101 21943 gene locus_tag LOCUS_38670 21101 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 23389 21974 gene locus_tag LOCUS_38680 23389 21974 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011190648.1 protein_id gnl|my_center|LOCUS_38680 23844 24893 gene locus_tag LOCUS_38690 23844 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence089 206 649 gene locus_tag LOCUS_38700 206 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 652 1800 gene locus_tag LOCUS_38710 652 1800 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_38710 3187 1811 gene locus_tag LOCUS_38720 3187 1811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668661.1 protein_id gnl|my_center|LOCUS_38720 5495 3693 gene locus_tag LOCUS_38730 5495 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6584 5742 gene locus_tag LOCUS_38740 6584 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 7405 6647 gene locus_tag LOCUS_38750 7405 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 8061 7513 gene locus_tag LOCUS_38760 8061 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 8947 8081 gene locus_tag LOCUS_38770 8947 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 10364 9483 gene locus_tag LOCUS_38780 10364 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 11441 10383 gene locus_tag LOCUS_38790 11441 10383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705009.1 protein_id gnl|my_center|LOCUS_38790 12365 11538 gene locus_tag LOCUS_38800 12365 11538 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_38800 12973 12317 gene locus_tag LOCUS_38810 12973 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 13344 14045 gene locus_tag LOCUS_38820 13344 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 14521 17448 gene locus_tag LOCUS_38830 14521 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 17503 19329 gene locus_tag LOCUS_38840 17503 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 19506 20324 gene locus_tag LOCUS_38850 19506 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 20873 21499 gene locus_tag LOCUS_38860 20873 21499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 22800 21913 gene locus_tag LOCUS_38870 22800 21913 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_38870 23787 22849 gene locus_tag LOCUS_38880 23787 22849 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929266.1 protein_id gnl|my_center|LOCUS_38880 24583 23735 gene locus_tag LOCUS_38890 24583 23735 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_38890 >Feature sequence090 311 1351 gene locus_tag LOCUS_38900 gene mtnA 311 1351 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_38900 2649 1360 gene locus_tag LOCUS_38910 2649 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 3359 3526 gene locus_tag LOCUS_38920 3359 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 3526 4461 gene locus_tag LOCUS_38930 3526 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 4463 5056 gene locus_tag LOCUS_38940 4463 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 5557 5243 gene locus_tag LOCUS_38950 5557 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 5947 6939 gene locus_tag LOCUS_38960 5947 6939 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_38960 7052 7879 gene locus_tag LOCUS_38970 7052 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 9269 7905 gene locus_tag LOCUS_38980 9269 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 10320 9538 gene locus_tag LOCUS_38990 10320 9538 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_38990 11014 10649 gene locus_tag LOCUS_39000 11014 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 11567 10992 gene locus_tag LOCUS_39010 11567 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 12879 12187 gene locus_tag LOCUS_39020 12879 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 14539 12899 gene locus_tag LOCUS_39030 14539 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 16641 14536 gene locus_tag LOCUS_39040 gene nadE 16641 14536 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_39040 16907 16680 gene locus_tag LOCUS_39050 16907 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 18296 16983 gene locus_tag LOCUS_39060 18296 16983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_39060 19406 18387 gene locus_tag LOCUS_39070 19406 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 20789 19410 gene locus_tag LOCUS_39080 20789 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 21229 20786 gene locus_tag LOCUS_39090 21229 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 24220 21314 gene locus_tag LOCUS_39100 24220 21314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence091 447 1364 gene locus_tag LOCUS_39110 447 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 1400 2323 gene locus_tag LOCUS_39120 1400 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4381 2393 gene locus_tag LOCUS_39130 4381 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 5632 4547 gene locus_tag LOCUS_39140 5632 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 6740 5721 gene locus_tag LOCUS_39150 6740 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 9677 7062 gene locus_tag LOCUS_39160 9677 7062 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_39160 10553 9792 gene locus_tag LOCUS_39170 10553 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 11418 10564 gene locus_tag LOCUS_39180 11418 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 11858 12115 gene locus_tag LOCUS_39190 11858 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 12283 15348 gene locus_tag LOCUS_39200 12283 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 15707 17095 gene locus_tag LOCUS_39210 gene ffh 15707 17095 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_39210 17172 17609 gene locus_tag LOCUS_39220 17172 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 17674 17928 gene locus_tag LOCUS_39230 17674 17928 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_39230 17950 18678 gene locus_tag LOCUS_39240 gene trmD 17950 18678 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_39240 18739 19083 gene locus_tag LOCUS_39250 gene rplS 18739 19083 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_39250 19088 19678 gene locus_tag LOCUS_39260 19088 19678 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_39260 19731 20120 gene locus_tag LOCUS_39270 19731 20120 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_39270 20153 20836 gene locus_tag LOCUS_39280 gene hddC 20153 20836 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_39280 21077 21898 gene locus_tag LOCUS_39290 21077 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 22222 23511 gene locus_tag LOCUS_39300 22222 23511 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_39300 23567 24583 gene locus_tag LOCUS_39310 23567 24583 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_39310 >Feature sequence092 284 712 gene locus_tag LOCUS_39320 284 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 822 1829 gene locus_tag LOCUS_39330 822 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1901 2878 gene locus_tag LOCUS_39340 1901 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 2962 4482 gene locus_tag LOCUS_39350 2962 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 5630 4725 gene locus_tag LOCUS_39360 5630 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 7011 5908 gene locus_tag LOCUS_39370 7011 5908 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_39370 8232 7075 gene locus_tag LOCUS_39380 8232 7075 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_39380 9118 8225 gene locus_tag LOCUS_39390 9118 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 9605 9138 gene locus_tag LOCUS_39400 9605 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 10512 10111 gene locus_tag LOCUS_39410 10512 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 10902 10660 gene locus_tag LOCUS_39420 10902 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 12931 10988 gene locus_tag LOCUS_39430 12931 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 13873 12938 gene locus_tag LOCUS_39440 13873 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 15057 14074 gene locus_tag LOCUS_39450 gene pdhA 15057 14074 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_39450 15826 15098 gene locus_tag LOCUS_39460 15826 15098 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_39460 17063 16233 gene locus_tag LOCUS_39470 17063 16233 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286686.1 protein_id gnl|my_center|LOCUS_39470 18459 17167 gene locus_tag LOCUS_39480 18459 17167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 18590 18949 gene locus_tag LOCUS_39490 