>Feature sequence0001 338 24 gene locus_tag LOCUS_00010 338 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 647 450 gene locus_tag LOCUS_00020 647 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1121 657 gene locus_tag LOCUS_00030 1121 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1982 1221 gene locus_tag LOCUS_00040 1982 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2661 2137 gene locus_tag LOCUS_00050 2661 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2809 3969 gene locus_tag LOCUS_00060 2809 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4323 5267 gene locus_tag LOCUS_00070 4323 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5347 5604 gene locus_tag LOCUS_00080 5347 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6195 5845 gene locus_tag LOCUS_00090 6195 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6736 6185 gene locus_tag LOCUS_00100 6736 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7269 6877 gene locus_tag LOCUS_00110 7269 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8712 7291 gene locus_tag LOCUS_00120 8712 7291 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267012.1 protein_id gnl|my_center|LOCUS_00120 9334 8837 gene locus_tag LOCUS_00130 9334 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9656 9321 gene locus_tag LOCUS_00140 9656 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10291 9734 gene locus_tag LOCUS_00150 10291 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 10732 10391 gene locus_tag LOCUS_00160 10732 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 11194 10931 gene locus_tag LOCUS_00170 11194 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 11612 11277 gene locus_tag LOCUS_00180 11612 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 11740 12360 gene locus_tag LOCUS_00190 11740 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 12641 12357 gene locus_tag LOCUS_00200 12641 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 12975 12652 gene locus_tag LOCUS_00210 12975 12652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 13462 13175 gene locus_tag LOCUS_00220 13462 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 14349 13513 gene locus_tag LOCUS_00230 14349 13513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 14521 14351 gene locus_tag LOCUS_00240 14521 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 15086 14577 gene locus_tag LOCUS_00250 15086 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 15331 15083 gene locus_tag LOCUS_00260 15331 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 15512 15676 gene locus_tag LOCUS_00270 15512 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 16526 15690 gene locus_tag LOCUS_00280 16526 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 17023 16703 gene locus_tag LOCUS_00290 17023 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 17510 17046 gene locus_tag LOCUS_00300 17510 17046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 18119 17652 gene locus_tag LOCUS_00310 18119 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18675 18196 gene locus_tag LOCUS_00320 18675 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 19304 18672 gene locus_tag LOCUS_00330 19304 18672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 19504 20868 gene locus_tag LOCUS_00340 19504 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20918 21181 gene locus_tag LOCUS_00350 20918 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 21192 21449 gene locus_tag LOCUS_00360 21192 21449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 21449 21898 gene locus_tag LOCUS_00370 21449 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 21853 22065 gene locus_tag LOCUS_00380 21853 22065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 22572 22255 gene locus_tag LOCUS_00390 22572 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22898 22569 gene locus_tag LOCUS_00400 22898 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 23324 22908 gene locus_tag LOCUS_00410 23324 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 23796 23536 gene locus_tag LOCUS_00420 23796 23536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 24268 23783 gene locus_tag LOCUS_00430 24268 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 25125 24259 gene locus_tag LOCUS_00440 25125 24259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 25808 25122 gene locus_tag LOCUS_00450 25808 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 25844 26692 gene locus_tag LOCUS_00460 25844 26692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 26789 27070 gene locus_tag LOCUS_00470 26789 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 27410 27099 gene locus_tag LOCUS_00480 27410 27099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 27779 27486 gene locus_tag LOCUS_00490 27779 27486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 28512 27883 gene locus_tag LOCUS_00500 28512 27883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 29526 28645 gene locus_tag LOCUS_00510 29526 28645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 30059 29592 gene locus_tag LOCUS_00520 30059 29592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 30446 30195 gene locus_tag LOCUS_00530 30446 30195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 30933 30433 gene locus_tag LOCUS_00540 30933 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 31265 30933 gene locus_tag LOCUS_00550 31265 30933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 33641 31410 gene locus_tag LOCUS_00560 33641 31410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 34591 33827 gene locus_tag LOCUS_00570 34591 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 35275 34673 gene locus_tag LOCUS_00580 35275 34673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 36129 35281 gene locus_tag LOCUS_00590 36129 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 36584 36126 gene locus_tag LOCUS_00600 36584 36126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 37111 36584 gene locus_tag LOCUS_00610 37111 36584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 37619 37179 gene locus_tag LOCUS_00620 37619 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 38506 37679 gene locus_tag LOCUS_00630 38506 37679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 38909 38562 gene locus_tag LOCUS_00640 38909 38562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 39397 38909 gene locus_tag LOCUS_00650 39397 38909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 39335 39532 gene locus_tag LOCUS_00660 39335 39532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 39548 40141 gene locus_tag LOCUS_00670 39548 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 40587 40150 gene locus_tag LOCUS_00680 40587 40150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 41289 40588 gene locus_tag LOCUS_00690 gene tmk 41289 40588 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490472.1 protein_id gnl|my_center|LOCUS_00690 42208 41399 gene locus_tag LOCUS_00700 42208 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 43280 42444 gene locus_tag LOCUS_00710 43280 42444 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_00710 44031 43396 gene locus_tag LOCUS_00720 44031 43396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 44383 44042 gene locus_tag LOCUS_00730 44383 44042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 44583 44819 gene locus_tag LOCUS_00740 44583 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 44873 45709 gene locus_tag LOCUS_00750 44873 45709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 45972 45724 gene locus_tag LOCUS_00760 45972 45724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 46145 46897 gene locus_tag LOCUS_00770 46145 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 47038 47406 gene locus_tag LOCUS_00780 47038 47406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 47473 48039 gene locus_tag LOCUS_00790 47473 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 48036 48245 gene locus_tag LOCUS_00800 48036 48245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 48325 49656 gene locus_tag LOCUS_00810 48325 49656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 49707 50084 gene locus_tag LOCUS_00820 49707 50084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 50188 50685 gene locus_tag LOCUS_00830 50188 50685 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_00830 50685 52070 gene locus_tag LOCUS_00840 50685 52070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 52070 53824 gene locus_tag LOCUS_00850 52070 53824 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_00850 53840 57001 gene locus_tag LOCUS_00860 53840 57001 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_00860 57040 57387 gene locus_tag LOCUS_00870 57040 57387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 57463 57693 gene locus_tag LOCUS_00880 57463 57693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 57767 58489 gene locus_tag LOCUS_00890 57767 58489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 58653 58826 gene locus_tag LOCUS_00900 58653 58826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 58750 59235 gene locus_tag LOCUS_00910 58750 59235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 59232 60581 gene locus_tag LOCUS_00920 59232 60581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 60592 61254 gene locus_tag LOCUS_00930 60592 61254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 61323 61733 gene locus_tag LOCUS_00940 61323 61733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 62178 62996 gene locus_tag LOCUS_00950 62178 62996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 63078 63371 gene locus_tag LOCUS_00960 63078 63371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 64709 64404 gene locus_tag LOCUS_00970 64709 64404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 65434 64787 gene locus_tag LOCUS_00980 65434 64787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 65834 65523 gene locus_tag LOCUS_00990 65834 65523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 66229 65837 gene locus_tag LOCUS_01000 66229 65837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 66976 66233 gene locus_tag LOCUS_01010 66976 66233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 67755 67108 gene locus_tag LOCUS_01020 67755 67108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 68482 68090 gene locus_tag LOCUS_01030 68482 68090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 69227 68550 gene locus_tag LOCUS_01040 69227 68550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 69690 69499 gene locus_tag LOCUS_01050 69690 69499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 69985 69803 gene locus_tag LOCUS_01060 69985 69803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 70087 70269 gene locus_tag LOCUS_01070 70087 70269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 71388 70720 gene locus_tag LOCUS_01080 71388 70720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 72104 71385 gene locus_tag LOCUS_01090 72104 71385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 72881 72387 gene locus_tag LOCUS_01100 72881 72387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 73577 73008 gene locus_tag LOCUS_01110 73577 73008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 74015 73599 gene locus_tag LOCUS_01120 74015 73599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 74642 74085 gene locus_tag LOCUS_01130 74642 74085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 75108 74629 gene locus_tag LOCUS_01140 75108 74629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 75273 75629 gene locus_tag LOCUS_01150 75273 75629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 75662 75973 gene locus_tag LOCUS_01160 75662 75973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 76032 76754 gene locus_tag LOCUS_01170 76032 76754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 77217 76786 gene locus_tag LOCUS_01180 77217 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 77640 77326 gene locus_tag LOCUS_01190 77640 77326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 77941 78423 gene locus_tag LOCUS_01200 77941 78423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 78507 79325 gene locus_tag LOCUS_01210 78507 79325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 80229 79399 gene locus_tag LOCUS_01220 80229 79399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 80592 80347 gene locus_tag LOCUS_01230 gene hfq 80592 80347 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_01230 81185 80724 gene locus_tag LOCUS_01240 81185 80724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 81917 81258 gene locus_tag LOCUS_01250 81917 81258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 82642 82058 gene locus_tag LOCUS_01260 82642 82058 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_01260 83320 82730 gene locus_tag LOCUS_01270 83320 82730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 84122 83385 gene locus_tag LOCUS_01280 84122 83385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 84401 84198 gene locus_tag LOCUS_01290 84401 84198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 85050 84418 gene locus_tag LOCUS_01300 85050 84418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 85847 85047 gene locus_tag LOCUS_01310 85847 85047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 86385 85840 gene locus_tag LOCUS_01320 86385 85840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 86726 86382 gene locus_tag LOCUS_01330 86726 86382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 86928 87095 gene locus_tag LOCUS_01340 86928 87095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 87448 87092 gene locus_tag LOCUS_01350 87448 87092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 88330 87692 gene locus_tag LOCUS_01360 88330 87692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 89184 88561 gene locus_tag LOCUS_01370 89184 88561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 89900 89274 gene locus_tag LOCUS_01380 89900 89274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 90660 90412 gene locus_tag LOCUS_01390 90660 90412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 91127 90669 gene locus_tag LOCUS_01400 91127 90669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 91264 91905 gene locus_tag LOCUS_01410 91264 91905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 92576 91965 gene locus_tag LOCUS_01420 92576 91965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 94584 92596 gene locus_tag LOCUS_01430 94584 92596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 95358 94681 gene locus_tag LOCUS_01440 95358 94681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 96514 95345 gene locus_tag LOCUS_01450 96514 95345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 96799 97410 gene locus_tag LOCUS_01460 96799 97410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 97407 98129 gene locus_tag LOCUS_01470 97407 98129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 98114 98803 gene locus_tag LOCUS_01480 98114 98803 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_01480 98823 100043 gene locus_tag LOCUS_01490 98823 100043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_01490 100440 100054 gene locus_tag LOCUS_01500 100440 100054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 101030 100443 gene locus_tag LOCUS_01510 101030 100443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 102150 101392 gene locus_tag LOCUS_01520 102150 101392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 102655 102176 gene locus_tag LOCUS_01530 102655 102176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 103126 102710 gene locus_tag LOCUS_01540 103126 102710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 103921 103244 gene locus_tag LOCUS_01550 103921 103244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 104660 104127 gene locus_tag LOCUS_01560 104660 104127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 105428 104793 gene locus_tag LOCUS_01570 105428 104793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 107605 105392 gene locus_tag LOCUS_01580 107605 105392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 108309 107605 gene locus_tag LOCUS_01590 108309 107605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 108802 108461 gene locus_tag LOCUS_01600 108802 108461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 109141 108947 gene locus_tag LOCUS_01610 109141 108947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 109349 109624 gene locus_tag LOCUS_01620 109349 109624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 110403 109621 gene locus_tag LOCUS_01630 110403 109621 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_01630 111227 110472 gene locus_tag LOCUS_01640 111227 110472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 111382 111624 gene locus_tag LOCUS_01650 111382 111624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 112357 111635 gene locus_tag LOCUS_01660 112357 111635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 112487 113143 gene locus_tag LOCUS_01670 112487 113143 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_01670 113632 113210 gene locus_tag LOCUS_01680 113632 113210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070814.1 protein_id gnl|my_center|LOCUS_01680 113878 114270 gene locus_tag LOCUS_01690 113878 114270 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384139.1 protein_id gnl|my_center|LOCUS_01690 114474 115028 gene locus_tag LOCUS_01700 114474 115028 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_01700 115037 116698 gene locus_tag LOCUS_01710 115037 116698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 119069 117255 gene locus_tag LOCUS_01720 119069 117255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 119695 119111 gene locus_tag LOCUS_01730 119695 119111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 120321 119689 gene locus_tag LOCUS_01740 120321 119689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 121988 120516 gene locus_tag LOCUS_01750 121988 120516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 122211 122960 gene locus_tag LOCUS_01760 122211 122960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 124017 123013 gene locus_tag LOCUS_01770 124017 123013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 124120 124497 gene locus_tag LOCUS_01780 124120 124497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 125014 124553 gene locus_tag LOCUS_01790 125014 124553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 125275 125027 gene locus_tag LOCUS_01800 125275 125027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 125679 125377 gene locus_tag LOCUS_01810 125679 125377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 125827 127164 gene locus_tag LOCUS_01820 125827 127164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 127724 127161 gene locus_tag LOCUS_01830 127724 127161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 128266 127781 gene locus_tag LOCUS_01840 128266 127781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 128386 128745 gene locus_tag LOCUS_01850 128386 128745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 129497 128784 gene locus_tag LOCUS_01860 129497 128784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 129896 129573 gene locus_tag LOCUS_01870 129896 129573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 130162 129893 gene locus_tag LOCUS_01880 130162 129893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 130305 130739 gene locus_tag LOCUS_01890 130305 130739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 130739 131179 gene locus_tag LOCUS_01900 130739 131179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 131250 131441 gene locus_tag LOCUS_01910 131250 131441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 131631 132500 gene locus_tag LOCUS_01920 131631 132500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 132864 132556 gene locus_tag LOCUS_01930 132864 132556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 134918 132945 gene locus_tag LOCUS_01940 134918 132945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 135511 135032 gene locus_tag LOCUS_01950 135511 135032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 136009 135515 gene locus_tag LOCUS_01960 136009 135515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 136747 136091 gene locus_tag LOCUS_01970 136747 136091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 136899 137156 gene locus_tag LOCUS_01980 136899 137156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 137585 137286 gene locus_tag LOCUS_01990 137585 137286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 138633 137605 gene locus_tag LOCUS_02000 138633 137605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 139597 138938 gene locus_tag LOCUS_02010 139597 138938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 140334 139660 gene locus_tag LOCUS_02020 140334 139660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 141180 140467 gene locus_tag LOCUS_02030 141180 140467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 141762 141370 gene locus_tag LOCUS_02040 141762 141370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 142489 141920 gene locus_tag LOCUS_02050 142489 141920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 143086 142592 gene locus_tag LOCUS_02060 143086 142592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 144031 143504 gene locus_tag LOCUS_02070 gene dfrA 144031 143504 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_02070 144404 144078 gene locus_tag LOCUS_02080 144404 144078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 144984 144463 gene locus_tag LOCUS_02090 144984 144463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 145782 145063 gene locus_tag LOCUS_02100 145782 145063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 146092 146817 gene locus_tag LOCUS_02110 146092 146817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 146832 147071 gene locus_tag LOCUS_02120 146832 147071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 148510 147074 gene locus_tag LOCUS_02130 148510 147074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 148642 150354 gene locus_tag LOCUS_02140 148642 150354 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011068.1 protein_id gnl|my_center|LOCUS_02140 150359 151471 gene locus_tag LOCUS_02150 150359 151471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 151468 152589 gene locus_tag LOCUS_02160 151468 152589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 152586 152864 gene locus_tag LOCUS_02170 152586 152864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 152931 153551 gene locus_tag LOCUS_02180 152931 153551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 153548 154036 gene locus_tag LOCUS_02190 153548 154036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 154023 155528 gene locus_tag LOCUS_02200 154023 155528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 155685 155963 gene locus_tag LOCUS_02210 gene hupB 155685 155963 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_02210 156696 156052 gene locus_tag LOCUS_02220 156696 156052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 156827 157042 gene locus_tag LOCUS_02230 156827 157042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 158055 157039 gene locus_tag LOCUS_02240 158055 157039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 158194 158436 gene locus_tag LOCUS_02250 158194 158436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 159110 158484 gene locus_tag LOCUS_02260 159110 158484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 159401 160984 gene locus_tag LOCUS_02270 159401 160984 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 protein_id gnl|my_center|LOCUS_02270 161835 162323 gene locus_tag LOCUS_02280 161835 162323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 162369 162572 gene locus_tag LOCUS_02290 162369 162572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 162680 165295 gene locus_tag LOCUS_02300 162680 165295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 165295 165915 gene locus_tag LOCUS_02310 165295 165915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 165905 166726 gene locus_tag LOCUS_02320 165905 166726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 166770 167825 gene locus_tag LOCUS_02330 166770 167825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 167971 169683 gene locus_tag LOCUS_02340 167971 169683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 170275 169760 gene locus_tag LOCUS_02350 170275 169760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 171592 170486 gene locus_tag LOCUS_02360 171592 170486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 172045 177687 gene locus_tag LOCUS_02370 172045 177687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 178424 177801 gene locus_tag LOCUS_02380 178424 177801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 178875 178513 gene locus_tag LOCUS_02390 178875 178513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 179224 179472 gene locus_tag LOCUS_02400 179224 179472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 180012 179488 gene locus_tag LOCUS_02410 180012 179488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 180631 180020 gene locus_tag LOCUS_02420 180631 180020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 181700 180624 gene locus_tag LOCUS_02430 181700 180624 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_02430 182196 181858 gene locus_tag LOCUS_02440 182196 181858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 182692 182189 gene locus_tag LOCUS_02450 182692 182189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 183836 182673 gene locus_tag LOCUS_02460 183836 182673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 184345 183902 gene locus_tag LOCUS_02470 184345 183902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 184844 184356 gene locus_tag LOCUS_02480 184844 184356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 185474 184908 gene locus_tag LOCUS_02490 185474 184908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 186866 185607 gene locus_tag LOCUS_02500 186866 185607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 187318 186935 gene locus_tag LOCUS_02510 187318 186935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 188528 187272 gene locus_tag LOCUS_02520 188528 187272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 188976 188695 gene locus_tag LOCUS_02530 gene grxC 188976 188695 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772051.1 protein_id gnl|my_center|LOCUS_02530 190090 189047 gene locus_tag LOCUS_02540 190090 189047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 191025 190177 gene locus_tag LOCUS_02550 gene rpoH 191025 190177 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421372.1 protein_id gnl|my_center|LOCUS_02550 191565 191116 gene locus_tag LOCUS_02560 191565 191116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 192061 191639 gene locus_tag LOCUS_02570 192061 191639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 192536 192123 gene locus_tag LOCUS_02580 192536 192123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 193029 192526 gene locus_tag LOCUS_02590 193029 192526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 193377 193042 gene locus_tag LOCUS_02600 193377 193042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 194312 193404 gene locus_tag LOCUS_02610 194312 193404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 195222 195539 gene locus_tag LOCUS_02620 195222 195539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 195539 196240 gene locus_tag LOCUS_02630 195539 196240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 196699 196259 gene locus_tag LOCUS_02640 196699 196259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 197043 196699 gene locus_tag LOCUS_02650 197043 196699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 197702 197076 gene locus_tag LOCUS_02660 197702 197076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 198201 197692 gene locus_tag LOCUS_02670 198201 197692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 198777 198211 gene locus_tag LOCUS_02680 198777 198211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 198908 199651 gene locus_tag LOCUS_02690 198908 199651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 200619 199714 gene locus_tag LOCUS_02700 200619 199714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 201019 200837 gene locus_tag LOCUS_02710 201019 200837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 201210 200932 gene locus_tag LOCUS_02720 201210 200932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 202129 201371 gene locus_tag LOCUS_02730 202129 201371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 202914 202126 gene locus_tag LOCUS_02740 202914 202126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 204002 202977 gene locus_tag LOCUS_02750 204002 202977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 204225 204004 gene locus_tag LOCUS_02760 204225 204004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 205115 204222 gene locus_tag LOCUS_02770 205115 204222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 205277 206512 gene locus_tag LOCUS_02780 205277 206512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 206783 208279 gene locus_tag LOCUS_02790 206783 208279 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_02790 209522 208335 gene locus_tag LOCUS_02800 209522 208335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 210087 209515 gene locus_tag LOCUS_02810 210087 209515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 210463 210173 gene locus_tag LOCUS_02820 210463 210173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 210854 210684 gene locus_tag LOCUS_02830 210854 210684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 211512 210973 gene locus_tag LOCUS_02840 211512 210973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 212806 211949 gene locus_tag LOCUS_02850 212806 211949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 214010 212799 gene locus_tag LOCUS_02860 214010 212799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 214976 214020 gene locus_tag LOCUS_02870 214976 214020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 215462 214986 gene locus_tag LOCUS_02880 215462 214986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 216864 215545 gene locus_tag LOCUS_02890 216864 215545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 217915 216932 gene locus_tag LOCUS_02900 217915 216932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 219014 218163 gene locus_tag LOCUS_02910 219014 218163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 219863 219024 gene locus_tag LOCUS_02920 219863 219024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 219957 221189 gene locus_tag LOCUS_02930 219957 221189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 221437 222147 gene locus_tag LOCUS_02940 221437 222147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 222448 222179 gene locus_tag LOCUS_02950 222448 222179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 222818 222537 gene locus_tag LOCUS_02960 222818 222537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 223342 222890 gene locus_tag LOCUS_02970 223342 222890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 223578 223375 gene locus_tag LOCUS_02980 223578 223375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 224263 223949 gene locus_tag LOCUS_02990 224263 223949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 224823 224260 gene locus_tag LOCUS_03000 224823 224260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 225025 224879 gene locus_tag LOCUS_03010 225025 224879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 226511 225042 gene locus_tag LOCUS_03020 226511 225042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 227874 226672 gene locus_tag LOCUS_03030 227874 226672 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072276.1 protein_id gnl|my_center|LOCUS_03030 228439 227978 gene locus_tag LOCUS_03040 228439 227978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 228786 228463 gene locus_tag LOCUS_03050 228786 228463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 229829 228858 gene locus_tag LOCUS_03060 229829 228858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 230147 230527 gene locus_tag LOCUS_03070 230147 230527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 231007 230528 gene locus_tag LOCUS_03080 231007 230528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 231727 231134 gene locus_tag LOCUS_03090 231727 231134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 233620 231827 gene locus_tag LOCUS_03100 233620 231827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 234408 233683 gene locus_tag LOCUS_03110 234408 233683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 235621 234410 gene locus_tag LOCUS_03120 235621 234410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 237540 235717 gene locus_tag LOCUS_03130 237540 235717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 237670 238080 gene locus_tag LOCUS_03140 237670 238080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 240073 238145 gene locus_tag LOCUS_03150 240073 238145 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_03150 240209 240526 gene locus_tag LOCUS_03160 240209 240526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 240537 240947 gene locus_tag LOCUS_03170 240537 240947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 241525 240944 gene locus_tag LOCUS_03180 241525 240944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 241663 242004 gene locus_tag LOCUS_03190 241663 242004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 242536 241970 gene locus_tag LOCUS_03200 242536 241970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 243392 242832 gene locus_tag LOCUS_03210 243392 242832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 243755 243447 gene locus_tag LOCUS_03220 243755 243447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 243962 244159 gene locus_tag LOCUS_03230 243962 244159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 244168 244671 gene locus_tag LOCUS_03240 gene dsbB 244168 244671 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706278.1 protein_id gnl|my_center|LOCUS_03240 244787 245716 gene locus_tag LOCUS_03250 244787 245716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 245876 247633 gene locus_tag LOCUS_03260 245876 247633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 247645 249147 gene locus_tag LOCUS_03270 247645 249147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 249245 249577 gene locus_tag LOCUS_03280 249245 249577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 250446 249571 gene locus_tag LOCUS_03290 250446 249571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 250671 250868 gene locus_tag LOCUS_03300 gene csrA 250671 250868 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906485.1 protein_id gnl|my_center|LOCUS_03300 251007 252827 gene locus_tag LOCUS_03310 251007 252827 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071015.1 protein_id gnl|my_center|LOCUS_03310 253563 252829 gene locus_tag LOCUS_03320 253563 252829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 254588 253644 gene locus_tag LOCUS_03330 254588 253644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 255059 256135 gene locus_tag LOCUS_03340 255059 256135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 258521 256185 gene locus_tag LOCUS_03350 258521 256185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 259022 258657 gene locus_tag LOCUS_03360 259022 258657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 259423 261819 gene locus_tag LOCUS_03370 gene nrdA 259423 261819 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098011.1 protein_id gnl|my_center|LOCUS_03370 261882 263015 gene locus_tag LOCUS_03380 gene nrdB 261882 263015 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332037.1 protein_id gnl|my_center|LOCUS_03380 263122 264123 gene locus_tag LOCUS_03390 263122 264123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 264763 266421 gene locus_tag LOCUS_03400 264763 266421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 271100 267222 gene locus_tag LOCUS_03410 271100 267222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 273252 271192 gene locus_tag LOCUS_03420 273252 271192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 273426 273803 gene locus_tag LOCUS_03430 273426 273803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 274332 279176 gene locus_tag LOCUS_03440 274332 279176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 280332 279223 gene locus_tag LOCUS_03450 280332 279223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 280732 280397 gene locus_tag LOCUS_03460 280732 280397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 281169 280804 gene locus_tag LOCUS_03470 281169 280804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 281751 282725 gene locus_tag LOCUS_03480 281751 282725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 282810 283697 gene locus_tag LOCUS_03490 282810 283697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 283700 284182 gene locus_tag LOCUS_03500 283700 284182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 285303 284179 gene locus_tag LOCUS_03510 285303 284179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 285947 285369 gene locus_tag LOCUS_03520 285947 285369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 287555 285951 gene locus_tag LOCUS_03530 287555 285951 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120833.1 protein_id gnl|my_center|LOCUS_03530 288502 287633 gene locus_tag LOCUS_03540 288502 287633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 289064 288693 gene locus_tag LOCUS_03550 289064 288693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 290045 289158 gene locus_tag LOCUS_03560 290045 289158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 290616 290143 gene locus_tag LOCUS_03570 290616 290143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 291501 290923 gene locus_tag LOCUS_03580 291501 290923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 291941 291627 gene locus_tag LOCUS_03590 291941 291627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 292110 292802 gene locus_tag LOCUS_03600 292110 292802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 292817 293467 gene locus_tag LOCUS_03610 292817 293467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 293553 294302 gene locus_tag LOCUS_03620 293553 294302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 294375 294686 gene locus_tag LOCUS_03630 294375 294686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 294749 295189 gene locus_tag LOCUS_03640 294749 295189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 295182 295343 gene locus_tag LOCUS_03650 295182 295343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 296055 295348 gene locus_tag LOCUS_03660 296055 295348 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_03660 296362 296646 gene locus_tag LOCUS_03670 296362 296646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 298035 296680 gene locus_tag LOCUS_03680 298035 296680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence0002 2858 783 gene locus_tag LOCUS_03690 2858 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3811 2882 gene locus_tag LOCUS_03700 3811 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 5210 3879 gene locus_tag LOCUS_03710 5210 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5929 5291 gene locus_tag LOCUS_03720 5929 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 5991 6260 gene locus_tag LOCUS_03730 5991 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6736 7581 gene locus_tag LOCUS_03740 6736 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7737 9242 gene locus_tag LOCUS_03750 7737 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9244 10086 gene locus_tag LOCUS_03760 9244 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10501 10043 gene locus_tag LOCUS_03770 10501 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 10631 11281 gene locus_tag LOCUS_03780 gene rnhB 10631 11281 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071798.1 protein_id gnl|my_center|LOCUS_03780 11787 11290 gene locus_tag LOCUS_03790 11787 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 12150 11806 gene locus_tag LOCUS_03800 12150 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 13728 12298 gene locus_tag LOCUS_03810 gene glmM 13728 12298 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_03810 13810 14340 gene locus_tag LOCUS_03820 13810 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 14988 14719 gene locus_tag LOCUS_03830 14988 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 15131 16126 gene locus_tag LOCUS_03840 15131 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 16467 16156 gene locus_tag LOCUS_03850 16467 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17625 16492 gene locus_tag LOCUS_03860 17625 16492 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268014.1 protein_id gnl|my_center|LOCUS_03860 18147 17689 gene locus_tag LOCUS_03870 18147 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 18328 19119 gene locus_tag LOCUS_03880 18328 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 19804 19172 gene locus_tag LOCUS_03890 19804 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 20081 21055 gene locus_tag LOCUS_03900 20081 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 21057 22838 gene locus_tag LOCUS_03910 21057 22838 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036087.1 protein_id gnl|my_center|LOCUS_03910 24117 22897 gene locus_tag LOCUS_03920 24117 22897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 24218 25612 gene locus_tag LOCUS_03930 24218 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 26401 25613 gene locus_tag LOCUS_03940 26401 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 26463 26966 gene locus_tag LOCUS_03950 26463 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 28678 26948 gene locus_tag LOCUS_03960 28678 26948 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_03960 29482 28745 gene locus_tag LOCUS_03970 29482 28745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 29628 31709 gene locus_tag LOCUS_03980 gene recG 29628 31709 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421393.1 protein_id gnl|my_center|LOCUS_03980 31774 32043 gene locus_tag LOCUS_03990 31774 32043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 32396 32848 gene locus_tag LOCUS_04000 32396 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 33610 32894 gene locus_tag LOCUS_04010 33610 32894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 33780 34355 gene locus_tag LOCUS_04020 33780 34355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 34827 34426 gene locus_tag LOCUS_04030 34827 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 35825 34992 gene locus_tag LOCUS_04040 35825 34992 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889336.1 protein_id gnl|my_center|LOCUS_04040 36210 37730 gene locus_tag LOCUS_04050 36210 37730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 37903 39171 gene locus_tag LOCUS_04060 37903 39171 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_04060 39329 40822 gene locus_tag LOCUS_04070 39329 40822 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502881.1 protein_id gnl|my_center|LOCUS_04070 40921 41058 gene locus_tag LOCUS_04080 40921 41058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 41220 42332 gene locus_tag LOCUS_04090 gene wecB 41220 42332 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176215.1 protein_id gnl|my_center|LOCUS_04090 42401 43663 gene locus_tag LOCUS_04100 gene wecC 42401 43663 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006609.1 protein_id gnl|my_center|LOCUS_04100 44145 43792 gene locus_tag LOCUS_04110 44145 43792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 44394 44158 gene locus_tag LOCUS_04120 44394 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 45267 44425 gene locus_tag LOCUS_04130 45267 44425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 46357 45341 gene locus_tag LOCUS_04140 gene galE 46357 45341 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_04140 46505 47515 gene locus_tag LOCUS_04150 46505 47515 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 protein_id gnl|my_center|LOCUS_04150 47717 47968 gene locus_tag LOCUS_04160 47717 47968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 47949 48257 gene locus_tag LOCUS_04170 47949 48257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04170 48430 50091 gene locus_tag LOCUS_04180 48430 50091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 51201 50164 gene locus_tag LOCUS_04190 51201 50164 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_04190 52297 51257 gene locus_tag LOCUS_04200 52297 51257 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_04200 53080 52400 gene locus_tag LOCUS_04210 53080 52400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 54322 53234 gene locus_tag LOCUS_04220 54322 53234 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_04220 54623 56173 gene locus_tag LOCUS_04230 54623 56173 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880867.1 protein_id gnl|my_center|LOCUS_04230 56151 56597 gene locus_tag LOCUS_04240 56151 56597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 56599 57132 gene locus_tag LOCUS_04250 56599 57132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 57147 58265 gene locus_tag LOCUS_04260 57147 58265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 58277 58834 gene locus_tag LOCUS_04270 58277 58834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 58821 60350 gene locus_tag LOCUS_04280 58821 60350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 60360 61223 gene locus_tag LOCUS_04290 60360 61223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 61299 62450 gene locus_tag LOCUS_04300 61299 62450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 62539 64707 gene locus_tag LOCUS_04310 62539 64707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 64704 65075 gene locus_tag LOCUS_04320 64704 65075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 66202 65090 gene locus_tag LOCUS_04330 66202 65090 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_04330 66339 67292 gene locus_tag LOCUS_04340 66339 67292 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392634.1 protein_id gnl|my_center|LOCUS_04340 67289 68614 gene locus_tag LOCUS_04350 67289 68614 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_04350 68617 69243 gene locus_tag LOCUS_04360 68617 69243 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_04360 69247 70902 gene locus_tag LOCUS_04370 69247 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 71001 71783 gene locus_tag LOCUS_04380 71001 71783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 73279 71888 gene locus_tag LOCUS_04390 gene prsR 73279 71888 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_04390 74425 73280 gene locus_tag LOCUS_04400 74425 73280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 74928 75134 gene locus_tag LOCUS_04410 74928 75134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 76561 75323 gene locus_tag LOCUS_04420 76561 75323 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_04420 78477 76561 gene locus_tag LOCUS_04430 gene asnB 78477 76561 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398625.1 protein_id gnl|my_center|LOCUS_04430 79072 78626 gene locus_tag LOCUS_04440 79072 78626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 81127 79286 gene locus_tag LOCUS_04450 gene glmS 81127 79286 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453795.1 protein_id gnl|my_center|LOCUS_04450 81957 81172 gene locus_tag LOCUS_04460 81957 81172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 83619 81967 gene locus_tag LOCUS_04470 83619 81967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 83804 85198 gene locus_tag LOCUS_04480 83804 85198 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_04480 85182 86063 gene locus_tag LOCUS_04490 85182 86063 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_04490 86060 87517 gene locus_tag LOCUS_04500 86060 87517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 87532 88338 gene locus_tag LOCUS_04510 87532 88338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 88339 90207 gene locus_tag LOCUS_04520 88339 90207 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_04520 90241 91374 gene locus_tag LOCUS_04530 90241 91374 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_04530 91377 92705 gene locus_tag LOCUS_04540 91377 92705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 92702 94303 gene locus_tag LOCUS_04550 92702 94303 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528485.1 protein_id gnl|my_center|LOCUS_04550 94350 94679 gene locus_tag LOCUS_04560 94350 94679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 94676 95101 gene locus_tag LOCUS_04570 94676 95101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 95120 96553 gene locus_tag LOCUS_04580 95120 96553 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_04580 96528 96905 gene locus_tag LOCUS_04590 96528 96905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 96902 98647 gene locus_tag LOCUS_04600 96902 98647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 100000 98648 gene locus_tag LOCUS_04610 100000 98648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 100192 101148 gene locus_tag LOCUS_04620 100192 101148 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335012.1 protein_id gnl|my_center|LOCUS_04620 102364 101201 gene locus_tag LOCUS_04630 102364 101201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 103769 102411 gene locus_tag LOCUS_04640 103769 102411 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210664.1 protein_id gnl|my_center|LOCUS_04640 103080 103003 gene locus_tag LOCUS_t00010 103080 103003 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 104671 103787 gene locus_tag LOCUS_04650 gene galU 104671 103787 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818749.1 protein_id gnl|my_center|LOCUS_04650 104818 106215 gene locus_tag LOCUS_04660 104818 106215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 106166 108856 gene locus_tag LOCUS_04670 gene prsT 106166 108856 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_04670 108940 111483 gene locus_tag LOCUS_04680 108940 111483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 112660 113055 gene locus_tag LOCUS_04690 112660 113055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 113108 114694 gene locus_tag LOCUS_04700 113108 114694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 117202 114725 gene locus_tag LOCUS_04710 117202 114725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 117497 118108 gene locus_tag LOCUS_04720 117497 118108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 118300 119094 gene locus_tag LOCUS_04730 118300 119094 CDS product leishmanolysin-related zinc metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088772.1 protein_id gnl|my_center|LOCUS_04730 119358 120098 gene locus_tag LOCUS_04740 119358 120098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 120254 121060 gene locus_tag LOCUS_04750 gene dam 120254 121060 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369388.1 protein_id gnl|my_center|LOCUS_04750 123531 121141 gene locus_tag LOCUS_04760 123531 121141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 124585 123515 gene locus_tag LOCUS_04770 124585 123515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence0003 203 493 gene locus_tag LOCUS_04780 203 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 575 1009 gene locus_tag LOCUS_04790 gene rplM 575 1009 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_04790 1022 1504 gene locus_tag LOCUS_04800 gene rpsI 1022 1504 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122781.1 protein_id gnl|my_center|LOCUS_04800 1576 2445 gene locus_tag LOCUS_04810 1576 2445 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454103.1 protein_id gnl|my_center|LOCUS_04810 2497 3504 gene locus_tag LOCUS_04820 gene argC 2497 3504 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_04820 3605 4231 gene locus_tag LOCUS_04830 3605 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4301 5140 gene locus_tag LOCUS_04840 4301 5140 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_04840 5185 6864 gene locus_tag LOCUS_04850 5185 6864 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679009.1 protein_id gnl|my_center|LOCUS_04850 6923 7303 gene locus_tag LOCUS_04860 6923 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7320 8342 gene locus_tag LOCUS_04870 7320 8342 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_04870 10742 8379 gene locus_tag LOCUS_04880 10742 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 12182 10872 gene locus_tag LOCUS_04890 12182 10872 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_04890 13516 12227 gene locus_tag LOCUS_04900 13516 12227 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_04900 14342 14163 gene locus_tag LOCUS_04910 14342 14163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_04910 14713 15033 gene locus_tag LOCUS_04920 14713 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 15154 15486 gene locus_tag LOCUS_04930 15154 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15663 15824 gene locus_tag LOCUS_04940 15663 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 16213 16626 gene locus_tag