18590 18949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 18961 19752 gene locus_tag LOCUS_39500 18961 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 20380 19778 gene locus_tag LOCUS_39510 20380 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 21003 20377 gene locus_tag LOCUS_39520 21003 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 21977 21435 gene locus_tag LOCUS_39530 21977 21435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 22848 22051 gene locus_tag LOCUS_39540 22848 22051 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_39540 24063 22984 gene locus_tag LOCUS_39550 24063 22984 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_39550 24368 24111 gene locus_tag LOCUS_39560 24368 24111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence093 207 491 gene locus_tag LOCUS_39570 207 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 488 1246 gene locus_tag LOCUS_39580 488 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 1256 2584 gene locus_tag LOCUS_39590 1256 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 2764 4995 gene locus_tag LOCUS_39600 2764 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 5190 6143 gene locus_tag LOCUS_39610 5190 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 6944 6147 gene locus_tag LOCUS_39620 6944 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 7972 6926 gene locus_tag LOCUS_39630 gene purM 7972 6926 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_39630 8414 7962 gene locus_tag LOCUS_39640 8414 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 10101 8695 gene locus_tag LOCUS_39650 gene purF 10101 8695 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_39650 10765 10217 gene locus_tag LOCUS_39660 10765 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 11047 12204 gene locus_tag LOCUS_39670 11047 12204 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_39670 12204 12611 gene locus_tag LOCUS_39680 12204 12611 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039844900.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39680 12703 13617 gene locus_tag LOCUS_39690 12703 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 13664 13993 gene locus_tag LOCUS_39700 13664 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 13980 14330 gene locus_tag LOCUS_39710 13980 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 14352 15368 gene locus_tag LOCUS_39720 14352 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 15401 16354 gene locus_tag LOCUS_39730 15401 16354 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975313.1 protein_id gnl|my_center|LOCUS_39730 17768 16368 gene locus_tag LOCUS_39740 17768 16368 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_39740 18648 17797 gene locus_tag LOCUS_39750 18648 17797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 22251 18925 gene locus_tag LOCUS_39760 22251 18925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 23945 22572 gene locus_tag LOCUS_39770 23945 22572 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence094 430 915 gene locus_tag LOCUS_39780 430 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 1254 1628 gene locus_tag LOCUS_39790 gene rpsL 1254 1628 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656492.1 protein_id gnl|my_center|LOCUS_39790 1660 2130 gene locus_tag LOCUS_39800 gene rpsG 1660 2130 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_39800 2242 4305 gene locus_tag LOCUS_39810 gene fusA 2242 4305 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_39810 4590 5789 gene locus_tag LOCUS_39820 gene tuf 4590 5789 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940180.1 protein_id gnl|my_center|LOCUS_39820 5976 6287 gene locus_tag LOCUS_39830 gene rpsJ 5976 6287 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_39830 6300 6956 gene locus_tag LOCUS_39840 gene rplC 6300 6956 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_39840 7058 7693 gene locus_tag LOCUS_39850 gene rplD 7058 7693 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_39850 7698 7997 gene locus_tag LOCUS_39860 gene rplW 7698 7997 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_39860 8055 8876 gene locus_tag LOCUS_39870 gene rplB 8055 8876 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_39870 8934 9209 gene locus_tag LOCUS_39880 gene rpsS 8934 9209 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_39880 9337 9690 gene locus_tag LOCUS_39890 gene rplV 9337 9690 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_39890 9748 10578 gene locus_tag LOCUS_39900 gene rpsC 9748 10578 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_39900 10632 11045 gene locus_tag LOCUS_39910 gene rplP 10632 11045 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_39910 11048 11266 gene locus_tag LOCUS_39920 gene rpmC 11048 11266 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_39920 11323 11589 gene locus_tag LOCUS_39930 gene rpsQ 11323 11589 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055338.1 protein_id gnl|my_center|LOCUS_39930 11610 11978 gene locus_tag LOCUS_39940 gene rplN 11610 11978 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258241.1 protein_id gnl|my_center|LOCUS_39940 11989 12222 gene locus_tag LOCUS_39950 11989 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 12302 12865 gene locus_tag LOCUS_39960 gene rplE 12302 12865 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_39960 12919 13104 gene locus_tag LOCUS_39970 12919 13104 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258244.1 protein_id gnl|my_center|LOCUS_39970 13119 13520 gene locus_tag LOCUS_39980 gene rpsH 13119 13520 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_39980 13581 14147 gene locus_tag LOCUS_39990 gene rplF 13581 14147 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_39990 14255 14623 gene locus_tag LOCUS_40000 gene rplR 14255 14623 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393921.1 protein_id gnl|my_center|LOCUS_40000 14656 15186 gene locus_tag LOCUS_40010 gene rpsE 14656 15186 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_40010 15223 15669 gene locus_tag LOCUS_40020 gene rplO 15223 15669 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_40020 15670 17013 gene locus_tag LOCUS_40030 gene secY 15670 17013 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_40030 17229 17624 gene locus_tag LOCUS_40040 gene rpsM 17229 17624 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_40040 17725 18096 gene locus_tag LOCUS_40050 gene rpsK 17725 18096 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_40050 18110 18742 gene locus_tag LOCUS_40060 gene rpsD 18110 18742 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_40060 18919 19908 gene locus_tag LOCUS_40070 18919 19908 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_40070 19909 20310 gene locus_tag LOCUS_40080 19909 20310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 21676 20411 gene locus_tag LOCUS_40090 21676 20411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 22564 22049 gene locus_tag LOCUS_40100 22564 22049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 22674 23579 gene locus_tag LOCUS_40110 22674 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence095 1278 715 gene locus_tag LOCUS_40120 1278 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 3055 1814 gene locus_tag LOCUS_40130 3055 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 3924 6359 gene locus_tag LOCUS_40140 3924 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 9059 7059 gene locus_tag LOCUS_40150 9059 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 10873 9176 gene locus_tag LOCUS_40160 10873 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 12941 11232 gene locus_tag LOCUS_40170 12941 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 14903 13209 gene locus_tag LOCUS_40180 14903 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 16019 15207 gene locus_tag LOCUS_40190 16019 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 16825 16019 gene locus_tag LOCUS_40200 16825 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 17355 16822 gene locus_tag LOCUS_40210 17355 16822 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_40210 17533 20286 gene locus_tag LOCUS_40220 17533 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 20679 23465 gene locus_tag LOCUS_40230 20679 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 >Feature sequence096 1294 443 gene locus_tag LOCUS_40240 1294 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2135 6532 gene locus_tag LOCUS_40250 2135 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 7282 7440 gene locus_tag LOCUS_40260 7282 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 