LOCUS_04950 16213 16626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 17488 16619 gene locus_tag LOCUS_04960 17488 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 17767 17540 gene locus_tag LOCUS_04970 17767 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 18166 17825 gene locus_tag LOCUS_04980 18166 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 18695 19006 gene locus_tag LOCUS_04990 18695 19006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 19215 20381 gene locus_tag LOCUS_05000 19215 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 20526 21596 gene locus_tag LOCUS_05010 20526 21596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 22352 21687 gene locus_tag LOCUS_05020 22352 21687 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_05020 22949 22449 gene locus_tag LOCUS_05030 22949 22449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 23441 23082 gene locus_tag LOCUS_05040 23441 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 24967 23516 gene locus_tag LOCUS_05050 24967 23516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 25343 25044 gene locus_tag LOCUS_05060 25343 25044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 27798 25555 gene locus_tag LOCUS_05070 27798 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 28124 29758 gene locus_tag LOCUS_05080 28124 29758 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_05080 29829 30869 gene locus_tag LOCUS_05090 29829 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 30891 31826 gene locus_tag LOCUS_05100 30891 31826 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_05100 33122 31827 gene locus_tag LOCUS_05110 33122 31827 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_05110 34225 33377 gene locus_tag LOCUS_05120 34225 33377 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_05120 34323 35048 gene locus_tag LOCUS_05130 34323 35048 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839199.1 protein_id gnl|my_center|LOCUS_05130 35744 35061 gene locus_tag LOCUS_05140 35744 35061 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_05140 35954 37186 gene locus_tag LOCUS_05150 35954 37186 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228554.1 protein_id gnl|my_center|LOCUS_05150 37195 38424 gene locus_tag LOCUS_05160 37195 38424 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_05160 38440 40200 gene locus_tag LOCUS_05170 38440 40200 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_05170 40237 40734 gene locus_tag LOCUS_05180 40237 40734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 40809 40901 gene locus_tag LOCUS_t00020 40809 40901 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 41280 45086 gene locus_tag LOCUS_05190 41280 45086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 45342 45127 gene locus_tag LOCUS_05200 45342 45127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 45537 46166 gene locus_tag LOCUS_05210 45537 46166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 48460 46634 gene locus_tag LOCUS_05220 48460 46634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 51070 48488 gene locus_tag LOCUS_05230 51070 48488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 51552 52943 gene locus_tag LOCUS_05240 51552 52943 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_05240 54182 52989 gene locus_tag LOCUS_05250 54182 52989 CDS product agarase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731459.1 protein_id gnl|my_center|LOCUS_05250 54418 55500 gene locus_tag LOCUS_05260 54418 55500 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_05260 55584 56828 gene locus_tag LOCUS_05270 55584 56828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 56980 60528 gene locus_tag LOCUS_05280 56980 60528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 61586 60567 gene locus_tag LOCUS_05290 gene galT 61586 60567 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258726.1 protein_id gnl|my_center|LOCUS_05290 62816 61680 gene locus_tag LOCUS_05300 62816 61680 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_05300 63103 64980 gene locus_tag LOCUS_05310 63103 64980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 66419 64992 gene locus_tag LOCUS_05320 66419 64992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 67466 66456 gene locus_tag LOCUS_05330 67466 66456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 70100 67494 gene locus_tag LOCUS_05340 70100 67494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 72736 70232 gene locus_tag LOCUS_05350 72736 70232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 74268 72820 gene locus_tag LOCUS_05360 74268 72820 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_05360 74502 75137 gene locus_tag LOCUS_05370 74502 75137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 75166 77721 gene locus_tag LOCUS_05380 75166 77721 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_05380 77891 78709 gene locus_tag LOCUS_05390 77891 78709 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339509.1 protein_id gnl|my_center|LOCUS_05390 78811 80160 gene locus_tag LOCUS_05400 78811 80160 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_05400 80300 80584 gene locus_tag LOCUS_05410 80300 80584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 82312 80633 gene locus_tag LOCUS_05420 82312 80633 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05420 83306 82344 gene locus_tag LOCUS_05430 83306 82344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_05430 84835 83306 gene locus_tag LOCUS_05440 gene rbsA 84835 83306 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244379.1 protein_id gnl|my_center|LOCUS_05440 85794 84832 gene locus_tag LOCUS_05450 85794 84832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968299.1 protein_id gnl|my_center|LOCUS_05450 86099 86986 gene locus_tag LOCUS_05460 gene iolB 86099 86986 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550585.1 protein_id gnl|my_center|LOCUS_05460 87032 88063 gene locus_tag LOCUS_05470 87032 88063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 88183 90063 gene locus_tag LOCUS_05480 gene iolD 88183 90063 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_05480 90120 91058 gene locus_tag LOCUS_05490 gene iolE 90120 91058 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192432.1 protein_id gnl|my_center|LOCUS_05490 91077 92033 gene locus_tag LOCUS_05500 91077 92033 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_05500 92368 92631 gene locus_tag LOCUS_05510 92368 92631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 92860 93543 gene locus_tag LOCUS_05520 92860 93543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 97369 94385 gene locus_tag LOCUS_05530 97369 94385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 97729 99078 gene locus_tag LOCUS_05540 97729 99078 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_05540 99094 100185 gene locus_tag LOCUS_05550 99094 100185 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_05550 100379 100852 gene locus_tag LOCUS_05560 100379 100852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 104327 101184 gene locus_tag LOCUS_05570 104327 101184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 105221 104448 gene locus_tag LOCUS_05580 105221 104448 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_05580 105501 106931 gene locus_tag LOCUS_05590 105501 106931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 107546 110278 gene locus_tag LOCUS_05600 107546 110278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0004 1178 1906 gene locus_tag LOCUS_05610 1178 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2537 1935 gene locus_tag LOCUS_05620 2537 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2619 6431 gene locus_tag LOCUS_05630 2619 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 7209 6463 gene locus_tag LOCUS_05640 7209 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7329 9224 gene locus_tag LOCUS_05650 gene recJ 7329 9224 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_05650 9266 11077 gene locus_tag LOCUS_05660 9266 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 12779 11166 gene locus_tag LOCUS_05670 12779 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13328 12786 gene locus_tag LOCUS_05680 13328 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13619 14389 gene locus_tag LOCUS_05690 13619 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 14398 14739 gene locus_tag LOCUS_05700 14398 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14757 15239 gene locus_tag LOCUS_05710 14757 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 15242 17407 gene locus_tag LOCUS_05720 15242 17407 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_05720 17486 17827 gene locus_tag LOCUS_05730 17486 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 17827 21195 gene locus_tag LOCUS_05740 17827 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 21192 23972 gene locus_tag LOCUS_05750 21192 23972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23975 26686 gene locus_tag LOCUS_05760 23975 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 26760 31796 gene locus_tag LOCUS_05770 26760 31796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 32505 31849 gene locus_tag LOCUS_05780 32505 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 33222 32515 gene locus_tag LOCUS_05790 gene lepB 33222 32515 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002535.1 protein_id gnl|my_center|LOCUS_05790 34483 33353 gene locus_tag LOCUS_05800 34483 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 34533 35312 gene locus_tag LOCUS_05810 34533 35312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 36742 35366 gene locus_tag LOCUS_05820 36742 35366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 36891 37670 gene locus_tag LOCUS_05830 36891 37670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 37797 38102 gene locus_tag LOCUS_05840 37797 38102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 38224 40227 gene locus_tag LOCUS_05850 38224 40227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 40429 40280 gene locus_tag LOCUS_05860 40429 40280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 40614 40967 gene locus_tag LOCUS_05870 40614 40967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 40977 41630 gene locus_tag LOCUS_05880 40977 41630 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029200.1 protein_id gnl|my_center|LOCUS_05880 41639 42217 gene locus_tag LOCUS_05890 41639 42217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 44021 42528 gene locus_tag LOCUS_05900 44021 42528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 44136 44594 gene locus_tag LOCUS_05910 44136 44594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 44608 45471 gene locus_tag LOCUS_05920 44608 45471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 45984 45520 gene locus_tag LOCUS_05930 45984 45520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 46103 46567 gene locus_tag LOCUS_05940 46103 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 46592 47368 gene locus_tag LOCUS_05950 46592 47368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 47458 49377 gene locus_tag LOCUS_05960 47458 49377 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378421.1 protein_id gnl|my_center|LOCUS_05960 49367 49987 gene locus_tag LOCUS_05970 49367 49987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 50257 50718 gene locus_tag LOCUS_05980 50257 50718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 50763 51344 gene locus_tag LOCUS_05990 50763 51344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 51768 52421 gene locus_tag LOCUS_06000 51768 52421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 52455 53612 gene locus_tag LOCUS_06010 52455 53612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 53666 54721 gene locus_tag LOCUS_06020 53666 54721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 54752 58687 gene locus_tag LOCUS_06030 54752 58687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 58743 59195 gene locus_tag LOCUS_06040 58743 59195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 59197 59964 gene locus_tag LOCUS_06050 59197 59964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 59970 60503 gene locus_tag LOCUS_06060 59970 60503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 60586 61653 gene locus_tag LOCUS_06070 60586 61653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 61653 62354 gene locus_tag LOCUS_06080 61653 62354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 62367 62840 gene locus_tag LOCUS_06090 62367 62840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 62931 64250 gene locus_tag LOCUS_06100 62931 64250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 64257 65408 gene locus_tag LOCUS_06110 64257 65408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 65419 65988 gene locus_tag LOCUS_06120 65419 65988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 65998 66402 gene locus_tag LOCUS_06130 65998 66402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 66481 66870 gene locus_tag LOCUS_06140 66481 66870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 66936 67301 gene locus_tag LOCUS_06150 66936 67301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 67554 67988 gene locus_tag LOCUS_06160 67554 67988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 67990 68667 gene locus_tag LOCUS_06170 67990 68667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 68732 73321 gene locus_tag LOCUS_06180 68732 73321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 73426 74736 gene locus_tag LOCUS_06190 73426 74736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 74739 75776 gene locus_tag LOCUS_06200 74739 75776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 75871 76818 gene locus_tag LOCUS_06210 75871 76818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 76830 82859 gene locus_tag LOCUS_06220 76830 82859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 82870 85182 gene locus_tag LOCUS_06230 82870 85182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 85428 85904 gene locus_tag LOCUS_06240 85428 85904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 85885 86565 gene locus_tag LOCUS_06250 85885 86565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 86691 87341 gene locus_tag LOCUS_06260 86691 87341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 87371 89737 gene locus_tag LOCUS_06270 87371 89737 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_06270 89867 90211 gene locus_tag LOCUS_06280 89867 90211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 90244 93126 gene locus_tag LOCUS_06290 90244 93126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 93227 96313 gene locus_tag LOCUS_06300 93227 96313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 96323 99037 gene locus_tag LOCUS_06310 96323 99037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 99047 99586 gene locus_tag LOCUS_06320 99047 99586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 99564 99929 gene locus_tag LOCUS_06330 99564 99929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 99942 100595 gene locus_tag LOCUS_06340 99942 100595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 100595 101350 gene locus_tag LOCUS_06350 100595 101350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 101353 101919 gene locus_tag LOCUS_06360 101353 101919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 101975 102820 gene locus_tag LOCUS_06370 101975 102820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 104528 103083 gene locus_tag LOCUS_06380 104528 103083 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317502.1 protein_id gnl|my_center|LOCUS_06380 104703 105527 gene locus_tag LOCUS_06390 104703 105527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 105542 107161 gene locus_tag LOCUS_06400 105542 107161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence0005 2159 2010 gene locus_tag LOCUS_06410 2159 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3314 2520 gene locus_tag LOCUS_06420 3314 2520 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_06420 4013 3405 gene locus_tag LOCUS_06430 4013 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4434 5393 gene locus_tag LOCUS_06440 4434 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 8821 5699 gene locus_tag LOCUS_06450 8821 5699 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_06450 9087 10430 gene locus_tag LOCUS_06460 9087 10430 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_06460 13066 10478 gene locus_tag LOCUS_06470 13066 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 17282 13314 gene locus_tag LOCUS_06480 17282 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 20195 18036 gene locus_tag LOCUS_06490 20195 18036 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_06490 21328 20474 gene locus_tag LOCUS_06500 gene ispH 21328 20474 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544912.1 protein_id gnl|my_center|LOCUS_06500 21614 22216 gene locus_tag LOCUS_06510 21614 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 22213 23202 gene locus_tag LOCUS_06520 gene galE 22213 23202 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_06520 23249 24550 gene locus_tag LOCUS_06530 23249 24550 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_06530 25318 24557 gene locus_tag LOCUS_06540 25318 24557 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697190.1 protein_id gnl|my_center|LOCUS_06540 25453 26649 gene locus_tag LOCUS_06550 25453 26649 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_06550 26689 27696 gene locus_tag LOCUS_06560 26689 27696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 30037 28055 gene locus_tag LOCUS_06570 30037 28055 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_06570 31917 30238 gene locus_tag LOCUS_06580 31917 30238 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_06580 35021 32199 gene locus_tag LOCUS_06590 35021 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 36444 35170 gene locus_tag LOCUS_06600 gene ackA 36444 35170 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_06600 37487 36447 gene locus_tag LOCUS_06610 gene pta 37487 36447 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_06610 37567 38415 gene locus_tag LOCUS_06620 37567 38415 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889392.1 protein_id gnl|my_center|LOCUS_06620 39408 38479 gene locus_tag LOCUS_06630 39408 38479 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_06630 40444 39542 gene locus_tag LOCUS_06640 40444 39542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 41293 41222 gene locus_tag LOCUS_t00030 41293 41222 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42268 41675 gene locus_tag LOCUS_06650 42268 41675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 42958 44331 gene locus_tag LOCUS_06660 42958 44331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 44957 44520 gene locus_tag LOCUS_06670 44957 44520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 45544 45134 gene locus_tag LOCUS_06680 45544 45134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 46754 47209 gene locus_tag LOCUS_06690 46754 47209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 47398 47673 gene locus_tag LOCUS_06700 47398 47673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 48157 47816 gene locus_tag LOCUS_06710 48157 47816 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_06710 48368 49186 gene locus_tag LOCUS_06720 48368 49186 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_06720 49239 50156 gene locus_tag LOCUS_06730 49239 50156 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_06730 50161 51246 gene locus_tag LOCUS_06740 50161 51246 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_06740 51243 52094 gene locus_tag LOCUS_06750 51243 52094 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_06750 52078 52842 gene locus_tag LOCUS_06760 gene fabG 52078 52842 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_06760 52875 53333 gene locus_tag LOCUS_06770 52875 53333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 53555 54934 gene locus_tag LOCUS_06780 53555 54934 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_06780 55116 56393 gene locus_tag LOCUS_06790 55116 56393 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777076.1 protein_id gnl|my_center|LOCUS_06790 56437 57888 gene locus_tag LOCUS_06800 gene gnd 56437 57888 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_06800 58281 57952 gene locus_tag LOCUS_06810 58281 57952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 58658 58873 gene locus_tag LOCUS_06820 58658 58873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 58929 60344 gene locus_tag LOCUS_06830 gene uxaC 58929 60344 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_06830 60416 60500 gene locus_tag LOCUS_t00040 60416 60500 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 63181 61040 gene locus_tag LOCUS_06840 63181 61040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 63689 63847 gene locus_tag LOCUS_06850 63689 63847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 64246 64923 gene locus_tag LOCUS_06860 64246 64923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 65483 66121 gene locus_tag LOCUS_06870 65483 66121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 66125 66379 gene locus_tag LOCUS_06880 66125 66379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 66372 68132 gene locus_tag LOCUS_06890 66372 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 69890 69579 gene locus_tag LOCUS_06900 69890 69579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 70333 69929 gene locus_tag LOCUS_06910 70333 69929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 70722 70378 gene locus_tag LOCUS_06920 70722 70378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 71296 71120 gene locus_tag LOCUS_06930 71296 71120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 72255 71302 gene locus_tag LOCUS_06940 gene moaA 72255 71302 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943768.1 protein_id gnl|my_center|LOCUS_06940 73026 72373 gene locus_tag LOCUS_06950 73026 72373 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461966.1 protein_id gnl|my_center|LOCUS_06950 74064 73276 gene locus_tag LOCUS_06960 74064 73276 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461607.1 protein_id gnl|my_center|LOCUS_06960 76602 74089 gene locus_tag LOCUS_06970 76602 74089 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_06970 77382 77576 gene locus_tag LOCUS_06980 77382 77576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 78006 77608 gene locus_tag LOCUS_06990 78006 77608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 79089 78097 gene locus_tag LOCUS_07000 79089 78097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 80067 79162 gene locus_tag LOCUS_07010 80067 79162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 81617 80253 gene locus_tag LOCUS_07020 81617 80253 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_07020 82570 81698 gene locus_tag LOCUS_07030 82570 81698 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_07030 83615 82563 gene locus_tag LOCUS_07040 83615 82563 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932918.1 protein_id gnl|my_center|LOCUS_07040 83702 83872 gene locus_tag LOCUS_07050 83702 83872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 83978 84439 gene locus_tag LOCUS_07060 83978 84439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 84954 84487 gene locus_tag LOCUS_07070 84954 84487 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_07070 86751 84961 gene locus_tag LOCUS_07080 86751 84961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 88487 86760 gene locus_tag LOCUS_07090 gene nuoF 88487 86760 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_07090 89945 88635 gene locus_tag LOCUS_07100 89945 88635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 90912 90025 gene locus_tag LOCUS_07110 90912 90025 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_07110 91472 90909 gene locus_tag LOCUS_07120 91472 90909 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_07120 95150 91542 gene locus_tag LOCUS_07130 95150 91542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 97094 95772 gene locus_tag LOCUS_07140 97094 95772 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_07140 97657 97445 gene locus_tag LOCUS_07150 97657 97445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence0006 601 1149 gene locus_tag LOCUS_07160 601 1149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_07160 1146 2459 gene locus_tag LOCUS_07170 1146 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2579 3550 gene locus_tag LOCUS_07180 2579 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3733 4278 gene locus_tag LOCUS_07190 3733 4278 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_07190 4275 5468 gene locus_tag LOCUS_07200 4275 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5799 6344 gene locus_tag LOCUS_07210 5799 6344 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_07210 6500 7534 gene locus_tag LOCUS_07220 6500 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 7769 8365 gene locus_tag LOCUS_07230 7769 8365 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224600.1 protein_id gnl|my_center|LOCUS_07230 8362 9588 gene locus_tag LOCUS_07240 8362 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11201 9666 gene locus_tag LOCUS_07250 11201 9666 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_07250 12742 11219 gene locus_tag LOCUS_07260 12742 11219 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_07260 14207 12810 gene locus_tag LOCUS_07270 14207 12810 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_07270 15688 14288 gene locus_tag LOCUS_07280 15688 14288 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_07280 17154 15712 gene locus_tag LOCUS_07290 gene tilS 17154 15712 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_07290 18116 17319 gene locus_tag LOCUS_07300 18116 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 18767 19957 gene locus_tag LOCUS_07310 18767 19957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 20208 20603 gene locus_tag LOCUS_07320 20208 20603 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_07320 20608 21510 gene locus_tag LOCUS_07330 20608 21510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_07330 21529 22176 gene locus_tag LOCUS_07340 21529 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 22187 24049 gene locus_tag LOCUS_07350 22187 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 24191 24691 gene locus_tag LOCUS_07360 24191 24691 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760363.1 protein_id gnl|my_center|LOCUS_07360 24940 26076 gene locus_tag LOCUS_07370 24940 26076 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_07370 26136 27017 gene locus_tag LOCUS_07380 26136 27017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 27104 27523 gene locus_tag LOCUS_07390 27104 27523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 28190 27726 gene locus_tag LOCUS_07400 28190 27726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 29235 28225 gene locus_tag LOCUS_07410 29235 28225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 30326 29742 gene locus_tag LOCUS_07420 30326 29742 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_07420 31390 30347 gene locus_tag LOCUS_07430 31390 30347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 32268 31708 gene locus_tag LOCUS_07440 gene amrA 32268 31708 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_07440 32993 32319 gene locus_tag LOCUS_07450 32993 32319 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_07450 33674 33018 gene locus_tag LOCUS_07460 33674 33018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 34097 34861 gene locus_tag LOCUS_07470 34097 34861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 34984 35883 gene locus_tag LOCUS_07480 gene ispE 34984 35883 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_07480 35877 36347 gene locus_tag LOCUS_07490 35877 36347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 36777 36496 gene locus_tag LOCUS_07500 36777 36496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 37582 40179 gene locus_tag LOCUS_07510 37582 40179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 42000 40294 gene locus_tag LOCUS_07520 42000 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 42553 44742 gene locus_tag LOCUS_07530 42553 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 44947 46059 gene locus_tag LOCUS_07540 gene murG 44947 46059 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_07540 46279 48081 gene locus_tag LOCUS_07550 46279 48081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 48135 49610 gene locus_tag LOCUS_07560 48135 49610 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_07560 49610 50422 gene locus_tag LOCUS_07570 49610 50422 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_07570 50756 50475 gene locus_tag LOCUS_07580 50756 50475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 50984 53968 gene locus_tag LOCUS_07590 50984 53968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 54086 55036 gene locus_tag LOCUS_07600 gene fba 54086 55036 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_07600 55189 57423 gene locus_tag LOCUS_07610 55189 57423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 57559 59022 gene locus_tag LOCUS_07620 gene lysS 57559 59022 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_07620 59079 60422 gene locus_tag LOCUS_07630 59079 60422 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_07630 60446 61798 gene locus_tag LOCUS_07640 60446 61798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 61873 62589 gene locus_tag LOCUS_07650 61873 62589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_07650 62621 63487 gene locus_tag LOCUS_07660 gene ilvE 62621 63487 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_07660 63531 64544 gene locus_tag LOCUS_07670 63531 64544 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_07670 65461 64625 gene locus_tag LOCUS_07680 65461 64625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 65732 67120 gene locus_tag LOCUS_07690 65732 67120 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_07690 67121 67726 gene locus_tag LOCUS_07700 67121 67726 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_07700 67728 68855 gene locus_tag LOCUS_07710 67728 68855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 69880 68915 gene locus_tag LOCUS_07720 69880 68915 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_07720 71186 69915 gene locus_tag LOCUS_07730 gene clpX 71186 69915 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_07730 72945 71302 gene locus_tag LOCUS_07740 72945 71302 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117733.1 protein_id gnl|my_center|LOCUS_07740 73554 72985 gene locus_tag LOCUS_07750 73554 72985 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_07750 74291 73557 gene locus_tag LOCUS_07760 74291 73557 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_07760 75395 74295 gene locus_tag LOCUS_07770 75395 74295 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_07770 75701 75423 gene locus_tag LOCUS_07780 75701 75423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 76018 77310 gene locus_tag LOCUS_07790 gene nagA 76018 77310 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210351.1 protein_id gnl|my_center|LOCUS_07790 77371 79023 gene locus_tag LOCUS_07800 gene galK 77371 79023 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292299.1 protein_id gnl|my_center|LOCUS_07800 80486 79122 gene locus_tag LOCUS_07810 gene gabT 80486 79122 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_07810 81806 80538 gene locus_tag LOCUS_07820 81806 80538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 81894 82079 gene locus_tag LOCUS_07830 81894 82079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 82081 83286 gene locus_tag LOCUS_07840 82081 83286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 83316 84869 gene locus_tag LOCUS_07850 83316 84869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 85579 84920 gene locus_tag LOCUS_07860 85579 84920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 86676 85564 gene locus_tag LOCUS_07870 86676 85564 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_07870 87536 86673 gene locus_tag LOCUS_07880 gene ilvE 87536 86673 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528161.1 protein_id gnl|my_center|LOCUS_07880 89055 87538 gene locus_tag LOCUS_07890 gene pabB 89055 87538 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438631.1 protein_id gnl|my_center|LOCUS_07890 89753 89052 gene locus_tag LOCUS_07900 gene deoC 89753 89052 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_07900 91190 90105 gene locus_tag LOCUS_07910 91190 90105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 92316 91228 gene locus_tag LOCUS_07920 gene prfA 92316 91228 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564946.1 protein_id gnl|my_center|LOCUS_07920 92751 92518 gene locus_tag LOCUS_07930 gene rpmE 92751 92518 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_07930 93584 92865 gene locus_tag LOCUS_07940 93584 92865 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_07940 93941 93654 gene locus_tag LOCUS_07950 93941 93654 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_07950 95381 94209 gene locus_tag LOCUS_07960 95381 94209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence0007 564 1727 gene locus_tag LOCUS_07970 564 1727 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_07970 3189 1771 gene locus_tag LOCUS_07980 3189 1771 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_07980 3698 4966 gene locus_tag LOCUS_07990 3698 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5204 5647 gene locus_tag LOCUS_08000 gene smpB 5204 5647 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_08000 5672 6064 gene locus_tag LOCUS_08010 5672 6064 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123553.1 protein_id gnl|my_center|LOCUS_08010 6070 6873 gene locus_tag LOCUS_08020 gene trpC 6070 6873 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_08020 8629 6926 gene locus_tag LOCUS_08030 8629 6926 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_08030 9456 8689 gene locus_tag LOCUS_08040 gene lgt 9456 8689 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_08040 9661 11295 gene locus_tag LOCUS_08050 gene gltX 9661 11295 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_08050 11413 12219 gene locus_tag LOCUS_08060 11413 12219 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_08060 12234 12800 gene locus_tag LOCUS_08070 gene thpR 12234 12800 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_08070 12860 13933 gene locus_tag LOCUS_08080 gene recA 12860 13933 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_08080 14006 16726 gene locus_tag LOCUS_08090 gene alaS 14006 16726 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_08090 16765 17802 gene locus_tag LOCUS_08100 16765 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 18795 18610 gene locus_tag LOCUS_08110 18795 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 19015 20025 gene locus_tag LOCUS_08120 19015 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 21366 20041 gene locus_tag LOCUS_08130 gene hisD 21366 20041 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_08130 22301 21378 gene locus_tag LOCUS_08140 22301 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 22848 22327 gene locus_tag LOCUS_08150 22848 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 24814 22841 gene locus_tag LOCUS_08160 24814 22841 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_08160 26300 25023 gene locus_tag LOCUS_08170 26300 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 28370 26931 gene locus_tag LOCUS_08180 28370 26931 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_08180 29982 28408 gene locus_tag LOCUS_08190 29982 28408 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_08190 31698 29986 gene locus_tag LOCUS_08200 31698 29986 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_08200 33034 31724 gene locus_tag LOCUS_08210 33034 31724 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_08210 34479 33055 gene locus_tag LOCUS_08220 34479 33055 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_08220 34631 37291 gene locus_tag LOCUS_08230 34631 37291 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022429.1 protein_id gnl|my_center|LOCUS_08230 38163 37723 gene locus_tag LOCUS_08240 38163 37723 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_08240 40279 38285 gene locus_tag LOCUS_08250 40279 38285 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_08250 40491 41270 gene locus_tag LOCUS_08260 gene zupT 40491 41270 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_08260 42292 41330 gene locus_tag LOCUS_08270 42292 41330 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462280.1 protein_id gnl|my_center|LOCUS_08270 44498 42891 gene locus_tag LOCUS_08280 44498 42891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 45598 44540 gene locus_tag LOCUS_08290 45598 44540 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_08290 47423 46224 gene locus_tag LOCUS_08300 47423 46224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 48714 49229 gene locus_tag LOCUS_08310 48714 49229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 49245 53957 gene locus_tag LOCUS_08320 49245 53957 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_08320 54838 54008 gene locus_tag LOCUS_08330 54838 54008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 55781 54828 gene locus_tag LOCUS_08340 55781 54828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_08340 56889 55954 gene locus_tag LOCUS_08350 56889 55954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 57386 56889 gene locus_tag LOCUS_08360 57386 56889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 58161 57652 gene locus_tag LOCUS_08370 58161 57652 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_08370 58313 59293 gene locus_tag LOCUS_08380 gene hflK 58313 59293 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_08380 59296 60249 gene locus_tag LOCUS_08390 gene hflC 59296 60249 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_08390 60643 61086 gene locus_tag LOCUS_08400 60643 61086 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_08400 62096 61209 gene locus_tag LOCUS_08410 62096 61209 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_08410 62490 63827 gene locus_tag LOCUS_08420 62490 63827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 64472 65737 gene locus_tag LOCUS_08430 64472 65737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 65902 66510 gene locus_tag LOCUS_08440 65902 66510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 66868 67443 gene locus_tag LOCUS_08450 66868 67443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 67494 68615 gene locus_tag LOCUS_08460 67494 68615 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257632.1 protein_id gnl|my_center|LOCUS_08460 70909 68738 gene locus_tag LOCUS_08470 70909 68738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 73573 71357 gene locus_tag LOCUS_08480 73573 71357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 74514 74011 gene locus_tag LOCUS_08490 gene purE 74514 74011 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057689.1 protein_id gnl|my_center|LOCUS_08490 74694 75569 gene locus_tag LOCUS_08500 74694 75569 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867663.1 protein_id gnl|my_center|LOCUS_08500 77619 75652 gene locus_tag LOCUS_08510 77619 75652 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_08510 78825 80213 gene locus_tag LOCUS_08520 78825 80213 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_08520 80290 81132 gene locus_tag LOCUS_08530 80290 81132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 82083 81235 gene locus_tag LOCUS_08540 82083 81235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 82527 82455 gene locus_tag LOCUS_t00050 82527 82455 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82839 83249 gene locus_tag LOCUS_08550 82839 83249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 83806 85623 gene locus_tag LOCUS_08560 83806 85623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 85818 86045 gene locus_tag LOCUS_08570 85818 86045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 86962 86075 gene locus_tag LOCUS_08580 86962 86075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 87166 87498 gene locus_tag LOCUS_08590 87166 87498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 87500 88081 gene locus_tag LOCUS_08600 87500 88081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence0008 265 621 gene locus_tag LOCUS_08610 265 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1687 911 gene locus_tag LOCUS_08620 1687 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2370 1945 gene locus_tag LOCUS_08630 2370 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3641 2355 gene locus_tag LOCUS_08640 3641 2355 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243289.1 protein_id gnl|my_center|LOCUS_08640 3907 4431 gene locus_tag LOCUS_08650 3907 4431 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294661.1 protein_id gnl|my_center|LOCUS_08650 4571 6133 gene locus_tag LOCUS_08660 4571 6133 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943428.1 protein_id gnl|my_center|LOCUS_08660 7309 6143 gene locus_tag LOCUS_08670 7309 6143 CDS product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 protein_id gnl|my_center|LOCUS_08670 8148 7393 gene locus_tag LOCUS_08680 gene modA 8148 7393 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932353.1 protein_id gnl|my_center|LOCUS_08680 8608 8138 gene locus_tag LOCUS_08690 8608 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 9441 8662 gene locus_tag LOCUS_08700 gene modA 9441 8662 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_08700 10615 9452 gene locus_tag LOCUS_08710 gene thiH 10615 9452 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_08710 11391 10618 gene locus_tag LOCUS_08720 11391 10618 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_08720 11605 11396 gene locus_tag LOCUS_08730 11605 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 12469 11636 gene locus_tag LOCUS_08740 gene larE 12469 11636 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_08740 13639 12482 gene locus_tag LOCUS_08750 gene nifS 13639 12482 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_08750 14521 13643 gene locus_tag LOCUS_08760 gene nifU 14521 13643 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_08760 15816 14527 gene locus_tag LOCUS_08770 15816 14527 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_08770 17622 15820 gene locus_tag LOCUS_08780 17622 15820 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_08780 18542 17625 gene locus_tag LOCUS_08790 gene nadA 18542 17625 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_08790 19497 18562 gene locus_tag LOCUS_08800 19497 18562 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_08800 19941 19507 gene locus_tag LOCUS_08810 19941 19507 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_08810 20143 20589 gene locus_tag LOCUS_08820 20143 20589 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868963.1 protein_id gnl|my_center|LOCUS_08820 20683 20904 gene locus_tag LOCUS_08830 20683 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 20945 21658 gene locus_tag LOCUS_08840 20945 21658 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_08840 21677 22927 gene locus_tag LOCUS_08850 21677 22927 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_08850 22924 23139 gene locus_tag LOCUS_08860 gene thiS 22924 23139 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_08860 23126 23941 gene locus_tag LOCUS_08870 gene moeB 23126 23941 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_08870 23935 24345 gene locus_tag LOCUS_08880 23935 24345 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_08880 24347 26572 gene locus_tag LOCUS_08890 24347 26572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 26658 27623 gene locus_tag LOCUS_08900 gene cysM 26658 27623 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930733.1 protein_id gnl|my_center|LOCUS_08900 27993 28913 gene locus_tag LOCUS_08910 gene cysK 27993 28913 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_08910 28926 30053 gene locus_tag LOCUS_08920 gene mnmA 28926 30053 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_08920 30138 30419 gene locus_tag LOCUS_08930 30138 30419 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393176.1 protein_id gnl|my_center|LOCUS_08930 30482 31789 gene locus_tag LOCUS_08940 30482 31789 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444633.1 protein_id gnl|my_center|LOCUS_08940 31851 33794 gene locus_tag LOCUS_08950 31851 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 33832 34191 gene locus_tag LOCUS_08960 33832 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 34321 38097 gene locus_tag LOCUS_08970 34321 38097 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_08970 38347 40632 gene locus_tag LOCUS_08980 38347 40632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 41574 40687 gene locus_tag LOCUS_08990 41574 40687 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026257.1 protein_id gnl|my_center|LOCUS_08990 41805 42659 gene locus_tag LOCUS_09000 gene fba 41805 42659 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_09000 42759 44747 gene locus_tag LOCUS_09010 gene yagF 42759 44747 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_09010 44792 45694 gene locus_tag LOCUS_09020 44792 45694 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_09020 45752 47131 gene locus_tag LOCUS_09030 gene xylB 45752 47131 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 protein_id gnl|my_center|LOCUS_09030 48545 47256 gene locus_tag LOCUS_09040 48545 47256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 50119 49088 gene locus_tag LOCUS_09050 50119 49088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 52830 50332 gene locus_tag LOCUS_09060 52830 50332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 53095 53259 gene locus_tag LOCUS_09070 53095 53259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 53391 53990 gene locus_tag LOCUS_09080 53391 53990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 54409 55386 gene locus_tag LOCUS_09090 54409 55386 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922011.1 protein_id gnl|my_center|LOCUS_09090 58253 55422 gene locus_tag LOCUS_09100 58253 55422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 59471 60994 gene locus_tag LOCUS_09110 59471 60994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 60991 62451 gene locus_tag LOCUS_09120 60991 62451 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_09120 62448 65900 gene locus_tag LOCUS_09130 62448 65900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 66601 65942 gene locus_tag LOCUS_09140 66601 65942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 68421 66799 gene locus_tag LOCUS_09150 68421 66799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 69466 71406 gene locus_tag LOCUS_09160 69466 71406 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_09160 74027 71412 gene locus_tag LOCUS_09170 74027 71412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 77030 74064 gene locus_tag LOCUS_09180 77030 74064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 77715 77077 gene locus_tag LOCUS_09190 77715 77077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09190 78021 77764 gene locus_tag LOCUS_09200 78021 77764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09200 78689 78018 gene locus_tag LOCUS_09210 78689 78018 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_09210 79126 78692 gene locus_tag LOCUS_09220 79126 78692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 79905 79564 gene locus_tag LOCUS_09230 79905 79564 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_09230 81170 79935 gene locus_tag LOCUS_09240 81170 79935 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_09240 81746 83323 gene locus_tag LOCUS_09250 81746 83323 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_09250 83327 85909 gene locus_tag LOCUS_09260 83327 85909 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_09260 86165 86371 gene locus_tag LOCUS_09270 86165 86371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 86722 88203 gene locus_tag LOCUS_09280 86722 88203 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0009 1199 2128 gene locus_tag LOCUS_09290 1199 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2551 4056 gene locus_tag LOCUS_09300 2551 4056 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_09300 4101 5180 gene locus_tag LOCUS_09310 4101 5180 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_09310 5235 6218 gene locus_tag LOCUS_09320 5235 6218 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_09320 7395 6589 gene locus_tag LOCUS_09330 7395 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7708 7466 gene locus_tag LOCUS_09340 7708 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023563.1 protein_id gnl|my_center|LOCUS_09340 9092 7842 gene locus_tag LOCUS_09350 9092 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 9634 9089 gene locus_tag LOCUS_09360 9634 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11155 9806 gene locus_tag LOCUS_09370 11155 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 11727 11152 gene locus_tag LOCUS_09380 11727 11152 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_09380 13528 12317 gene locus_tag LOCUS_09390 13528 12317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965428.1 protein_id gnl|my_center|LOCUS_09390 14431 13532 gene locus_tag LOCUS_09400 14431 13532 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_09400 15301 14504 gene locus_tag LOCUS_09410 15301 14504 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_09410 15401 15673 gene locus_tag LOCUS_09420 15401 15673 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_09420 17066 15693 gene locus_tag LOCUS_09430 17066 15693 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_09430 17937 17251 gene locus_tag LOCUS_09440 17937 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 19973 18114 gene locus_tag LOCUS_09450 19973 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 21379 20045 gene locus_tag LOCUS_09460 21379 20045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_09460 21883 21521 gene locus_tag LOCUS_09470 21883 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 23435 22149 gene locus_tag LOCUS_09480 gene eno 23435 22149 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889730.1 protein_id gnl|my_center|LOCUS_09480 23643 24167 gene locus_tag LOCUS_09490 23643 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 24164 25375 gene locus_tag LOCUS_09500 24164 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 25839 26489 gene locus_tag LOCUS_09510 25839 26489 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974924.1 protein_id gnl|my_center|LOCUS_09510 26503 27438 gene locus_tag LOCUS_09520 gene pssA 26503 27438 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616286.1 protein_id gnl|my_center|LOCUS_09520 28414 27515 gene locus_tag LOCUS_09530 28414 27515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 28684 29511 gene locus_tag LOCUS_09540 28684 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 29542 34278 gene locus_tag LOCUS_09550 29542 34278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 34287 34985 gene locus_tag LOCUS_09560 34287 34985 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_09560 35153 36121 gene locus_tag LOCUS_09570 35153 36121 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041466227.1 protein_id gnl|my_center|LOCUS_09570 36147 37595 gene locus_tag LOCUS_09580 gene purB 36147 37595 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_09580 37603 38334 gene locus_tag LOCUS_09590 gene fabG 37603 38334 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_09590 38414 38944 gene locus_tag LOCUS_09600 gene pyrE 38414 38944 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_09600 38957 39982 gene locus_tag LOCUS_09610 38957 39982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 40097 41194 gene locus_tag LOCUS_09620 gene ald 40097 41194 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 protein_id gnl|my_center|LOCUS_09620 41845 41222 gene locus_tag LOCUS_09630 41845 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09630 42466 41894 gene locus_tag LOCUS_09640 42466 41894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09640 42747 42514 gene locus_tag LOCUS_09650 42747 42514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 43475 42891 gene locus_tag LOCUS_09660 gene gmk 43475 42891 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_09660 44407 43523 gene locus_tag LOCUS_09670 44407 43523 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_09670 44860 44474 gene locus_tag LOCUS_09680 44860 44474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 45718 44957 gene locus_tag LOCUS_09690 gene tpiA 45718 44957 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_09690 46852 45782 gene locus_tag LOCUS_09700 gene pheA 46852 45782 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_09700 47006 47530 gene locus_tag LOCUS_09710 47006 47530 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243584.1 protein_id gnl|my_center|LOCUS_09710 48317 47607 gene locus_tag LOCUS_09720 48317 47607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 48638 49087 gene locus_tag LOCUS_09730 48638 49087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 49084 49530 gene locus_tag LOCUS_09740 49084 49530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 49517 49738 gene locus_tag LOCUS_09750 49517 49738 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_09750 49853 50935 gene locus_tag LOCUS_09760 49853 50935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 51100 52419 gene locus_tag LOCUS_09770 gene der 51100 52419 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_09770 52460 54208 gene locus_tag LOCUS_09780 52460 54208 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_09780 55190 54156 gene locus_tag LOCUS_09790 55190 54156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 56058 55264 gene locus_tag LOCUS_09800 gene cdaA 56058 55264 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_09800 56344 56108 gene locus_tag LOCUS_09810 56344 56108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 56560 57144 gene locus_tag LOCUS_09820 gene sigW 56560 57144 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_09820 57147 57854 gene locus_tag LOCUS_09830 57147 57854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 57908 59641 gene locus_tag LOCUS_09840 57908 59641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 60585 59752 gene locus_tag LOCUS_09850 60585 59752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 62556 60811 gene locus_tag LOCUS_09860 62556 60811 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_09860 63088 64335 gene locus_tag LOCUS_09870 63088 64335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 66269 64365 gene locus_tag LOCUS_09880 gene rhgW 66269 64365 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_09880 67340 66333 gene locus_tag LOCUS_09890 67340 66333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 69990 67405 gene locus_tag LOCUS_09900 69990 67405 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_09900 70087 71364 gene locus_tag LOCUS_09910 70087 71364 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_09910 71372 72382 gene locus_tag LOCUS_09920 71372 72382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_09920 72632 72411 gene locus_tag LOCUS_09930 72632 72411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 72863 72645 gene locus_tag LOCUS_09940 72863 72645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 74373 72865 gene locus_tag LOCUS_09950 74373 72865 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_09950 74698 75963 gene locus_tag LOCUS_09960 74698 75963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 76123 76194 gene locus_tag LOCUS_t00060 76123 76194 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77600 76134 gene locus_tag LOCUS_09970 77600 76134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 77788 77597 gene locus_tag LOCUS_09980 77788 77597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 78087 77827 gene locus_tag LOCUS_09990 78087 77827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 79676 78249 gene locus_tag LOCUS_10000 79676 78249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 79954 79739 gene locus_tag LOCUS_10010 79954 79739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 80153 79944 gene locus_tag LOCUS_10020 80153 79944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 81081 80215 gene locus_tag LOCUS_10030 81081 80215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 82472 83245 gene locus_tag LOCUS_10040 82472 83245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 83915 83532 gene locus_tag LOCUS_10050 83915 83532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 84089 84829 gene locus_tag LOCUS_10060 84089 84829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 84987 85133 gene locus_tag LOCUS_10070 84987 85133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 86399 87025 gene locus_tag LOCUS_10080 86399 87025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence0010 <1 7270 gene locus_tag LOCUS_10090 <1 7270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267188.