7729 7881 gene locus_tag LOCUS_40270 7729 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 7951 8211 gene locus_tag LOCUS_40280 7951 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 8738 9811 gene locus_tag LOCUS_40290 8738 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 10114 10293 gene locus_tag LOCUS_40300 10114 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 11402 10860 gene locus_tag LOCUS_40310 11402 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 12760 12188 gene locus_tag LOCUS_40320 12760 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 13932 16916 gene locus_tag LOCUS_40330 13932 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 17451 18557 gene locus_tag LOCUS_40340 17451 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 20456 18570 gene locus_tag LOCUS_40350 20456 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 22439 20562 gene locus_tag LOCUS_40360 22439 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence097 218 892 gene locus_tag LOCUS_40370 218 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 885 1133 gene locus_tag LOCUS_40380 885 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 1229 1417 gene locus_tag LOCUS_40390 1229 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1635 1940 gene locus_tag LOCUS_40400 1635 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 2715 6635 gene locus_tag LOCUS_40410 2715 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 6629 7471 gene locus_tag LOCUS_40420 6629 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 8087 11188 gene locus_tag LOCUS_40430 8087 11188 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583653.1 protein_id gnl|my_center|LOCUS_40430 11211 14351 gene locus_tag LOCUS_40440 11211 14351 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_40440 14689 15006 gene locus_tag LOCUS_40450 14689 15006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 15029 15169 gene locus_tag LOCUS_40460 15029 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 15378 17816 gene locus_tag LOCUS_40470 15378 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 18073 20301 gene locus_tag LOCUS_40480 18073 20301 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_40480 20302 22401 gene locus_tag LOCUS_40490 20302 22401 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence098 924 73 gene locus_tag LOCUS_40500 924 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 1265 1023 gene locus_tag LOCUS_40510 1265 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 2832 2137 gene locus_tag LOCUS_40520 2832 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 3575 2868 gene locus_tag LOCUS_40530 3575 2868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_40530 4550 3660 gene locus_tag LOCUS_40540 4550 3660 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_40540 6360 4567 gene locus_tag LOCUS_40550 6360 4567 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065602.1 protein_id gnl|my_center|LOCUS_40550 7085 6576 gene locus_tag LOCUS_40560 7085 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 8031 7075 gene locus_tag LOCUS_40570 8031 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 8902 8045 gene locus_tag LOCUS_40580 8902 8045 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392390.1 protein_id gnl|my_center|LOCUS_40580 9522 8917 gene locus_tag LOCUS_40590 9522 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 10915 9605 gene locus_tag LOCUS_40600 10915 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 11250 10915 gene locus_tag LOCUS_40610 11250 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 11804 11259 gene locus_tag LOCUS_40620 11804 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 13994 11814 gene locus_tag LOCUS_40630 gene ccsA 13994 11814 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_40630 14487 14038 gene locus_tag LOCUS_40640 14487 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 14778 15725 gene locus_tag LOCUS_40650 14778 15725 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_40650 16077 18650 gene locus_tag LOCUS_40660 16077 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 18689 19903 gene locus_tag LOCUS_40670 18689 19903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_40670 19999 20970 gene locus_tag LOCUS_40680 19999 20970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 20980 21969 gene locus_tag LOCUS_40690 20980 21969 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_40690 >Feature sequence099 276 692 gene locus_tag LOCUS_40700 276 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 883 3978 gene locus_tag LOCUS_40710 883 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 4165 6486 gene locus_tag LOCUS_40720 4165 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 6686 7909 gene locus_tag LOCUS_40730 6686 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 7937 9286 gene locus_tag LOCUS_40740 7937 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 9437 11644 gene locus_tag LOCUS_40750 9437 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 12288 11641 gene locus_tag LOCUS_40760 12288 11641 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294676.1 protein_id gnl|my_center|LOCUS_40760 12418 13779 gene locus_tag LOCUS_40770 12418 13779 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_40770 13780 14925 gene locus_tag LOCUS_40780 13780 14925 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_40780 14976 16217 gene locus_tag LOCUS_40790 gene lysA 14976 16217 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_40790 16244 16486 gene locus_tag LOCUS_40800 16244 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 16483 16701 gene locus_tag LOCUS_40810 16483 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 16950 17363 gene locus_tag LOCUS_40820 16950 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 17598 19622 gene locus_tag LOCUS_40830 17598 19622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_40830 19651 20094 gene locus_tag LOCUS_40840 19651 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 20772 20194 gene locus_tag LOCUS_40850 20772 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence100 157 444 gene locus_tag LOCUS_40860 157 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 441 1028 gene locus_tag LOCUS_40870 441 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 1075 6309 gene locus_tag LOCUS_40880 1075 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 7458 6478 gene locus_tag LOCUS_40890 7458 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 10484 7482 gene locus_tag LOCUS_40900 10484 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 12408 10513 gene locus_tag LOCUS_40910 gene metG 12408 10513 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_40910 13766 12987 gene locus_tag LOCUS_40920 13766 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 14043 13831 gene locus_tag LOCUS_40930 14043 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 14911 14225 gene locus_tag LOCUS_40940 14911 14225 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051901260.1 protein_id gnl|my_center|LOCUS_40940 19167 14920 gene locus_tag LOCUS_40950 19167 14920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence101 3359 321 gene locus_tag LOCUS_40960 3359 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 6625 3605 gene locus_tag LOCUS_40970 6625 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 9891 6871 gene locus_tag LOCUS_40980 9891 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 11381 13354 gene locus_tag LOCUS_40990 11381 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 14298 17306 gene locus_tag LOCUS_41000 14298 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 >Feature sequence102 617 60 gene locus_tag LOCUS_41010 gene sigW 617 60 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_41010 3916 1013 gene locus_tag LOCUS_41020 3916 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 6713 4038 gene locus_tag LOCUS_41030 6713 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 7312 7623 gene locus_tag LOCUS_41040 7312 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 10146 7708 gene locus_tag LOCUS_41050 10146 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 10696 10046 gene locus_tag LOCUS_41060 10696 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 11615 10845 gene locus_tag LOCUS_41070 11615 10845 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_41070 12528 11965 gene locus_tag LOCUS_41080 12528 11965 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_41080 14042 12540 gene locus_tag LOCUS_41090 gene trpE 14042 12540 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_41090 