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase 7336 8193 gene locus_tag LOCUS_10100 7336 8193 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_10100 8271 8519 gene locus_tag LOCUS_10110 8271 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226596.1 protein_id gnl|my_center|LOCUS_10110 8561 9736 gene locus_tag LOCUS_10120 8561 9736 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_10120 9733 10785 gene locus_tag LOCUS_10130 9733 10785 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_10130 11218 11487 gene locus_tag LOCUS_10140 11218 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 11969 18601 gene locus_tag LOCUS_10150 11969 18601 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031213.1 protein_id gnl|my_center|LOCUS_10150 18598 34953 gene locus_tag LOCUS_10160 18598 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 34950 38894 gene locus_tag LOCUS_10170 34950 38894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 38899 51330 gene locus_tag LOCUS_10180 38899 51330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 51524 52819 gene locus_tag LOCUS_10190 51524 52819 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_10190 52993 53712 gene locus_tag LOCUS_10200 52993 53712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 53904 70451 gene locus_tag LOCUS_10210 53904 70451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 71045 85303 gene locus_tag LOCUS_10220 71045 85303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 86029 86841 gene locus_tag LOCUS_10230 86029 86841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 86929 87150 gene locus_tag LOCUS_10240 86929 87150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 87412 87188 gene locus_tag LOCUS_10250 87412 87188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0011 542 18 gene locus_tag LOCUS_10260 542 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 821 1960 gene locus_tag LOCUS_10270 gene lpxB 821 1960 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_10270 3309 5138 gene locus_tag LOCUS_10280 3309 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5319 5501 gene locus_tag LOCUS_10290 5319 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5539 5745 gene locus_tag LOCUS_10300 5539 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5973 6257 gene locus_tag LOCUS_10310 5973 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6630 8564 gene locus_tag LOCUS_10320 6630 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9046 8870 gene locus_tag LOCUS_10330 9046 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9392 10531 gene locus_tag LOCUS_10340 9392 10531 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_10340 10915 10718 gene locus_tag LOCUS_10350 10915 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11211 12137 gene locus_tag LOCUS_10360 11211 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 12355 13692 gene locus_tag LOCUS_10370 12355 13692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 14080 15966 gene locus_tag LOCUS_10380 gene pepF 14080 15966 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_10380 16717 16004 gene locus_tag LOCUS_10390 gene lepB 16717 16004 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_10390 16921 17601 gene locus_tag LOCUS_10400 16921 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 17672 18757 gene locus_tag LOCUS_10410 17672 18757 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_10410 18854 19825 gene locus_tag LOCUS_10420 18854 19825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 19946 21265 gene locus_tag LOCUS_10430 19946 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 21302 21916 gene locus_tag LOCUS_10440 21302 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 23327 21969 gene locus_tag LOCUS_10450 23327 21969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 23686 25281 gene locus_tag LOCUS_10460 23686 25281 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_10460 25364 27310 gene locus_tag LOCUS_10470 25364 27310 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_10470 28558 27356 gene locus_tag LOCUS_10480 28558 27356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 30050 28644 gene locus_tag LOCUS_10490 30050 28644 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_10490 30634 30080 gene locus_tag LOCUS_10500 30634 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 32386 30638 gene locus_tag LOCUS_10510 32386 30638 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_10510 32993 32463 gene locus_tag LOCUS_10520 32993 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 35517 33286 gene locus_tag LOCUS_10530 35517 33286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 36322 37359 gene locus_tag LOCUS_10540 36322 37359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 37740 40586 gene locus_tag LOCUS_10550 37740 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 40627 42000 gene locus_tag LOCUS_10560 40627 42000 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_10560 42257 42478 gene locus_tag LOCUS_10570 42257 42478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 42755 43582 gene locus_tag LOCUS_10580 42755 43582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 46358 43704 gene locus_tag LOCUS_10590 46358 43704 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_10590 46420 46602 gene locus_tag LOCUS_10600 46420 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 46796 47590 gene locus_tag LOCUS_10610 46796 47590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 47943 49154 gene locus_tag LOCUS_10620 47943 49154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 50623 49169 gene locus_tag LOCUS_10630 50623 49169 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 protein_id gnl|my_center|LOCUS_10630 50840 52531 gene locus_tag LOCUS_10640 50840 52531 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_10640 52725 54227 gene locus_tag LOCUS_10650 52725 54227 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_10650 55345 54266 gene locus_tag LOCUS_10660 55345 54266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 56761 55361 gene locus_tag LOCUS_10670 56761 55361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 57014 58273 gene locus_tag LOCUS_10680 57014 58273 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_10680 58532 58338 gene locus_tag LOCUS_10690 58532 58338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 58798 60198 gene locus_tag LOCUS_10700 gene fumC 58798 60198 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_10700 60275 62206 gene locus_tag LOCUS_10710 60275 62206 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943084.1 protein_id gnl|my_center|LOCUS_10710 62218 63975 gene locus_tag LOCUS_10720 gene sdhA 62218 63975 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_10720 64073 64795 gene locus_tag LOCUS_10730 64073 64795 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056123.1 protein_id gnl|my_center|LOCUS_10730 64917 65936 gene locus_tag LOCUS_10740 gene sucC 64917 65936 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765647.1 protein_id gnl|my_center|LOCUS_10740 65936 66790 gene locus_tag LOCUS_10750 gene sucD 65936 66790 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_10750 67052 69838 gene locus_tag LOCUS_10760 67052 69838 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_10760 69835 70986 gene locus_tag LOCUS_10770 gene odhB 69835 70986 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227835.1 protein_id gnl|my_center|LOCUS_10770 71102 72244 gene locus_tag LOCUS_10780 71102 72244 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892129.1 protein_id gnl|my_center|LOCUS_10780 72290 73384 gene locus_tag LOCUS_10790 72290 73384 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 protein_id gnl|my_center|LOCUS_10790 74414 73494 gene locus_tag LOCUS_10800 74414 73494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 75638 74442 gene locus_tag LOCUS_10810 75638 74442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 78751 75638 gene locus_tag LOCUS_10820 78751 75638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 80397 78787 gene locus_tag LOCUS_10830 80397 78787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0012 448 1413 gene locus_tag LOCUS_10840 448 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1463 2188 gene locus_tag LOCUS_10850 1463 2188 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_10850 2208 3080 gene locus_tag LOCUS_10860 gene dapA 2208 3080 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_10860 4182 3088 gene locus_tag LOCUS_10870 4182 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5674 4313 gene locus_tag LOCUS_10880 gene dnaA 5674 4313 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_10880 6120 7043 gene locus_tag LOCUS_10890 gene ftsY 6120 7043 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_10890 7339 8178 gene locus_tag LOCUS_10900 7339 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8292 8966 gene locus_tag LOCUS_10910 8292 8966 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_10910 8963 10429 gene locus_tag LOCUS_10920 8963 10429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_10920 10528 11493 gene locus_tag LOCUS_10930 10528 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12779 11568 gene locus_tag LOCUS_10940 12779 11568 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_10940 13003 13683 gene locus_tag LOCUS_10950 13003 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 14964 13705 gene locus_tag LOCUS_10960 14964 13705 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_10960 18735 14965 gene locus_tag LOCUS_10970 gene addA 18735 14965 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288050.1 protein_id gnl|my_center|LOCUS_10970 22165 18728 gene locus_tag LOCUS_10980 gene addB 22165 18728 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_10980 23152 22271 gene locus_tag LOCUS_10990 23152 22271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 23691 23149 gene locus_tag LOCUS_11000 23691 23149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316410.1 protein_id gnl|my_center|LOCUS_11000 24473 24039 gene locus_tag LOCUS_11010 gene arfB 24473 24039 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_11010 25624 24632 gene locus_tag LOCUS_11020 gene pheS 25624 24632 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_11020 26034 25678 gene locus_tag LOCUS_11030 gene rplT 26034 25678 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830839.1 protein_id gnl|my_center|LOCUS_11030 26358 26164 gene locus_tag LOCUS_11040 gene rpmI 26358 26164 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_11040 28053 27409 gene locus_tag LOCUS_11050 28053 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11050 29284 28043 gene locus_tag LOCUS_11060 29284 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 29716 29309 gene locus_tag LOCUS_11070 29716 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 30218 29775 gene locus_tag LOCUS_11080 30218 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 30824 30513 gene locus_tag LOCUS_11090 30824 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 31289 30852 gene locus_tag LOCUS_11100 31289 30852 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965703.1 protein_id gnl|my_center|LOCUS_11100 31712 31299 gene locus_tag LOCUS_11110 31712 31299 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965703.1 protein_id gnl|my_center|LOCUS_11110 32920 31700 gene locus_tag LOCUS_11120 32920 31700 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544542.1 protein_id gnl|my_center|LOCUS_11120 33427 33011 gene locus_tag LOCUS_11130 33427 33011 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965703.1 protein_id gnl|my_center|LOCUS_11130 33853 33437 gene locus_tag LOCUS_11140 33853 33437 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965703.1 protein_id gnl|my_center|LOCUS_11140 34279 33863 gene locus_tag LOCUS_11150 34279 33863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 34610 36289 gene locus_tag LOCUS_11160 34610 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 36369 38741 gene locus_tag LOCUS_11170 36369 38741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 38754 39002 gene locus_tag LOCUS_11180 38754 39002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 39295 41055 gene locus_tag LOCUS_11190 39295 41055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 41285 41569 gene locus_tag LOCUS_11200 41285 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 42422 41979 gene locus_tag LOCUS_11210 42422 41979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 42700 42858 gene locus_tag LOCUS_11220 42700 42858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 42858 43007 gene locus_tag LOCUS_11230 42858 43007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 43156 44436 gene locus_tag LOCUS_11240 43156 44436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 45259 44822 gene locus_tag LOCUS_11250 gene infC 45259 44822 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_11250 47342 45426 gene locus_tag LOCUS_11260 gene thrS 47342 45426 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_11260 47531 47995 gene locus_tag LOCUS_11270 47531 47995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 48186 49796 gene locus_tag LOCUS_11280 48186 49796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 49802 50434 gene locus_tag LOCUS_11290 49802 50434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 52672 50771 gene locus_tag LOCUS_11300 52672 50771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 53721 52690 gene locus_tag LOCUS_11310 53721 52690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_11310 55007 53727 gene locus_tag LOCUS_11320 55007 53727 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970646.1 protein_id gnl|my_center|LOCUS_11320 56995 55196 gene locus_tag LOCUS_11330 56995 55196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 60778 57515 gene locus_tag LOCUS_11340 60778 57515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 61249 62046 gene locus_tag LOCUS_11350 61249 62046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 62063 63433 gene locus_tag LOCUS_11360 62063 63433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 65983 63464 gene locus_tag LOCUS_11370 65983 63464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 66825 66253 gene locus_tag LOCUS_11380 66825 66253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 68704 67028 gene locus_tag LOCUS_11390 68704 67028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 69656 68907 gene locus_tag LOCUS_11400 69656 68907 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_11400 71093 69894 gene locus_tag LOCUS_11410 71093 69894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 72299 71139 gene locus_tag LOCUS_11420 72299 71139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 72885 72418 gene locus_tag LOCUS_11430 72885 72418 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_11430 73259 73447 gene locus_tag LOCUS_11440 73259 73447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 73645 73938 gene locus_tag LOCUS_11450 73645 73938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 73958 75331 gene locus_tag LOCUS_11460 gene rsxC 73958 75331 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_11460 75449 76411 gene locus_tag LOCUS_11470 75449 76411 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082949.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence0013 712 122 gene locus_tag LOCUS_11480 712 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1589 753 gene locus_tag LOCUS_11490 1589 753 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_11490 2061 1651 gene locus_tag LOCUS_11500 2061 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2260 2063 gene locus_tag LOCUS_11510 2260 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3657 2503 gene locus_tag LOCUS_11520 3657 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4342 3668 gene locus_tag LOCUS_11530 4342 3668 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206820.1 protein_id gnl|my_center|LOCUS_11530 4588 5445 gene locus_tag LOCUS_11540 4588 5445 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206822.1 protein_id gnl|my_center|LOCUS_11540 5473 7083 gene locus_tag LOCUS_11550 5473 7083 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206821.1 protein_id gnl|my_center|LOCUS_11550 7685 7122 gene locus_tag LOCUS_11560 7685 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7884 8186 gene locus_tag LOCUS_11570 7884 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 9063 8188 gene locus_tag LOCUS_11580 9063 8188 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810854.1 protein_id gnl|my_center|LOCUS_11580 9383 9063 gene locus_tag LOCUS_11590 9383 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 9546 12962 gene locus_tag LOCUS_11600 9546 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 13382 12954 gene locus_tag LOCUS_11610 13382 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 13889 13395 gene locus_tag LOCUS_11620 13889 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 14715 13897 gene locus_tag LOCUS_11630 14715 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 15744 14773 gene locus_tag LOCUS_11640 15744 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 16867 17346 gene locus_tag LOCUS_11650 16867 17346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 17418 18002 gene locus_tag LOCUS_11660 17418 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 18004 18678 gene locus_tag LOCUS_11670 18004 18678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 18922 19284 gene locus_tag LOCUS_11680 18922 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 19474 19398 gene locus_tag LOCUS_t00070 19474 19398 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19556 19480 gene locus_tag LOCUS_t00080 19556 19480 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19645 19570 gene locus_tag LOCUS_t00090 19645 19570 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19815 20108 gene locus_tag LOCUS_11690 19815 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 20216 20902 gene locus_tag LOCUS_11700 20216 20902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 21363 20935 gene locus_tag LOCUS_11710 21363 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 21968 21360 gene locus_tag LOCUS_11720 21968 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 22297 21980 gene locus_tag LOCUS_11730 22297 21980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 22767 22540 gene locus_tag LOCUS_11740 22767 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 22733 25882 gene locus_tag LOCUS_11750 22733 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 25971 29123 gene locus_tag LOCUS_11760 25971 29123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 29436 29170 gene locus_tag LOCUS_11770 gene yebG 29436 29170 CDS product DNA damage-inducible protein YebG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257728.1 protein_id gnl|my_center|LOCUS_11770 29589 30290 gene locus_tag LOCUS_11780 29589 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 30836 30261 gene locus_tag LOCUS_11790 30836 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 30937 31272 gene locus_tag LOCUS_11800 30937 31272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 31269 33143 gene locus_tag LOCUS_11810 31269 33143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 33170 33367 gene locus_tag LOCUS_11820 33170 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 33481 33708 gene locus_tag LOCUS_11830 33481 33708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 34123 34207 gene locus_tag LOCUS_t00100 34123 34207 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 34215 34303 gene locus_tag LOCUS_t00110 34215 34303 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 34309 34384 gene locus_tag LOCUS_t00120 34309 34384 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 34597 34674 gene locus_tag LOCUS_t00130 34597 34674 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 34681 34757 gene locus_tag LOCUS_t00140 34681 34757 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 34788 34952 gene locus_tag LOCUS_11840 34788 34952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 35077 35161 gene locus_tag LOCUS_t00150 35077 35161 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 35168 35243 gene locus_tag LOCUS_t00160 35168 35243 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35805 35518 gene locus_tag LOCUS_11850 35805 35518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 37130 36105 gene locus_tag LOCUS_11860 37130 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 38261 37707 gene locus_tag LOCUS_11870 38261 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 38575 38267 gene locus_tag LOCUS_11880 38575 38267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 39050 38682 gene locus_tag LOCUS_11890 39050 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 39811 39176 gene locus_tag LOCUS_11900 39811 39176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 40148 40402 gene locus_tag LOCUS_11910 40148 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 41405 40785 gene locus_tag LOCUS_11920 41405 40785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 41556 42287 gene locus_tag LOCUS_11930 41556 42287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 42913 43866 gene locus_tag LOCUS_11940 42913 43866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 44392 43934 gene locus_tag LOCUS_11950 44392 43934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 44703 45554 gene locus_tag LOCUS_11960 44703 45554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 46830 46366 gene locus_tag LOCUS_11970 46830 46366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 47212 46895 gene locus_tag LOCUS_11980 47212 46895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 47785 47450 gene locus_tag LOCUS_11990 47785 47450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 47891 48232 gene locus_tag LOCUS_12000 47891 48232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 50024 48432 gene locus_tag LOCUS_12010 50024 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 51309 50275 gene locus_tag LOCUS_12020 51309 50275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 52054 51605 gene locus_tag LOCUS_12030 52054 51605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 52139 52993 gene locus_tag LOCUS_12040 52139 52993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 53463 53065 gene locus_tag LOCUS_12050 53463 53065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 54124 53642 gene locus_tag LOCUS_12060 54124 53642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 54843 54160 gene locus_tag LOCUS_12070 54843 54160 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477263.1 protein_id gnl|my_center|LOCUS_12070 55010 54846 gene locus_tag LOCUS_12080 55010 54846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 56004 55156 gene locus_tag LOCUS_12090 56004 55156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 57247 55985 gene locus_tag LOCUS_12100 57247 55985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 57885 57247 gene locus_tag LOCUS_12110 57885 57247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 61616 57882 gene locus_tag LOCUS_12120 61616 57882 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_12120 61794 62153 gene locus_tag LOCUS_12130 61794 62153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 62312 62836 gene locus_tag LOCUS_12140 62312 62836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 64382 62979 gene locus_tag LOCUS_12150 64382 62979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 64517 64765 gene locus_tag LOCUS_12160 64517 64765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 64801 65322 gene locus_tag LOCUS_12170 64801 65322 CDS product CbrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071180.1 protein_id gnl|my_center|LOCUS_12170 65602 67218 gene locus_tag LOCUS_12180 65602 67218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 67261 69363 gene locus_tag LOCUS_12190 67261 69363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 69499 70104 gene locus_tag LOCUS_12200 69499 70104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 70697 71251 gene locus_tag LOCUS_12210 70697 71251 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_12210 71260 72921 gene locus_tag LOCUS_12220 71260 72921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 73012 73878 gene locus_tag LOCUS_12230 73012 73878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 73974 74561 gene locus_tag LOCUS_12240 73974 74561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 76041 74575 gene locus_tag LOCUS_12250 76041 74575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0014 1260 157 gene locus_tag LOCUS_12260 1260 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1820 1278 gene locus_tag LOCUS_12270 1820 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3998 1953 gene locus_tag LOCUS_12280 3998 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4921 4367 gene locus_tag LOCUS_12290 4921 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 6190 5567 gene locus_tag LOCUS_12300 6190 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7514 7678 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttgttggatgaatatggttgttttg 9091 11220 gene locus_tag LOCUS_12310 9091 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11816 12496 gene locus_tag LOCUS_12320 11816 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 13233 12616 gene locus_tag LOCUS_12330 13233 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 14003 13329 gene locus_tag LOCUS_12340 14003 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 14869 14165 gene locus_tag LOCUS_12350 14869 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 15664 15011 gene locus_tag LOCUS_12360 15664 15011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 15924 16529 gene locus_tag LOCUS_12370 15924 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16513 17127 gene locus_tag LOCUS_12380 16513 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 17120 17338 gene locus_tag LOCUS_12390 17120 17338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 17342 17776 gene locus_tag LOCUS_12400 17342 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 17776 18294 gene locus_tag LOCUS_12410 17776 18294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 18294 18749 gene locus_tag LOCUS_12420 18294 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 18749 19162 gene locus_tag LOCUS_12430 18749 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 20133 19753 gene locus_tag LOCUS_12440 20133 19753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 20489 20304 gene locus_tag LOCUS_12450 20489 20304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 20861 20553 gene locus_tag LOCUS_12460 20861 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 21278 20910 gene locus_tag LOCUS_12470 21278 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 21634 21377 gene locus_tag LOCUS_12480 21634 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 22069 21746 gene locus_tag LOCUS_12490 22069 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 22322 22729 gene locus_tag LOCUS_12500 22322 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 22766 23155 gene locus_tag LOCUS_12510 22766 23155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 23532 23374 gene locus_tag LOCUS_12520 23532 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 24087 23635 gene locus_tag LOCUS_12530 24087 23635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 25004 24327 gene locus_tag LOCUS_12540 25004 24327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 25681 25133 gene locus_tag LOCUS_12550 25681 25133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 25972 26202 gene locus_tag LOCUS_12560 25972 26202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 27300 26218 gene locus_tag LOCUS_12570 27300 26218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 27783 27571 gene locus_tag LOCUS_12580 27783 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 28572 27862 gene locus_tag LOCUS_12590 28572 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 29446 28838 gene locus_tag LOCUS_12600 29446 28838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 29635 30318 gene locus_tag LOCUS_12610 29635 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 31141 30446 gene locus_tag LOCUS_12620 31141 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 31761 31252 gene locus_tag LOCUS_12630 31761 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 32007 31852 gene locus_tag LOCUS_12640 32007 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 32612 32004 gene locus_tag LOCUS_12650 32612 32004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 33274 32711 gene locus_tag LOCUS_12660 33274 32711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 33561 33271 gene locus_tag LOCUS_12670 33561 33271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 34211 33711 gene locus_tag LOCUS_12680 34211 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 34697 34338 gene locus_tag LOCUS_12690 34697 34338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 36034 34766 gene locus_tag LOCUS_12700 36034 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 37260 36484 gene locus_tag LOCUS_12710 37260 36484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 37714 37352 gene locus_tag LOCUS_12720 37714 37352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443268.1 protein_id gnl|my_center|LOCUS_12720 38089 37727 gene locus_tag LOCUS_12730 38089 37727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 38980 38186 gene locus_tag LOCUS_12740 38980 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 39245 39039 gene locus_tag LOCUS_12750 39245 39039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 39759 39397 gene locus_tag LOCUS_12760 39759 39397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 40225 39809 gene locus_tag LOCUS_12770 40225 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 40554 40384 gene locus_tag LOCUS_12780 40554 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 41087 40806 gene locus_tag LOCUS_12790 41087 40806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 41327 41533 gene locus_tag LOCUS_12800 41327 41533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 41869 41561 gene locus_tag LOCUS_12810 41869 41561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 41998 42762 gene locus_tag LOCUS_12820 41998 42762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 43344 43099 gene locus_tag LOCUS_12830 43344 43099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 44303 43506 gene locus_tag LOCUS_12840 44303 43506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 44700 44467 gene locus_tag LOCUS_12850 44700 44467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 45237 44710 gene locus_tag LOCUS_12860 45237 44710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 45622 45332 gene locus_tag LOCUS_12870 45622 45332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 46006 45785 gene locus_tag LOCUS_12880 46006 45785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 46462 46172 gene locus_tag LOCUS_12890 46462 46172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 47138 46476 gene locus_tag LOCUS_12900 47138 46476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 47458 47225 gene locus_tag LOCUS_12910 47458 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 47854 47504 gene locus_tag LOCUS_12920 47854 47504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 48356 47973 gene locus_tag LOCUS_12930 48356 47973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 48838 48464 gene locus_tag LOCUS_12940 48838 48464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 49168 48914 gene locus_tag LOCUS_12950 49168 48914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 49740 49480 gene locus_tag LOCUS_12960 49740 49480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 50318 49740 gene locus_tag LOCUS_12970 50318 49740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 51098 50445 gene locus_tag LOCUS_12980 51098 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 52549 51380 gene locus_tag LOCUS_12990 gene tnpB 52549 51380 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888231.1 protein_id gnl|my_center|LOCUS_12990 53051 52614 gene locus_tag LOCUS_13000 53051 52614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 53924 53193 gene locus_tag LOCUS_13010 53924 53193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 54194 54069 gene locus_tag LOCUS_13020 54194 54069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 54780 54490 gene locus_tag LOCUS_13030 54780 54490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 55336 54848 gene locus_tag LOCUS_13040 55336 54848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 55903 55457 gene locus_tag LOCUS_13050 55903 55457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 56339 55986 gene locus_tag LOCUS_13060 56339 55986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 56861 56424 gene locus_tag LOCUS_13070 56861 56424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 57341 56961 gene locus_tag LOCUS_13080 57341 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 57834 57412 gene locus_tag LOCUS_13090 57834 57412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 58591 57986 gene locus_tag LOCUS_13100 58591 57986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 58821 58624 gene locus_tag LOCUS_13110 58821 58624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 59305 58883 gene locus_tag LOCUS_13120 59305 58883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 59962 59444 gene locus_tag LOCUS_13130 59962 59444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 60315 60070 gene locus_tag LOCUS_13140 60315 60070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 60566 60327 gene locus_tag LOCUS_13150 60566 60327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 61398 60682 gene locus_tag LOCUS_13160 61398 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 62885 61404 gene locus_tag LOCUS_13170 62885 61404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 63302 63012 gene locus_tag LOCUS_13180 63302 63012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 63699 63487 gene locus_tag LOCUS_13190 63699 63487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 64405 63728 gene locus_tag LOCUS_13200 64405 63728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 65000 64497 gene locus_tag LOCUS_13210 65000 64497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 65643 65152 gene locus_tag LOCUS_13220 65643 65152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 66373 65768 gene locus_tag LOCUS_13230 66373 65768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 67154 66606 gene locus_tag LOCUS_13240 67154 66606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 68046 67273 gene locus_tag LOCUS_13250 68046 67273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 68230 68982 gene locus_tag LOCUS_13260 68230 68982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 69497 69045 gene locus_tag LOCUS_13270 69497 69045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 70352 69651 gene locus_tag LOCUS_13280 70352 69651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 70642 70349 gene locus_tag LOCUS_13290 70642 70349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 71179 70682 gene locus_tag LOCUS_13300 71179 70682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 71933 71262 gene locus_tag LOCUS_13310 71933 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 72065 72313 gene locus_tag LOCUS_13320 72065 72313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 72419 73207 gene locus_tag LOCUS_13330 72419 73207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 73284 73709 gene locus_tag LOCUS_13340 73284 73709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 74275 73874 gene locus_tag LOCUS_13350 74275 73874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0015 <1 1296 gene locus_tag LOCUS_13360 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942281.1:amidophosphoribosyltransferase 1373 2440 gene locus_tag LOCUS_13370 gene purM 1373 2440 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 protein_id gnl|my_center|LOCUS_13370 2554 4050 gene locus_tag LOCUS_13380 2554 4050 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_13380 4704 5150 gene locus_tag LOCUS_13390 4704 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5246 7354 gene locus_tag LOCUS_13400 5246 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8137 7409 gene locus_tag LOCUS_13410 8137 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 8631 8347 gene locus_tag LOCUS_13420 8631 8347 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082152.1 protein_id gnl|my_center|LOCUS_13420 9598 8687 gene locus_tag LOCUS_13430 9598 8687 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_13430 10860 9673 gene locus_tag LOCUS_13440 10860 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11039 11839 gene locus_tag LOCUS_13450 11039 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 12283 13116 gene locus_tag LOCUS_13460 12283 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 13287 14060 gene locus_tag LOCUS_13470 13287 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 14548 14264 gene locus_tag LOCUS_13480 14548 14264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 16127 14832 gene locus_tag LOCUS_13490 16127 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 17586 16294 gene locus_tag LOCUS_13500 17586 16294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 19504 17603 gene locus_tag LOCUS_13510 19504 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 19693 21033 gene locus_tag LOCUS_13520 19693 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 21976 21104 gene locus_tag LOCUS_13530 21976 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22421 25228 gene locus_tag LOCUS_13540 22421 25228 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066498163.1 protein_id gnl|my_center|LOCUS_13540 25920 25387 gene locus_tag LOCUS_13550 25920 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 26313 26828 gene locus_tag LOCUS_13560 26313 26828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 26859 27425 gene locus_tag LOCUS_13570 26859 27425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 28407 27874 gene locus_tag LOCUS_13580 28407 27874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 30001 28457 gene locus_tag LOCUS_13590 30001 28457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 30680 30345 gene locus_tag LOCUS_13600 30680 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 31728 30772 gene locus_tag LOCUS_13610 gene rbsK 31728 30772 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_13610 32247 31894 gene locus_tag LOCUS_13620 32247 31894 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191031.1 protein_id gnl|my_center|LOCUS_13620 33013 32288 gene locus_tag LOCUS_13630 33013 32288 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_13630 33308 33739 gene locus_tag LOCUS_13640 33308 33739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 33752 34396 gene locus_tag LOCUS_13650 33752 34396 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211791.1 protein_id gnl|my_center|LOCUS_13650 34396 35139 gene locus_tag LOCUS_13660 34396 35139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 35538 35227 gene locus_tag LOCUS_13670 35538 35227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 35910 36368 gene locus_tag LOCUS_13680 35910 36368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 36602 37393 gene locus_tag LOCUS_13690 36602 37393 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_13690 37474 38016 gene locus_tag LOCUS_13700 37474 38016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 38549 38806 gene locus_tag LOCUS_13710 38549 38806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 40492 38918 gene locus_tag LOCUS_13720 40492 38918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 40891 40688 gene locus_tag LOCUS_13730 40891 40688 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011562175.1 protein_id gnl|my_center|LOCUS_13730 41407 42912 gene locus_tag LOCUS_13740 41407 42912 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_13740 43738 42902 gene locus_tag LOCUS_13750 43738 42902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 44834 43731 gene locus_tag LOCUS_13760 44834 43731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 45279 46001 gene locus_tag LOCUS_13770 45279 46001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 45988 46677 gene locus_tag LOCUS_13780 45988 46677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 46821 47195 gene locus_tag LOCUS_13790 46821 47195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 47296 47739 gene locus_tag LOCUS_13800 47296 47739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 47886 49274 gene locus_tag LOCUS_13810 47886 49274 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_13810 49415 52780 gene locus_tag LOCUS_13820 49415 52780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 52954 54459 gene locus_tag LOCUS_13830 52954 54459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 54605 55702 gene locus_tag LOCUS_13840 54605 55702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 55674 56195 gene locus_tag LOCUS_13850 55674 56195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 56976 58904 gene locus_tag LOCUS_13860 56976 58904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 58999 60849 gene locus_tag LOCUS_13870 gene aspS 58999 60849 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_13870 61113 62777 gene locus_tag LOCUS_13880 61113 62777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_13880 62802 64928 gene locus_tag LOCUS_13890 62802 64928 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_13890 64995 65489 gene locus_tag LOCUS_13900 gene coaD 64995 65489 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_13900 65538 65903 gene locus_tag LOCUS_13910 65538 65903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 66183 66680 gene locus_tag LOCUS_13920 66183 66680 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_13920 66720 67862 gene locus_tag LOCUS_13930 66720 67862 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_13930 68156 68545 gene locus_tag LOCUS_13940 68156 68545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 68532 69458 gene locus_tag LOCUS_13950 68532 69458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 69455 69631 gene locus_tag LOCUS_13960 69455 69631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 70046 70624 gene locus_tag LOCUS_13970 70046 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 71293 70847 gene locus_tag LOCUS_13980 71293 70847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 71993 74359 gene locus_tag LOCUS_13990 71993 74359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence0016 1298 804 gene locus_tag LOCUS_14000 1298 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2309 1446 gene locus_tag LOCUS_14010 2309 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3352 2603 gene locus_tag LOCUS_14020 3352 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4765 3497 gene locus_tag LOCUS_14030 4765 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5104 4901 gene locus_tag LOCUS_14040 5104 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5613 5140 gene locus_tag LOCUS_14050 5613 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6298 5756 gene locus_tag LOCUS_14060 6298 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6446 6592 gene locus_tag LOCUS_14070 6446 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6987 6736 gene locus_tag LOCUS_14080 6987 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7676 6984 gene locus_tag LOCUS_14090 7676 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 8251 7817 gene locus_tag LOCUS_14100 8251 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 8649 8248 gene locus_tag LOCUS_14110 8649 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 9196 8792 gene locus_tag LOCUS_14120 9196 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9582 9232 gene locus_tag LOCUS_14130 9582 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 9660 10073 gene locus_tag LOCUS_14140 9660 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 10467 10222 gene locus_tag LOCUS_14150 10467 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11181 10528 gene locus_tag LOCUS_14160 11181 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11366 12094 gene locus_tag LOCUS_14170 11366 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 12357 12109 gene locus_tag LOCUS_14180 12357 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 12770 12372 gene locus_tag LOCUS_14190 12770 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13483 12821 gene locus_tag LOCUS_14200 13483 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14439 13594 gene locus_tag LOCUS_14210 14439 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 15298 14564 gene locus_tag LOCUS_14220 15298 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 16093 15512 gene locus_tag LOCUS_14230 16093 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 16425 17258 gene locus_tag LOCUS_14240 16425 17258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 17814 17293 gene locus_tag LOCUS_14250 17814 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18190 18885 gene locus_tag LOCUS_14260 18190 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18966 19451 gene locus_tag LOCUS_14270 18966 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 19599 20627 gene locus_tag LOCUS_14280 19599 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 20620 21255 gene locus_tag LOCUS_14290 20620 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 21276 21677 gene locus_tag LOCUS_14300 21276 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 22339 22569 gene locus_tag LOCUS_14310 22339 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 22557 23198 gene locus_tag LOCUS_14320 22557 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23319 23636 gene locus_tag LOCUS_14330 23319 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 23638 24264 gene locus_tag LOCUS_14340 23638 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 24268 24699 gene locus_tag LOCUS_14350 24268 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 24696 25322 gene locus_tag LOCUS_14360 24696 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 25435 26172 gene locus_tag LOCUS_14370 25435 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 26547 27077 gene locus_tag LOCUS_14380 26547 27077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 27144 27752 gene locus_tag LOCUS_14390 27144 27752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 27774 28313 gene locus_tag LOCUS_14400 27774 28313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 28554 28258 gene locus_tag LOCUS_14410 28554 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 29128 28604 gene locus_tag LOCUS_14420 29128 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 30922 29186 gene locus_tag LOCUS_14430 30922 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 31633 31163 gene locus_tag LOCUS_14440 31633 31163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 32482 31706 gene locus_tag LOCUS_14450 32482 31706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 32750 32565 gene locus_tag LOCUS_14460 32750 32565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 33114 32845 gene locus_tag LOCUS_14470 33114 32845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 33799 33170 gene locus_tag LOCUS_14480 33799 33170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 33959 34660 gene locus_tag LOCUS_14490 33959 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 34834 35514 gene locus_tag LOCUS_14500 34834 35514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 35588 36037 gene locus_tag LOCUS_14510 35588 36037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 36486 36202 gene locus_tag LOCUS_14520 36486 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 36771 36562 gene locus_tag LOCUS_14530 36771 36562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 36931 37602 gene locus_tag LOCUS_14540 36931 37602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 38327 37707 gene locus_tag LOCUS_14550 38327 37707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 38955 38590 gene locus_tag LOCUS_14560 38955 38590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 39716 39000 gene locus_tag LOCUS_14570 39716 39000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 40271 39831 gene locus_tag LOCUS_14580 40271 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 40833 40264 gene locus_tag LOCUS_14590 40833 40264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 41307 40966 gene locus_tag LOCUS_14600 41307 40966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 42022 41423 gene locus_tag LOCUS_14610 42022 41423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 43140 42142 gene locus_tag LOCUS_14620 43140 42142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 43947 43300 gene locus_tag LOCUS_14630 43947 43300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 44241 43960 gene locus_tag LOCUS_14640 44241 43960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 44666 44343 gene locus_tag LOCUS_14650 44666 44343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 45712 44663 gene locus_tag LOCUS_14660 45712 44663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 46996 45833 gene locus_tag LOCUS_14670 gene dnaN 46996 45833 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070425.1 protein_id gnl|my_center|LOCUS_14670 47830 47168 gene locus_tag LOCUS_14680 47830 47168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 48555 47875 