14543 14163 gene locus_tag LOCUS_41100 gene hisI 14543 14163 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_41100 16079 14871 gene locus_tag LOCUS_41110 16079 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 17474 16389 gene locus_tag LOCUS_41120 17474 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 18475 17471 gene locus_tag LOCUS_41130 18475 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 18789 18484 gene locus_tag LOCUS_41140 18789 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 19494 18886 gene locus_tag LOCUS_41150 19494 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 >Feature sequence103 1215 2510 gene locus_tag LOCUS_41160 1215 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 2545 4035 gene locus_tag LOCUS_41170 2545 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 5269 4190 gene locus_tag LOCUS_41180 gene pyrB 5269 4190 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_41180 6288 5278 gene locus_tag LOCUS_41190 6288 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 7269 6340 gene locus_tag LOCUS_41200 7269 6340 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_41200 9276 7363 gene locus_tag LOCUS_41210 9276 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 9298 9519 gene locus_tag LOCUS_41220 9298 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 10297 9587 gene locus_tag LOCUS_41230 10297 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 10961 10868 gene locus_tag LOCUS_t00440 10961 10868 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11321 11464 gene locus_tag LOCUS_41240 11321 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 11637 12161 gene locus_tag LOCUS_41250 11637 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 13196 12252 gene locus_tag LOCUS_41260 13196 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 14512 13307 gene locus_tag LOCUS_41270 gene argJ 14512 13307 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_41270 14669 15670 gene locus_tag LOCUS_41280 14669 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 16371 15706 gene locus_tag LOCUS_41290 16371 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 17233 16463 gene locus_tag LOCUS_41300 17233 16463 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_41300 18003 17293 gene locus_tag LOCUS_41310 18003 17293 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_41310 19117 18461 gene locus_tag LOCUS_41320 19117 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 19391 19176 gene locus_tag LOCUS_41330 19391 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence104 551 4315 gene locus_tag LOCUS_41340 551 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 5064 4420 gene locus_tag LOCUS_41350 5064 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5321 6229 gene locus_tag LOCUS_41360 gene murB 5321 6229 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_41360 6696 8123 gene locus_tag LOCUS_41370 6696 8123 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942079.1 protein_id gnl|my_center|LOCUS_41370 8913 8125 gene locus_tag LOCUS_41380 8913 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 10884 9235 gene locus_tag LOCUS_41390 10884 9235 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_41390 12089 10896 gene locus_tag LOCUS_41400 12089 10896 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_41400 12560 13501 gene locus_tag LOCUS_41410 gene tcmP 12560 13501 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445522.1 protein_id gnl|my_center|LOCUS_41410 13505 14245 gene locus_tag LOCUS_41420 13505 14245 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_41420 15552 14251 gene locus_tag LOCUS_41430 15552 14251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_41430 16906 15605 gene locus_tag LOCUS_41440 16906 15605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_41440 18184 17054 gene locus_tag LOCUS_41450 18184 17054 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_41450 >Feature sequence105 329 1057 gene locus_tag LOCUS_41460 329 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 999 2585 gene locus_tag LOCUS_41470 999 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2598 3860 gene locus_tag LOCUS_41480 2598 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 3888 4952 gene locus_tag LOCUS_41490 3888 4952 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_41490 5128 5055 gene locus_tag LOCUS_t00450 5128 5055 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5229 5143 gene locus_tag LOCUS_t00460 5229 5143 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6308 5382 gene locus_tag LOCUS_41500 6308 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 6602 7366 gene locus_tag LOCUS_41510 6602 7366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_41510 7451 8734 gene locus_tag LOCUS_41520 7451 8734 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_41520 8748 10184 gene locus_tag LOCUS_41530 gene gnfM 8748 10184 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_41530 10191 10907 gene locus_tag LOCUS_41540 10191 10907 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048193.1 protein_id gnl|my_center|LOCUS_41540 12237 10876 gene locus_tag LOCUS_41550 12237 10876 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880295.1 protein_id gnl|my_center|LOCUS_41550 13580 12474 gene locus_tag LOCUS_41560 13580 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 14946 13927 gene locus_tag LOCUS_41570 14946 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 16321 14975 gene locus_tag LOCUS_41580 16321 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 17245 16460 gene locus_tag LOCUS_41590 17245 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 18142 17303 gene locus_tag LOCUS_41600 18142 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence106 1084 452 gene locus_tag LOCUS_41610 gene rpoE 1084 452 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_41610 1530 2921 gene locus_tag LOCUS_41620 1530 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 4381 3371 gene locus_tag LOCUS_41630 4381 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 4947 4456 gene locus_tag LOCUS_41640 4947 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 5236 7908 gene locus_tag LOCUS_41650 5236 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 7929 9008 gene locus_tag LOCUS_41660 7929 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 10260 9292 gene locus_tag LOCUS_41670 10260 9292 CDS product IS982-like element ISEfm1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295743.1 protein_id gnl|my_center|LOCUS_41670 10793 11521 gene locus_tag LOCUS_41680 10793 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 11540 12451 gene locus_tag LOCUS_41690 11540 12451 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_41690 12470 13795 gene locus_tag LOCUS_41700 12470 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 15942 13864 gene locus_tag LOCUS_41710 15942 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence107 524 1285 gene locus_tag LOCUS_41720 524 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 2045 5035 gene locus_tag LOCUS_41730 2045 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 5313 8336 gene locus_tag LOCUS_41740 5313 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 8579 11533 gene locus_tag LOCUS_41750 8579 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 11755 14745 gene locus_tag LOCUS_41760 11755 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 14989 16071 gene locus_tag LOCUS_41770 14989 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 >Feature sequence108 178 1410 gene locus_tag LOCUS_41780 178 1410 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_41780 2486 1407 gene locus_tag LOCUS_41790 2486 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 3038 2589 gene locus_tag LOCUS_41800 3038 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 3979 3116 gene locus_tag LOCUS_41810 3979 3116 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_41810 4173 5354 gene locus_tag LOCUS_41820 4173 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 6305 5412 gene locus_tag LOCUS_41830 6305 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 7426 6611 gene locus_tag LOCUS_41840 7426 6611 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_41840 7640 8479 gene locus_tag LOCUS_41850 7640 8479 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_41850 8567 9349 gene locus_tag LOCUS_41860 8567 9349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 9410 9955 gene locus_tag LOCUS_41870 9410 9955 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380327.1 protein_id gnl|my_center|LOCUS_41870 10061 10852 gene locus_tag LOCUS_41880 10061 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 11058 12251 gene locus_tag LOCUS_41890 11058 12251 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_41890 12291 12497 gene locus_tag LOCUS_41900 12291 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 12499 14373 gene locus_tag LOCUS_41910 12499 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 14455 16005 gene locus_tag LOCUS_41920 14455 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 >Feature sequence109 382 705 gene locus_tag LOCUS_41930 382 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 764 1747 gene locus_tag LOCUS_41940 764 1747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_41940 1901 2794 gene locus_tag LOCUS_41950 1901 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 2884 3708 gene locus_tag LOCUS_41960 2884 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 4378 3692 gene locus_tag LOCUS_41970 4378 3692 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929296.1 protein_id gnl|my_center|LOCUS_41970 5156 4419 gene locus_tag LOCUS_41980 5156 4419 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_41980 5375 5590 gene locus_tag LOCUS_41990 5375 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 5651 7129 gene locus_tag LOCUS_42000 5651 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 7179 8753 gene locus_tag LOCUS_42010 7179 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 8873 10321 gene locus_tag LOCUS_42020 8873 10321 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_42020 10302 10805 gene locus_tag LOCUS_42030 10302 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 11542 11060 gene locus_tag LOCUS_42040 11542 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 11998 11588 gene locus_tag LOCUS_42050 gene atpC 11998 11588 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405147.1 protein_id gnl|my_center|LOCUS_42050 13931 12522 gene locus_tag LOCUS_42060 gene atpD 13931 12522 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_42060 14871 13978 gene locus_tag LOCUS_42070 14871 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 15815 14868 gene locus_tag LOCUS_42080 15815 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 >Feature sequence110 151 1656 gene locus_tag LOCUS_42090 151 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 1766 2716 gene locus_tag LOCUS_42100 1766 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 3981 2950 gene locus_tag LOCUS_42110 3981 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 5005 3974 gene locus_tag LOCUS_42120 5005 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 5067 5273 gene locus_tag LOCUS_42130 5067 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 5506 6258 gene locus_tag LOCUS_42140 5506 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 6277 7032 gene locus_tag LOCUS_42150 6277 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 7053 7814 gene locus_tag LOCUS_42160 7053 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 7811 8953 gene locus_tag LOCUS_42170 7811 8953 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_42170 9202 11076 gene locus_tag LOCUS_42180 9202 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 11097 13199 gene locus_tag LOCUS_42190 11097 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 13255 15531 gene locus_tag LOCUS_42200 13255 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 15582 15761 gene locus_tag LOCUS_42210 15582 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 >Feature sequence111 2161 1070 gene locus_tag LOCUS_42220 2161 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 3001 2225 gene locus_tag LOCUS_42230 3001 2225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086102.1 protein_id gnl|my_center|LOCUS_42230 3935 3060 gene locus_tag LOCUS_42240 3935 3060 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_42240 4041 4868 gene locus_tag LOCUS_42250 4041 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 5849 5142 gene locus_tag LOCUS_42260 5849 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 6600 5911 gene locus_tag LOCUS_42270 6600 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 7330 6662 gene locus_tag LOCUS_42280 7330 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 9664 7391 gene locus_tag LOCUS_42290 9664 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 10693 10082 gene locus_tag LOCUS_42300 10693 10082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 10941 10868 gene locus_tag LOCUS_t00470 10941 10868 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11026 10952 gene locus_tag LOCUS_t00480 11026 10952 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11144 11073 gene locus_tag LOCUS_t00490 11144 11073 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13714 11243 gene locus_tag LOCUS_42310 13714 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 15286 13892 gene locus_tag LOCUS_42320 15286 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 >Feature sequence112 1142 162 gene locus_tag LOCUS_42330 1142 162 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_42330 1936 3750 gene locus_tag LOCUS_42340 1936 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 3778 5799 gene locus_tag LOCUS_42350 3778 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 6074 8680 gene locus_tag LOCUS_42360 6074 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 8924 10816 gene locus_tag LOCUS_42370 8924 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 11183 13654 gene locus_tag LOCUS_42380 11183 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 14028 13777 gene locus_tag LOCUS_42390 14028 13777 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 protein_id gnl|my_center|LOCUS_42390 14569 14922 gene locus_tag LOCUS_42400 14569 14922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence113 1154 684 gene locus_tag LOCUS_42410 1154 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 3610 1292 gene locus_tag LOCUS_42420 3610 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 4115 3735 gene locus_tag LOCUS_42430 4115 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 5098 4112 gene locus_tag LOCUS_42440 5098 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 5628 5194 gene locus_tag LOCUS_42450 5628 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 6557 5799 gene locus_tag LOCUS_42460 6557 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 7045 7572 gene locus_tag LOCUS_42470 7045 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 7569 8630 gene locus_tag LOCUS_42480 7569 8630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 10001 8634 gene locus_tag LOCUS_42490 10001 8634 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040522.1 protein_id gnl|my_center|LOCUS_42490 10819 10250 gene locus_tag LOCUS_42500 10819 10250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 12210 10837 gene locus_tag LOCUS_42510 12210 10837 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_42510 12706 13401 gene locus_tag LOCUS_42520 12706 13401 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_42520 13877 13449 gene locus_tag LOCUS_42530 13877 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 14777 13986 gene locus_tag LOCUS_42540 14777 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence114 502 302 gene locus_tag LOCUS_42550 502 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 630 875 gene locus_tag LOCUS_42560 630 875 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111326817.1 protein_id gnl|my_center|LOCUS_42560 985 1872 gene locus_tag LOCUS_42570 985 1872 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_42570 2043 2687 gene locus_tag LOCUS_42580 2043 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 3897 4061 gene locus_tag LOCUS_42590 3897 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 5976 4078 gene locus_tag LOCUS_42600 5976 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 8168 6306 gene locus_tag LOCUS_42610 8168 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 9596 8868 gene locus_tag LOCUS_42620 9596 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 10776 10090 gene locus_tag LOCUS_42630 10776 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 10995 10849 gene locus_tag LOCUS_42640 10995 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 12125 11136 gene locus_tag LOCUS_42650 12125 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence115 801 286 gene locus_tag LOCUS_42660 801 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 2777 915 gene locus_tag LOCUS_42670 2777 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 4466 2937 gene locus_tag LOCUS_42680 4466 2937 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_42680 5850 4471 gene