gene locus_tag LOCUS_14690 48555 47875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 49450 48713 gene locus_tag LOCUS_14700 49450 48713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 50241 49627 gene locus_tag LOCUS_14710 50241 49627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 50330 50920 gene locus_tag LOCUS_14720 50330 50920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 50931 51746 gene locus_tag LOCUS_14730 50931 51746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 51759 52388 gene locus_tag LOCUS_14740 51759 52388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 52411 52743 gene locus_tag LOCUS_14750 52411 52743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 52793 53431 gene locus_tag LOCUS_14760 52793 53431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 53547 53999 gene locus_tag LOCUS_14770 53547 53999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 54013 54549 gene locus_tag LOCUS_14780 54013 54549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 54568 55185 gene locus_tag LOCUS_14790 54568 55185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 55276 55962 gene locus_tag LOCUS_14800 55276 55962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 55995 56552 gene locus_tag LOCUS_14810 55995 56552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 56648 58528 gene locus_tag LOCUS_14820 56648 58528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 59593 58607 gene locus_tag LOCUS_14830 59593 58607 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_14830 59776 60408 gene locus_tag LOCUS_14840 59776 60408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 61018 60479 gene locus_tag LOCUS_14850 61018 60479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 61097 61447 gene locus_tag LOCUS_14860 61097 61447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 61447 61977 gene locus_tag LOCUS_14870 61447 61977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 61974 62498 gene locus_tag LOCUS_14880 61974 62498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 62623 63402 gene locus_tag LOCUS_14890 62623 63402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 63551 64270 gene locus_tag LOCUS_14900 63551 64270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 65301 65113 gene locus_tag LOCUS_14910 65301 65113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 65576 65298 gene locus_tag LOCUS_14920 65576 65298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 65641 65832 gene locus_tag LOCUS_14930 65641 65832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 66198 65989 gene locus_tag LOCUS_14940 66198 65989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 66649 66326 gene locus_tag LOCUS_14950 66649 66326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 67062 66709 gene locus_tag LOCUS_14960 67062 66709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 67221 67910 gene locus_tag LOCUS_14970 67221 67910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 68332 67925 gene locus_tag LOCUS_14980 68332 67925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 68937 68491 gene locus_tag LOCUS_14990 68937 68491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 69397 69026 gene locus_tag LOCUS_15000 69397 69026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 70010 69534 gene locus_tag LOCUS_15010 70010 69534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 70152 71132 gene locus_tag LOCUS_15020 70152 71132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 72541 71129 gene locus_tag LOCUS_15030 72541 71129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 72855 72676 gene locus_tag LOCUS_15040 72855 72676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 73442 72909 gene locus_tag LOCUS_15050 73442 72909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0017 187 435 gene locus_tag LOCUS_15060 187 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 927 472 gene locus_tag LOCUS_15070 927 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2572 998 gene locus_tag LOCUS_15080 2572 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3448 2816 gene locus_tag LOCUS_15090 3448 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4999 3734 gene locus_tag LOCUS_15100 4999 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 5302 6084 gene locus_tag LOCUS_15110 5302 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6388 6098 gene locus_tag LOCUS_15120 6388 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6788 6477 gene locus_tag LOCUS_15130 6788 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6933 8264 gene locus_tag LOCUS_15140 6933 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9080 8511 gene locus_tag LOCUS_15150 9080 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 9634 9077 gene locus_tag LOCUS_15160 9634 9077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10008 9637 gene locus_tag LOCUS_15170 10008 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 10171 12264 gene locus_tag LOCUS_15180 10171 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 12341 13030 gene locus_tag LOCUS_15190 12341 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 13027 13893 gene locus_tag LOCUS_15200 13027 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 14507 13896 gene locus_tag LOCUS_15210 14507 13896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 14669 15301 gene locus_tag LOCUS_15220 14669 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 16667 15276 gene locus_tag LOCUS_15230 16667 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 17359 17685 gene locus_tag LOCUS_15240 17359 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 18415 17672 gene locus_tag LOCUS_15250 18415 17672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 18876 18415 gene locus_tag LOCUS_15260 18876 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 19075 20973 gene locus_tag LOCUS_15270 19075 20973 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819968.1 protein_id gnl|my_center|LOCUS_15270 21066 21752 gene locus_tag LOCUS_15280 21066 21752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 23017 21779 gene locus_tag LOCUS_15290 gene rtcB 23017 21779 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105467.1 protein_id gnl|my_center|LOCUS_15290 23220 24845 gene locus_tag LOCUS_15300 gene rtcR 23220 24845 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_15300 24925 25821 gene locus_tag LOCUS_15310 24925 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 26222 25818 gene locus_tag LOCUS_15320 26222 25818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 26394 28910 gene locus_tag LOCUS_15330 26394 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 28947 29228 gene locus_tag LOCUS_15340 28947 29228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 30778 29225 gene locus_tag LOCUS_15350 30778 29225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 30840 31211 gene locus_tag LOCUS_15360 30840 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 31280 31573 gene locus_tag LOCUS_15370 31280 31573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 31793 32230 gene locus_tag LOCUS_15380 31793 32230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 32235 33056 gene locus_tag LOCUS_15390 32235 33056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 33058 33438 gene locus_tag LOCUS_15400 33058 33438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 33560 34279 gene locus_tag LOCUS_15410 33560 34279 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_15410 34712 34269 gene locus_tag LOCUS_15420 34712 34269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 34815 35183 gene locus_tag LOCUS_15430 34815 35183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 35792 35187 gene locus_tag LOCUS_15440 35792 35187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15440 36779 35820 gene locus_tag LOCUS_15450 36779 35820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15450 36910 37596 gene locus_tag LOCUS_15460 36910 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 38193 37591 gene locus_tag LOCUS_15470 38193 37591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 41334 38200 gene locus_tag LOCUS_15480 41334 38200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 42160 41411 gene locus_tag LOCUS_15490 42160 41411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 42723 42905 gene locus_tag LOCUS_15500 42723 42905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 43009 43085 gene locus_tag LOCUS_t00170 43009 43085 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 43109 43264 gene locus_tag LOCUS_15510 43109 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 43255 43331 gene locus_tag LOCUS_t00180 43255 43331 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43371 43446 gene locus_tag LOCUS_t00190 43371 43446 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43451 43537 gene locus_tag LOCUS_t00200 43451 43537 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43923 43999 gene locus_tag LOCUS_t00210 43923 43999 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44007 44095 gene locus_tag LOCUS_t00220 44007 44095 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44140 44215 gene locus_tag LOCUS_t00230 44140 44215 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 44254 44331 gene locus_tag LOCUS_t00240 44254 44331 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44474 44550 gene locus_tag LOCUS_t00250 44474 44550 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 44643 44734 gene locus_tag LOCUS_t00260 44643 44734 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 45064 45140 gene locus_tag LOCUS_t00270 45064 45140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45279 45354 gene locus_tag LOCUS_t00280 45279 45354 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 45442 45517 gene locus_tag LOCUS_t00290 45442 45517 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 45524 45599 gene locus_tag LOCUS_t00300 45524 45599 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45651 46055 gene locus_tag LOCUS_15520 45651 46055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 46712 46077 gene locus_tag LOCUS_15530 46712 46077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 48123 47017 gene locus_tag LOCUS_15540 48123 47017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 49123 48134 gene locus_tag LOCUS_15550 49123 48134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 49690 49765 gene locus_tag LOCUS_t00310 49690 49765 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 49773 49861 gene locus_tag LOCUS_t00320 49773 49861 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 49881 49956 gene locus_tag LOCUS_t00330 49881 49956 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 49987 50062 gene locus_tag LOCUS_t00340 49987 50062 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 50070 50146 gene locus_tag LOCUS_t00350 50070 50146 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 50607 50682 gene locus_tag LOCUS_t00360 50607 50682 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 50690 50766 gene locus_tag LOCUS_t00370 50690 50766 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 50808 51014 gene locus_tag LOCUS_15560 50808 51014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 51041 51116 gene locus_tag LOCUS_t00380 51041 51116 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51124 51199 gene locus_tag LOCUS_t00390 51124 51199 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 51405 51480 gene locus_tag LOCUS_t00400 51405 51480 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51497 51572 gene locus_tag LOCUS_t00410 51497 51572 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 51585 51660 gene locus_tag LOCUS_t00420 51585 51660 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 51664 51739 gene locus_tag LOCUS_t00430 51664 51739 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 51787 51863 gene locus_tag LOCUS_t00440 51787 51863 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 51889 52053 gene locus_tag LOCUS_15570 51889 52053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 52634 52710 gene locus_tag LOCUS_t00450 52634 52710 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53153 53227 gene locus_tag LOCUS_t00460 53153 53227 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53381 53473 gene locus_tag LOCUS_t00470 53381 53473 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 53507 53583 gene locus_tag LOCUS_t00480 53507 53583 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56340 53722 gene locus_tag LOCUS_15580 56340 53722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 61994 56520 gene locus_tag LOCUS_15590 61994 56520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 62278 63402 gene locus_tag LOCUS_15600 62278 63402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 63412 63825 gene locus_tag LOCUS_15610 63412 63825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 65395 63854 gene locus_tag LOCUS_15620 65395 63854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 66264 65395 gene locus_tag LOCUS_15630 66264 65395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 68374 66365 gene locus_tag LOCUS_15640 gene ligA 68374 66365 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 protein_id gnl|my_center|LOCUS_15640 69528 68449 gene locus_tag LOCUS_15650 69528 68449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 71647 69572 gene locus_tag LOCUS_15660 71647 69572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence0018 313 504 gene locus_tag LOCUS_15670 313 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 443 3154 gene locus_tag LOCUS_15680 443 3154 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166522727.1 protein_id gnl|my_center|LOCUS_15680 3467 4342 gene locus_tag LOCUS_15690 3467 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4473 5906 gene locus_tag LOCUS_15700 4473 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6170 8575 gene locus_tag LOCUS_15710 6170 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 8738 9541 gene locus_tag LOCUS_15720 8738 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 11842 9710 gene locus_tag LOCUS_15730 11842 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 11885 12118 gene locus_tag LOCUS_15740 11885 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12230 13066 gene locus_tag LOCUS_15750 12230 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 15007 13205 gene locus_tag LOCUS_15760 15007 13205 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117992.1 protein_id gnl|my_center|LOCUS_15760 21094 15266 gene locus_tag LOCUS_15770 21094 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 21641 23005 gene locus_tag LOCUS_15780 21641 23005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 23174 24322 gene locus_tag LOCUS_15790 23174 24322 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_15790 24417 27704 gene locus_tag LOCUS_15800 24417 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 30622 27815 gene locus_tag LOCUS_15810 30622 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 31974 30742 gene locus_tag LOCUS_15820 31974 30742 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15820 34112 32106 gene locus_tag LOCUS_15830 34112 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 34481 35761 gene locus_tag LOCUS_15840 34481 35761 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15840 35806 37770 gene locus_tag LOCUS_15850 35806 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 40015 37988 gene locus_tag LOCUS_15860 40015 37988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 40577 41644 gene locus_tag LOCUS_15870 40577 41644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 41848 44217 gene locus_tag LOCUS_15880 41848 44217 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_15880 44510 46204 gene locus_tag LOCUS_15890 44510 46204 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_15890 47060 47836 gene locus_tag LOCUS_15900 47060 47836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 47871 47799 gene locus_tag LOCUS_t00490 47871 47799 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 48084 48011 gene locus_tag LOCUS_t00500 48084 48011 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 48314 49111 gene locus_tag LOCUS_15910 48314 49111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 49457 49996 gene locus_tag LOCUS_15920 49457 49996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 50700 50110 gene locus_tag LOCUS_15930 50700 50110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 50897 51070 gene locus_tag LOCUS_15940 50897 51070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 52421 51891 gene locus_tag LOCUS_15950 52421 51891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 53183 52527 gene locus_tag LOCUS_15960 53183 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 53770 53621 gene locus_tag LOCUS_15970 53770 53621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 54333 55214 gene locus_tag LOCUS_15980 54333 55214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 55250 57544 gene locus_tag LOCUS_15990 gene gspD 55250 57544 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940997.1 protein_id gnl|my_center|LOCUS_15990 57583 59322 gene locus_tag LOCUS_16000 gene gspE 57583 59322 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_16000 59303 60535 gene locus_tag LOCUS_16010 59303 60535 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_16010 60551 60967 gene locus_tag LOCUS_16020 60551 60967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 60964 61749 gene locus_tag LOCUS_16030 60964 61749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 61746 62735 gene locus_tag LOCUS_16040 61746 62735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 62785 64260 gene locus_tag LOCUS_16050 62785 64260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 64257 64802 gene locus_tag LOCUS_16060 64257 64802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 65165 65842 gene locus_tag LOCUS_16070 65165 65842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 65956 66498 gene locus_tag LOCUS_16080 gene cobO 65956 66498 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_16080 66551 67291 gene locus_tag LOCUS_16090 gene ispD 66551 67291 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_16090 67359 68048 gene locus_tag LOCUS_16100 67359 68048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_16100 68195 69475 gene locus_tag LOCUS_16110 gene purD 68195 69475 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence0019 531 157 gene locus_tag LOCUS_16120 531 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 511 1071 gene locus_tag LOCUS_16130 511 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1440 2705 gene locus_tag LOCUS_16140 gene araD 1440 2705 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_16140 2869 5007 gene locus_tag LOCUS_16150 2869 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5653 8052 gene locus_tag LOCUS_16160 5653 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8152 8511 gene locus_tag LOCUS_16170 8152 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 9042 8635 gene locus_tag LOCUS_16180 9042 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9555 9118 gene locus_tag LOCUS_16190 9555 9118 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_16190 10719 9640 gene locus_tag LOCUS_16200 10719 9640 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_16200 11928 10858 gene locus_tag LOCUS_16210 11928 10858 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_16210 13817 12831 gene locus_tag LOCUS_16220 13817 12831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 14320 13859 gene locus_tag LOCUS_16230 14320 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 15070 14348 gene locus_tag LOCUS_16240 15070 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 15791 15864 gene locus_tag LOCUS_t00510 15791 15864 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15923 17167 gene locus_tag LOCUS_16250 gene glmU 15923 17167 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_16250 17154 18107 gene locus_tag LOCUS_16260 17154 18107 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_16260 18181 18849 gene locus_tag LOCUS_16270 18181 18849 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092871.1 protein_id gnl|my_center|LOCUS_16270 18873 19448 gene locus_tag LOCUS_16280 gene pth 18873 19448 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_16280 19530 20162 gene locus_tag LOCUS_16290 19530 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 20239 20667 gene locus_tag LOCUS_16300 20239 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 20739 21029 gene locus_tag LOCUS_16310 gene rpsR 20739 21029 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583715.1 protein_id gnl|my_center|LOCUS_16310 21161 21661 gene locus_tag LOCUS_16320 gene rplI 21161 21661 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_16320 22950 21658 gene locus_tag LOCUS_16330 22950 21658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 23756 22947 gene locus_tag LOCUS_16340 23756 22947 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_16340 24135 23881 gene locus_tag LOCUS_16350 24135 23881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 27002 24153 gene locus_tag LOCUS_16360 27002 24153 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956752.1 protein_id gnl|my_center|LOCUS_16360 27385 27047 gene locus_tag LOCUS_16370 27385 27047 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_16370 29097 27400 gene locus_tag LOCUS_16380 29097 27400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 protein_id gnl|my_center|LOCUS_16380 29405 29118 gene locus_tag LOCUS_16390 29405 29118 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 protein_id gnl|my_center|LOCUS_16390 29935 30510 gene locus_tag LOCUS_16400 29935 30510 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_16400 30633 32873 gene locus_tag LOCUS_16410 30633 32873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 33159 34991 gene locus_tag LOCUS_16420 33159 34991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 35049 35834 gene locus_tag LOCUS_16430 35049 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 35891 36499 gene locus_tag LOCUS_16440 35891 36499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 36673 37617 gene locus_tag LOCUS_16450 36673 37617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 37887 38516 gene locus_tag LOCUS_16460 37887 38516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 39352 40536 gene locus_tag LOCUS_16470 gene ftsZ 39352 40536 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_16470 40762 42084 gene locus_tag LOCUS_16480 gene orpR 40762 42084 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_16480 42267 42692 gene locus_tag LOCUS_16490 42267 42692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 42758 42946 gene locus_tag LOCUS_16500 42758 42946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 42949 43140 gene locus_tag LOCUS_16510 42949 43140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 43224 43574 gene locus_tag LOCUS_16520 43224 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 43649 43834 gene locus_tag LOCUS_16530 43649 43834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 43815 44696 gene locus_tag LOCUS_16540 43815 44696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 44795 45727 gene locus_tag LOCUS_16550 44795 45727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 47027 47218 gene locus_tag LOCUS_16560 47027 47218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 47223 47654 gene locus_tag LOCUS_16570 47223 47654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 47651 48271 gene locus_tag LOCUS_16580 47651 48271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 48369 49124 gene locus_tag LOCUS_16590 48369 49124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 49124 49315 gene locus_tag LOCUS_16600 49124 49315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 49422 49604 gene locus_tag LOCUS_16610 49422 49604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 49814 52144 gene locus_tag LOCUS_16620 49814 52144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 52159 54180 gene locus_tag LOCUS_16630 52159 54180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 54293 55186 gene locus_tag LOCUS_16640 54293 55186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 55198 57786 gene locus_tag LOCUS_16650 55198 57786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 57915 58199 gene locus_tag LOCUS_16660 57915 58199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 58278 58526 gene locus_tag LOCUS_16670 58278 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 58516 58797 gene locus_tag LOCUS_16680 58516 58797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 58913 59119 gene locus_tag LOCUS_16690 58913 59119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 59232 59687 gene locus_tag LOCUS_16700 59232 59687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 59766 60875 gene locus_tag LOCUS_16710 59766 60875 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880512.1 protein_id gnl|my_center|LOCUS_16710 60936 61175 gene locus_tag LOCUS_16720 60936 61175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 61337 62203 gene locus_tag LOCUS_16730 61337 62203 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_16730 62207 63136 gene locus_tag LOCUS_16740 62207 63136 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_16740 63247 63807 gene locus_tag LOCUS_16750 63247 63807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 64380 65390 gene locus_tag LOCUS_16760 64380 65390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 65538 66362 gene locus_tag LOCUS_16770 65538 66362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 66359 66898 gene locus_tag LOCUS_16780 66359 66898 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_16780 66981 67157 gene locus_tag LOCUS_16790 66981 67157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 67236 69239 gene locus_tag LOCUS_16800 gene feoB 67236 69239 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0020 259 2553 gene locus_tag LOCUS_16810 259 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2575 4443 gene locus_tag LOCUS_16820 2575 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5281 5640 gene locus_tag LOCUS_16830 5281 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6721 5687 gene locus_tag LOCUS_16840 6721 5687 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942440.1 protein_id gnl|my_center|LOCUS_16840 7659 7099 gene locus_tag LOCUS_16850 7659 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 8510 7953 gene locus_tag LOCUS_16860 8510 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 10109 8580 gene locus_tag LOCUS_16870 10109 8580 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334446.1 protein_id gnl|my_center|LOCUS_16870 10960 10253 gene locus_tag LOCUS_16880 10960 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 11116 11451 gene locus_tag LOCUS_16890 11116 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 11833 11663 gene locus_tag LOCUS_16900 11833 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 11872 12681 gene locus_tag LOCUS_16910 11872 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 14931 12793 gene locus_tag LOCUS_16920 14931 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 15444 16256 gene locus_tag LOCUS_16930 15444 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 16648 17412 gene locus_tag LOCUS_16940 16648 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 17574 18368 gene locus_tag LOCUS_16950 17574 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18400 19263 gene locus_tag LOCUS_16960 18400 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 19831 20883 gene locus_tag LOCUS_16970 gene queA 19831 20883 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830755.1 protein_id gnl|my_center|LOCUS_16970 22674 20926 gene locus_tag LOCUS_16980 22674 20926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 23436 22675 gene locus_tag LOCUS_16990 23436 22675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776310.1 protein_id gnl|my_center|LOCUS_16990 24308 23505 gene locus_tag LOCUS_17000 24308 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17000 24642 24295 gene locus_tag LOCUS_17010 24642 24295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17010 24856 26733 gene locus_tag LOCUS_17020 24856 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 28449 26884 gene locus_tag LOCUS_17030 28449 26884 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_17030 29847 28537 gene locus_tag LOCUS_17040 gene xylA 29847 28537 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_17040 31406 29913 gene locus_tag LOCUS_17050 31406 29913 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838522.1 protein_id gnl|my_center|LOCUS_17050 32049 31591 gene locus_tag LOCUS_17060 32049 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 33609 32152 gene locus_tag LOCUS_17070 33609 32152 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_17070 35032 33689 gene locus_tag LOCUS_17080 35032 33689 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_17080 37542 35206 gene locus_tag LOCUS_17090 37542 35206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 37991 40129 gene locus_tag LOCUS_17100 37991 40129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 40525 42693 gene locus_tag LOCUS_17110 40525 42693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 43302 42802 gene locus_tag LOCUS_17120 43302 42802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 44794 43322 gene locus_tag LOCUS_17130 44794 43322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 46142 44826 gene locus_tag LOCUS_17140 46142 44826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 46987 46139 gene locus_tag LOCUS_17150 46987 46139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 47790 47002 gene locus_tag LOCUS_17160 47790 47002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 48400 47774 gene locus_tag LOCUS_17170 48400 47774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 48788 48351 gene locus_tag LOCUS_17180 gene gspG 48788 48351 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_17180 50030 48810 gene locus_tag LOCUS_17190 gene gspF 50030 48810 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_17190 51801 50095 gene locus_tag LOCUS_17200 gene gspE 51801 50095 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_17200 54932 51804 gene locus_tag LOCUS_17210 54932 51804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 55925 54987 gene locus_tag LOCUS_17220 55925 54987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 57336 55978 gene locus_tag LOCUS_17230 57336 55978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 58484 57411 gene locus_tag LOCUS_17240 58484 57411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 58878 59876 gene locus_tag LOCUS_17250 58878 59876 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_17250 59873 61867 gene locus_tag LOCUS_17260 59873 61867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 61901 62620 gene locus_tag LOCUS_17270 61901 62620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 62634 63749 gene locus_tag LOCUS_17280 62634 63749 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_17280 63746 64846 gene locus_tag LOCUS_17290 63746 64846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 64831 65676 gene locus_tag LOCUS_17300 64831 65676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 65720 66448 gene locus_tag LOCUS_17310 65720 66448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 66683 66483 gene locus_tag LOCUS_17320 66683 66483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 67030 66728 gene locus_tag LOCUS_17330 67030 66728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 67083 67478 gene locus_tag LOCUS_17340 67083 67478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 <68691 67465 gene locus_tag LOCUS_17350 <68691 67465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081014.1:serine hydroxymethyltransferase >Feature sequence0021 164 565 gene locus_tag LOCUS_17360 164 565 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_17360 1200 811 gene locus_tag LOCUS_17370 1200 811 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976145.1 protein_id gnl|my_center|LOCUS_17370 1886 1452 gene locus_tag LOCUS_17380 1886 1452 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087706.1 protein_id gnl|my_center|LOCUS_17380 2424 1966 gene locus_tag LOCUS_17390 2424 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3715 2414 gene locus_tag LOCUS_17400 3715 2414 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_17400 5052 4054 gene locus_tag LOCUS_17410 5052 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5520 5185 gene locus_tag LOCUS_17420 5520 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5924 7408 gene locus_tag LOCUS_17430 5924 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 7878 8060 gene locus_tag LOCUS_17440 7878 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8142 9671 gene locus_tag LOCUS_17450 8142 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 9830 11077 gene locus_tag LOCUS_17460 9830 11077 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_17460 11766 11089 gene locus_tag LOCUS_17470 11766 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 12283 11840 gene locus_tag LOCUS_17480 12283 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 12840 12655 gene locus_tag LOCUS_17490 12840 12655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 15772 13439 gene locus_tag LOCUS_17500 15772 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 18712 15884 gene locus_tag LOCUS_17510 18712 15884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 20891 18750 gene locus_tag LOCUS_17520 20891 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 23046 20959 gene locus_tag LOCUS_17530 23046 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 25225 23108 gene locus_tag LOCUS_17540 25225 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 26171 25623 gene locus_tag LOCUS_17550 26171 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 26568 27653 gene locus_tag LOCUS_17560 26568 27653 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376722.1 protein_id gnl|my_center|LOCUS_17560 27653 28897 gene locus_tag LOCUS_17570 27653 28897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_17570 28894 30132 gene locus_tag LOCUS_17580 28894 30132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481616.1 protein_id gnl|my_center|LOCUS_17580 30125 30814 gene locus_tag LOCUS_17590 30125 30814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_17590 31085 31861 gene locus_tag LOCUS_17600 31085 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 31922 32395 gene locus_tag LOCUS_17610 gene ndk 31922 32395 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415887.1 protein_id gnl|my_center|LOCUS_17610 32610 34496 gene locus_tag LOCUS_17620 32610 34496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 34542 36002 gene locus_tag LOCUS_17630 34542 36002 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_17630 36268 37269 gene locus_tag LOCUS_17640 36268 37269 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_17640 37290 38606 gene locus_tag LOCUS_17650 37290 38606 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_17650 38735 40030 gene locus_tag LOCUS_17660 38735 40030 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_17660 40102 41736 gene locus_tag LOCUS_17670 40102 41736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 41746 43128 gene locus_tag LOCUS_17680 41746 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 43184 44260 gene locus_tag LOCUS_17690 43184 44260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 44337 45704 gene locus_tag LOCUS_17700 44337 45704 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_17700 45820 47154 gene locus_tag LOCUS_17710 45820 47154 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_17710 47235 48629 gene locus_tag LOCUS_17720 47235 48629 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_17720 48721 50091 gene locus_tag LOCUS_17730 48721 50091 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_17730 50160 51494 gene locus_tag LOCUS_17740 50160 51494 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_17740 51581 53014 gene locus_tag LOCUS_17750 51581 53014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 53041 54477 gene locus_tag LOCUS_17760 53041 54477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 54671 56047 gene locus_tag LOCUS_17770 54671 56047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 56094 58085 gene locus_tag LOCUS_17780 56094 58085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921796.1 protein_id gnl|my_center|LOCUS_17780 58114 58713 gene locus_tag LOCUS_17790 58114 58713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 58819 59925 gene locus_tag LOCUS_17800 58819 59925 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_17800 60030 61466 gene locus_tag LOCUS_17810 gene cytX 60030 61466 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868210.1 protein_id gnl|my_center|LOCUS_17810 61807 62628 gene locus_tag LOCUS_17820 61807 62628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 62714 64252 gene locus_tag LOCUS_17830 62714 64252 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_17830 64357 65223 gene locus_tag LOCUS_17840 64357 65223 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_17840 65989 65249 gene locus_tag LOCUS_17850 65989 65249 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_17850 67722 66346 gene locus_tag LOCUS_17860 67722 66346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 66349 66438 gene locus_tag LOCUS_t00520 66349 66438 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67970 67719 gene locus_tag LOCUS_17870 67970 67719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0022 1399 284 gene locus_tag LOCUS_17880 1399 284 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119138.1 protein_id gnl|my_center|LOCUS_17880 1600 1421 gene locus_tag LOCUS_17890 1600 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1799 3394 gene locus_tag LOCUS_17900 1799 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3461 4831 gene locus_tag LOCUS_17910 3461 4831 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_17910 6320 4848 gene locus_tag LOCUS_17920 6320 4848 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_17920 6519 7985 gene locus_tag LOCUS_17930 6519 7985 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_17930 8020 9630 gene locus_tag LOCUS_17940 8020 9630 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_17940 10142 9642 gene locus_tag LOCUS_17950 10142 9642 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876457.1 protein_id gnl|my_center|LOCUS_17950 10337 11842 gene locus_tag LOCUS_17960 10337 11842 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_17960 12895 11912 gene locus_tag LOCUS_17970 12895 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_17970 15264 12892 gene locus_tag LOCUS_17980 15264 12892 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_17980 18896 15264 gene locus_tag LOCUS_17990 18896 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_17990 20710 18893 gene locus_tag LOCUS_18000 20710 18893 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_18000 21990 21013 gene locus_tag LOCUS_18010 21990 21013 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_18010 22994 21987 gene locus_tag LOCUS_18020 22994 21987 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_18020 23856 23008 gene locus_tag LOCUS_18030 23856 23008 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_18030 26240 23853 gene locus_tag LOCUS_18040 26240 23853 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_18040 26863 26666 gene locus_tag LOCUS_18050 26863 26666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 27382 28365 gene locus_tag LOCUS_18060 27382 28365 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_18060 29693 28395 gene locus_tag LOCUS_18070 29693 28395 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_18070 31169 29742 gene locus_tag LOCUS_18080 31169 29742 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_18080 31408 32382 gene locus_tag LOCUS_18090 31408 32382 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 protein_id gnl|my_center|LOCUS_18090 32673 32386 gene locus_tag LOCUS_18100 32673 32386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 34442 32847 gene locus_tag LOCUS_18110 34442 32847 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_18110 36010 34511 gene locus_tag LOCUS_18120 36010 34511 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828469.1 protein_id gnl|my_center|LOCUS_18120 36283 36606 gene locus_tag LOCUS_18130 36283 36606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 39989 36738 gene locus_tag LOCUS_18140 39989 36738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_18140 41785 40274 gene locus_tag LOCUS_18150 41785 40274 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_18150 42069 43127 gene locus_tag LOCUS_18160 42069 43127 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_18160 43200 45638 gene locus_tag LOCUS_18170 43200 45638 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_18170 47024 45747 gene locus_tag LOCUS_18180 47024 45747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 49013 47106 gene locus_tag LOCUS_18190 49013 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 50067 49060 gene locus_tag LOCUS_18200 50067 49060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 52724 50097 gene locus_tag LOCUS_18210 52724 50097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 54096 52786 gene locus_tag LOCUS_18220 54096 52786 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_18220 55029 54112 gene locus_tag LOCUS_18230 55029 54112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_18230 56193 55045 gene locus_tag LOCUS_18240 56193 55045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097689.1 protein_id gnl|my_center|LOCUS_18240 58416 56296 gene locus_tag LOCUS_18250 58416 56296 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_18250 59169 58483 gene locus_tag LOCUS_18260 gene deoC 59169 58483 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_18260 59431 60519 gene locus_tag LOCUS_18270 59431 60519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 61375 60584 gene locus_tag LOCUS_18280 61375 60584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_18280 62297 61362 gene locus_tag LOCUS_18290 62297 61362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence0023 427 1575 gene locus_tag LOCUS_18300 427 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1560 1739 gene locus_tag LOCUS_18310 1560 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1736 2515 gene locus_tag LOCUS_18320 1736 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2603 3628 gene locus_tag LOCUS_18330 2603 3628 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_18330 4558 5217 gene locus_tag LOCUS_18340 4558 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5214 5924 gene locus_tag LOCUS_18350 5214 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6115 8409 gene locus_tag LOCUS_18360 6115 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8884 11055 gene locus_tag LOCUS_18370 8884 11055 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_18370 13202 11133 gene locus_tag LOCUS_18380 13202 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 13561 15615 gene locus_tag LOCUS_18390 13561 15615 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_18390 15897 16286 gene locus_tag LOCUS_18400 15897 16286 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257840.1 protein_id gnl|my_center|LOCUS_18400 16399 17427 gene locus_tag LOCUS_18410 16399 17427 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_18410 17433 18275 gene locus_tag LOCUS_18420 17433 18275 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_18420 18275 19015 gene locus_tag LOCUS_18430 18275 19015 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_18430 19015 20313 gene locus_tag LOCUS_18440 19015 20313 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_18440 20329 20790 gene locus_tag LOCUS_18450 20329 20790 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_18450 21099 22877 gene locus_tag LOCUS_18460 21099 22877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228613.1 protein_id gnl|my_center|LOCUS_18460 22874 24661 gene locus_tag LOCUS_18470 22874 24661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228612.1 protein_id gnl|my_center|LOCUS_18470 24888 25091 gene locus_tag LOCUS_18480 24888 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 26574 25207 gene locus_tag LOCUS_18490 26574 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 27155 26691 gene locus_tag LOCUS_18500 27155 26691 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_18500 27594 28778 gene locus_tag LOCUS_18510 27594 28778 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_18510 29044 30189 gene locus_tag LOCUS_18520 29044 30189 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_18520 30359 34294 gene locus_tag LOCUS_18530 30359 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 34333 35724 gene locus_tag LOCUS_18540 34333 35724 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334318.1 protein_id gnl|my_center|LOCUS_18540 36340 38499 gene locus_tag LOCUS_18550 36340 38499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 39681 38623 gene locus_tag LOCUS_18560 39681 38623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 39984 42398 gene locus_tag LOCUS_18570 39984 42398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 42497 44293 gene locus_tag LOCUS_18580 42497 44293 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_18580 44307 44531 gene locus_tag LOCUS_18590 44307 44531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 44793 46436 gene locus_tag LOCUS_18600 44793 46436 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_18600 46780 48918 gene locus_tag LOCUS_18610 46780 48918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 49325 50155 gene locus_tag LOCUS_18620 49325 50155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 51199 50213 gene locus_tag LOCUS_18630 gene rbsK 51199 50213 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 protein_id gnl|my_center|LOCUS_18630 51581 51231 gene locus_tag LOCUS_18640 51581 51231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 51835 52800 gene locus_tag LOCUS_18650 gene pdhA 51835 52800 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_18650 52797 53807 gene locus_tag LOCUS_18660 52797 53807 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_18660 53824 55002 gene locus_tag LOCUS_18670 53824 55002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 55025 56182 gene locus_tag LOCUS_18680 55025 56182 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943072.1 protein_id gnl|my_center|LOCUS_18680 56185 56913 gene locus_tag LOCUS_18690 56185 56913 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_18690 56942 57586 gene locus_tag LOCUS_18700 gene fsa 56942 57586 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_18700 57621 58880 gene locus_tag LOCUS_18710 57621 58880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 58891 59940 gene locus_tag LOCUS_18720 58891 59940 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067003.