locus_tag LOCUS_42690 5850 4471 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_42690 6083 6322 gene locus_tag LOCUS_42700 6083 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 8023 7181 gene locus_tag LOCUS_42710 8023 7181 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820268.1 protein_id gnl|my_center|LOCUS_42710 9142 8102 gene locus_tag LOCUS_42720 9142 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 9874 9173 gene locus_tag LOCUS_42730 9874 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 10694 9879 gene locus_tag LOCUS_42740 10694 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 11360 10698 gene locus_tag LOCUS_42750 11360 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 12526 11369 gene locus_tag LOCUS_42760 12526 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 13645 12557 gene locus_tag LOCUS_42770 gene aroB 13645 12557 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125161.1 protein_id gnl|my_center|LOCUS_42770 14114 13647 gene locus_tag LOCUS_42780 14114 13647 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence116 1975 605 gene locus_tag LOCUS_42790 1975 605 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_42790 3176 2031 gene locus_tag LOCUS_42800 3176 2031 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_42800 3948 3316 gene locus_tag LOCUS_42810 3948 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 7389 4816 gene locus_tag LOCUS_42820 7389 4816 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_42820 10979 7404 gene locus_tag LOCUS_42830 10979 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 11888 11112 gene locus_tag LOCUS_42840 11888 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 13965 12031 gene locus_tag LOCUS_42850 13965 12031 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_42850 >Feature sequence117 939 499 gene locus_tag LOCUS_42860 939 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 1684 2649 gene locus_tag LOCUS_42870 gene msrP 1684 2649 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_42870 2774 3958 gene locus_tag LOCUS_42880 2774 3958 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_42880 4024 5277 gene locus_tag LOCUS_42890 4024 5277 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_42890 5285 6202 gene locus_tag LOCUS_42900 5285 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 6183 7184 gene locus_tag LOCUS_42910 6183 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 7202 8104 gene locus_tag LOCUS_42920 7202 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 8275 9138 gene locus_tag LOCUS_42930 8275 9138 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336895.1 protein_id gnl|my_center|LOCUS_42930 9226 9408 gene locus_tag LOCUS_42940 9226 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 9321 9890 gene locus_tag LOCUS_42950 9321 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 10045 10317 gene locus_tag LOCUS_42960 gene eutM 10045 10317 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_42960 10346 11053 gene locus_tag LOCUS_42970 10346 11053 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_42970 11056 11796 gene locus_tag LOCUS_42980 11056 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 12077 13663 gene locus_tag LOCUS_42990 12077 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 >Feature sequence118 1667 138 gene locus_tag LOCUS_43000 1667 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 3021 2113 gene locus_tag LOCUS_43010 3021 2113 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946112.1 protein_id gnl|my_center|LOCUS_43010 3176 3481 gene locus_tag LOCUS_43020 3176 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 3948 3478 gene locus_tag LOCUS_43030 3948 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 4935 3970 gene locus_tag LOCUS_43040 4935 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 6064 5132 gene locus_tag LOCUS_43050 6064 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 7143 6184 gene locus_tag LOCUS_43060 7143 6184 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039877.1 protein_id gnl|my_center|LOCUS_43060 7258 8844 gene locus_tag LOCUS_43070 7258 8844 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_43070 10398 9052 gene locus_tag LOCUS_43080 10398 9052 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_43080 11550 10501 gene locus_tag LOCUS_43090 11550 10501 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_43090 12646 11609 gene locus_tag LOCUS_43100 12646 11609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 13697 12702 gene locus_tag LOCUS_43110 13697 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence119 467 1807 gene locus_tag LOCUS_43120 467 1807 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_43120 1840 2076 gene locus_tag LOCUS_43130 1840 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 2073 2426 gene locus_tag LOCUS_43140 2073 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 2479 3744 gene locus_tag LOCUS_43150 2479 3744 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_43150 3807 4298 gene locus_tag LOCUS_43160 3807 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 4300 4497 gene locus_tag LOCUS_43170 4300 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 4631 4831 gene locus_tag LOCUS_43180 4631 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 4895 6166 gene locus_tag LOCUS_43190 4895 6166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_43190 6214 7203 gene locus_tag LOCUS_43200 6214 7203 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_43200 7261 7333 gene locus_tag LOCUS_t00500 7261 7333 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7356 7430 gene locus_tag LOCUS_t00510 7356 7430 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8548 7460 gene locus_tag LOCUS_43210 8548 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 10414 8561 gene locus_tag LOCUS_43220 10414 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 12093 10480 gene locus_tag LOCUS_43230 12093 10480 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_43230 13485 12187 gene locus_tag LOCUS_43240 13485 12187 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence120 1766 549 gene locus_tag LOCUS_43250 1766 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 2551 2000 gene locus_tag LOCUS_43260 2551 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 3115 3858 gene locus_tag LOCUS_43270 3115 3858 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_43270 3855 4865 gene locus_tag LOCUS_43280 3855 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 4877 5896 gene locus_tag LOCUS_43290 4877 5896 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_43290 6221 6514 gene locus_tag LOCUS_43300 6221 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 6504 7334 gene locus_tag LOCUS_43310 6504 7334 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_43310 7959 7360 gene locus_tag LOCUS_43320 7959 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 8893 8030 gene locus_tag LOCUS_43330 8893 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 9888 8914 gene locus_tag LOCUS_43340 9888 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 <12872 9962 gene locus_tag LOCUS_43350 <12872 9962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001237656.1:Ig-like domain repeat protein >Feature sequence121 1604 360 gene locus_tag LOCUS_43360 1604 360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_43360 1762 2598 gene locus_tag LOCUS_43370 1762 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 2595 3359 gene locus_tag LOCUS_43380 2595 3359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_43380 4011 3361 gene locus_tag LOCUS_43390 4011 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43390 4461 4108 gene locus_tag LOCUS_43400 4461 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 4706 4473 gene locus_tag LOCUS_43410 4706 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 5178 4651 gene locus_tag LOCUS_43420 5178 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 6126 5914 gene locus_tag LOCUS_43430 6126 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 6510 7388 gene locus_tag LOCUS_43440 6510 7388 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_43440 7449 7919 gene locus_tag LOCUS_43450 7449 7919 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_43450 7933 10188 gene locus_tag LOCUS_43460 7933 10188 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_43460 10267 10542 gene locus_tag LOCUS_43470 10267 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 10567 11343 gene locus_tag LOCUS_43480 10567 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 >Feature sequence122 2877 430 gene locus_tag LOCUS_43490 