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0024 299 808 gene locus_tag LOCUS_18730 299 808 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_18730 1076 2209 gene locus_tag LOCUS_18740 1076 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2295 2528 gene locus_tag LOCUS_18750 2295 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2889 2698 gene locus_tag LOCUS_18760 2889 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2904 3131 gene locus_tag LOCUS_18770 2904 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3467 3267 gene locus_tag LOCUS_18780 3467 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3881 3612 gene locus_tag LOCUS_18790 3881 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 4323 3862 gene locus_tag LOCUS_18800 4323 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 4880 4320 gene locus_tag LOCUS_18810 4880 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5265 4993 gene locus_tag LOCUS_18820 5265 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 5931 5536 gene locus_tag LOCUS_18830 5931 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 6357 6019 gene locus_tag LOCUS_18840 6357 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 7428 6673 gene locus_tag LOCUS_18850 7428 6673 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015917.1 protein_id gnl|my_center|LOCUS_18850 7956 7441 gene locus_tag LOCUS_18860 7956 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8284 8096 gene locus_tag LOCUS_18870 8284 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 8860 8330 gene locus_tag LOCUS_18880 8860 8330 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956900.1 protein_id gnl|my_center|LOCUS_18880 9170 8913 gene locus_tag LOCUS_18890 9170 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_18890 9370 9176 gene locus_tag LOCUS_18900 9370 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10099 9419 gene locus_tag LOCUS_18910 10099 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10539 10243 gene locus_tag LOCUS_18920 10539 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 10880 10707 gene locus_tag LOCUS_18930 10880 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 11273 10920 gene locus_tag LOCUS_18940 11273 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 11493 11266 gene locus_tag LOCUS_18950 11493 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 11992 11747 gene locus_tag LOCUS_18960 11992 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 12480 12205 gene locus_tag LOCUS_18970 12480 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 12859 12599 gene locus_tag LOCUS_18980 12859 12599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 13284 13751 gene locus_tag LOCUS_18990 13284 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 13748 14899 gene locus_tag LOCUS_19000 13748 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 16777 15065 gene locus_tag LOCUS_19010 16777 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 18295 16874 gene locus_tag LOCUS_19020 18295 16874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 19252 18464 gene locus_tag LOCUS_19030 19252 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 19759 19409 gene locus_tag LOCUS_19040 19759 19409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 22445 19890 gene locus_tag LOCUS_19050 22445 19890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 23268 22741 gene locus_tag LOCUS_19060 23268 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 24391 23393 gene locus_tag LOCUS_19070 24391 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 25098 24694 gene locus_tag LOCUS_19080 25098 24694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 25636 25166 gene locus_tag LOCUS_19090 25636 25166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 26178 25750 gene locus_tag LOCUS_19100 26178 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 26678 26325 gene locus_tag LOCUS_19110 26678 26325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 27100 26792 gene locus_tag LOCUS_19120 27100 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 27729 27205 gene locus_tag LOCUS_19130 27729 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 28831 27842 gene locus_tag LOCUS_19140 28831 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 29498 28926 gene locus_tag LOCUS_19150 29498 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 30887 29646 gene locus_tag LOCUS_19160 30887 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 31257 30901 gene locus_tag LOCUS_19170 31257 30901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 31826 31317 gene locus_tag LOCUS_19180 31826 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 34330 32105 gene locus_tag LOCUS_19190 34330 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 36372 34444 gene locus_tag LOCUS_19200 36372 34444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 36767 36441 gene locus_tag LOCUS_19210 36767 36441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 38405 36963 gene locus_tag LOCUS_19220 38405 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 38894 38547 gene locus_tag LOCUS_19230 38894 38547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 39649 38897 gene locus_tag LOCUS_19240 39649 38897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 40553 39792 gene locus_tag LOCUS_19250 40553 39792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 41471 40581 gene locus_tag LOCUS_19260 41471 40581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 42088 41669 gene locus_tag LOCUS_19270 42088 41669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 42339 42094 gene locus_tag LOCUS_19280 42339 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 42563 42336 gene locus_tag LOCUS_19290 42563 42336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 43016 42618 gene locus_tag LOCUS_19300 43016 42618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 43443 43114 gene locus_tag LOCUS_19310 43443 43114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 43657 43469 gene locus_tag LOCUS_19320 43657 43469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 43893 43639 gene locus_tag LOCUS_19330 43893 43639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 44781 43915 gene locus_tag LOCUS_19340 44781 43915 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485220.1 protein_id gnl|my_center|LOCUS_19340 46059 44866 gene locus_tag LOCUS_19350 gene dnaN 46059 44866 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_19350 46364 46116 gene locus_tag LOCUS_19360 46364 46116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 46844 46452 gene locus_tag LOCUS_19370 46844 46452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 47302 46883 gene locus_tag LOCUS_19380 47302 46883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 47958 47302 gene locus_tag LOCUS_19390 47958 47302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 48275 48054 gene locus_tag LOCUS_19400 48275 48054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 48623 48553 gene locus_tag LOCUS_t00530 48623 48553 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49402 48650 gene locus_tag LOCUS_19410 49402 48650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 50673 49375 gene locus_tag LOCUS_19420 50673 49375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 50952 50677 gene locus_tag LOCUS_19430 50952 50677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 51880 50936 gene locus_tag LOCUS_19440 gene xerD 51880 50936 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_19440 53294 52755 gene locus_tag LOCUS_19450 53294 52755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849873.1 protein_id gnl|my_center|LOCUS_19450 56281 53264 gene locus_tag LOCUS_19460 56281 53264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 56314 57399 gene locus_tag LOCUS_19470 56314 57399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 58267 57380 gene locus_tag LOCUS_19480 58267 57380 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339488.1 protein_id gnl|my_center|LOCUS_19480 58334 58825 gene locus_tag LOCUS_19490 58334 58825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 59340 58891 gene locus_tag LOCUS_19500 59340 58891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 59642 59409 gene locus_tag LOCUS_19510 59642 59409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 60937 59921 gene locus_tag LOCUS_19520 60937 59921 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537316.1 protein_id gnl|my_center|LOCUS_19520 61308 60934 gene locus_tag LOCUS_19530 61308 60934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 61556 61631 gene locus_tag LOCUS_t00540 61556 61631 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0025 554 2383 gene locus_tag LOCUS_19540 554 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 3815 2397 gene locus_tag LOCUS_19550 3815 2397 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_19550 5335 3899 gene locus_tag LOCUS_19560 5335 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6039 5359 gene locus_tag LOCUS_19570 6039 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 7608 6196 gene locus_tag LOCUS_19580 7608 6196 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_19580 8455 10842 gene locus_tag LOCUS_19590 8455 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 10958 12424 gene locus_tag LOCUS_19600 10958 12424 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_19600 12446 13429 gene locus_tag LOCUS_19610 12446 13429 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_19610 14717 13494 gene locus_tag LOCUS_19620 14717 13494 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_19620 16168 14804 gene locus_tag LOCUS_19630 16168 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 17069 16215 gene locus_tag LOCUS_19640 17069 16215 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_19640 18660 17233 gene locus_tag LOCUS_19650 18660 17233 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 protein_id gnl|my_center|LOCUS_19650 19864 18713 gene locus_tag LOCUS_19660 19864 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 20197 20424 gene locus_tag LOCUS_19670 20197 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 20439 20846 gene locus_tag LOCUS_19680 20439 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 20962 21438 gene locus_tag LOCUS_19690 20962 21438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 21641 22732 gene locus_tag LOCUS_19700 21641 22732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 22782 23255 gene locus_tag LOCUS_19710 22782 23255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 23662 24807 gene locus_tag LOCUS_19720 23662 24807 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_19720 26598 24832 gene locus_tag LOCUS_19730 26598 24832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 26774 27955 gene locus_tag LOCUS_19740 gene anmK 26774 27955 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274964.1 protein_id gnl|my_center|LOCUS_19740 27952 28860 gene locus_tag LOCUS_19750 gene murQ 27952 28860 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121425.1 protein_id gnl|my_center|LOCUS_19750 28857 30344 gene locus_tag LOCUS_19760 28857 30344 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933713.1 protein_id gnl|my_center|LOCUS_19760 31841 30378 gene locus_tag LOCUS_19770 31841 30378 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_19770 33613 31850 gene locus_tag LOCUS_19780 33613 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 33827 34402 gene locus_tag LOCUS_19790 33827 34402 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_19790 35696 34440 gene locus_tag LOCUS_19800 35696 34440 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_19800 37138 35714 gene locus_tag LOCUS_19810 37138 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 38961 37204 gene locus_tag LOCUS_19820 38961 37204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 41263 39167 gene locus_tag LOCUS_19830 41263 39167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 42563 41433 gene locus_tag LOCUS_19840 42563 41433 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_19840 42825 47108 gene locus_tag LOCUS_19850 42825 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 48685 47150 gene locus_tag LOCUS_19860 48685 47150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 49975 48848 gene locus_tag LOCUS_19870 49975 48848 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_19870 51515 50091 gene locus_tag LOCUS_19880 51515 50091 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_19880 51758 53086 gene locus_tag LOCUS_19890 51758 53086 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_19890 53151 54170 gene locus_tag LOCUS_19900 53151 54170 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_19900 54182 55246 gene locus_tag LOCUS_19910 54182 55246 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_19910 55364 57556 gene locus_tag LOCUS_19920 55364 57556 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_19920 57800 58138 gene locus_tag LOCUS_19930 57800 58138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 59134 58349 gene locus_tag LOCUS_19940 59134 58349 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_19940 <60876 59176 gene locus_tag LOCUS_19950 <60876 59176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120422.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence0026 50 1087 gene locus_tag LOCUS_19960 50 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1140 1781 gene locus_tag LOCUS_19970 1140 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1783 2406 gene locus_tag LOCUS_19980 1783 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2403 3212 gene locus_tag LOCUS_19990 gene soj 2403 3212 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_19990 3216 4748 gene locus_tag LOCUS_20000 3216 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4956 6281 gene locus_tag LOCUS_20010 4956 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6662 6438 gene locus_tag LOCUS_20020 6662 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6920 7789 gene locus_tag LOCUS_20030 6920 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 7917 8150 gene locus_tag LOCUS_20040 gene rpmA 7917 8150 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_20040 8237 9232 gene locus_tag LOCUS_20050 gene obgE 8237 9232 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948349.1 protein_id gnl|my_center|LOCUS_20050 11496 9241 gene locus_tag LOCUS_20060 11496 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 12032 11499 gene locus_tag LOCUS_20070 12032 11499 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_20070 13271 12222 gene locus_tag LOCUS_20080 13271 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 13804 13268 gene locus_tag LOCUS_20090 13804 13268 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861377.1 protein_id gnl|my_center|LOCUS_20090 15206 13992 gene locus_tag LOCUS_20100 15206 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 15745 15203 gene locus_tag LOCUS_20110 15745 15203 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405461.1 protein_id gnl|my_center|LOCUS_20110 15919 16713 gene locus_tag LOCUS_20120 15919 16713 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_20120 16798 17958 gene locus_tag LOCUS_20130 gene mnmE 16798 17958 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_20130 17968 20595 gene locus_tag LOCUS_20140 gene mutS 17968 20595 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_20140 20585 21148 gene locus_tag LOCUS_20150 20585 21148 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941409.1 protein_id gnl|my_center|LOCUS_20150 21258 22067 gene locus_tag LOCUS_20160 21258 22067 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20160 22355 23833 gene locus_tag LOCUS_20170 22355 23833 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412099.1 protein_id gnl|my_center|LOCUS_20170 23909 24103 gene locus_tag LOCUS_20180 23909 24103 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023998.1 protein_id gnl|my_center|LOCUS_20180 24230 25405 gene locus_tag LOCUS_20190 24230 25405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 25422 26630 gene locus_tag LOCUS_20200 25422 26630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 26620 28131 gene locus_tag LOCUS_20210 26620 28131 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_20210 28273 29244 gene locus_tag LOCUS_20220 28273 29244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 29296 30177 gene locus_tag LOCUS_20230 gene prmC 29296 30177 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_20230 30396 30169 gene locus_tag LOCUS_20240 30396 30169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 31162 30458 gene locus_tag LOCUS_20250 31162 30458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 31938 31408 gene locus_tag LOCUS_20260 31938 31408 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_20260 32936 32067 gene locus_tag LOCUS_20270 32936 32067 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_20270 36332 33210 gene locus_tag LOCUS_20280 36332 33210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 37447 38628 gene locus_tag LOCUS_20290 37447 38628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 38664 39467 gene locus_tag LOCUS_20300 38664 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 39510 39896 gene locus_tag LOCUS_20310 39510 39896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 40051 41034 gene locus_tag LOCUS_20320 40051 41034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 41290 41069 gene locus_tag LOCUS_20330 41290 41069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 42946 41378 gene locus_tag LOCUS_20340 42946 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 43100 44173 gene locus_tag LOCUS_20350 gene ispG 43100 44173 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_20350 44177 44908 gene locus_tag LOCUS_20360 44177 44908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 46077 44932 gene locus_tag LOCUS_20370 46077 44932 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_20370 47406 46459 gene locus_tag LOCUS_20380 47406 46459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 47677 47423 gene locus_tag LOCUS_20390 47677 47423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 48206 47667 gene locus_tag LOCUS_20400 gene rpoE 48206 47667 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_20400 48572 49168 gene locus_tag LOCUS_20410 48572 49168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 49489 50973 gene locus_tag LOCUS_20420 49489 50973 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883612.1 protein_id gnl|my_center|LOCUS_20420 51225 51836 gene locus_tag LOCUS_20430 51225 51836 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_20430 52030 53238 gene locus_tag LOCUS_20440 52030 53238 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941677.1 protein_id gnl|my_center|LOCUS_20440 53338 53673 gene locus_tag LOCUS_20450 53338 53673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20450 53722 53928 gene locus_tag LOCUS_20460 53722 53928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20460 54872 54069 gene locus_tag LOCUS_20470 54872 54069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 55819 55004 gene locus_tag LOCUS_20480 55819 55004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0027 1952 522 gene locus_tag LOCUS_20490 gene glmM 1952 522 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_20490 3526 1937 gene locus_tag LOCUS_20500 gene serA 3526 1937 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_20500 4336 6099 gene locus_tag LOCUS_20510 4336 6099 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_20510 6167 7420 gene locus_tag LOCUS_20520 6167 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7472 8350 gene locus_tag LOCUS_20530 7472 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 8504 9343 gene locus_tag LOCUS_20540 8504 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 9380 9859 gene locus_tag LOCUS_20550 9380 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 9925 10767 gene locus_tag LOCUS_20560 9925 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 10775 11503 gene locus_tag LOCUS_20570 10775 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 11591 12634 gene locus_tag LOCUS_20580 11591 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 12645 15170 gene locus_tag LOCUS_20590 12645 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 15994 15179 gene locus_tag LOCUS_20600 15994 15179 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_20600 17899 16748 gene locus_tag LOCUS_20610 17899 16748 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_20610 19666 17930 gene locus_tag LOCUS_20620 19666 17930 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_20620 20968 19730 gene locus_tag LOCUS_20630 20968 19730 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_20630 21823 21005 gene locus_tag LOCUS_20640 21823 21005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289420.1 protein_id gnl|my_center|LOCUS_20640 22893 21859 gene locus_tag LOCUS_20650 gene gutB 22893 21859 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_20650 23802 23008 gene locus_tag LOCUS_20660 23802 23008 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_20660 24899 23829 gene locus_tag LOCUS_20670 gene ychF 24899 23829 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_20670 25118 25765 gene locus_tag LOCUS_20680 25118 25765 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_20680 26180 25851 gene locus_tag LOCUS_20690 gene rplU 26180 25851 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_20690 26343 27176 gene locus_tag LOCUS_20700 26343 27176 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460959.1 protein_id gnl|my_center|LOCUS_20700 33629 27222 gene locus_tag LOCUS_20710 33629 27222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 34036 38433 gene locus_tag LOCUS_20720 34036 38433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 39320 38583 gene locus_tag LOCUS_20730 39320 38583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 40668 39802 gene locus_tag LOCUS_20740 40668 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 41661 40855 gene locus_tag LOCUS_20750 41661 40855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 44563 42239 gene locus_tag LOCUS_20760 44563 42239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 46090 44642 gene locus_tag LOCUS_20770 46090 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 46981 46781 gene locus_tag LOCUS_20780 46981 46781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 49332 47002 gene locus_tag LOCUS_20790 49332 47002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 50045 49719 gene locus_tag LOCUS_20800 50045 49719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 53768 50964 gene locus_tag LOCUS_20810 53768 50964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence0028 462 1757 gene locus_tag LOCUS_20820 462 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1762 3444 gene locus_tag LOCUS_20830 1762 3444 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20830 3495 4949 gene locus_tag LOCUS_20840 3495 4949 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 protein_id gnl|my_center|LOCUS_20840 4924 6648 gene locus_tag LOCUS_20850 4924 6648 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20850 7867 6614 gene locus_tag LOCUS_20860 7867 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 9368 7893 gene locus_tag LOCUS_20870 9368 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 10655 9456 gene locus_tag LOCUS_20880 10655 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 13560 10678 gene locus_tag LOCUS_20890 13560 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 15202 13568 gene locus_tag LOCUS_20900 15202 13568 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_20900 16986 15199 gene locus_tag LOCUS_20910 16986 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 18622 17495 gene locus_tag LOCUS_20920 18622 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 19073 19001 gene locus_tag LOCUS_t00550 19073 19001 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19813 19307 gene locus_tag LOCUS_20930 19813 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 21047 19947 gene locus_tag LOCUS_20940 21047 19947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 21889 21050 gene locus_tag LOCUS_20950 21889 21050 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027145.1 protein_id gnl|my_center|LOCUS_20950 22945 21974 gene locus_tag LOCUS_20960 22945 21974 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733831.1 protein_id gnl|my_center|LOCUS_20960 24142 22961 gene locus_tag LOCUS_20970 24142 22961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_20970 24804 24139 gene locus_tag LOCUS_20980 24804 24139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_20980 26963 24801 gene locus_tag LOCUS_20990 26963 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 27826 26966 gene locus_tag LOCUS_21000 27826 26966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 29837 27921 gene locus_tag LOCUS_21010 29837 27921 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_21010 31537 30047 gene locus_tag LOCUS_21020 31537 30047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 32176 31685 gene locus_tag LOCUS_21030 32176 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 32577 32374 gene locus_tag LOCUS_21040 32577 32374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 33518 32961 gene locus_tag LOCUS_21050 33518 32961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 33844 35688 gene locus_tag LOCUS_21060 33844 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 38246 35868 gene locus_tag LOCUS_21070 38246 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 39916 38375 gene locus_tag LOCUS_21080 39916 38375 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_21080 40572 41246 gene locus_tag LOCUS_21090 gene lexA 40572 41246 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_21090 41579 43282 gene locus_tag LOCUS_21100 41579 43282 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_21100 43702 44907 gene locus_tag LOCUS_21110 gene preA 43702 44907 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_21110 44909 45703 gene locus_tag LOCUS_21120 44909 45703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 45905 46342 gene locus_tag LOCUS_21130 45905 46342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21130 49554 46618 gene locus_tag LOCUS_21140 49554 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 52664 49887 gene locus_tag LOCUS_21150 52664 49887 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033052029.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence0029 405 1316 gene locus_tag LOCUS_21160 405 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2046 1402 gene locus_tag LOCUS_21170 2046 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3108 2446 gene locus_tag LOCUS_21180 3108 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 4155 3172 gene locus_tag LOCUS_21190 4155 3172 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_21190 4550 5287 gene locus_tag LOCUS_21200 4550 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5361 8528 gene locus_tag LOCUS_21210 5361 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 8897 10729 gene locus_tag LOCUS_21220 8897 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 10801 11877 gene locus_tag LOCUS_21230 10801 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 12077 13126 gene locus_tag LOCUS_21240 12077 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 13175 14632 gene locus_tag LOCUS_21250 13175 14632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_21250 14694 15665 gene locus_tag LOCUS_21260 14694 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 15874 16731 gene locus_tag LOCUS_21270 gene panB 15874 16731 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869215.1 protein_id gnl|my_center|LOCUS_21270 16925 19099 gene locus_tag LOCUS_21280 16925 19099 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_21280 20903 19128 gene locus_tag LOCUS_21290 20903 19128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 22297 21287 gene locus_tag LOCUS_21300 22297 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 22991 22350 gene locus_tag LOCUS_21310 22991 22350 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_21310 24873 23068 gene locus_tag LOCUS_21320 24873 23068 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_21320 28205 24948 gene locus_tag LOCUS_21330 28205 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 28510 29952 gene locus_tag LOCUS_21340 28510 29952 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_21340 30011 31390 gene locus_tag LOCUS_21350 30011 31390 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_21350 31418 32644 gene locus_tag LOCUS_21360 gene larA 31418 32644 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_21360 32754 33719 gene locus_tag LOCUS_21370 gene gutB 32754 33719 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_21370 35282 33759 gene locus_tag LOCUS_21380 35282 33759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 36529 35282 gene locus_tag LOCUS_21390 36529 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 36881 38320 gene locus_tag LOCUS_21400 gene rsxC 36881 38320 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144393375.1 protein_id gnl|my_center|LOCUS_21400 38317 39435 gene locus_tag LOCUS_21410 38317 39435 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_21410 39425 40039 gene locus_tag LOCUS_21420 39425 40039 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_21420 40042 40707 gene locus_tag LOCUS_21430 40042 40707 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 protein_id gnl|my_center|LOCUS_21430 40707 41297 gene locus_tag LOCUS_21440 gene rsxA 40707 41297 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_21440 41307 42398 gene locus_tag LOCUS_21450 gene nqrF 41307 42398 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_21450 42488 42916 gene locus_tag LOCUS_21460 42488 42916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 42900 44249 gene locus_tag LOCUS_21470 42900 44249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 44887 44621 gene locus_tag LOCUS_21480 44887 44621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 44996 45715 gene locus_tag LOCUS_21490 44996 45715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 45724 46899 gene locus_tag LOCUS_21500 45724 46899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 47049 48422 gene locus_tag LOCUS_21510 47049 48422 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_21510 48440 49492 gene locus_tag LOCUS_21520 48440 49492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 49715 50113 gene locus_tag LOCUS_21530 49715 50113 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_21530 50117 52153 gene locus_tag LOCUS_21540 50117 52153 CDS product cytochrome c-type biogenesis CcmF C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938349.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence0030 347 538 gene locus_tag LOCUS_21550 347 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 539 1972 gene locus_tag LOCUS_21560 539 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 1999 2430 gene locus_tag LOCUS_21570 1999 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2442 8060 gene locus_tag LOCUS_21580 2442 8060 CDS product cadherin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258551.1 protein_id gnl|my_center|LOCUS_21580 8070 8528 gene locus_tag LOCUS_21590 8070 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8594 9283 gene locus_tag LOCUS_21600 8594 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 9514 11217 gene locus_tag LOCUS_21610 9514 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 11351 12616 gene locus_tag LOCUS_21620 11351 12616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 12628 12891 gene locus_tag LOCUS_21630 12628 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 12888 13112 gene locus_tag LOCUS_21640 12888 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 13117 13395 gene locus_tag LOCUS_21650 13117 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 13376 13567 gene locus_tag LOCUS_21660 13376 13567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 13740 13564 gene locus_tag LOCUS_21670 13740 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 13952 13770 gene locus_tag LOCUS_21680 13952 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 14332 13967 gene locus_tag LOCUS_21690 14332 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 14565 14344 gene locus_tag LOCUS_21700 14565 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 14959 14549 gene locus_tag LOCUS_21710 14959 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 15567 14956 gene locus_tag LOCUS_21720 15567 14956 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186873.1 protein_id gnl|my_center|LOCUS_21720 16379 15564 gene locus_tag LOCUS_21730 16379 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 16683 16381 gene locus_tag LOCUS_21740 16683 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 16958 16680 gene locus_tag LOCUS_21750 16958 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 17270 17001 gene locus_tag LOCUS_21760 17270 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 17576 17304 gene locus_tag LOCUS_21770 17576 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 18308 17670 gene locus_tag LOCUS_21780 18308 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 18823 18305 gene locus_tag LOCUS_21790 18823 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 18884 19162 gene locus_tag LOCUS_21800 18884 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 19186 19398 gene locus_tag LOCUS_21810 19186 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 19967 20167 gene locus_tag LOCUS_21820 19967 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 20186 20383 gene locus_tag LOCUS_21830 20186 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 20573 20767 gene locus_tag LOCUS_21840 20573 20767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 20776 21036 gene locus_tag LOCUS_21850 20776 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 21065 21298 gene locus_tag LOCUS_21860 21065 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 21390 21602 gene locus_tag LOCUS_21870 21390 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 21773 21997 gene locus_tag LOCUS_21880 21773 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 22001 22336 gene locus_tag LOCUS_21890 22001 22336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 22312 22539 gene locus_tag LOCUS_21900 22312 22539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 22727 23665 gene locus_tag LOCUS_21910 22727 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 23662 23817 gene locus_tag LOCUS_21920 23662 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 23817 24215 gene locus_tag LOCUS_21930 23817 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 24216 25385 gene locus_tag LOCUS_21940 24216 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 25584 25826 gene locus_tag LOCUS_21950 25584 25826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 26082 26327 gene locus_tag LOCUS_21960 26082 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 26311 26640 gene locus_tag LOCUS_21970 26311 26640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 27003 26752 gene locus_tag LOCUS_21980 27003 26752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 27264 27037 gene locus_tag LOCUS_21990 27264 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 27432 27277 gene locus_tag LOCUS_22000 27432 27277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 27758 27471 gene locus_tag LOCUS_22010 27758 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 28018 27776 gene locus_tag LOCUS_22020 28018 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 28179 28015 gene locus_tag LOCUS_22030 28179 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 28460 28200 gene locus_tag LOCUS_22040 28460 28200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 29048 28494 gene locus_tag LOCUS_22050 29048 28494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 29435 29118 gene locus_tag LOCUS_22060 29435 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 29784 29503 gene locus_tag LOCUS_22070 29784 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 30425 29859 gene locus_tag LOCUS_22080 30425 29859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 30991 30809 gene locus_tag LOCUS_22090 30991 30809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 31555 32100 gene locus_tag LOCUS_22100 31555 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 32114 32587 gene locus_tag LOCUS_22110 32114 32587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 33051 33209 gene locus_tag LOCUS_22120 33051 33209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 33214 33522 gene locus_tag LOCUS_22130 33214 33522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 33623 34042 gene locus_tag LOCUS_22140 33623 34042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 34370 34639 gene locus_tag LOCUS_22150 34370 34639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 34632 34793 gene locus_tag LOCUS_22160 34632 34793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 34783 35328 gene locus_tag LOCUS_22170 34783 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 35332 35793 gene locus_tag LOCUS_22180 35332 35793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 35794 36093 gene locus_tag LOCUS_22190 35794 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 36100 36312 gene locus_tag LOCUS_22200 36100 36312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 36313 37932 gene locus_tag LOCUS_22210 36313 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 37933 38169 gene locus_tag LOCUS_22220 37933 38169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 38166 38501 gene locus_tag LOCUS_22230 38166 38501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 38505 40358 gene locus_tag LOCUS_22240 38505 40358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 40358 40702 gene locus_tag LOCUS_22250 40358 40702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 40868 41608 gene locus_tag LOCUS_22260 40868 41608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 41862 42686 gene locus_tag LOCUS_22270 41862 42686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 42701 43603 gene locus_tag LOCUS_22280 42701 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 43725 44654 gene locus_tag LOCUS_22290 43725 44654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 44699 45187 gene locus_tag LOCUS_22300 44699 45187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 45184 46083 gene locus_tag LOCUS_22310 45184 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 46086 47624 gene locus_tag LOCUS_22320 46086 47624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 47687 47908 gene locus_tag LOCUS_22330 47687 47908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 47901 49100 gene locus_tag LOCUS_22340 47901 49100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 49113 50471 gene locus_tag LOCUS_22350 49113 50471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence0031 167 2158 gene locus_tag LOCUS_22360 167 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3019 6177 gene locus_tag LOCUS_22370 3019 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 6694 7935 gene locus_tag LOCUS_22380 6694 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 8252 9490 gene locus_tag LOCUS_22390 8252 9490 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975891.1 protein_id gnl|my_center|LOCUS_22390 9592 11715 gene locus_tag LOCUS_22400 9592 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12167 12421 gene locus_tag LOCUS_22410 12167 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 12438 13385 gene locus_tag LOCUS_22420 12438 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 15129 15806 gene locus_tag LOCUS_22430 15129 15806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922278.1 protein_id gnl|my_center|LOCUS_22430 15929 16588 gene locus_tag LOCUS_22440 15929 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 18490 16892 gene locus_tag LOCUS_22450 18490 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 19344 19784 gene locus_tag LOCUS_22460 19344 19784 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_22460 19785 23678 gene locus_tag LOCUS_22470 19785 23678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 23710 24888 gene locus_tag LOCUS_22480 23710 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 25753 27363 gene locus_tag LOCUS_22490 25753 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 31523 28374 gene locus_tag LOCUS_22500 31523 28374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 34664 31959 gene locus_tag LOCUS_22510 34664 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 38715 35539 gene locus_tag LOCUS_22520 38715 35539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 41030 39411 gene locus_tag LOCUS_22530 gene amrB 41030 39411 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_22530 41214 41032 gene locus_tag LOCUS_22540 41214 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 42158 41211 gene locus_tag LOCUS_22550 gene amrS 42158 41211 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_22550 42508 42323 gene locus_tag LOCUS_22560 42508 42323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 42628 43749 gene locus_tag LOCUS_22570 42628 43749 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_22570 44577 46223 gene locus_tag LOCUS_22580 44577 46223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 49163 46650 gene locus_tag LOCUS_22590 49163 46650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 49425 49234 gene locus_tag LOCUS_22600 49425 49234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence0032 2108 72 gene locus_tag LOCUS_22610 2108 72 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_22610 5305 2453 gene locus_tag LOCUS_22620 5305 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6317 5445 gene locus_tag LOCUS_22630 6317 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7614 7048 gene locus_tag LOCUS_22640 7614 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 9563 8187 gene locus_tag LOCUS_22650 9563 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 10726 9575 gene locus_tag LOCUS_22660 10726 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 11027 12739 gene locus_tag LOCUS_22670 11027 12739 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_22670 13031 13357 gene locus_tag LOCUS_22680 13031 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 13445 15559 gene locus_tag LOCUS_22690 13445 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 15810 15628 gene locus_tag LOCUS_22700 15810 15628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 15949 15800 gene locus_tag LOCUS_22710 15949 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 16003 17682 gene locus_tag LOCUS_22720 16003 17682 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_22720 17701 18390 gene locus_tag LOCUS_22730 17701 18390 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_22730 18428 19834 gene locus_tag LOCUS_22740 18428 19834 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_22740 19899 24209 gene locus_tag LOCUS_22750 19899 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 24283 26322 gene locus_tag LOCUS_22760 24283 26322 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_22760 26371 28545 gene locus_tag LOCUS_22770 26371 28545 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_22770 28669 29664 gene locus_tag LOCUS_22780 28669 29664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_22780 29970 30890 gene locus_tag LOCUS_22790 29970 30890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 32421 30958 gene locus_tag LOCUS_22800 32421 30958 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260568.1 protein_id gnl|my_center|LOCUS_22800 32380 32661 gene locus_tag LOCUS_22810 32380 32661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 33894 32752 gene locus_tag LOCUS_22820 gene gmuG 33894 32752 CDS product mannan endo-1,4-beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244107.1 protein_id gnl|my_center|LOCUS_22820 34780 34070 gene locus_tag LOCUS_22830 34780 34070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 35088 35843 gene locus_tag LOCUS_22840 35088 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 35840 36736 gene locus_tag LOCUS_22850 35840 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 36845 37099 gene locus_tag LOCUS_22860 36845 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 37523 38926 gene locus_tag LOCUS_22870 37523 38926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 39313 40449 gene locus_tag LOCUS_22880 39313 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 40622 40446 gene locus_tag LOCUS_22890 40622 40446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 40641 42074 gene locus_tag LOCUS_22900 40641 42074 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_22900 45279 42259 gene locus_tag LOCUS_22910 45279 42259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 45365 47278 gene locus_tag LOCUS_22920 45365 47278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 48758 47313 gene locus_tag LOCUS_22930 48758 47313 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_22930 49944 48808 gene locus_tag LOCUS_22940 49944 48808 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22940 >Feature sequence0033 1332 517 gene locus_tag LOCUS_22950 1332 517 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_22950 1589 3058 gene locus_tag LOCUS_22960 1589 3058 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121664.1 protein_id gnl|my_center|LOCUS_22960 3224 5080 gene locus_tag LOCUS_22970 3224 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5908 5120 gene locus_tag LOCUS_22980 5908 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7584 6118 gene locus_tag LOCUS_22990 7584 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 9027 7711 gene locus_tag LOCUS_23000 gene hflX 9027 7711 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_23000 9322 9504 gene locus_tag LOCUS_23010 gene rpsU 9322 9504 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_23010 11113 9617 gene locus_tag LOCUS_23020 11113 9617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12175 13074 gene locus_tag LOCUS_23030 12175 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 15211 13577 gene locus_tag LOCUS_23040 15211 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 15626 15285 gene locus_tag LOCUS_23050 15626 15285 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_23050 15863 15949 gene locus_tag LOCUS_t00560 15863 15949 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16135 17505 gene locus_tag LOCUS_23060 16135 17505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_23060 18659 17535 gene locus_tag LOCUS_23070 gene ugpC 18659 17535 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_23070 18872 19240 gene locus_tag LOCUS_23080 18872 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 22122 20494 gene locus_tag LOCUS_23090 22122 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 25008 24082 gene locus_tag LOCUS_23100 25008 24082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_23100 27247 25001 gene locus_tag LOCUS_23110 27247 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 29271 27280 gene locus_tag LOCUS_23120 29271 27280 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_23120 30206 29307 gene locus_tag LOCUS_23130 30206 29307 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_23130 31253 30228 gene locus_tag LOCUS_23140 31253 30228 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_23140 34252 31274 gene locus_tag LOCUS_23150 34252 31274 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922518.1 protein_id gnl|my_center|LOCUS_23150 36729 34249 gene locus_tag LOCUS_23160 36729 34249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 37757 36726 gene locus_tag LOCUS_23170 37757 36726 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714689.1 protein_id gnl|my_center|LOCUS_23170 39441 37777 gene locus_tag LOCUS_23180 39441 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 41070 39703 gene locus_tag LOCUS_23190 41070 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 41246 41929 gene locus_tag LOCUS_23200 41246 41929 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_23200 42110 43090 gene locus_tag LOCUS_23210 42110 43090 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330721.1 protein_id gnl|my_center|LOCUS_23210 43100 43822 gene locus_tag LOCUS_23220 43100 43822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 43842 45389 gene locus_tag LOCUS_23230 gene gguA 43842 45389 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080606.1 protein_id gnl|my_center|LOCUS_23230 45407 46384 gene locus_tag LOCUS_23240 45407 46384 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330724.1 protein_id gnl|my_center|LOCUS_23240 46408 47259 gene locus_tag LOCUS_23250 46408 47259 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_23250 47256 48224 gene locus_tag LOCUS_23260 47256 48224 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_23260 48225 49724 gene locus_tag LOCUS_23270 gene glpK 48225 49724 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0034 1119 262 gene locus_tag LOCUS_23280 1119 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2636 1353 gene locus_tag LOCUS_23290 gene larA 2636 1353 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_23290 3912 2641 gene locus_tag LOCUS_23300 3912 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4774 3953 gene locus_tag LOCUS_23310 gene fabG 4774 3953 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_23310 6605 4854 gene locus_tag LOCUS_23320 6605 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6752 8338 gene locus_tag LOCUS_23330 6752 8338 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663661.1 protein_id gnl|my_center|LOCUS_23330 8498 9229 gene locus_tag LOCUS_23340 8498 9229 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340751.1 protein_id gnl|my_center|LOCUS_23340 9301 10446 gene locus_tag LOCUS_23350 9301 10446 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_23350 10469 11929 gene locus_tag LOCUS_23360 10469 11929 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_23360 12053 13120 gene locus_tag LOCUS_23370 12053 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 13158 14510 gene locus_tag LOCUS_23380 13158 14510 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_23380 15444 14557 gene locus_tag LOCUS_23390 gene garR 15444 14557 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_23390 16571 15531 gene locus_tag LOCUS_23400 16571 15531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 19705 16745 gene locus_tag LOCUS_23410 19705 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 21021 19774 gene locus_tag LOCUS_23420 21021 19774 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_23420 23587 21053 gene locus_tag LOCUS_23430 23587 21053 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_23430 23858 25600 gene locus_tag LOCUS_23440 23858 25600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 26025 25654 gene locus_tag LOCUS_23450 26025 25654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23450 26897 26088 gene locus_tag LOCUS_23460 26897 26088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23460 28194 26938 gene locus_tag LOCUS_23470 28194 26938 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_23470 29754 28318 gene locus_tag LOCUS_23480 gene mttB 29754 28318 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_23480 31364 29868 gene locus_tag LOCUS_23490 31364 29868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 32854 31373 gene locus_tag LOCUS_23500 32854 31373 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_23500 33166 33831 gene locus_tag LOCUS_23510 33166 33831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 34725 33862 gene locus_tag LOCUS_23520 34725 33862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 34962 35747 gene locus_tag LOCUS_23530 34962 35747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 35763 36209 gene locus_tag LOCUS_23540 35763 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 36283 37719 gene locus_tag LOCUS_23550 36283 37719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 37789 38811 gene locus_tag LOCUS_23560 37789 38811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 40238 38877 gene locus_tag LOCUS_23570 40238 38877 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_23570 42317 40527 gene locus_tag LOCUS_23580 42317 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 42856 42314 gene locus_tag LOCUS_23590 42856 42314 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836263.1 protein_id gnl|my_center|LOCUS_23590 44971 43025 gene locus_tag LOCUS_23600 44971 43025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 46967 44988 gene locus_tag LOCUS_23610 46967 44988 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_23610 47078 48502 gene locus_tag LOCUS_23620 47078 48502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 48541 49623 gene locus_tag LOCUS_23630 48541 49623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence0035 2 448 gene locus_tag LOCUS_23640 2 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1904 477 gene locus_tag LOCUS_23650 1904 477 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_23650 2233 1931 gene locus_tag LOCUS_23660 2233 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2605 2303 gene locus_tag LOCUS_23670 2605 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4111 2873 gene locus_tag LOCUS_23680 4111 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5640 4138 gene locus_tag LOCUS_23690 5640 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 7016 5715 gene locus_tag LOCUS_23700 7016 5715 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_23700 8493 7045 gene locus_tag LOCUS_23710 8493 7045 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198931.1 protein_id gnl|my_center|LOCUS_23710 11006 8607 gene locus_tag LOCUS_23720 11006 8607 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_23720 11969 11031 gene locus_tag LOCUS_23730 11969 11031 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_23730 12414 11953 gene locus_tag LOCUS_23740 12414 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 13320 12523 gene locus_tag LOCUS_23750 13320 12523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 14128 15369 gene locus_tag LOCUS_23760 14128 15369 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_23760 15559 16596 gene locus_tag LOCUS_23770 gene waaC 15559 16596 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_23770 19486 16622 gene locus_tag LOCUS_23780 gene ileS 19486 16622 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546193.1 protein_id gnl|my_center|LOCUS_23780 20348 19566 gene locus_tag LOCUS_23790 20348 19566 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667426.1 protein_id gnl|my_center|LOCUS_23790 20837 20361 gene locus_tag LOCUS_23800 20837 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 21628 21122 gene locus_tag LOCUS_23810 21628 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 23559 21649 gene locus_tag LOCUS_23820 23559 21649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 23983 23615 gene locus_tag LOCUS_23830 23983 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 25703 24108 gene locus_tag LOCUS_23840 25703 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 26642 25932 gene locus_tag LOCUS_23850 gene deoC 26642 25932 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_23850 27012 26755 gene locus_tag LOCUS_23860 27012 26755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 28074 27103 gene locus_tag LOCUS_23870 28074 27103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 29032 28154 gene locus_tag LOCUS_23880 29032 28154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 31141 30050 gene locus_tag LOCUS_23890 31141 30050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 31645 31166 gene locus_tag LOCUS_23900 31645 31166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 32167 31904 gene locus_tag LOCUS_23910 32167 31904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 33037 32438 gene locus_tag LOCUS_23920 33037 32438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 33357 33139 gene locus_tag LOCUS_23930 33357 33139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 34164 36941 gene locus_tag LOCUS_23940 gene polA 34164 36941 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_23940 38469 37486 gene locus_tag LOCUS_23950 38469 37486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 42132 38746 gene locus_tag LOCUS_23960 42132 38746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 43852 42671 gene locus_tag LOCUS_23970 43852 42671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 46476 44407 gene locus_tag LOCUS_23980 46476 44407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 49542 47062 gene locus_tag LOCUS_23990 49542 47062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence0036 1832 1038 gene locus_tag LOCUS_24000 1832 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2707 1829 gene locus_tag LOCUS_24010 2707 1829 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_24010 3338 2736 gene locus_tag LOCUS_24020 3338 2736 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_24020 3504 4541 gene locus_tag LOCUS_24030 3504 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 4576 5571 gene locus_tag LOCUS_24040 gene trxB 4576 5571 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_24040 5737 6063 gene locus_tag LOCUS_24050 gene trxA 5737 6063 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022275.1 protein_id gnl|my_center|LOCUS_24050 6248 9571 gene locus_tag LOCUS_24060 6248 9571 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_24060 11144 9612 gene locus_tag LOCUS_24070 11144 9612 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_24070 11381 12289 gene locus_tag LOCUS_24080 11381 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 12420 14252 gene locus_tag LOCUS_24090 gene recJ 12420 14252 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_24090 15903 14269 gene locus_tag LOCUS_24100 15903 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16159 17610 gene locus_tag LOCUS_24110 16159 17610 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_24110 17913 17611 gene locus_tag LOCUS_24120 17913 17611 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_24120 18204 17923 gene locus_tag LOCUS_24130 18204 17923 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_24130 18422 19819 gene locus_tag LOCUS_24140 18422 19819 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_24140 19854 20993 gene locus_tag LOCUS_24150 gene mraY 19854 20993 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_24150 21357 22163 gene locus_tag LOCUS_24160 21357 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 22951 23355 gene locus_tag LOCUS_24170 22951 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 23694 23395 gene locus_tag LOCUS_24180 23694 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 25405 23777 gene locus_tag LOCUS_24190 gene groL 25405 23777 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_24190 25766 25476 gene locus_tag LOCUS_24200 gene groES 25766 25476 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_24200 26249 25824 gene locus_tag LOCUS_24210 26249 25824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 26562 28250 gene locus_tag LOCUS_24220 26562 28250 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764376.1 protein_id gnl|my_center|LOCUS_24220 30101 28419 gene locus_tag LOCUS_24230 30101 28419 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249724.1 protein_id gnl|my_center|LOCUS_24230 31125 30268 gene locus_tag LOCUS_24240 31125 30268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 31958 32902 gene locus_tag LOCUS_24250 31958 32902 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_24250 34272 32923 gene locus_tag LOCUS_24260 gene thrC 34272 32923 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_24260 35179 36861 gene locus_tag LOCUS_24270 35179 36861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 