2877 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 3206 4309 gene locus_tag LOCUS_43500 gene dgoD 3206 4309 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_43500 4365 5165 gene locus_tag LOCUS_43510 4365 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 5175 5987 gene locus_tag LOCUS_43520 5175 5987 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_43520 6217 6453 gene locus_tag LOCUS_43530 6217 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 7831 6572 gene locus_tag LOCUS_43540 7831 6572 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_43540 8758 8312 gene locus_tag LOCUS_43550 8758 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 9568 8801 gene locus_tag LOCUS_43560 gene tpiA 9568 8801 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_43560 10572 9568 gene locus_tag LOCUS_43570 gene gap 10572 9568 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_43570 >Feature sequence123 3686 786 gene locus_tag LOCUS_43580 3686 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 7385 4314 gene locus_tag LOCUS_43590 7385 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 8293 7565 gene locus_tag LOCUS_43600 8293 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 >Feature sequence124 2548 1631 gene locus_tag LOCUS_43610 2548 1631 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_43610 2962 3171 gene locus_tag LOCUS_43620 2962 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 3186 3524 gene locus_tag LOCUS_43630 3186 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 5167 3761 gene locus_tag LOCUS_43640 5167 3761 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_43640 7379 5190 gene locus_tag LOCUS_43650 7379 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 8400 7669 gene locus_tag LOCUS_43660 8400 7669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_43660 10154 8739 gene locus_tag LOCUS_43670 10154 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence125 140 3532 gene locus_tag LOCUS_43680 140 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 3547 3753 gene locus_tag LOCUS_43690 3547 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 3750 3962 gene locus_tag LOCUS_43700 3750 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 4042 5208 gene locus_tag LOCUS_43710 4042 5208 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_43710 5382 6470 gene locus_tag LOCUS_43720 5382 6470 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_43720 6511 8835 gene locus_tag LOCUS_43730 6511 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 8962 10266 gene locus_tag LOCUS_43740 8962 10266 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_43740 >Feature sequence126 354 2375 gene locus_tag LOCUS_43750 354 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 2372 4405 gene locus_tag LOCUS_43760 2372 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 4402 6759 gene locus_tag LOCUS_43770 4402 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 7917 6778 gene locus_tag LOCUS_43780 gene nagA 7917 6778 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418266.1 protein_id gnl|my_center|LOCUS_43780 8111 8893 gene locus_tag LOCUS_43790 8111 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 8921 9994 gene locus_tag LOCUS_43800 8921 9994 CDS product erythritol/L-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402615.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence127 406 771 gene locus_tag LOCUS_43810 406 771 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_43810 893 1960 gene locus_tag LOCUS_43820 893 1960 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_43820 2339 3169 gene locus_tag LOCUS_43830 2339 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 3357 4808 gene locus_tag LOCUS_43840 3357 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 5640 7037 gene locus_tag LOCUS_43850 5640 7037 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_43850 7076 8095 gene locus_tag LOCUS_43860 7076 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 8355 8513 gene locus_tag LOCUS_43870 8355 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 8901 9659 gene locus_tag LOCUS_43880 8901 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 >Feature sequence128 417 950 gene locus_tag LOCUS_43890 417 950 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_43890 954 1574 gene locus_tag LOCUS_43900 954 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 1623 2165 gene locus_tag LOCUS_43910 1623 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 2195 3631 gene locus_tag LOCUS_43920 2195 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 3621 4049 gene locus_tag LOCUS_43930 3621 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 4673 5380 gene locus_tag LOCUS_43940 4673 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 6563 5529 gene locus_tag LOCUS_43950 6563 5529 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_43950 7400 6606 gene locus_tag LOCUS_43960 7400 6606 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_43960 7906 8106 gene locus_tag LOCUS_43970 7906 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 9048 9701 gene locus_tag LOCUS_43980 9048 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 >Feature sequence129 219 1565 gene locus_tag LOCUS_43990 219 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 2003 1593 gene locus_tag LOCUS_44000 2003 1593 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_44000 3316 2630 gene locus_tag LOCUS_44010 3316 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 5705 3276 gene locus_tag LOCUS_44020 5705 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 8404 6080 gene locus_tag LOCUS_44030 8404 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence130 691 485 gene locus_tag LOCUS_44040 691 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 851 1135 gene locus_tag LOCUS_44050 851 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1168 1917 gene locus_tag LOCUS_44060 1168 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44060 1921 2259 gene locus_tag LOCUS_44070 1921 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 2464 2207 gene locus_tag LOCUS_44080 2464 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 3424 2705 gene locus_tag LOCUS_44090 3424 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 4054 3560 gene locus_tag LOCUS_44100 4054 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4564 4424 gene locus_tag LOCUS_44110 4564 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 4873 4565 gene locus_tag LOCUS_44120 4873 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44120 5216 5389 gene locus_tag LOCUS_44130 5216 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44130 6471 6229 gene locus_tag LOCUS_44140 6471 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 8512 6494 gene locus_tag LOCUS_44150 8512 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 >Feature sequence131 695 84 gene locus_tag LOCUS_44160 695 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 1346 4453 gene locus_tag LOCUS_44170 1346 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 5038 6138 gene locus_tag LOCUS_44180 5038 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 6320 8692 gene locus_tag LOCUS_44190 6320 8692 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_44190 >Feature sequence132 176 1066 gene locus_tag LOCUS_44200 176 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 1173 1772 gene locus_tag LOCUS_44210 1173 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 1826 2425 gene locus_tag LOCUS_44220 1826 2425 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_44220 2412 2936 gene locus_tag LOCUS_44230 2412 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 2949 4727 gene locus_tag LOCUS_44240 2949 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 4874 5488 gene locus_tag LOCUS_44250 gene purN 4874 5488 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_44250 5548 6483 gene locus_tag LOCUS_44260 5548 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 6627 7457 gene locus_tag LOCUS_44270 6627 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 7501 8331 gene locus_tag LOCUS_44280 7501 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 >Feature sequence133 681 1091 gene locus_tag LOCUS_44290 681 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 1628 2164 gene locus_tag LOCUS_44300 1628 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 3899 2598 gene locus_tag LOCUS_44310 3899 2598 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_44310 4730 3978 gene locus_tag LOCUS_44320 4730 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 5044 5781 gene locus_tag LOCUS_44330 5044 5781 