36888 38555 gene locus_tag LOCUS_24280 36888 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 39190 42192 gene locus_tag LOCUS_24290 39190 42192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 42411 42953 gene locus_tag LOCUS_24300 42411 42953 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_24300 42960 43547 gene locus_tag LOCUS_24310 42960 43547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 43528 44244 gene locus_tag LOCUS_24320 43528 44244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 44228 44902 gene locus_tag LOCUS_24330 44228 44902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 45100 45771 gene locus_tag LOCUS_24340 45100 45771 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_24340 45768 46502 gene locus_tag LOCUS_24350 45768 46502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 46483 47868 gene locus_tag LOCUS_24360 46483 47868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0037 264 986 gene locus_tag LOCUS_24370 264 986 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_24370 1330 2607 gene locus_tag LOCUS_24380 1330 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2847 3350 gene locus_tag LOCUS_24390 gene accB 2847 3350 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_24390 3454 4791 gene locus_tag LOCUS_24400 gene accC 3454 4791 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_24400 5353 5096 gene locus_tag LOCUS_24410 5353 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 7478 6201 gene locus_tag LOCUS_24420 gene lysA 7478 6201 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_24420 7901 7782 gene locus_tag LOCUS_24430 7901 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 8429 9070 gene locus_tag LOCUS_24440 gene nadD 8429 9070 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_24440 9750 9079 gene locus_tag LOCUS_24450 gene hypB 9750 9079 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_24450 10099 9755 gene locus_tag LOCUS_24460 10099 9755 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_24460 11121 10099 gene locus_tag LOCUS_24470 gene hypE 11121 10099 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810719.1 protein_id gnl|my_center|LOCUS_24470 12048 11125 gene locus_tag LOCUS_24480 gene hypD 12048 11125 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_24480 12501 12259 gene locus_tag LOCUS_24490 12501 12259 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_24490 14789 12570 gene locus_tag LOCUS_24500 gene hypF 14789 12570 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_24500 14985 15059 gene locus_tag LOCUS_t00570 14985 15059 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 15355 15098 gene locus_tag LOCUS_24510 15355 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 15754 15527 gene locus_tag LOCUS_24520 15754 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 16029 17438 gene locus_tag LOCUS_24530 16029 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 17475 18971 gene locus_tag LOCUS_24540 17475 18971 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_24540 19645 18983 gene locus_tag LOCUS_24550 19645 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 19923 20687 gene locus_tag LOCUS_24560 19923 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 21754 20711 gene locus_tag LOCUS_24570 21754 20711 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_24570 22960 21902 gene locus_tag LOCUS_24580 22960 21902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 23939 23007 gene locus_tag LOCUS_24590 23939 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 24117 27209 gene locus_tag LOCUS_24600 24117 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 27337 27855 gene locus_tag LOCUS_24610 27337 27855 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_24610 27926 28630 gene locus_tag LOCUS_24620 27926 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 28683 29597 gene locus_tag LOCUS_24630 28683 29597 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_24630 29639 30859 gene locus_tag LOCUS_24640 29639 30859 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_24640 30989 32503 gene locus_tag LOCUS_24650 30989 32503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_24650 35229 32617 gene locus_tag LOCUS_24660 35229 32617 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272644.1 protein_id gnl|my_center|LOCUS_24660 35543 36106 gene locus_tag LOCUS_24670 35543 36106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 36103 37917 gene locus_tag LOCUS_24680 gene for 36103 37917 CDS product tungsten-containing formaldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868317.1 protein_id gnl|my_center|LOCUS_24680 38100 39158 gene locus_tag LOCUS_24690 38100 39158 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087351.1 protein_id gnl|my_center|LOCUS_24690 41643 39244 gene locus_tag LOCUS_24700 41643 39244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 42020 42886 gene locus_tag LOCUS_24710 42020 42886 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_24710 43218 44624 gene locus_tag LOCUS_24720 43218 44624 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_24720 47593 44789 gene locus_tag LOCUS_24730 47593 44789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence0038 1998 1858 gene locus_tag LOCUS_24740 1998 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 2358 3257 gene locus_tag LOCUS_24750 2358 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3590 3808 gene locus_tag LOCUS_24760 3590 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 4452 3913 gene locus_tag LOCUS_24770 4452 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5791 4712 gene locus_tag LOCUS_24780 5791 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 6096 6407 gene locus_tag LOCUS_24790 6096 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 6662 7348 gene locus_tag LOCUS_24800 6662 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 7590 8582 gene locus_tag LOCUS_24810 7590 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 9373 8927 gene locus_tag LOCUS_24820 9373 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 10027 9473 gene locus_tag LOCUS_24830 10027 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 11993 10908 gene locus_tag LOCUS_24840 11993 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 12174 12788 gene locus_tag LOCUS_24850 12174 12788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 12788 15613 gene locus_tag LOCUS_24860 12788 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 17510 15669 gene locus_tag LOCUS_24870 17510 15669 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_24870 19451 17652 gene locus_tag LOCUS_24880 gene dnaG 19451 17652 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_24880 20810 19878 gene locus_tag LOCUS_24890 20810 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 22332 21931 gene locus_tag LOCUS_24900 22332 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 22791 22501 gene locus_tag LOCUS_24910 22791 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 23528 22929 gene locus_tag LOCUS_24920 23528 22929 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076362.1 protein_id gnl|my_center|LOCUS_24920 24633 23599 gene locus_tag LOCUS_24930 24633 23599 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970669.1 protein_id gnl|my_center|LOCUS_24930 24969 26363 gene locus_tag LOCUS_24940 24969 26363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 27202 26423 gene locus_tag LOCUS_24950 27202 26423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 28356 27247 gene locus_tag LOCUS_24960 28356 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 29792 28488 gene locus_tag LOCUS_24970 29792 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 30365 29949 gene locus_tag LOCUS_24980 30365 29949 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404560.1 protein_id gnl|my_center|LOCUS_24980 30803 30435 gene locus_tag LOCUS_24990 gene rplS 30803 30435 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_24990 32381 31053 gene locus_tag LOCUS_25000 32381 31053 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_25000 33514 32477 gene locus_tag LOCUS_25010 33514 32477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 35258 33828 gene locus_tag LOCUS_25020 35258 33828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 36701 35280 gene locus_tag LOCUS_25030 36701 35280 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_25030 37666 36971 gene locus_tag LOCUS_25040 gene trmD 37666 36971 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_25040 38699 37743 gene locus_tag LOCUS_25050 38699 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 39373 38999 gene locus_tag LOCUS_25060 39373 38999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 40956 39508 gene locus_tag LOCUS_25070 40956 39508 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_25070 42495 41053 gene locus_tag LOCUS_25080 gene ffh 42495 41053 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_25080 43184 46240 gene locus_tag LOCUS_25090 43184 46240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence0039 1801 179 gene locus_tag LOCUS_25100 1801 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3156 1957 gene locus_tag LOCUS_25110 3156 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3471 3319 gene locus_tag LOCUS_25120 3471 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3613 4293 gene locus_tag LOCUS_25130 3613 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4414 4938 gene locus_tag LOCUS_25140 4414 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 5873 6145 gene locus_tag LOCUS_25150 5873 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 6155 7294 gene locus_tag LOCUS_25160 6155 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 8713 7361 gene locus_tag LOCUS_25170 8713 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 9368 9201 gene locus_tag LOCUS_25180 9368 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 9928 9365 gene locus_tag LOCUS_25190 9928 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 10341 11003 gene locus_tag LOCUS_25200 10341 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 12052 11000 gene locus_tag LOCUS_25210 12052 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 12660 13271 gene locus_tag LOCUS_25220 12660 13271 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262220.1 protein_id gnl|my_center|LOCUS_25220 13283 15175 gene locus_tag LOCUS_25230 13283 15175 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070590.1 protein_id gnl|my_center|LOCUS_25230 15863 15243 gene locus_tag LOCUS_25240 15863 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 16874 15948 gene locus_tag LOCUS_25250 16874 15948 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679309.1 protein_id gnl|my_center|LOCUS_25250 17164 18300 gene locus_tag LOCUS_25260 17164 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 18601 18311 gene locus_tag LOCUS_25270 18601 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 19002 18604 gene locus_tag LOCUS_25280 19002 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 19327 20541 gene locus_tag LOCUS_25290 19327 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 21632 20595 gene locus_tag LOCUS_25300 21632 20595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 22066 21737 gene locus_tag LOCUS_25310 22066 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 22399 22091 gene locus_tag LOCUS_25320 22399 22091 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188824681.1 protein_id gnl|my_center|LOCUS_25320 22525 22710 gene locus_tag LOCUS_25330 22525 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 22697 22903 gene locus_tag LOCUS_25340 22697 22903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 23488 23195 gene locus_tag LOCUS_25350 23488 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 24150 23608 gene locus_tag LOCUS_25360 24150 23608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 24286 24660 gene locus_tag LOCUS_25370 24286 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 25342 24851 gene locus_tag LOCUS_25380 25342 24851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 25892 25416 gene locus_tag LOCUS_25390 25892 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 26544 26008 gene locus_tag LOCUS_25400 26544 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 26923 26492 gene locus_tag LOCUS_25410 26923 26492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 27098 27439 gene locus_tag LOCUS_25420 27098 27439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 28251 27451 gene locus_tag LOCUS_25430 28251 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 29060 28248 gene locus_tag LOCUS_25440 29060 28248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 30077 29163 gene locus_tag LOCUS_25450 30077 29163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 30173 31273 gene locus_tag LOCUS_25460 30173 31273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 31726 31313 gene locus_tag LOCUS_25470 31726 31313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 32604 31723 gene locus_tag LOCUS_25480 32604 31723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 33132 32791 gene locus_tag LOCUS_25490 33132 32791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 33743 33141 gene locus_tag LOCUS_25500 33743 33141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 33865 34533 gene locus_tag LOCUS_25510 33865 34533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 35386 34694 gene locus_tag LOCUS_25520 35386 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 36939 35443 gene locus_tag LOCUS_25530 36939 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 37973 37170 gene locus_tag LOCUS_25540 37973 37170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 38292 39452 gene locus_tag LOCUS_25550 38292 39452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 40887 39472 gene locus_tag LOCUS_25560 40887 39472 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070866.1 protein_id gnl|my_center|LOCUS_25560 41881 40880 gene locus_tag LOCUS_25570 41881 40880 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528495.1 protein_id gnl|my_center|LOCUS_25570 43397 41955 gene locus_tag LOCUS_25580 43397 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 43656 44453 gene locus_tag LOCUS_25590 43656 44453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 44697 45251 gene locus_tag LOCUS_25600 44697 45251 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_25600 45260 46921 gene locus_tag LOCUS_25610 45260 46921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence0040 316 2295 gene locus_tag LOCUS_25620 316 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2292 2651 gene locus_tag LOCUS_25630 2292 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2648 3013 gene locus_tag LOCUS_25640 2648 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3010 3405 gene locus_tag LOCUS_25650 3010 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 3332 4579 gene locus_tag LOCUS_25660 3332 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 4594 4986 gene locus_tag LOCUS_25670 4594 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 5281 7428 gene locus_tag LOCUS_25680 5281 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 7428 7811 gene locus_tag LOCUS_25690 7428 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 7808 11305 gene locus_tag LOCUS_25700 7808 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 11307 11621 gene locus_tag LOCUS_25710 11307 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 11921 11631 gene locus_tag LOCUS_25720 11921 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 13037 11928 gene locus_tag LOCUS_25730 13037 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 13477 13034 gene locus_tag LOCUS_25740 13477 13034 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003580735.1 protein_id gnl|my_center|LOCUS_25740 14579 13470 gene locus_tag LOCUS_25750 14579 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 15165 14572 gene locus_tag LOCUS_25760 gene yfbR 15165 14572 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706162.1 protein_id gnl|my_center|LOCUS_25760 17990 15162 gene locus_tag LOCUS_25770 gene dnaE 17990 15162 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880626.1 protein_id gnl|my_center|LOCUS_25770 18205 17987 gene locus_tag LOCUS_25780 18205 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 18753 18217 gene locus_tag LOCUS_25790 18753 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 19575 18766 gene locus_tag LOCUS_25800 19575 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 19925 19572 gene locus_tag LOCUS_25810 19925 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 21084 20257 gene locus_tag LOCUS_25820 21084 20257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 22047 21169 gene locus_tag LOCUS_25830 22047 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 23204 22044 gene locus_tag LOCUS_25840 23204 22044 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964273.1 protein_id gnl|my_center|LOCUS_25840 23392 23198 gene locus_tag LOCUS_25850 23392 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 23604 23407 gene locus_tag LOCUS_25860 23604 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 24097 23657 gene locus_tag LOCUS_25870 24097 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 24343 24134 gene locus_tag LOCUS_25880 24343 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 26025 24496 gene locus_tag LOCUS_25890 26025 24496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 26930 26070 gene locus_tag LOCUS_25900 26930 26070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 27418 26969 gene locus_tag LOCUS_25910 27418 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 27994 27707 gene locus_tag LOCUS_25920 27994 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 28313 28047 gene locus_tag LOCUS_25930 28313 28047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 28507 28319 gene locus_tag LOCUS_25940 28507 28319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 28855 28622 gene locus_tag LOCUS_25950 28855 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 29052 28852 gene locus_tag LOCUS_25960 29052 28852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 29218 29063 gene locus_tag LOCUS_25970 29218 29063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 29535 29221 gene locus_tag LOCUS_25980 29535 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 29822 29541 gene locus_tag LOCUS_25990 29822 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 30015 29824 gene locus_tag LOCUS_26000 30015 29824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 30313 30017 gene locus_tag LOCUS_26010 30313 30017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 30694 30317 gene locus_tag LOCUS_26020 30694 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 31331 31014 gene locus_tag LOCUS_26030 31331 31014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 32015 31518 gene locus_tag LOCUS_26040 32015 31518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 32843 32055 gene locus_tag LOCUS_26050 32843 32055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 33040 32819 gene locus_tag LOCUS_26060 33040 32819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 33446 33066 gene locus_tag LOCUS_26070 33446 33066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 33655 35871 gene locus_tag LOCUS_26080 33655 35871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 35899 36276 gene locus_tag LOCUS_26090 35899 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 36258 36740 gene locus_tag LOCUS_26100 36258 36740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 36727 37116 gene locus_tag LOCUS_26110 36727 37116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 37109 38392 gene locus_tag LOCUS_26120 37109 38392 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566296.1 protein_id gnl|my_center|LOCUS_26120 38393 39808 gene locus_tag LOCUS_26130 38393 39808 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267980.1 protein_id gnl|my_center|LOCUS_26130 39801 40166 gene locus_tag LOCUS_26140 39801 40166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 40159 41205 gene locus_tag LOCUS_26150 40159 41205 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207062.1 protein_id gnl|my_center|LOCUS_26150 41222 41974 gene locus_tag LOCUS_26160 41222 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 42292 43317 gene locus_tag LOCUS_26170 42292 43317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390337.1 protein_id gnl|my_center|LOCUS_26170 43381 43896 gene locus_tag LOCUS_26180 43381 43896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 43982 44557 gene locus_tag LOCUS_26190 43982 44557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 44718 44978 gene locus_tag LOCUS_26200 44718 44978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 44981 45448 gene locus_tag LOCUS_26210 44981 45448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 45455 45820 gene locus_tag LOCUS_26220 45455 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence0041 956 1942 gene locus_tag LOCUS_26230 956 1942 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_26230 2366 3595 gene locus_tag LOCUS_26240 2366 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4097 4663 gene locus_tag LOCUS_26250 4097 4663 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458818.1 protein_id gnl|my_center|LOCUS_26250 4754 5419 gene locus_tag LOCUS_26260 4754 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 7198 5837 gene locus_tag LOCUS_26270 7198 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 8911 7304 gene locus_tag LOCUS_26280 8911 7304 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_26280 9965 11398 gene locus_tag LOCUS_26290 9965 11398 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_26290 11398 13014 gene locus_tag LOCUS_26300 11398 13014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 13158 14228 gene locus_tag LOCUS_26310 13158 14228 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456695.1 protein_id gnl|my_center|LOCUS_26310 14396 16123 gene locus_tag LOCUS_26320 14396 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 16312 18222 gene locus_tag LOCUS_26330 16312 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 19711 18623 gene locus_tag LOCUS_26340 19711 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 19875 20492 gene locus_tag LOCUS_26350 19875 20492 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_26350 20489 23380 gene locus_tag LOCUS_26360 20489 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 23904 24245 gene locus_tag LOCUS_26370 23904 24245 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_26370 24292 26121 gene locus_tag LOCUS_26380 24292 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 28662 26434 gene locus_tag LOCUS_26390 28662 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 30790 29219 gene locus_tag LOCUS_26400 30790 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 32499 30817 gene locus_tag LOCUS_26410 32499 30817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 36947 32736 gene locus_tag LOCUS_26420 36947 32736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 37618 37040 gene locus_tag LOCUS_26430 37618 37040 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_26430 39504 38077 gene locus_tag LOCUS_26440 39504 38077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 41884 39725 gene locus_tag LOCUS_26450 41884 39725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 43270 42629 gene locus_tag LOCUS_26460 43270 42629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 45066 43606 gene locus_tag LOCUS_26470 45066 43606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence0042 2485 1583 gene locus_tag LOCUS_26480 2485 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 5908 2690 gene locus_tag LOCUS_26490 5908 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 7704 6151 gene locus_tag LOCUS_26500 7704 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 10397 7986 gene locus_tag LOCUS_26510 10397 7986 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_26510 13574 10854 gene locus_tag LOCUS_26520 13574 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 14613 13840 gene locus_tag LOCUS_26530 14613 13840 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_26530 14932 16497 gene locus_tag LOCUS_26540 14932 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 17156 18856 gene locus_tag LOCUS_26550 17156 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 19035 20354 gene locus_tag LOCUS_26560 19035 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 21000 23075 gene locus_tag LOCUS_26570 21000 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 25179 23515 gene locus_tag LOCUS_26580 25179 23515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 26083 28221 gene locus_tag LOCUS_26590 26083 28221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 31812 28618 gene locus_tag LOCUS_26600 31812 28618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 33810 31888 gene locus_tag LOCUS_26610 33810 31888 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082989.1 protein_id gnl|my_center|LOCUS_26610 35599 33929 gene locus_tag LOCUS_26620 35599 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 35858 36655 gene locus_tag LOCUS_26630 35858 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 36724 40881 gene locus_tag LOCUS_26640 36724 40881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 41670 43100 gene locus_tag LOCUS_26650 41670 43100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 43186 43992 gene locus_tag LOCUS_26660 43186 43992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence0043 517 1218 gene locus_tag LOCUS_26670 517 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1223 2716 gene locus_tag LOCUS_26680 1223 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2697 2624 gene locus_tag LOCUS_t00580 2697 2624 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3336 4991 gene locus_tag LOCUS_26690 3336 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 4936 5109 gene locus_tag LOCUS_26700 4936 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 5123 7174 gene locus_tag LOCUS_26710 5123 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 7149 7880 gene locus_tag LOCUS_26720 7149 7880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_26720 7942 9189 gene locus_tag LOCUS_26730 7942 9189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_26730 11389 9239 gene locus_tag LOCUS_26740 11389 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11727 16577 gene locus_tag LOCUS_26750 11727 16577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 17032 17289 gene locus_tag LOCUS_26760 17032 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 17289 18248 gene locus_tag LOCUS_26770 17289 18248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 20165 18297 gene locus_tag LOCUS_26780 20165 18297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 21694 20210 gene locus_tag LOCUS_26790 21694 20210 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_26790 21893 21687 gene locus_tag LOCUS_26800 21893 21687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 23825 21930 gene locus_tag LOCUS_26810 23825 21930 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_26810 26500 23903 gene locus_tag LOCUS_26820 26500 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_26820 29010 26509 gene locus_tag LOCUS_26830 29010 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 32383 29093 gene locus_tag LOCUS_26840 32383 29093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 33377 35278 gene locus_tag LOCUS_26850 33377 35278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 35371 41121 gene locus_tag LOCUS_26860 35371 41121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 42019 41204 gene locus_tag LOCUS_26870 42019 41204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 42672 44720 gene locus_tag LOCUS_26880 42672 44720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence0044 703 50 gene locus_tag LOCUS_26890 703 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1819 911 gene locus_tag LOCUS_26900 1819 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 2117 2785 gene locus_tag LOCUS_26910 2117 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 2928 3404 gene locus_tag LOCUS_26920 2928 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 3408 5096 gene locus_tag LOCUS_26930 3408 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 5120 6877 gene locus_tag LOCUS_26940 5120 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 6895 8187 gene locus_tag LOCUS_26950 6895 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 8197 9258 gene locus_tag LOCUS_26960 8197 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9335 10309 gene locus_tag LOCUS_26970 9335 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 10320 11864 gene locus_tag LOCUS_26980 10320 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 11878 12606 gene locus_tag LOCUS_26990 11878 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 12664 13251 gene locus_tag LOCUS_27000 12664 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 13262 14902 gene locus_tag LOCUS_27010 13262 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 14889 15827 gene locus_tag LOCUS_27020 14889 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 15814 16206 gene locus_tag LOCUS_27030 15814 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 16277 16789 gene locus_tag LOCUS_27040 16277 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 16789 17637 gene locus_tag LOCUS_27050 16789 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 17751 19097 gene locus_tag LOCUS_27060 17751 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 19111 20658 gene locus_tag LOCUS_27070 19111 20658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 20655 21392 gene locus_tag LOCUS_27080 20655 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 21482 21847 gene locus_tag LOCUS_27090 21482 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 21849 22223 gene locus_tag LOCUS_27100 21849 22223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 22379 22807 gene locus_tag LOCUS_27110 22379 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 22819 24459 gene locus_tag LOCUS_27120 22819 24459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 24459 25055 gene locus_tag LOCUS_27130 24459 25055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 25109 28276 gene locus_tag LOCUS_27140 25109 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 28366 29823 gene locus_tag LOCUS_27150 28366 29823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 29826 30671 gene locus_tag LOCUS_27160 29826 30671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 30728 32380 gene locus_tag LOCUS_27170 30728 32380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 32380 33615 gene locus_tag LOCUS_27180 32380 33615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 35064 33901 gene locus_tag LOCUS_27190 35064 33901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 36964 35066 gene locus_tag LOCUS_27200 36964 35066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 38084 37095 gene locus_tag LOCUS_27210 38084 37095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 39957 38089 gene locus_tag LOCUS_27220 39957 38089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 41700 39976 gene locus_tag LOCUS_27230 41700 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 42847 41714 gene locus_tag LOCUS_27240 42847 41714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 43136 42864 gene locus_tag LOCUS_27250 43136 42864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 <44306 43149 gene locus_tag LOCUS_27260 <44306 43149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073220.1:PilT/PilU family type 4a pilus ATPase >Feature sequence0045 5060 939 gene locus_tag LOCUS_27270 5060 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7163 5112 gene locus_tag LOCUS_27280 7163 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 7797 7594 gene locus_tag LOCUS_27290 7797 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 8047 9132 gene locus_tag LOCUS_27300 8047 9132 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_27300 9165 9947 gene locus_tag LOCUS_27310 9165 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 10742 13411 gene locus_tag LOCUS_27320 10742 13411 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_27320 14704 13742 gene locus_tag LOCUS_27330 14704 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 15142 15693 gene locus_tag LOCUS_27340 15142 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 16042 15812 gene locus_tag LOCUS_27350 16042 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 16566 16114 gene locus_tag LOCUS_27360 16566 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 16704 17084 gene locus_tag LOCUS_27370 16704 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 17591 17761 gene locus_tag LOCUS_27380 17591 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 18057 18392 gene locus_tag LOCUS_27390 18057 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 18665 18913 gene locus_tag LOCUS_27400 18665 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 19186 19761 gene locus_tag LOCUS_27410 19186 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 19859 20467 gene locus_tag LOCUS_27420 19859 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 22066 20495 gene locus_tag LOCUS_27430 22066 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 23002 22151 gene locus_tag LOCUS_27440 23002 22151 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529511.1 protein_id gnl|my_center|LOCUS_27440 23961 23092 gene locus_tag LOCUS_27450 23961 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 24773 24006 gene locus_tag LOCUS_27460 24773 24006 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_27460 25086 26081 gene locus_tag LOCUS_27470 gene prfB 25086 26081 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453255.1 protein_id gnl|my_center|LOCUS_27470 26100 27641 gene locus_tag LOCUS_27480 26100 27641 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_27480 27711 28295 gene locus_tag LOCUS_27490 gene folE 27711 28295 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_27490 28306 29118 gene locus_tag LOCUS_27500 28306 29118 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_27500 29366 30148 gene locus_tag LOCUS_27510 29366 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 30555 32945 gene locus_tag LOCUS_27520 30555 32945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 32980 34470 gene locus_tag LOCUS_27530 32980 34470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 34482 35756 gene locus_tag LOCUS_27540 34482 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 35878 37251 gene locus_tag LOCUS_27550 35878 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 37319 38476 gene locus_tag LOCUS_27560 37319 38476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 38496 39695 gene locus_tag LOCUS_27570 38496 39695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 39695 40906 gene locus_tag LOCUS_27580 39695 40906 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257995.1 protein_id gnl|my_center|LOCUS_27580 40903 41520 gene locus_tag LOCUS_27590 40903 41520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 42701 41529 gene locus_tag LOCUS_27600 42701 41529 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_27600 42912 43538 gene locus_tag LOCUS_27610 42912 43538 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence0046 170 2026 gene locus_tag LOCUS_27620 gene typA 170 2026 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_27620 2098 3894 gene locus_tag LOCUS_27630 gene lepA 2098 3894 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583469.1 protein_id gnl|my_center|LOCUS_27630 4125 5507 gene locus_tag LOCUS_27640 gene mgtE 4125 5507 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_27640 6030 5575 gene locus_tag LOCUS_27650 6030 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 6402 7535 gene locus_tag LOCUS_27660 6402 7535 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_27660 7554 9200 gene locus_tag LOCUS_27670 7554 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 9266 10432 gene locus_tag LOCUS_27680 9266 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 10782 10633 gene locus_tag LOCUS_27690 10782 10633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 12109 11138 gene locus_tag LOCUS_27700 12109 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 14010 12568 gene locus_tag LOCUS_27710 14010 12568 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_27710 14347 16557 gene locus_tag LOCUS_27720 14347 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 16975 16838 gene locus_tag LOCUS_27730 16975 16838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 17139 18974 gene locus_tag LOCUS_27740 17139 18974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 20501 19023 gene locus_tag LOCUS_27750 20501 19023 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_27750 23704 20645 gene locus_tag LOCUS_27760 23704 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 24777 23866 gene locus_tag LOCUS_27770 24777 23866 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_27770 25055 27694 gene locus_tag LOCUS_27780 25055 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 29077 27716 gene locus_tag LOCUS_27790 29077 27716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 30509 29112 gene locus_tag LOCUS_27800 30509 29112 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_27800 32247 30544 gene locus_tag LOCUS_27810 32247 30544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 32590 34002 gene locus_tag LOCUS_27820 32590 34002 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_27820 35347 34055 gene locus_tag LOCUS_27830 35347 34055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 36719 35349 gene locus_tag LOCUS_27840 36719 35349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_27840 36935 38581 gene locus_tag LOCUS_27850 36935 38581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 38776 40131 gene locus_tag LOCUS_27860 38776 40131 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_27860 40172 41194 gene locus_tag LOCUS_27870 40172 41194 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_27870 42550 41237 gene locus_tag LOCUS_27880 42550 41237 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence0047 1368 1571 gene locus_tag LOCUS_27890 1368 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 2264 2082 gene locus_tag LOCUS_27900 2264 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2677 5376 gene locus_tag LOCUS_27910 2677 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 5373 8072 gene locus_tag LOCUS_27920 5373 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 8085 8528 gene locus_tag LOCUS_27930 8085 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 8538 9095 gene locus_tag LOCUS_27940 8538 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 9285 9569 gene locus_tag LOCUS_27950 9285 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27950 9627 11255 gene locus_tag LOCUS_27960 9627 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27960 11252 12709 gene locus_tag LOCUS_27970 11252 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 12673 14622 gene locus_tag LOCUS_27980 12673 14622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 14686 14868 gene locus_tag LOCUS_27990 14686 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 15530 17392 gene locus_tag LOCUS_28000 15530 17392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 18303 18127 gene locus_tag LOCUS_28010 18303 18127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 18601 19680 gene locus_tag LOCUS_28020 18601 19680 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722895.1 protein_id gnl|my_center|LOCUS_28020 19983 21935 gene locus_tag LOCUS_28030 19983 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 22428 23006 gene locus_tag LOCUS_28040 22428 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 23549 23971 gene locus_tag LOCUS_28050 23549 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 25675 24413 gene locus_tag LOCUS_28060 25675 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 26245 27498 gene locus_tag LOCUS_28070 26245 27498 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990661.1 protein_id gnl|my_center|LOCUS_28070 27775 27575 gene locus_tag LOCUS_28080 27775 27575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 28237 28479 gene locus_tag LOCUS_28090 28237 28479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 28581 29420 gene locus_tag LOCUS_28100 28581 29420 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485222.1 protein_id gnl|my_center|LOCUS_28100 29417 30325 gene locus_tag LOCUS_28110 29417 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 31241 30465 gene locus_tag LOCUS_28120 31241 30465 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_28120 31970 31725 gene locus_tag LOCUS_28130 31970 31725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 32810 33916 gene locus_tag LOCUS_28140 32810 33916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 36146 33999 gene locus_tag LOCUS_28150 36146 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 38397 36286 gene locus_tag LOCUS_28160 38397 36286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 39201 39740 gene locus_tag LOCUS_28170 39201 39740 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_28170 39900 41027 gene locus_tag LOCUS_28180 39900 41027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 41812 42264 gene locus_tag LOCUS_28190 41812 42264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence0048 2408 3031 gene locus_tag LOCUS_28200 2408 3031 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_28200 3031 4062 gene locus_tag LOCUS_28210 3031 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 5219 4149 gene locus_tag LOCUS_28220 5219 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 5759 5238 gene locus_tag LOCUS_28230 5759 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6344 5778 gene locus_tag LOCUS_28240 6344 5778 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_28240 7270 6566 gene locus_tag LOCUS_28250 7270 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28250 9478 7370 gene locus_tag LOCUS_28260 9478 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 10571 9618 gene locus_tag LOCUS_28270 gene queG 10571 9618 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813933.1 protein_id gnl|my_center|LOCUS_28270 10819 11850 gene locus_tag LOCUS_28280 10819 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 11856 12791 gene locus_tag LOCUS_28290 11856 12791 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_28290 12815 14302 gene locus_tag LOCUS_28300 12815 14302 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_28300 14398 15096 gene locus_tag LOCUS_28310 gene kdsB 14398 15096 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_28310 15083 16267 gene locus_tag LOCUS_28320 15083 16267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 16309 17469 gene locus_tag LOCUS_28330 16309 17469 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_28330 17545 20274 gene locus_tag LOCUS_28340 17545 20274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 20807 20289 gene locus_tag LOCUS_28350 20807 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 21996 20875 gene locus_tag LOCUS_28360 21996 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 22945 22046 gene locus_tag LOCUS_28370 22945 22046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 23183 24121 gene locus_tag LOCUS_28380 23183 24121 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_28380 25403 24183 gene locus_tag LOCUS_28390 25403 24183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_28390 26620 25478 gene locus_tag LOCUS_28400 26620 25478 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_28400 27729 26692 gene locus_tag LOCUS_28410 27729 26692 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_28410 28586 28014 gene locus_tag LOCUS_28420 28586 28014 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_28420 29975 28635 gene locus_tag LOCUS_28430 29975 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 31237 30146 gene locus_tag LOCUS_28440 31237 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 32197 31556 gene locus_tag LOCUS_28450 32197 31556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 33235 32438 gene locus_tag LOCUS_28460 gene trpA 33235 32438 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_28460 34450 33272 gene locus_tag LOCUS_28470 gene trpB 34450 33272 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_28470 35097 34474 gene locus_tag LOCUS_28480 35097 34474 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_28480 36171 35125 gene locus_tag LOCUS_28490 gene trpD 36171 35125 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_28490 36784 36179 gene locus_tag LOCUS_28500 36784 36179 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693974.1 protein_id gnl|my_center|LOCUS_28500 38445 36853 gene locus_tag LOCUS_28510 38445 36853 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 protein_id gnl|my_center|LOCUS_28510 39765 38761 gene locus_tag LOCUS_28520 39765 38761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_28520 41303 39762 gene locus_tag LOCUS_28530 41303 39762 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_28530 42307 41288 gene locus_tag LOCUS_28540 42307 41288 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence0049 1255 362 gene locus_tag LOCUS_28550 gene folD 1255 362 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_28550 3089 1326 gene locus_tag LOCUS_28560 3089 1326 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_28560 4129 3302 gene locus_tag LOCUS_28570 4129 3302 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_28570 5146 4193 gene locus_tag LOCUS_28580 gene cdhD 5146 4193 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_28580 5938 5201 gene locus_tag LOCUS_28590 5938 5201 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_28590 7885 5966 gene locus_tag LOCUS_28600 7885 5966 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_28600 9294 7957 gene locus_tag LOCUS_28610 gene acsC 9294 7957 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_28610 11564 9378 gene locus_tag LOCUS_28620 gene acsB 11564 9378 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418359.1 protein_id gnl|my_center|LOCUS_28620 13554 11620 gene locus_tag LOCUS_28630 gene cooS 13554 11620 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_28630 14505 13663 gene locus_tag LOCUS_28640 14505 13663 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_28640 15251 14646 gene locus_tag LOCUS_28650 15251 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 16429 15299 gene locus_tag LOCUS_28660 16429 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 17540 16431 gene locus_tag LOCUS_28670 gene wtpC 17540 16431 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_28670 18330 17524 gene locus_tag LOCUS_28680 gene wtpB 18330 17524 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_28680 19325 18327 gene locus_tag LOCUS_28690 gene wtpA 19325 18327 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867274.1 protein_id gnl|my_center|LOCUS_28690 19681 19322 gene locus_tag LOCUS_28700 19681 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 19895 19695 gene locus_tag LOCUS_28710 19895 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 23010 20128 gene locus_tag LOCUS_28720 23010 20128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 23954 23106 gene locus_tag LOCUS_28730 23954 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 24381 23959 gene locus_tag LOCUS_28740 24381 23959 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_28740 25616 24378 gene locus_tag LOCUS_28750 25616 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 26200 26430 gene locus_tag LOCUS_28760 26200 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 28279 26480 gene locus_tag LOCUS_28770 28279 26480 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_28770 29982 28699 gene locus_tag LOCUS_28780 29982 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 30790 30341 gene locus_tag LOCUS_28790 30790 30341 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125527.1 protein_id gnl|my_center|LOCUS_28790 31823 31005 gene locus_tag LOCUS_28800 31823 31005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682019.1 protein_id gnl|my_center|LOCUS_28800 32851 31820 gene locus_tag LOCUS_28810 32851 31820 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_28810 33752 32856 gene locus_tag LOCUS_28820 33752 32856 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_28820 35599 33752 gene locus_tag LOCUS_28830 gene mutL 35599 33752 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_28830 36085 35726 gene locus_tag LOCUS_28840 36085 35726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 37702 36128 gene locus_tag LOCUS_28850 gene gpmI 37702 36128 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541097.1 protein_id gnl|my_center|LOCUS_28850 38539 37859 gene locus_tag LOCUS_28860 38539 37859 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_28860 39254 38559 gene locus_tag LOCUS_28870 gene queC 39254 38559 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_28870 40700 39258 gene locus_tag LOCUS_28880 40700 39258 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_28880 40933 41286 gene locus_tag LOCUS_28890 gene queF 40933 41286 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_28890 41375 41896 gene locus_tag LOCUS_28900 41375 41896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence0050 639 2594 gene locus_tag LOCUS_28910 gene dnaK 639 2594 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_28910 4124 2703 gene locus_tag LOCUS_28920 gene mnmE 4124 2703 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_28920 6313 4178 gene locus_tag LOCUS_28930 6313 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 7153 6377 gene locus_tag LOCUS_28940 7153 6377 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_28940 7457 8206 gene locus_tag LOCUS_28950 gene lptB 7457 8206 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_28950 8219 8731 gene locus_tag LOCUS_28960 gene def 8219 8731 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940621.1 protein_id gnl|my_center|LOCUS_28960 8824 9777 gene locus_tag LOCUS_28970 gene fmt 8824 9777 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_28970 9781 11142 gene locus_tag LOCUS_28980 gene rsmB 9781 11142 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965032.1 protein_id gnl|my_center|LOCUS_28980 11513 12967 gene locus_tag LOCUS_28990 gene dnaA 11513 12967 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_28990 14471 12999 gene locus_tag LOCUS_29000 14471 12999 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_29000 14742 14392 gene locus_tag LOCUS_29010 14742 14392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 14813 15967 gene locus_tag LOCUS_29020 14813 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 16947 16027 gene locus_tag LOCUS_29030 16947 16027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 18364 16988 gene locus_tag LOCUS_29040 18364 16988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_29040 18744 20174 gene locus_tag LOCUS_29050 18744 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 20463 23522 gene locus_tag LOCUS_29060 20463 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 25255 23573 gene locus_tag LOCUS_29070 25255 23573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 26234 25368 gene locus_tag LOCUS_29080 26234 25368 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_29080 28287 26293 gene locus_tag LOCUS_29090 gene dxs 28287 26293 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_29090 30614 30805 gene locus_tag LOCUS_29100 30614 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 30880 32070 gene locus_tag LOCUS_29110 30880 32070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 32238 32891 gene locus_tag LOCUS_29120 32238 32891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 33174 33893 gene locus_tag LOCUS_29130 33174 33893 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_29130 35849 34962 gene locus_tag LOCUS_29140 35849 34962 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_29140 35958 36869 gene locus_tag LOCUS_29150 gene miaA 35958 36869 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_29150 37356 36928 gene locus_tag LOCUS_29160 37356 36928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 37578 38582 gene locus_tag LOCUS_29170 37578 38582 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_29170 39526 38942 gene locus_tag LOCUS_29180 39526 38942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 40042 39551 gene locus_tag LOCUS_29190 gene nrdR 40042 39551 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327006.1 protein_id gnl|my_center|LOCUS_29190 40795 40508 gene locus_tag LOCUS_29200 40795 40508 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403775.1 protein_id gnl|my_center|LOCUS_29200 41537 40785 gene locus_tag LOCUS_29210 41537 40785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0051 950 1231 gene locus_tag LOCUS_29220 950 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1339 9384 gene locus_tag LOCUS_29230 1339 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 9398 13987 gene locus_tag LOCUS_29240 9398 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 14013 19619 gene locus_tag LOCUS_29250 14013 19619 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141952.1 protein_id gnl|my_center|LOCUS_29250 19702 24582 gene locus_tag LOCUS_29260 19702 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 24595 28785 gene locus_tag LOCUS_29270 24595 28785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 28888 30162 gene locus_tag LOCUS_29280 28888 30162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015207390.1 protein_id gnl|my_center|LOCUS_29280 30159 32294 gene locus_tag LOCUS_29290 30159 32294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 32317 33291 gene locus_tag LOCUS_29300 32317 33291 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112595.1 protein_id gnl|my_center|LOCUS_29300 >Feature sequence0052 2064 748 gene locus_tag LOCUS_29310 2064 748 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_29310 4097 2289 gene locus_tag LOCUS_29320 4097 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 5499 4267 gene locus_tag LOCUS_29330 5499 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6038 5496 gene locus_tag LOCUS_29340 6038 5496 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 protein_id gnl|my_center|LOCUS_29340 6796 6245 gene locus_tag LOCUS_29350 6796 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 7589 7296 gene locus_tag LOCUS_29360 7589 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 9040 7799 gene locus_tag LOCUS_29370 9040 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 9582 9037 gene locus_tag LOCUS_29380 9582 9037 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_29380 10620 9787 gene locus_tag LOCUS_29390 10620 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 11155 10607 gene locus_tag LOCUS_29400 11155 10607 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222410.1 protein_id gnl|my_center|LOCUS_29400 13998 11344 gene locus_tag LOCUS_29410 13998 11344 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_29410 15957 14149 gene locus_tag LOCUS_29420 15957 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 17173 16100 gene locus_tag LOCUS_29430 17173 16100 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603918.1 protein_id gnl|my_center|LOCUS_29430 18192 17173 gene locus_tag LOCUS_29440 18192 17173 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_29440 18584 20095 gene locus_tag LOCUS_29450 gene cobA 18584 20095 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_29450 20160 21134 gene locus_tag LOCUS_29460 gene hemB 20160 21134 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_29460 23705 21243 gene locus_tag LOCUS_29470 23705 21243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 24452 24033 gene locus_tag LOCUS_29480 gene hisI 24452 24033 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400419.1 protein_id gnl|my_center|LOCUS_29480 24555 25610 gene locus_tag LOCUS_29490 24555 25610 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_29490 25709 26422 gene locus_tag LOCUS_29500 25709 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 26471 26794 gene locus_tag LOCUS_29510 26471 26794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 26865 27344 gene locus_tag LOCUS_29520 26865 27344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 27390 27698 gene locus_tag LOCUS_29530 27390 27698 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_29530 27729 29468 gene locus_tag LOCUS_29540 gene ptsP 27729 29468 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_29540 30344 29568 gene locus_tag LOCUS_29550 30344 29568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021804.1 protein_id gnl|my_center|LOCUS_29550 30912 30346 gene locus_tag LOCUS_29560 30912 30346 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_29560 31824 32351 gene locus_tag LOCUS_29570 31824 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 32426 33952 gene locus_tag LOCUS_29580 32426 33952 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_29580 34020 34997 gene locus_tag LOCUS_29590 34020 34997 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_29590 35070 35585 gene locus_tag LOCUS_29600 35070 35585 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_29600 35608 37806 gene locus_tag LOCUS_29610 35608 37806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 <38370 37868 gene locus_tag LOCUS_29620 <38370 37868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942483.1:HAD family phosphatase >Feature sequence0053 1392 94 gene locus_tag LOCUS_29630 1392 94 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_29630 2794 1418 gene locus_tag LOCUS_29640 2794 1418 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_29640 3086 3850 gene locus_tag LOCUS_29650 3086 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 5492 4431 gene locus_tag LOCUS_29660 gene mtnA 5492 4431 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_29660 6623 5523 gene locus_tag LOCUS_29670 6623 5523 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_29670 8626 6671 gene locus_tag LOCUS_29680 8626 6671 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_29680 10230 8752 gene locus_tag LOCUS_29690 10230 8752 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_29690 11043 10258 gene locus_tag LOCUS_29700 11043 10258 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037291.1 protein_id gnl|my_center|LOCUS_29700 11850 11053 gene locus_tag LOCUS_29710 11850 11053 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_29710 14510 11871 gene locus_tag LOCUS_29720 14510 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 17586 14734 gene locus_tag LOCUS_29730 gene uvrA 17586 14734 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_29730 17710 18399 gene locus_tag LOCUS_29740 gene nfi 17710 18399 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_29740 19053 18430 gene locus_tag LOCUS_29750 19053 18430 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943932.1 protein_id gnl|my_center|LOCUS_29750 20154 19123 gene locus_tag LOCUS_29760 20154 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 21072 20266 gene locus_tag LOCUS_29770 gene lpxA 21072 20266 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_29770 21619 21158 gene locus_tag LOCUS_29780 gene fabZ 21619 21158 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723457.1 protein_id gnl|my_center|LOCUS_29780 22432 21629 gene locus_tag LOCUS_29790 gene lpxC 22432 21629 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_29790 23501 22440 gene locus_tag LOCUS_29800 gene lpxD 23501 22440 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_29800 24322 23717 gene locus_tag LOCUS_29810 24322 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 26588 24399 gene locus_tag LOCUS_29820 26588 24399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 28052 26592 gene locus_tag LOCUS_29830 28052 26592 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_29830 29341 28337 gene locus_tag LOCUS_29840 29341 28337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 29479 29345 gene locus_tag LOCUS_29850 29479 29345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 30709 29501 gene locus_tag LOCUS_29860 30709 29501 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_29860 31026 34259 gene locus_tag LOCUS_29870 31026 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 34278 37565 gene locus_tag LOCUS_29880 34278 37565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence0054 566 402 gene locus_tag LOCUS_29890 566 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 1321 647 gene locus_tag LOCUS_29900 1321 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1820 1593 gene locus_tag LOCUS_29910 1820 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2276 2052 gene locus_tag LOCUS_29920 2276 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3087 2431 gene locus_tag LOCUS_29930 3087 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 3939 4106 gene locus_tag LOCUS_29940 3939 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 4361 5401 gene locus_tag LOCUS_29950 4361 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 5649 5909 gene locus_tag LOCUS_29960 5649 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 6310 8292 gene locus_tag LOCUS_29970 6310 8292 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941642.1 protein_id gnl|my_center|LOCUS_29970 8305 8817 gene locus_tag LOCUS_29980 8305 8817 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_29980 8817 9656 gene locus_tag LOCUS_29990 8817 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9671 10972 gene locus_tag LOCUS_30000 9671 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 10972 12015 gene locus_tag LOCUS_30010 10972 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 12012 13343 gene locus_tag LOCUS_30020 12012 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 13330 13560 gene locus_tag LOCUS_30030 13330 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 13557 14234 gene locus_tag LOCUS_30040 13557 14234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 14272 14577 gene locus_tag LOCUS_30050 14272 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 14574 15695 gene locus_tag LOCUS_30060 14574 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 15698 16555 gene locus_tag LOCUS_30070 15698 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 16566 16964 gene locus_tag LOCUS_30080 16566 16964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 16957 18171 gene locus_tag LOCUS_30090 16957 18171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 18168 22307 gene locus_tag LOCUS_30100 18168 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 22304 25315 gene locus_tag LOCUS_30110 22304 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 25338 29789 gene locus_tag LOCUS_30120 25338 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 29792 30979 gene locus_tag LOCUS_30130 29792 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 31288 33255 gene locus_tag LOCUS_30140 31288 33255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 33416 35524 gene locus_tag LOCUS_30150 33416 35524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 35721 37205 gene locus_tag LOCUS_30160 35721 37205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0055 65 772 gene locus_tag LOCUS_30170 65 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1365 1916 gene locus_tag LOCUS_30180 1365 1916 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_30180 2828 2019 gene locus_tag LOCUS_30190 2828 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3280 2957 gene locus_tag LOCUS_30200 3280 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 4642 3347 gene locus_tag LOCUS_30210 4642 3347 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_30210 5199 4705 gene locus_tag LOCUS_30220 gene ybeY 5199 4705 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 protein_id gnl|my_center|LOCUS_30220 6323 5217 gene locus_tag LOCUS_30230 6323 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 7745 6804 gene locus_tag LOCUS_30240 7745 6804 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_30240 8615 7758 gene locus_tag LOCUS_30250 8615 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 9457 8699 gene locus_tag LOCUS_30260 9457 8699 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_30260 10790 9516 gene locus_tag LOCUS_30270 10790 9516 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940462.1 protein_id gnl|my_center|LOCUS_30270 11341 10862 gene locus_tag LOCUS_30280 11341 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 12125 11361 gene locus_tag LOCUS_30290 12125 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_30290 14867 12381 gene locus_tag LOCUS_30300 14867 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 15255 14899 gene locus_tag LOCUS_30310 15255 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 15605 16477 gene locus_tag LOCUS_30320 15605 16477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 16492 16632 gene locus_tag LOCUS_30330 16492 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 17165 16656 gene locus_tag LOCUS_30340 17165 16656 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930816.1 protein_id gnl|my_center|LOCUS_30340 18243 17251 gene locus_tag LOCUS_30350 18243 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 19303 18281 gene locus_tag LOCUS_30360 19303 18281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 19494 21161 gene locus_tag LOCUS_30370 gene ilvD 19494 21161 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255814.1 protein_id gnl|my_center|LOCUS_30370 21216 21896 gene locus_tag LOCUS_30380 21216 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 21963 22529 gene locus_tag LOCUS_30390 21963 22529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 22645 22959 gene locus_tag LOCUS_30400 22645 22959 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_30400 22956 23336 gene locus_tag LOCUS_30410 22956 23336 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869637.1 protein_id gnl|my_center|LOCUS_30410 23790 24227 gene locus_tag LOCUS_30420 23790 24227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 25171 24224 gene locus_tag LOCUS_30430 25171 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 26119 25181 gene locus_tag LOCUS_30440 26119 25181 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_30440 27017 26136 gene locus_tag LOCUS_30450 gene murB 27017 26136 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_30450 28473 26983 gene locus_tag LOCUS_30460 gene murC 28473 26983 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_30460 30965 28716 gene locus_tag LOCUS_30470 30965 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 31823 31653 gene locus_tag LOCUS_30480 31823 31653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 31974 32753 gene locus_tag LOCUS_30490 31974 32753 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583636.1 protein_id gnl|my_center|LOCUS_30490 32940 33938 gene locus_tag LOCUS_30500 32940 33938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 35393 33999 gene locus_tag LOCUS_30510 35393 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 <36803 35419 gene locus_tag LOCUS_30520 <36803 35419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640121.1:acylase >Feature sequence0056 704 1486 gene locus_tag LOCUS_30530 gene garL 704 1486 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058227.1 protein_id gnl|my_center|LOCUS_30530 1636 2757 gene locus_tag LOCUS_30540 1636 2757 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_30540 2757 4202 gene locus_tag LOCUS_30550 2757 4202 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_30550 4230 5534 gene locus_tag LOCUS_30560 4230 5534 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267913.1 protein_id gnl|my_center|LOCUS_30560 5575 5862 gene locus_tag LOCUS_30570 5575 5862 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812779.1 protein_id gnl|my_center|LOCUS_30570 5883 7046 gene locus_tag LOCUS_30580 5883 7046 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898047.1 protein_id gnl|my_center|LOCUS_30580 7346 8785 gene locus_tag LOCUS_30590 7346 8785 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_30590 8807 10276 gene locus_tag LOCUS_30600 8807 10276 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_30600 10452 11414 gene locus_tag LOCUS_30610 10452 11414 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_30610 14010 11497 gene locus_tag LOCUS_30620 14010 11497 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_30620 15725 16459 gene locus_tag LOCUS_30630 15725 16459 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_30630 16543 19203 gene locus_tag LOCUS_30640 16543 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 19359 20381 gene locus_tag LOCUS_30650 19359 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 20500 20426 gene locus_tag LOCUS_t00590 20500 20426 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20714 20947 gene locus_tag LOCUS_30660 20714 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 21122 21580 gene locus_tag LOCUS_30670 gene bcp 21122 21580 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_30670 22127 23080 gene locus_tag LOCUS_30680 22127 23080 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_30680 24681 24608 gene locus_tag LOCUS_t00600 24681 24608 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25344 24727 gene locus_tag LOCUS_30690 25344 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 28973 25818 gene locus_tag LOCUS_30700 28973 25818 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108138.1 protein_id gnl|my_center|LOCUS_30700 29321 31708 gene locus_tag LOCUS_30710 29321 31708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 35698 31946 gene locus_tag LOCUS_30720 35698 31946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0057 <1 1234 gene locus_tag LOCUS_30730 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017264255.1:class I SAM-dependent methyltransferase 1358 2473 gene locus_tag LOCUS_30740 1358 2473 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_30740 2703 3899 gene locus_tag LOCUS_30750 2703 3899 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073856746.1 protein_id gnl|my_center|LOCUS_30750 4721 4005 gene locus_tag LOCUS_30760 4721 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 5112 6245 gene locus_tag LOCUS_30770 5112 6245 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_30770 6426 7013 gene locus_tag LOCUS_30780 6426 7013 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_30780 7059 8417 gene locus_tag LOCUS_30790 7059 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 8444 9526 gene locus_tag LOCUS_30800 8444 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 9558 10583 gene locus_tag LOCUS_30810 9558 10583 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_30810 10606 11952 gene locus_tag LOCUS_30820 10606 11952 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_30820 12032 13084 gene locus_tag LOCUS_30830 12032 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 13167 15203 gene locus_tag LOCUS_30840 13167 15203 CDS product enterotoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703586.1 protein_id gnl|my_center|LOCUS_30840 15772 15275 gene locus_tag LOCUS_30850 15772 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 16007 17134 gene locus_tag LOCUS_30860 16007 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 19043 17880 gene locus_tag LOCUS_30870 19043 17880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 19249 19076 gene locus_tag LOCUS_30880 19249 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 20788 19256 gene locus_tag LOCUS_30890 20788 19256 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_30890 21987 20878 gene locus_tag LOCUS_30900 21987 20878 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_30900 22895 21984 gene locus_tag LOCUS_30910 22895 21984 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_30910 23821 23075 gene locus_tag LOCUS_30920 23821 23075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 24698 23931 gene locus_tag LOCUS_30930 24698 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 25952 24804 gene locus_tag LOCUS_30940 25952 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 27372 25996 gene locus_tag LOCUS_30950 27372 25996 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_30950 29224 27386 gene locus_tag LOCUS_30960 29224 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 30321 29284 gene locus_tag LOCUS_30970 30321 29284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 31390 30353 gene locus_tag LOCUS_30980 31390 30353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 33063 31480 gene locus_tag LOCUS_30990 33063 31480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 33343 35388 gene locus_tag LOCUS_31000 33343 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 <36567 35469 gene locus_tag LOCUS_31010 <36567 35469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108138.1:GH92 family glycosyl hydrolase >Feature sequence0058 335 1660 gene locus_tag LOCUS_31020 335 1660 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_31020 1736 2563 gene locus_tag LOCUS_31030 1736 2563 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_31030 2624 3445 gene locus_tag LOCUS_31040 2624 3445 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_31040 3622 5289 gene locus_tag LOCUS_31050 3622 5289 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_31050 5354 6502 gene locus_tag LOCUS_31060 5354 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 7940 6474 gene locus_tag LOCUS_31070 7940 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 10198 7982 gene locus_tag LOCUS_31080 10198 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 11357 10257 gene locus_tag LOCUS_31090 11357 10257 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_31090 13888 11465 gene locus_tag LOCUS_31100 13888 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 15377 14028 gene locus_tag LOCUS_31110 15377 14028 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_31110 16871 15549 gene locus_tag LOCUS_31120 16871 15549 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_31120 17870 16926 gene locus_tag LOCUS_31130 17870 16926 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919889.1 protein_id gnl|my_center|LOCUS_31130 19393 18059 gene locus_tag LOCUS_31140 19393 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 19926 19420 gene locus_tag LOCUS_31150 19926 19420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 20462 19926 gene locus_tag LOCUS_31160 20462 19926 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_31160 20775 22139 gene locus_tag LOCUS_31170 20775 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 22175 22987 gene locus_tag LOCUS_31180 22175 22987 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_31180 23025 24599 gene locus_tag LOCUS_31190 23025 24599 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_31190 24688 25356 gene locus_tag LOCUS_31200 24688 25356 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_31200 25432 26886 gene locus_tag LOCUS_31210 25432 26886 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_31210 26617 26707 gene locus_tag LOCUS_t00610 26617 26707 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27777 26920 gene locus_tag LOCUS_31220 27777 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 28110 29672 gene locus_tag LOCUS_31230 28110 29672 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_31230 30256 32100 gene locus_tag LOCUS_31240 30256 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 32191 34665 gene locus_tag LOCUS_31250 32191 34665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 35020 36015 gene locus_tag LOCUS_31260 35020 36015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 >Feature sequence0059 529 1023 gene locus_tag LOCUS_31270 529 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1357 1193 gene locus_tag LOCUS_31280 1357 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3067 1460 gene locus_tag LOCUS_31290 3067 1460 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 protein_id gnl|my_center|LOCUS_31290 4469 3093 gene locus_tag LOCUS_31300 gene lysA 4469 3093 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256477.1 protein_id gnl|my_center|LOCUS_31300 5083 4493 gene locus_tag LOCUS_31310 5083 4493 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022525.1 protein_id gnl|my_center|LOCUS_31310 6219 5050 gene locus_tag LOCUS_31320 gene speB 6219 5050 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_31320 7085 6288 gene locus_tag LOCUS_31330 gene fabG 7085 6288 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_31330 8291 7149 gene locus_tag LOCUS_31340 8291 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 9092 8322 gene locus_tag LOCUS_31350 9092 8322 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206876.1 protein_id gnl|my_center|LOCUS_31350 10132 9473 gene locus_tag LOCUS_31360 10132 9473 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_31360 12229 10454 gene locus_tag LOCUS_31370 12229 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 12980 12495 gene locus_tag LOCUS_31380 12980 12495 CDS product lactoylglutathione lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119583.1 protein_id gnl|my_center|LOCUS_31380 14200 13148 gene locus_tag LOCUS_31390 gene bdhA 14200 13148 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_31390 15338 14217 gene locus_tag LOCUS_31400 15338 14217 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798115.1 protein_id gnl|my_center|LOCUS_31400 16545 15400 gene locus_tag LOCUS_31410 16545 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 16744 16872 gene locus_tag LOCUS_31420 16744 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 18187 16925 gene locus_tag LOCUS_31430 18187 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 18573 20075 gene locus_tag LOCUS_31440 18573 20075 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_31440 20125 21666 gene locus_tag LOCUS_31450 20125 21666 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123028.1 protein_id gnl|my_center|LOCUS_31450 21663 25025 gene locus_tag LOCUS_31460 21663 25025 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120283.1 protein_id gnl|my_center|LOCUS_31460 25076 27163 gene locus_tag LOCUS_31470 25076 27163 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444553.1 protein_id gnl|my_center|LOCUS_31470 30384 27226 gene locus_tag LOCUS_31480 30384 27226 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_31480 31763 30609 gene locus_tag LOCUS_31490 31763 30609 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766159.1 protein_id gnl|my_center|LOCUS_31490 32215 32024 gene locus_tag LOCUS_31500 32215 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 33625 32294 gene locus_tag LOCUS_31510 33625 32294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 35021 33690 gene locus_tag LOCUS_31520 35021 33690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0060 128 574 gene locus_tag LOCUS_31530 128 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 586 1119 gene locus_tag LOCUS_31540 586 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 1664 1230 gene locus_tag LOCUS_31550 1664 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1967 2545 gene locus_tag LOCUS_31560 1967 2545 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_31560 2727 3854 gene locus_tag LOCUS_31570 2727 3854 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_31570 3984 4382 gene locus_tag LOCUS_31580 gene acpS 3984 4382 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174182.1 protein_id gnl|my_center|LOCUS_31580 4369 6183 gene locus_tag LOCUS_31590 gene mnmG 4369 6183 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_31590 6176 7192 gene locus_tag LOCUS_31600 6176 7192 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_31600 8368 7229 gene locus_tag LOCUS_31610 8368 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 8686 11526 gene locus_tag LOCUS_31620 8686 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 11545 13806 gene locus_tag LOCUS_31630 11545 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 13811 14515 gene locus_tag LOCUS_31640 13811 14515 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_31640 14493 15179 gene locus_tag LOCUS_31650 14493 15179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_31650 15952 15236 gene locus_tag LOCUS_31660 gene hisA 15952 15236 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_31660 16879 15953 gene locus_tag LOCUS_31670 16879 15953 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_31670 17159 18244 gene locus_tag LOCUS_31680 17159 18244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 18405 19250 gene locus_tag LOCUS_31690 gene rbsK 18405 19250 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419503.1 protein_id gnl|my_center|LOCUS_31690 19237 20187 gene locus_tag LOCUS_31700 19237 20187 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615550.1 protein_id gnl|my_center|LOCUS_31700 20184 21701 gene locus_tag LOCUS_31710 20184 21701 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103969.1 protein_id gnl|my_center|LOCUS_31710 21721 22701 gene locus_tag LOCUS_31720 21721 22701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521614.1 protein_id gnl|my_center|LOCUS_31720 22892 23776 gene locus_tag LOCUS_31730 22892 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 24054 24908 gene locus_tag LOCUS_31740 24054 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 24966 26351 gene locus_tag LOCUS_31750 24966 26351 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_31750 27434 26394 gene locus_tag LOCUS_31760 27434 26394 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_31760 28330 27494 gene locus_tag LOCUS_31770 28330 27494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 29777 28371 gene locus_tag LOCUS_31780 29777 28371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 30168 31340 gene locus_tag LOCUS_31790 30168 31340 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_31790 31451 32764 gene locus_tag LOCUS_31800 31451 32764 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_31800 32808 33635 gene locus_tag LOCUS_31810 32808 33635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 35210 34095 gene locus_tag LOCUS_31820 35210 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence0061 1101 130 gene locus_tag LOCUS_31830 1101 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 2416 1115 gene locus_tag LOCUS_31840 2416 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 2469 2651 gene locus_tag LOCUS_31850 2469 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2846 4207 gene locus_tag LOCUS_31860 2846 4207 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_31860 4549 6462 gene locus_tag LOCUS_31870 4549 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_31870 6579 7550 gene locus_tag LOCUS_31880 6579 7550 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_31880 10853 7845 gene locus_tag LOCUS_31890 10853 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 12792 11338 gene locus_tag LOCUS_31900 gene bchE 12792 11338 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083675.1 protein_id gnl|my_center|LOCUS_31900 13010 13546 gene locus_tag LOCUS_31910 gene sigE 13010 13546 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 protein_id gnl|my_center|LOCUS_31910 13543 14817 gene locus_tag LOCUS_31920 13543 14817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 15022 15612 gene locus_tag LOCUS_31930 15022 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 16059 17117 gene locus_tag LOCUS_31940 16059 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 18191 17124 gene locus_tag LOCUS_31950 18191 17124 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969294.1 protein_id gnl|my_center|LOCUS_31950 22880 18369 gene locus_tag LOCUS_31960 22880 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 25692 23248 gene locus_tag LOCUS_31970 25692 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 27030 25708 gene locus_tag LOCUS_31980 27030 25708 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_31980 28592 27087 gene locus_tag LOCUS_31990 28592 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 29054 29965 gene locus_tag LOCUS_32000 29054 29965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_32000 29949 31244 gene locus_tag LOCUS_32010 29949 31244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_32010 31296 32036 gene locus_tag LOCUS_32020 31296 32036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 32190 33206 gene locus_tag LOCUS_32030 32190 33206 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_32030 33242 34060 gene locus_tag LOCUS_32040 33242 34060 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence0062 333 641 gene locus_tag LOCUS_32050 333 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 865 653 gene locus_tag LOCUS_32060 865 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1214 1008 gene locus_tag LOCUS_32070 1214 1008 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_32070 1597 1313 gene locus_tag LOCUS_32080 1597 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2212 1829 gene locus_tag LOCUS_32090 2212 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 2786 2286 gene locus_tag LOCUS_32100 2786 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3275 4510 gene locus_tag LOCUS_32110 3275 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 4661 4852 gene locus_tag LOCUS_32120 4661 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 5251 6153 gene locus_tag LOCUS_32130 5251 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6221 8446 gene locus_tag LOCUS_32140 6221 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 8612 9118 gene locus_tag LOCUS_32150 8612 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 9174 9458 gene locus_tag LOCUS_32160 9174 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 9543 10775 gene locus_tag LOCUS_32170 9543 10775 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_32170 12017 11247 gene locus_tag LOCUS_32180 12017 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 13463 12942 gene locus_tag LOCUS_32190 13463 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 14239 13859 gene locus_tag LOCUS_32200 14239 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 14768 14938 gene locus_tag LOCUS_32210 14768 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 15747 15262 gene locus_tag LOCUS_32220 gene rpiB 15747 15262 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_32220 16162 15959 gene locus_tag LOCUS_32230 16162 15959 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_32230 16804 18648 gene locus_tag LOCUS_32240 16804 18648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 18814 18984 gene locus_tag LOCUS_32250 18814 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 18991 20940 gene locus_tag LOCUS_32260 18991 20940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 21643 22407 gene locus_tag LOCUS_32270 21643 22407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 22434 23870 gene locus_tag LOCUS_32280 22434 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 24040 26175 gene locus_tag LOCUS_32290 24040 26175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 26313 27767 gene locus_tag LOCUS_32300 26313 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 27956 29452 gene locus_tag LOCUS_32310 27956 29452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 29465 29617 gene locus_tag LOCUS_32320 29465 29617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 30215 32332 gene locus_tag LOCUS_32330 30215 32332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 32801 34741 gene locus_tag LOCUS_32340 32801 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence0063 631 2349 gene locus_tag LOCUS_32350 631 2349 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_32350 2407 3810 gene locus_tag LOCUS_32360 2407 3810 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_32360 5198 3882 gene locus_tag LOCUS_32370 5198 3882 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_32370 7155 5284 gene locus_tag LOCUS_32380 7155 5284 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_32380 7362 8174 gene locus_tag LOCUS_32390 7362 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 9697 8195 gene locus_tag LOCUS_32400 9697 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 10023 10724 gene locus_tag LOCUS_32410 10023 10724 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_32410 10757 11239 gene locus_tag LOCUS_32420 10757 11239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 11292 12383 gene locus_tag LOCUS_32430 11292 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 12407 13381 gene locus_tag LOCUS_32440 12407 13381 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_32440 13489 14412 gene locus_tag LOCUS_32450 13489 14412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 14485 14961 gene locus_tag LOCUS_32460 14485 14961 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_32460 15418 15200 gene locus_tag LOCUS_32470 15418 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 17927 15582 gene locus_tag LOCUS_32480 17927 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 18603 18379 gene locus_tag LOCUS_32490 18603 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 19249 18845 gene locus_tag LOCUS_32500 19249 18845 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393351.1 protein_id gnl|my_center|LOCUS_32500 20244 19657 gene locus_tag LOCUS_32510 20244 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 20623 21309 gene locus_tag LOCUS_32520 20623 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 22140 21514 gene locus_tag LOCUS_32530 22140 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 22961 22719 gene locus_tag LOCUS_32540 22961 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 25030 23252 gene locus_tag LOCUS_32550 25030 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 25370 25080 gene locus_tag LOCUS_32560 25370 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 26132 27169 gene locus_tag LOCUS_32570 26132 27169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 27320 28711 gene locus_tag LOCUS_32580 27320 28711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 29498 28977 gene locus_tag LOCUS_32590 29498 28977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 31651 29573 gene locus_tag LOCUS_32600 31651 29573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 33117 31939 gene locus_tag LOCUS_32610 33117 31939 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 protein_id gnl|my_center|LOCUS_32610 >Feature sequence0064 1252 131 gene locus_tag LOCUS_32620 1252 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 1693 1334 gene locus_tag LOCUS_32630 1693 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 2782 1877 gene locus_tag LOCUS_32640 2782 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 6084 2785 gene locus_tag LOCUS_32650 gene mfd 6084 2785 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_32650 8277 6247 gene locus_tag LOCUS_32660 gene tkt 8277 6247 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_32660 8551 10002 gene locus_tag LOCUS_32670 8551 10002 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_32670 10596 11459 gene locus_tag LOCUS_32680 10596 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 12318 11596 gene locus_tag LOCUS_32690 12318 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 15178 12398 gene locus_tag LOCUS_32700 15178 12398 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_32700 16805 15252 gene locus_tag LOCUS_32710 16805 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 17336 17650 gene locus_tag LOCUS_32720 17336 17650 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871614.1 protein_id gnl|my_center|LOCUS_32720 17779 18018 gene locus_tag LOCUS_32730 17779 18018 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941244.1 protein_id gnl|my_center|LOCUS_32730 18213 18848 gene locus_tag LOCUS_32740 18213 18848 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_32740 20998 19058 gene locus_tag LOCUS_32750 20998 19058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 22524 22084 gene locus_tag LOCUS_32760 22524 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 22779 23912 gene locus_tag LOCUS_32770 22779 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 23984 24652 gene locus_tag LOCUS_32780 23984 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 24649 25482 gene locus_tag LOCUS_32790 24649 25482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088033.1 protein_id gnl|my_center|LOCUS_32790 25522 27567 gene locus_tag LOCUS_32800 25522 27567 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_32800 27751 29358 gene locus_tag LOCUS_32810 27751 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 29553 30134 gene locus_tag LOCUS_32820 29553 30134 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_32820 30139 32238 gene locus_tag LOCUS_32830 30139 32238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 32278 33468 gene locus_tag LOCUS_32840 32278 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence0065 851 132 gene locus_tag LOCUS_32850 851 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1951 851 gene locus_tag LOCUS_32860 1951 851 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_32860 2032 2754 gene locus_tag LOCUS_32870 2032 2754 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 protein_id gnl|my_center|LOCUS_32870 2783 4000 gene locus_tag LOCUS_32880 2783 4000 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_32880 5459 4107 gene locus_tag LOCUS_32890 5459 4107 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_32890 6464 7501 gene locus_tag LOCUS_32900 6464 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 7778 8239 gene locus_tag LOCUS_32910 7778 8239 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_32910 8489 8175 gene locus_tag LOCUS_32920 8489 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 9658 9128 gene locus_tag LOCUS_32930 9658 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 9983 10183 gene locus_tag LOCUS_32940 9983 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 10975 10205 gene locus_tag LOCUS_32950 gene gloB 10975 10205 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083054.1 protein_id gnl|my_center|LOCUS_32950 11266 10976 gene locus_tag LOCUS_32960 11266 10976 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883059.1 protein_id gnl|my_center|LOCUS_32960 13951 13454 gene locus_tag LOCUS_32970 13951 13454 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582744.1 protein_id gnl|my_center|LOCUS_32970 14854 14306 gene locus_tag LOCUS_32980 14854 14306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 15923 15306 gene locus_tag LOCUS_32990 15923 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 15955 16353 gene locus_tag LOCUS_33000 15955 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 17036 16587 gene locus_tag LOCUS_33010 17036 16587 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_33010 17588 17100 gene locus_tag LOCUS_33020 17588 17100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 18235 17585 gene locus_tag LOCUS_33030 18235 17585 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_33030 19648 18248 gene locus_tag LOCUS_33040 19648 18248 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_33040 21413 19641 gene locus_tag LOCUS_33050 21413 19641 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_33050 22063 21416 gene locus_tag LOCUS_33060 22063 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 22438 22133 gene locus_tag LOCUS_33070 22438 22133 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_33070 22829 22446 gene locus_tag LOCUS_33080 22829 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 24868 22850 gene locus_tag LOCUS_33090 24868 22850 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_33090 25935 24868 gene locus_tag LOCUS_33100 25935 24868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 26267 25935 gene locus_tag LOCUS_33110 26267 25935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 26655 27440 gene locus_tag LOCUS_33120 26655 27440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 28857 27478 gene locus_tag LOCUS_33130 28857 27478 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120382.1 protein_id gnl|my_center|LOCUS_33130 29323 29670 gene locus_tag LOCUS_33140 29323 29670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 30474 29833 gene locus_tag LOCUS_33150 30474 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 30904 32430 gene locus_tag LOCUS_33160 30904 32430 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_33160 33269 32913 gene locus_tag LOCUS_33170 33269 32913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 <34384 33326 gene locus_tag LOCUS_33180 <34384 33326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940822.1:type IV pilus twitching motility protein PilT >Feature sequence0066 2587 3312 gene locus_tag LOCUS_33190 2587 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 3315 3446 gene locus_tag LOCUS_33200 3315 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3642 5006 gene locus_tag LOCUS_33210 3642 5006 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_33210 5157 6467 gene locus_tag LOCUS_33220 5157 6467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_33220 6598 7599 gene locus_tag LOCUS_33230 6598 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 8097 9878 gene locus_tag LOCUS_33240 8097 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 9985 10809 gene locus_tag LOCUS_33250 9985 10809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 12176 10806 gene locus_tag LOCUS_33260 12176 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 12718 12182 gene locus_tag LOCUS_33270 12718 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 14346 13117 gene locus_tag LOCUS_33280 14346 13117 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_33280 14669 17014 gene locus_tag LOCUS_33290 14669 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 17109 19157 gene locus_tag LOCUS_33300 17109 19157 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_33300 19300 20868 gene locus_tag LOCUS_33310 19300 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 20882 22663 gene locus_tag LOCUS_33320 20882 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 23217 24239 gene locus_tag LOCUS_33330 23217 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 25526 24243 gene locus_tag LOCUS_33340 25526 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 26932 25997 gene locus_tag LOCUS_33350 26932 25997 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921649.1 protein_id gnl|my_center|LOCUS_33350 28097 26988 gene locus_tag LOCUS_33360 28097 26988 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_33360 28572 29906 gene locus_tag LOCUS_33370 28572 29906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 29957 31219 gene locus_tag LOCUS_33380 29957 31219 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_33380 31276 32271 gene locus_tag LOCUS_33390 31276 32271 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121134.1 protein_id gnl|my_center|LOCUS_33390 32291 34162 gene locus_tag LOCUS_33400 32291 34162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence0067 2279 4432 gene locus_tag LOCUS_33410 2279 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4439 6052 gene locus_tag LOCUS_33420 4439 6052 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_33420 6049 6741 gene locus_tag LOCUS_33430 6049 6741 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188844.1 protein_id gnl|my_center|LOCUS_33430 9097 6824 gene locus_tag LOCUS_33440 9097 6824 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_33440 9412 10944 gene locus_tag LOCUS_33450 9412 10944 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 protein_id gnl|my_center|LOCUS_33450 11026 13368 gene locus_tag LOCUS_33460 11026 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 14115 13390 gene locus_tag LOCUS_33470 14115 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 14339 14791 gene locus_tag LOCUS_33480 14339 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 15642 14881 gene locus_tag LOCUS_33490 15642 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 16978 15788 gene locus_tag LOCUS_33500 16978 15788 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_33500 19182 17173 gene locus_tag LOCUS_33510 19182 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 20668 19484 gene locus_tag LOCUS_33520 20668 19484 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_33520 22033 20852 gene locus_tag LOCUS_33530 22033 20852 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_33530 22984 22217 gene locus_tag LOCUS_33540 gene gloB 22984 22217 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_33540 23520 23029 gene locus_tag LOCUS_33550 23520 23029 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584056.1 protein_id gnl|my_center|LOCUS_33550 25941 23986 gene locus_tag LOCUS_33560 25941 23986 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_33560 28145 26133 gene locus_tag LOCUS_33570 28145 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 28942 30477 gene locus_tag LOCUS_33580 28942 30477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 30493 31461 gene locus_tag LOCUS_33590 30493 31461 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960294.1 protein_id gnl|my_center|LOCUS_33590 33821 31491 gene locus_tag LOCUS_33600 33821 31491 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_33600 33928 33794 gene locus_tag LOCUS_33610 33928 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence0068 2073 487 gene locus_tag LOCUS_33620 2073 487 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_33620 3107 2172 gene locus_tag LOCUS_33630 3107 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 4458 3082 gene locus_tag LOCUS_33640 4458 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 4768 5487 gene locus_tag LOCUS_33650 4768 5487 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_33650 8889 5590 gene locus_tag LOCUS_33660 8889 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 12166 8978 gene locus_tag LOCUS_33670 12166 8978 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_33670 13488 12163 gene locus_tag LOCUS_33680 13488 12163 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_33680 14852 13497 gene locus_tag LOCUS_33690 14852 13497 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615477.1 protein_id gnl|my_center|LOCUS_33690 16574 15060 gene locus_tag LOCUS_33700 16574 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 18086 16602 gene locus_tag LOCUS_33710 18086 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 19102 18275 gene locus_tag LOCUS_33720 19102 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 21353 19134 gene locus_tag LOCUS_33730 21353 19134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_33730 23051 21411 gene locus_tag LOCUS_33740 23051 21411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 24156 23233 gene locus_tag LOCUS_33750 24156 23233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921771.1 protein_id gnl|my_center|LOCUS_33750 24466 25455 gene locus_tag LOCUS_33760 24466 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 25534 26820 gene locus_tag LOCUS_33770 25534 26820 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_33770 26901 28409 gene locus_tag LOCUS_33780 26901 28409 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_33780 30461 28476 gene locus_tag LOCUS_33790 30461 28476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 31868 30642 gene locus_tag LOCUS_33800 31868 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 33351 32188 gene locus_tag LOCUS_33810 33351 32188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence0069 379 570 gene locus_tag LOCUS_33820 379 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 1154 2107 gene locus_tag LOCUS_33830 1154 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 2819 2202 gene locus_tag LOCUS_33840 2819 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 3197 4708 gene locus_tag LOCUS_33850 3197 4708 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791295.1 protein_id gnl|my_center|LOCUS_33850 5408 4716 gene locus_tag LOCUS_33860 5408 4716 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871050.1 protein_id gnl|my_center|LOCUS_33860 5862 5443 gene locus_tag LOCUS_33870 5862 5443 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140937.1 protein_id gnl|my_center|LOCUS_33870 7049 5859 gene locus_tag LOCUS_33880 7049 5859 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_33880 8448 7105 gene locus_tag LOCUS_33890 8448 7105 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_33890 8778 11828 gene locus_tag LOCUS_33900 8778 11828 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_33900 12305 13870 gene locus_tag LOCUS_33910 12305 13870 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_33910 15260 13905 gene locus_tag LOCUS_33920 15260 13905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 15416 16738 gene locus_tag LOCUS_33930 15416 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 16926 18050 gene locus_tag LOCUS_33940 16926 18050 CDS product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029020.1 protein_id gnl|my_center|LOCUS_33940 18138 19628 gene locus_tag LOCUS_33950 18138 19628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_33950 20603 19671 gene locus_tag LOCUS_33960 20603 19671 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_33960 22435 20588 gene locus_tag LOCUS_33970 22435 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 23995 22505 gene locus_tag LOCUS_33980 23995 22505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_33980 24412 26472 gene locus_tag LOCUS_33990 24412 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 26804 28048 gene locus_tag LOCUS_34000 26804 28048 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_34000 28327 30429 gene locus_tag LOCUS_34010 28327 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 30829 32169 gene locus_tag LOCUS_34020 30829 32169 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_34020 32415 33437 gene locus_tag LOCUS_34030 gene rho 32415 33437 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405059.1 protein_id gnl|my_center|LOCUS_34030 >Feature sequence0070 257 2332 gene locus_tag LOCUS_34040 257 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2683 4737 gene locus_tag LOCUS_34050 2683 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 4915 6177 gene locus_tag LOCUS_34060 4915 6177 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_34060 6188 7933 gene locus_tag LOCUS_34070 6188 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 8211 8927 gene locus_tag LOCUS_34080 8211 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 10693 8969 gene locus_tag LOCUS_34090 10693 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 11830 10991 gene locus_tag LOCUS_34100 11830 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 12080 12967 gene locus_tag LOCUS_34110 12080 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 14340 13006 gene locus_tag LOCUS_34120 14340 13006 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421552.1 protein_id gnl|my_center|LOCUS_34120 15269 14352 gene locus_tag LOCUS_34130 15269 14352 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 protein_id gnl|my_center|LOCUS_34130 16862 15495 gene locus_tag LOCUS_34140 16862 15495 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_34140 17097 18812 gene locus_tag LOCUS_34150 17097 18812 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_34150 19092 19295 gene locus_tag LOCUS_34160 19092 19295 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222289.1 protein_id gnl|my_center|LOCUS_34160 20325 19582 gene locus_tag LOCUS_34170 20325 19582 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_34170 20724 20359 gene locus_tag LOCUS_34180 20724 20359 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_34180 21197 20721 gene locus_tag LOCUS_34190 21197 20721 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932946.1 protein_id gnl|my_center|LOCUS_34190 22159 21362 gene locus_tag LOCUS_34200 22159 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 22275 22192 gene locus_tag LOCUS_t00620 22275 22192 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22573 22331 gene locus_tag LOCUS_34210 22573 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 24065 22641 gene locus_tag LOCUS_34220 gene xseA 24065 22641 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 protein_id gnl|my_center|LOCUS_34220 25467 24082 gene locus_tag LOCUS_34230 25467 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 25715 26293 gene locus_tag LOCUS_34240 25715 26293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 27312 26365 gene locus_tag LOCUS_34250 27312 26365 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963171.1 protein_id gnl|my_center|LOCUS_34250 27498 28274 gene locus_tag LOCUS_34260 27498 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 28823 30634 gene locus_tag LOCUS_34270 28823 30634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 30656 31474 gene locus_tag LOCUS_34280 30656 31474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 31487 32179 gene locus_tag LOCUS_34290 31487 32179 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_34290 32216 32794 gene locus_tag LOCUS_34300 32216 32794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403631.