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763098.1 protein_id gnl|my_center|LOCUS_44330 5774 7693 gene locus_tag LOCUS_44340 5774 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 8100 7714 gene locus_tag LOCUS_44350 8100 7714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 >Feature sequence134 575 153 gene locus_tag LOCUS_44360 575 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 1543 1037 gene locus_tag LOCUS_44370 1543 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 3005 7237 gene locus_tag LOCUS_44380 3005 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence135 663 875 gene locus_tag LOCUS_44390 663 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 1016 1924 gene locus_tag LOCUS_44400 1016 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 2168 2431 gene locus_tag LOCUS_44410 2168 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 2451 3638 gene locus_tag LOCUS_44420 2451 3638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_44420 3663 4337 gene locus_tag LOCUS_44430 3663 4337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_44430 4334 5734 gene locus_tag LOCUS_44440 4334 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 5741 7636 gene locus_tag LOCUS_44450 5741 7636 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_44450 >Feature sequence136 459 656 gene locus_tag LOCUS_44460 459 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 3693 760 gene locus_tag LOCUS_44470 3693 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 6880 3785 gene locus_tag LOCUS_44480 6880 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence137 226 888 gene locus_tag LOCUS_44490 226 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 1507 3357 gene locus_tag LOCUS_44500 1507 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 3354 3536 gene locus_tag LOCUS_44510 3354 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 3835 4182 gene locus_tag LOCUS_44520 3835 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 5856 4939 gene locus_tag LOCUS_44530 5856 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 >Feature sequence138 276 2210 gene locus_tag LOCUS_44540 276 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 2273 3484 gene locus_tag LOCUS_44550 2273 3484 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_44550 3481 4098 gene locus_tag LOCUS_44560 3481 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 4308 5183 gene locus_tag LOCUS_44570 4308 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 5188 6123 gene locus_tag LOCUS_44580 gene rbsK 5188 6123 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence139 1436 624 gene locus_tag LOCUS_44590 1436 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 1831 3270 gene locus_tag LOCUS_44600 1831 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 4072 5706 gene locus_tag LOCUS_44610 4072 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 >Feature sequence140 267 1358 gene locus_tag LOCUS_44620 267 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 2947 1466 gene locus_tag LOCUS_44630 2947 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5489 3411 gene locus_tag LOCUS_44640 5489 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 >Feature sequence141 159 1130 gene locus_tag LOCUS_44650 159 1130 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_44650 1709 1158 gene locus_tag LOCUS_44660 1709 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 3715 2081 gene locus_tag LOCUS_44670 gene cimA 3715 2081 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_44670 3967 5382 gene locus_tag LOCUS_44680 3967 5382 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_44680 >Feature sequence142 1842 196 gene locus_tag LOCUS_44690 gene murJ 1842 196 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_44690 2560 2940 gene locus_tag LOCUS_44700 2560 2940 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_44700 3726 2941 gene locus_tag LOCUS_44710 gene thiD 3726 2941 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403990.1 protein_id gnl|my_center|LOCUS_44710 4526 5002 gene locus_tag LOCUS_44720 4526 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence143 232 92 gene locus_tag LOCUS_44730 232 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 635 2341 gene locus_tag LOCUS_44740 635 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2377 3237 gene locus_tag LOCUS_44750 2377 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 3265 4104 gene locus_tag LOCUS_44760 3265 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 4412 4696 gene locus_tag LOCUS_44770 4412 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 >Feature sequence144 672 1364 gene locus_tag LOCUS_44780 672 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 1386 2258 gene locus_tag LOCUS_44790 1386 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2503 3291 gene locus_tag LOCUS_44800 2503 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 3475 4227 gene locus_tag LOCUS_44810 3475 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 >Feature sequence145 534 409 gene locus_tag LOCUS_44820 534 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1479 685 gene locus_tag LOCUS_44830 1479 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 2448 2278 gene locus_tag LOCUS_44840 2448 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 4463 2826 gene locus_tag LOCUS_44850 4463 2826 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_44850 >Feature sequence146 470 264 gene locus_tag LOCUS_44860 470 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 1005 592 gene locus_tag LOCUS_44870 1005 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 1629 1270 gene locus_tag LOCUS_44880 1629 1270 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_44880 3193 2003 gene locus_tag LOCUS_44890 3193 2003 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921978.1 protein_id gnl|my_center|LOCUS_44890 4298 3177 gene locus_tag LOCUS_44900 4298 3177 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence147 170 2101 gene locus_tag LOCUS_44910 170 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 2173 3216 gene locus_tag LOCUS_44920 2173 3216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_44920 3410 4129 gene locus_tag LOCUS_44930 3410 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence148 219 1640 gene locus_tag LOCUS_44940 219 1640 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_44940 2666 1701 gene locus_tag LOCUS_44950 2666 1701 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_44950 3510 2932 gene locus_tag LOCUS_44960 3510 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 4125 3844 gene locus_tag LOCUS_44970 4125 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 >Feature sequence149 132 905 gene locus_tag LOCUS_44980 132 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 939 2492 gene locus_tag LOCUS_44990 939 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 2554 2757 gene locus_tag LOCUS_45000 2554 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 2790 3131 gene locus_tag LOCUS_45010 2790 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 3251 3454 gene locus_tag LOCUS_45020 3251 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 >Feature sequence150 922 248 gene locus_tag LOCUS_45030 922 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 3166 1847 gene locus_tag LOCUS_45040 3166 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 >Feature sequence151 345 3377 gene locus_tag LOCUS_45050 345 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 >Feature sequence152 66 1493 gene locus_tag LOCUS_45060 66 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 1846 3273 gene locus_tag LOCUS_45070 1846 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence153 3184 1640 gene locus_tag LOCUS_45080 3184 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 >Feature sequence154 2 2788 gene locus_tag LOCUS_45090 2 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 >Feature sequence155 >Feature sequence156 2 2806 gene locus_tag LOCUS_45100 2 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence157 900 1307 gene locus_tag LOCUS_45110 900 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45110 1322 1774 gene locus_tag LOCUS_45120 1322 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 1788 1919 gene locus_tag LOCUS_45130 1788 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 2126 2350 gene locus_tag LOCUS_45140 2126 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 >Feature sequence158 1543 641 gene locus_tag LOCUS_45150 1543 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 2177 1536 gene locus_tag LOCUS_45160 2177 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160