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence0071 3970 212 gene locus_tag LOCUS_34310 3970 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 5299 4013 gene locus_tag LOCUS_34320 5299 4013 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_34320 7539 5461 gene locus_tag LOCUS_34330 7539 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 7750 9201 gene locus_tag LOCUS_34340 7750 9201 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_34340 10721 9228 gene locus_tag LOCUS_34350 10721 9228 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_34350 12517 10820 gene locus_tag LOCUS_34360 12517 10820 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_34360 14060 12585 gene locus_tag LOCUS_34370 14060 12585 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_34370 16366 14135 gene locus_tag LOCUS_34380 16366 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 17990 16446 gene locus_tag LOCUS_34390 17990 16446 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_34390 19542 18049 gene locus_tag LOCUS_34400 19542 18049 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922831.1 protein_id gnl|my_center|LOCUS_34400 20091 20870 gene locus_tag LOCUS_34410 20091 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_34410 20902 22248 gene locus_tag LOCUS_34420 20902 22248 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_34420 22281 22622 gene locus_tag LOCUS_34430 22281 22622 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083241.1 protein_id gnl|my_center|LOCUS_34430 22670 24085 gene locus_tag LOCUS_34440 gene glnA 22670 24085 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_34440 24396 24644 gene locus_tag LOCUS_34450 24396 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 24711 26819 gene locus_tag LOCUS_34460 24711 26819 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_34460 26881 27837 gene locus_tag LOCUS_34470 gene sseA 26881 27837 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210799.1 protein_id gnl|my_center|LOCUS_34470 29434 27893 gene locus_tag LOCUS_34480 29434 27893 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_34480 30363 29479 gene locus_tag LOCUS_34490 30363 29479 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_34490 31360 30899 gene locus_tag LOCUS_34500 31360 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 31980 32681 gene locus_tag LOCUS_34510 31980 32681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence0072 1760 492 gene locus_tag LOCUS_34520 1760 492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_34520 3322 1805 gene locus_tag LOCUS_34530 3322 1805 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_34530 4751 3312 gene locus_tag LOCUS_34540 4751 3312 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_34540 6222 4741 gene locus_tag LOCUS_34550 6222 4741 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_34550 7717 6209 gene locus_tag LOCUS_34560 7717 6209 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_34560 10271 7707 gene locus_tag LOCUS_34570 10271 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922069.1 protein_id gnl|my_center|LOCUS_34570 11800 10424 gene locus_tag LOCUS_34580 11800 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 13130 11832 gene locus_tag LOCUS_34590 13130 11832 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_34590 14482 13145 gene locus_tag LOCUS_34600 14482 13145 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_34600 15496 14501 gene locus_tag LOCUS_34610 15496 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 16390 15599 gene locus_tag LOCUS_34620 16390 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 17802 16471 gene locus_tag LOCUS_34630 17802 16471 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669087.1 protein_id gnl|my_center|LOCUS_34630 19305 17914 gene locus_tag LOCUS_34640 19305 17914 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_34640 19460 19302 gene locus_tag LOCUS_34650 19460 19302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 19728 19480 gene locus_tag LOCUS_34660 19728 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 20025 19747 gene locus_tag LOCUS_34670 20025 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 21521 20181 gene locus_tag LOCUS_34680 21521 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 22087 21518 gene locus_tag LOCUS_34690 22087 21518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 23737 22511 gene locus_tag LOCUS_34700 23737 22511 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_34700 25679 23811 gene locus_tag LOCUS_34710 25679 23811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 26399 28486 gene locus_tag LOCUS_34720 26399 28486 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_34720 28720 29820 gene locus_tag LOCUS_34730 28720 29820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 29989 30486 gene locus_tag LOCUS_34740 29989 30486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 30491 31252 gene locus_tag LOCUS_34750 30491 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 31338 32123 gene locus_tag LOCUS_34760 31338 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence0073 122 1321 gene locus_tag LOCUS_34770 122 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1482 1691 gene locus_tag LOCUS_34780 1482 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 4349 1764 gene locus_tag LOCUS_34790 4349 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 6055 4949 gene locus_tag LOCUS_34800 6055 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 6254 6559 gene locus_tag LOCUS_34810 6254 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 7542 6589 gene locus_tag LOCUS_34820 7542 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 8984 9973 gene locus_tag LOCUS_34830 8984 9973 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_34830 10006 10881 gene locus_tag LOCUS_34840 10006 10881 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_34840 10935 12332 gene locus_tag LOCUS_34850 10935 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 12351 13415 gene locus_tag LOCUS_34860 12351 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 13416 14507 gene locus_tag LOCUS_34870 13416 14507 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_34870 14526 15545 gene locus_tag LOCUS_34880 14526 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 15526 16338 gene locus_tag LOCUS_34890 15526 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 16376 18214 gene locus_tag LOCUS_34900 16376 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 18211 19026 gene locus_tag LOCUS_34910 18211 19026 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_34910 21208 19142 gene locus_tag LOCUS_34920 21208 19142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 21644 22912 gene locus_tag LOCUS_34930 21644 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 25972 23294 gene locus_tag LOCUS_34940 25972 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 26513 27415 gene locus_tag LOCUS_34950 26513 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 27797 29059 gene locus_tag LOCUS_34960 27797 29059 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_34960 29953 30228 gene locus_tag LOCUS_34970 29953 30228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 30878 30663 gene locus_tag LOCUS_34980 30878 30663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 31265 31555 gene locus_tag LOCUS_34990 31265 31555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 31552 32085 gene locus_tag LOCUS_35000 31552 32085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence0074 1587 604 gene locus_tag LOCUS_35010 1587 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 4037 1749 gene locus_tag LOCUS_35020 4037 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 5346 4096 gene locus_tag LOCUS_35030 5346 4096 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_35030 7197 5476 gene locus_tag LOCUS_35040 7197 5476 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_35040 7644 9590 gene locus_tag LOCUS_35050 7644 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 11208 9610 gene locus_tag LOCUS_35060 11208 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 11673 11506 gene locus_tag LOCUS_35070 11673 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 13351 11609 gene locus_tag LOCUS_35080 gene polX 13351 11609 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880919.1 protein_id gnl|my_center|LOCUS_35080 14169 13471 gene locus_tag LOCUS_35090 14169 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 14502 15125 gene locus_tag LOCUS_35100 gene sigW 14502 15125 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_35100 15158 15691 gene locus_tag LOCUS_35110 15158 15691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 15819 16619 gene locus_tag LOCUS_35120 15819 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 16803 17534 gene locus_tag LOCUS_35130 16803 17534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 18272 17694 gene locus_tag LOCUS_35140 18272 17694 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_35140 18584 19708 gene locus_tag LOCUS_35150 18584 19708 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_35150 20525 20836 gene locus_tag LOCUS_35160 20525 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 23107 21056 gene locus_tag LOCUS_35170 23107 21056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 23793 23083 gene locus_tag LOCUS_35180 23793 23083 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_35180 27010 23834 gene locus_tag LOCUS_35190 27010 23834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 28320 26995 gene locus_tag LOCUS_35200 28320 26995 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986780.1 protein_id gnl|my_center|LOCUS_35200 29780 28971 gene locus_tag LOCUS_35210 29780 28971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_35210 31049 29886 gene locus_tag LOCUS_35220 31049 29886 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_35220 32080 31301 gene locus_tag LOCUS_35230 32080 31301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence0075 2247 544 gene locus_tag LOCUS_35240 2247 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 2558 3331 gene locus_tag LOCUS_35250 2558 3331 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_35250 3448 3744 gene locus_tag LOCUS_35260 3448 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35260 3826 5670 gene locus_tag LOCUS_35270 3826 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35270 8819 6234 gene locus_tag LOCUS_35280 8819 6234 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_35280 9588 8833 gene locus_tag LOCUS_35290 9588 8833 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157334022.1 protein_id gnl|my_center|LOCUS_35290 10031 11233 gene locus_tag LOCUS_35300 10031 11233 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_35300 11538 12218 gene locus_tag LOCUS_35310 11538 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 12419 13486 gene locus_tag LOCUS_35320 12419 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 14826 13534 gene locus_tag LOCUS_35330 14826 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 15603 14848 gene locus_tag LOCUS_35340 15603 14848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 17043 16081 gene locus_tag LOCUS_35350 17043 16081 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_35350 17307 18953 gene locus_tag LOCUS_35360 gene betC 17307 18953 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807791.1 protein_id gnl|my_center|LOCUS_35360 18985 19680 gene locus_tag LOCUS_35370 18985 19680 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_35370 19693 21075 gene locus_tag LOCUS_35380 19693 21075 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_35380 21100 22089 gene locus_tag LOCUS_35390 21100 22089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 22142 23179 gene locus_tag LOCUS_35400 22142 23179 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_35400 23193 24170 gene locus_tag LOCUS_35410 23193 24170 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_35410 24182 24994 gene locus_tag LOCUS_35420 24182 24994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 25067 26773 gene locus_tag LOCUS_35430 25067 26773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 26958 28598 gene locus_tag LOCUS_35440 26958 28598 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_35440 29853 28630 gene locus_tag LOCUS_35450 29853 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 31312 30080 gene locus_tag LOCUS_35460 31312 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 <32293 31393 gene locus_tag LOCUS_35470 <32293 31393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012896133.1:KamA family radical SAM protein >Feature sequence0076 425 1063 gene locus_tag LOCUS_35480 425 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 2342 1107 gene locus_tag LOCUS_35490 2342 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 3599 2412 gene locus_tag LOCUS_35500 3599 2412 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_35500 4921 3599 gene locus_tag LOCUS_35510 4921 3599 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_35510 5206 6624 gene locus_tag LOCUS_35520 5206 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 6988 7830 gene locus_tag LOCUS_35530 6988 7830 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563253.1 protein_id gnl|my_center|LOCUS_35530 7845 8543 gene locus_tag LOCUS_35540 7845 8543 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_35540 8551 9726 gene locus_tag LOCUS_35550 8551 9726 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928915.1 protein_id gnl|my_center|LOCUS_35550 9807 11411 gene locus_tag LOCUS_35560 9807 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 11592 14156 gene locus_tag LOCUS_35570 gene leuS 11592 14156 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199945.1 protein_id gnl|my_center|LOCUS_35570 14205 14738 gene locus_tag LOCUS_35580 gene cyaB 14205 14738 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978253.1 protein_id gnl|my_center|LOCUS_35580 14780 15724 gene locus_tag LOCUS_35590 14780 15724 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_35590 15802 16617 gene locus_tag LOCUS_35600 gene kdsA 15802 16617 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_35600 16621 17553 gene locus_tag LOCUS_35610 16621 17553 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_35610 17833 18072 gene locus_tag LOCUS_35620 17833 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 18166 19212 gene locus_tag LOCUS_35630 gene xerC 18166 19212 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_35630 19450 20235 gene locus_tag LOCUS_35640 19450 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 20270 20524 gene locus_tag LOCUS_35650 20270 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 20683 22761 gene locus_tag LOCUS_35660 20683 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 22902 24011 gene locus_tag LOCUS_35670 22902 24011 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_35670 24133 25860 gene locus_tag LOCUS_35680 24133 25860 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_35680 25958 27676 gene locus_tag LOCUS_35690 25958 27676 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_35690 27835 29313 gene locus_tag LOCUS_35700 27835 29313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 29411 29905 gene locus_tag LOCUS_35710 29411 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 29922 30938 gene locus_tag LOCUS_35720 gene floA 29922 30938 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_35720 31036 31602 gene locus_tag LOCUS_35730 31036 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence0077 2413 2279 gene locus_tag LOCUS_35740 2413 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 3495 2428 gene locus_tag LOCUS_35750 3495 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942591.1 protein_id gnl|my_center|LOCUS_35750 3592 3520 gene locus_tag LOCUS_t00630 3592 3520 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4210 3611 gene locus_tag LOCUS_35760 4210 3611 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_35760 7813 4448 gene locus_tag LOCUS_35770 7813 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 8232 9092 gene locus_tag LOCUS_35780 8232 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 9522 9136 gene locus_tag LOCUS_35790 9522 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 9855 10400 gene locus_tag LOCUS_35800 9855 10400 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_35800 10397 11611 gene locus_tag LOCUS_35810 10397 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 11795 12298 gene locus_tag LOCUS_35820 11795 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 12339 13553 gene locus_tag LOCUS_35830 12339 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 13848 14390 gene locus_tag LOCUS_35840 13848 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 14387 15286 gene locus_tag LOCUS_35850 14387 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 16722 15361 gene locus_tag LOCUS_35860 gene murD 16722 15361 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_35860 17543 16848 gene locus_tag LOCUS_35870 gene ubiE 17543 16848 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_35870 18683 17733 gene locus_tag LOCUS_35880 gene pyrF 18683 17733 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_35880 18767 19465 gene locus_tag LOCUS_35890 18767 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 20050 21270 gene locus_tag LOCUS_35900 gene nusA 20050 21270 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_35900 21297 24014 gene locus_tag LOCUS_35910 21297 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 24065 24427 gene locus_tag LOCUS_35920 gene rbfA 24065 24427 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_35920 24528 25244 gene locus_tag LOCUS_35930 24528 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 25256 26131 gene locus_tag LOCUS_35940 gene hisG 25256 26131 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_35940 28153 26243 gene locus_tag LOCUS_35950 28153 26243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 29140 28196 gene locus_tag LOCUS_35960 29140 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 <32241 29643 gene locus_tag LOCUS_35970 <32241 29643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein >Feature sequence0078 891 1628 gene locus_tag LOCUS_35980 891 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1874 2083 gene locus_tag LOCUS_35990 1874 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2193 3485 gene locus_tag LOCUS_36000 2193 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3608 3751 gene locus_tag LOCUS_36010 3608 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 3699 4988 gene locus_tag LOCUS_36020 3699 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 5164 5724 gene locus_tag LOCUS_36030 5164 5724 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_36030 7721 5886 gene locus_tag LOCUS_36040 7721 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_36040 8604 7783 gene locus_tag LOCUS_36050 8604 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 10242 8857 gene locus_tag LOCUS_36060 10242 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 11672 10374 gene locus_tag LOCUS_36070 11672 10374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_36070 12638 11700 gene locus_tag LOCUS_36080 12638 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 14124 12670 gene locus_tag LOCUS_36090 14124 12670 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_36090 15012 14188 gene locus_tag LOCUS_36100 15012 14188 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_36100 15946 15194 gene locus_tag LOCUS_36110 15946 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 18192 16099 gene locus_tag LOCUS_36120 18192 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 19449 18208 gene locus_tag LOCUS_36130 19449 18208 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_36130 20088 19561 gene locus_tag LOCUS_36140 20088 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 21670 20963 gene locus_tag LOCUS_36150 21670 20963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 23032 21935 gene locus_tag LOCUS_36160 23032 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 23455 23090 gene locus_tag LOCUS_36170 23455 23090 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964018.1 protein_id gnl|my_center|LOCUS_36170 25509 23503 gene locus_tag LOCUS_36180 25509 23503 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_36180 26291 25560 gene locus_tag LOCUS_36190 26291 25560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_36190 27049 26324 gene locus_tag LOCUS_36200 27049 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 27210 28001 gene locus_tag LOCUS_36210 27210 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 28723 29052 gene locus_tag LOCUS_36220 28723 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 29109 30080 gene locus_tag LOCUS_36230 29109 30080 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258773.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence0079 1680 565 gene locus_tag LOCUS_36240 gene carA 1680 565 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_36240 5106 1714 gene locus_tag LOCUS_36250 gene carB 5106 1714 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_36250 5321 6391 gene locus_tag LOCUS_36260 5321 6391 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_36260 6535 7515 gene locus_tag LOCUS_36270 6535 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 10811 7611 gene locus_tag LOCUS_36280 gene carB 10811 7611 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_36280 11105 12310 gene locus_tag LOCUS_36290 11105 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 14024 12330 gene locus_tag LOCUS_36300 14024 12330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 15326 14082 gene locus_tag LOCUS_36310 15326 14082 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919597.1 protein_id gnl|my_center|LOCUS_36310 17594 15354 gene locus_tag LOCUS_36320 17594 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 17938 19191 gene locus_tag LOCUS_36330 17938 19191 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_36330 20210 19251 gene locus_tag LOCUS_36340 20210 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 20580 20203 gene locus_tag LOCUS_36350 20580 20203 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233424.1 protein_id gnl|my_center|LOCUS_36350 22224 21025 gene locus_tag LOCUS_36360 22224 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 23510 22311 gene locus_tag LOCUS_36370 23510 22311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 24288 23554 gene locus_tag LOCUS_36380 gene rpe 24288 23554 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_36380 25181 24285 gene locus_tag LOCUS_36390 gene lsrF 25181 24285 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_36390 25427 25233 gene locus_tag LOCUS_36400 25427 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 26943 25441 gene locus_tag LOCUS_36410 26943 25441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_36410 28247 26982 gene locus_tag LOCUS_36420 28247 26982 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_36420 29438 28287 gene locus_tag LOCUS_36430 29438 28287 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_36430 31142 29472 gene locus_tag LOCUS_36440 31142 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence0080 1776 511 gene locus_tag LOCUS_36450 1776 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3037 1832 gene locus_tag LOCUS_36460 3037 1832 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186989.1 protein_id gnl|my_center|LOCUS_36460 4621 3089 gene locus_tag LOCUS_36470 4621 3089 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_36470 5734 4670 gene locus_tag LOCUS_36480 5734 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36480 6487 5816 gene locus_tag LOCUS_36490 6487 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36490 7135 6551 gene locus_tag LOCUS_36500 7135 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 10335 7198 gene locus_tag LOCUS_36510 10335 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_36510 11406 10519 gene locus_tag LOCUS_36520 11406 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 12811 11516 gene locus_tag LOCUS_36530 12811 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 13488 12871 gene locus_tag LOCUS_36540 13488 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 14576 13932 gene locus_tag LOCUS_36550 14576 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 15172 14687 gene locus_tag LOCUS_36560 gene greA 15172 14687 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_36560 16971 15517 gene locus_tag LOCUS_36570 16971 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 18524 16992 gene locus_tag LOCUS_36580 18524 16992 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_36580 20123 18684 gene locus_tag LOCUS_36590 20123 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 21177 20473 gene locus_tag LOCUS_36600 21177 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 21406 22029 gene locus_tag LOCUS_36610 gene trmB 21406 22029 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_36610 23453 22077 gene locus_tag LOCUS_36620 23453 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 25782 23560 gene locus_tag LOCUS_36630 25782 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 26187 26642 gene locus_tag LOCUS_36640 26187 26642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 26736 27101 gene locus_tag LOCUS_36650 26736 27101 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_36650 27270 28049 gene locus_tag LOCUS_36660 27270 28049 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_36660 <31317 28115 gene locus_tag LOCUS_36670 <31317 28115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120847.1:AsmA-like C-terminal region-containing protein >Feature sequence0081 <1 1593 gene locus_tag LOCUS_36680 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl oligopeptidase family serine peptidase 2808 1669 gene locus_tag LOCUS_36690 2808 1669 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_36690 4385 3687 gene locus_tag LOCUS_36700 4385 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 5394 4438 gene locus_tag LOCUS_36710 5394 4438 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_36710 5656 5444 gene locus_tag LOCUS_36720 5656 5444 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064831.1 protein_id gnl|my_center|LOCUS_36720 5889 5671 gene locus_tag LOCUS_36730 5889 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 6457 6185 gene locus_tag LOCUS_36740 6457 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 6837 6523 gene locus_tag LOCUS_36750 6837 6523 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023310.1 protein_id gnl|my_center|LOCUS_36750 7288 6842 gene locus_tag LOCUS_36760 7288 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 7829 7275 gene locus_tag LOCUS_36770 gene rpoE 7829 7275 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_36770 8477 8055 gene locus_tag LOCUS_36780 8477 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 12517 9254 gene locus_tag LOCUS_36790 12517 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 15539 12582 gene locus_tag LOCUS_36800 15539 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 16512 15880 gene locus_tag LOCUS_36810 16512 15880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_36810 16674 18818 gene locus_tag LOCUS_36820 16674 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 19094 20053 gene locus_tag LOCUS_36830 19094 20053 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_36830 21794 20124 gene locus_tag LOCUS_36840 21794 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 23055 21787 gene locus_tag LOCUS_36850 23055 21787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_36850 23828 23052 gene locus_tag LOCUS_36860 23828 23052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_36860 25227 23797 gene locus_tag LOCUS_36870 25227 23797 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_36870 27109 26066 gene locus_tag LOCUS_36880 gene amrS 27109 26066 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_36880 27240 28151 gene locus_tag LOCUS_36890 27240 28151 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_36890 28594 28196 gene locus_tag LOCUS_36900 28594 28196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 29808 28600 gene locus_tag LOCUS_36910 29808 28600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 30766 29876 gene locus_tag LOCUS_36920 30766 29876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence0082 <1 1062 gene locus_tag LOCUS_36930 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887919.1:serine--tRNA ligase 1079 1495 gene locus_tag LOCUS_36940 1079 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3502 4209 gene locus_tag LOCUS_36950 3502 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4967 4311 gene locus_tag LOCUS_36960 4967 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 6203 5007 gene locus_tag LOCUS_36970 6203 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 7478 6237 gene locus_tag LOCUS_36980 7478 6237 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_36980 8144 7686 gene locus_tag LOCUS_36990 8144 7686 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_36990 10727 8367 gene locus_tag LOCUS_37000 10727 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 12616 11048 gene locus_tag LOCUS_37010 gene aroE 12616 11048 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_37010 12847 13941 gene locus_tag LOCUS_37020 gene aroB 12847 13941 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_37020 13969 14913 gene locus_tag LOCUS_37030 13969 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 15090 16019 gene locus_tag LOCUS_37040 15090 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 16190 16471 gene locus_tag LOCUS_37050 16190 16471 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_37050 16549 17175 gene locus_tag LOCUS_37060 16549 17175 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705587.1 protein_id gnl|my_center|LOCUS_37060 17264 17821 gene locus_tag LOCUS_37070 17264 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 17959 19416 gene locus_tag LOCUS_37080 17959 19416 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376442.1 protein_id gnl|my_center|LOCUS_37080 19664 21079 gene locus_tag LOCUS_37090 19664 21079 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_37090 22041 21136 gene locus_tag LOCUS_37100 22041 21136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 22582 22322 gene locus_tag LOCUS_37110 22582 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 23208 22693 gene locus_tag LOCUS_37120 23208 22693 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_37120 24815 23565 gene locus_tag LOCUS_37130 24815 23565 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_37130 25877 25056 gene locus_tag LOCUS_37140 25877 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 26558 25911 gene locus_tag LOCUS_37150 26558 25911 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_37150 27631 26603 gene locus_tag LOCUS_37160 27631 26603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 28607 27732 gene locus_tag LOCUS_37170 gene mscS 28607 27732 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_37170 28823 28899 gene locus_tag LOCUS_t00640 28823 28899 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29578 29030 gene locus_tag LOCUS_37180 29578 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 <30928 29844 gene locus_tag LOCUS_37190 <30928 29844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932494.1:SO_0444 family Cu/Zn efflux transporter >Feature sequence0083 945 2183 gene locus_tag LOCUS_37200 945 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 2113 3789 gene locus_tag LOCUS_37210 2113 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37210 5240 4464 gene locus_tag LOCUS_37220 5240 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 7463 5355 gene locus_tag LOCUS_37230 gene pta 7463 5355 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_37230 7965 7603 gene locus_tag LOCUS_37240 7965 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 9589 8153 gene locus_tag LOCUS_37250 gene pyk 9589 8153 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_37250 10264 12171 gene locus_tag LOCUS_37260 10264 12171 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_37260 13737 12796 gene locus_tag LOCUS_37270 13737 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 14592 13786 gene locus_tag LOCUS_37280 14592 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 15566 14589 gene locus_tag LOCUS_37290 15566 14589 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_37290 16001 16744 gene locus_tag LOCUS_37300 gene surE 16001 16744 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_37300 16970 18046 gene locus_tag LOCUS_37310 gene tdh 16970 18046 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_37310 18031 19215 gene locus_tag LOCUS_37320 18031 19215 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_37320 19478 20233 gene locus_tag LOCUS_37330 19478 20233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 20547 21323 gene locus_tag LOCUS_37340 20547 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 21378 21953 gene locus_tag LOCUS_37350 21378 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 22709 23878 gene locus_tag LOCUS_37360 22709 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 23880 25580 gene locus_tag LOCUS_37370 23880 25580 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_37370 27879 25783 gene locus_tag LOCUS_37380 27879 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 29500 28430 gene locus_tag LOCUS_37390 29500 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 30197 30535 gene locus_tag LOCUS_37400 30197 30535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence0084 231 1313 gene locus_tag LOCUS_37410 231 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1736 2365 gene locus_tag LOCUS_37420 1736 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 2576 3772 gene locus_tag LOCUS_37430 2576 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 3928 4233 gene locus_tag LOCUS_37440 3928 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4258 5250 gene locus_tag LOCUS_37450 4258 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 5306 5866 gene locus_tag LOCUS_37460 5306 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 5987 6973 gene locus_tag LOCUS_37470 5987 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 7664 7047 gene locus_tag LOCUS_37480 7664 7047 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 protein_id gnl|my_center|LOCUS_37480 9059 7671 gene locus_tag LOCUS_37490 9059 7671 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869607.1 protein_id gnl|my_center|LOCUS_37490 11004 9217 gene locus_tag LOCUS_37500 11004 9217 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925146.1 protein_id gnl|my_center|LOCUS_37500 12908 11061 gene locus_tag LOCUS_37510 12908 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 13241 12918 gene locus_tag LOCUS_37520 13241 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 13869 13288 gene locus_tag LOCUS_37530 13869 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 14846 13938 gene locus_tag LOCUS_37540 14846 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 15889 14843 gene locus_tag LOCUS_37550 15889 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 16490 15897 gene locus_tag LOCUS_37560 16490 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 17066 16569 gene locus_tag LOCUS_37570 17066 16569 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363905.1 protein_id gnl|my_center|LOCUS_37570 19066 17099 gene locus_tag LOCUS_37580 19066 17099 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_37580 19374 19069 gene locus_tag LOCUS_37590 19374 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 19665 22976 gene locus_tag LOCUS_37600 19665 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 23140 23997 gene locus_tag LOCUS_37610 23140 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 25878 24031 gene locus_tag LOCUS_37620 25878 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 27530 26181 gene locus_tag LOCUS_37630 27530 26181 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_37630 30098 27576 gene locus_tag LOCUS_37640 30098 27576 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_37640 >Feature sequence0085 358 140 gene locus_tag LOCUS_37650 358 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 592 677 gene locus_tag LOCUS_t00650 592 677 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 721 797 gene locus_tag LOCUS_t00660 721 797 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 810 884 gene locus_tag LOCUS_t00670 810 884 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 895 972 gene locus_tag LOCUS_t00680 895 972 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 992 1066 gene locus_tag LOCUS_t00690 992 1066 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1079 1153 gene locus_tag LOCUS_t00700 1079 1153 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1160 1251 gene locus_tag LOCUS_t00710 1160 1251 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1273 1359 gene locus_tag LOCUS_t00720 1273 1359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1367 1444 gene locus_tag LOCUS_t00730 1367 1444 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1483 1572 gene locus_tag LOCUS_t00740 1483 1572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1670 1754 gene locus_tag LOCUS_t00750 1670 1754 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1775 1861 gene locus_tag LOCUS_t00760 1775 1861 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1868 1943 gene locus_tag LOCUS_t00770 1868 1943 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2172 2393 gene locus_tag LOCUS_37660 2172 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2417 2505 gene locus_tag LOCUS_t00780 2417 2505 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2519 2603 gene locus_tag LOCUS_t00790 2519 2603 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2612 2706 gene locus_tag LOCUS_t00800 2612 2706 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2723 2878 gene locus_tag LOCUS_37670 2723 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 2887 2973 gene locus_tag LOCUS_t00810 2887 2973 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2981 3057 gene locus_tag LOCUS_t00820 2981 3057 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3081 3168 gene locus_tag LOCUS_t00830 3081 3168 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3380 3171 gene locus_tag LOCUS_37680 3380 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3652 3386 gene locus_tag LOCUS_37690 3652 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 3864 6182 gene locus_tag LOCUS_37700 3864 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 7609 6206 gene locus_tag LOCUS_37710 gene radA 7609 6206 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 protein_id gnl|my_center|LOCUS_37710 8623 7619 gene locus_tag LOCUS_37720 8623 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 11042 8808 gene locus_tag LOCUS_37730 gene parC 11042 8808 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262648.1 protein_id gnl|my_center|LOCUS_37730 12942 11044 gene locus_tag LOCUS_37740 gene parE 12942 11044 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377107.1 protein_id gnl|my_center|LOCUS_37740 13849 12956 gene locus_tag LOCUS_37750 13849 12956 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_37750 14022 15173 gene locus_tag LOCUS_37760 14022 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 16749 15124 gene locus_tag LOCUS_37770 16749 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 17619 16819 gene locus_tag LOCUS_37780 17619 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 19298 17616 gene locus_tag LOCUS_37790 gene recN 19298 17616 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879555.1 protein_id gnl|my_center|LOCUS_37790 20382 19414 gene locus_tag LOCUS_37800 20382 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 20511 21524 gene locus_tag LOCUS_37810 gene recA 20511 21524 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_37810 21638 22438 gene locus_tag LOCUS_37820 21638 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 22501 22998 gene locus_tag LOCUS_37830 22501 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 23001 23303 gene locus_tag LOCUS_37840 23001 23303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 24037 23300 gene locus_tag LOCUS_37850 24037 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 24197 24484 gene locus_tag LOCUS_37860 24197 24484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 24839 24486 gene locus_tag LOCUS_37870 24839 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 26047 24836 gene locus_tag LOCUS_37880 26047 24836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 26130 26858 gene locus_tag LOCUS_37890 gene ung 26130 26858 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_37890 26938 27252 gene locus_tag LOCUS_37900 26938 27252 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212150.1 protein_id gnl|my_center|LOCUS_37900 27399 27839 gene locus_tag LOCUS_37910 27399 27839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 >Feature sequence0086 421 864 gene locus_tag LOCUS_37920 421 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1562 861 gene locus_tag LOCUS_37930 1562 861 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_37930 3302 1650 gene locus_tag LOCUS_37940 gene nadB 3302 1650 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_37940 3999 3373 gene locus_tag LOCUS_37950 3999 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 4162 4905 gene locus_tag LOCUS_37960 4162 4905 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_37960 4931 5608 gene locus_tag LOCUS_37970 4931 5608 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_37970 5666 7786 gene locus_tag LOCUS_37980 gene recG 5666 7786 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_37980 7869 9674 gene locus_tag LOCUS_37990 7869 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 9741 10430 gene locus_tag LOCUS_38000 9741 10430 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_38000 12058 10505 gene locus_tag LOCUS_38010 12058 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 13406 12393 gene locus_tag LOCUS_38020 13406 12393 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_38020 14274 13390 gene locus_tag LOCUS_38030 14274 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 14411 16279 gene locus_tag LOCUS_38040 14411 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 16359 18671 gene locus_tag LOCUS_38050 16359 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 19394 18735 gene locus_tag LOCUS_38060 19394 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 19592 19407 gene locus_tag LOCUS_38070 19592 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 20656 19781 gene locus_tag LOCUS_38080 20656 19781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 21589 20768 gene locus_tag LOCUS_38090 21589 20768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 22458 21679 gene locus_tag LOCUS_38100 22458 21679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 23397 22567 gene locus_tag LOCUS_38110 23397 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 24645 23743 gene locus_tag LOCUS_38120 gene rsmA 24645 23743 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922514.1 protein_id gnl|my_center|LOCUS_38120 25071 24688 gene locus_tag LOCUS_38130 25071 24688 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_38130 26134 25061 gene locus_tag LOCUS_38140 gene pdxA 26134 25061 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_38140 26823 26182 gene locus_tag LOCUS_38150 26823 26182 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963911.1 protein_id gnl|my_center|LOCUS_38150 26940 27545 gene locus_tag LOCUS_38160 26940 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 27546 28436 gene locus_tag LOCUS_38170 27546 28436 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870012.1 protein_id gnl|my_center|LOCUS_38170 28530 29387 gene locus_tag LOCUS_38180 28530 29387 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence0087 705 1163 gene locus_tag LOCUS_38190 705 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 1206 3365 gene locus_tag LOCUS_38200 1206 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 4168 3392 gene locus_tag LOCUS_38210 4168 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 5269 4193 gene locus_tag LOCUS_38220 5269 4193 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023369.1 protein_id gnl|my_center|LOCUS_38220 5973 5401 gene locus_tag LOCUS_38230 5973 5401 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_38230 6716 6000 gene locus_tag LOCUS_38240 6716 6000 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_38240 7472 6717 gene locus_tag LOCUS_38250 7472 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 8512 7553 gene locus_tag LOCUS_38260 8512 7553 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_38260 8868 8560 gene locus_tag LOCUS_38270 8868 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 10328 8958 gene locus_tag LOCUS_38280 10328 8958 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_38280 11220 10528 gene locus_tag LOCUS_38290 11220 10528 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_38290 11696 11220 gene locus_tag LOCUS_38300 11696 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 11951 11715 gene locus_tag LOCUS_38310 11951 11715 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868932.1 protein_id gnl|my_center|LOCUS_38310 13203 11983 gene locus_tag LOCUS_38320 gene arsB 13203 11983 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_38320 14567 13200 gene locus_tag LOCUS_38330 14567 13200 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_38330 14860 14618 gene locus_tag LOCUS_38340 14860 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 15244 14915 gene locus_tag LOCUS_38350 15244 14915 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306389.1 protein_id gnl|my_center|LOCUS_38350 16779 15349 gene locus_tag LOCUS_38360 gene rpoN 16779 15349 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435015.1 protein_id gnl|my_center|LOCUS_38360 16879 16691 gene locus_tag LOCUS_38370 16879 16691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 17555 16950 gene locus_tag LOCUS_38380 gene recR 17555 16950 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_38380 19279 17585 gene locus_tag LOCUS_38390 gene dnaX 19279 17585 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_38390 19702 19331 gene locus_tag LOCUS_38400 19702 19331 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_38400 20046 20228 gene locus_tag LOCUS_38410 20046 20228 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430011.1 protein_id gnl|my_center|LOCUS_38410 21601 20339 gene locus_tag LOCUS_38420 21601 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 22509 21601 gene locus_tag LOCUS_38430 22509 21601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966215.1 protein_id gnl|my_center|LOCUS_38430 23357 22548 gene locus_tag LOCUS_38440 gene proC 23357 22548 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_38440 23481 23984 gene locus_tag LOCUS_38450 23481 23984 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082774.1 protein_id gnl|my_center|LOCUS_38450 23998 24171 gene locus_tag LOCUS_38460 23998 24171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 24498 26639 gene locus_tag LOCUS_38470 24498 26639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 27458 26850 gene locus_tag LOCUS_38480 27458 26850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 29253 27562 gene locus_tag LOCUS_38490 29253 27562 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence0088 812 885 gene locus_tag LOCUS_t00840 812 885 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 890 2431 gene locus_tag LOCUS_38500 gene guaA 890 2431 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_38500 3528 2479 gene locus_tag LOCUS_38510 gene ruvB 3528 2479 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476176.1 protein_id gnl|my_center|LOCUS_38510 4209 3580 gene locus_tag LOCUS_38520 4209 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 4721 4236 gene locus_tag LOCUS_38530 gene ruvC 4721 4236 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_38530 6196 4718 gene locus_tag LOCUS_38540 gene cysS 6196 4718 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_38540 6732 6220 gene locus_tag LOCUS_38550 gene ispF 6732 6220 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680204.1 protein_id gnl|my_center|LOCUS_38550 7313 6729 gene locus_tag LOCUS_38560 gene hisB 7313 6729 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_38560 8416 7373 gene locus_tag LOCUS_38570 gene hisC 8416 7373 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_38570 9658 8489 gene locus_tag LOCUS_38580 9658 8489 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_38580 10770 9724 gene locus_tag LOCUS_38590 gene rhaT 10770 9724 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_38590 11359 10889 gene locus_tag LOCUS_38600 11359 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 12244 11399 gene locus_tag LOCUS_38610 gene accD 12244 11399 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_38610 13022 12357 gene locus_tag LOCUS_38620 gene rpe 13022 12357 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811794.1 protein_id gnl|my_center|LOCUS_38620 14304 13051 gene locus_tag LOCUS_38630 14304 13051 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_38630 15445 14432 gene locus_tag LOCUS_38640 gene gap 15445 14432 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118955.1 protein_id gnl|my_center|LOCUS_38640 15871 16518 gene locus_tag LOCUS_38650 15871 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 17975 16533 gene locus_tag LOCUS_38660 17975 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 18134 18694 gene locus_tag LOCUS_38670 18134 18694 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_38670 18696 20042 gene locus_tag LOCUS_38680 18696 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 20205 20957 gene locus_tag LOCUS_38690 20205 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 22012 21665 gene locus_tag LOCUS_38700 22012 21665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 22231 22076 gene locus_tag LOCUS_38710 22231 22076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 22394 22564 gene locus_tag LOCUS_38720 22394 22564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 23523 22729 gene locus_tag LOCUS_38730 23523 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 24069 23749 gene locus_tag LOCUS_38740 24069 23749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 24508 24903 gene locus_tag LOCUS_38750 24508 24903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 25954 24932 gene locus_tag LOCUS_38760 25954 24932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 26406 26780 gene locus_tag LOCUS_38770 26406 26780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 27253 26906 gene locus_tag LOCUS_38780 27253 26906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 28264 27269 gene locus_tag LOCUS_38790 28264 27269 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_38790 29328 28423 gene locus_tag LOCUS_38800 29328 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence0089 227 1612 gene locus_tag LOCUS_38810 227 1612 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_38810 1669 3060 gene locus_tag LOCUS_38820 1669 3060 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_38820 5650 3095 gene locus_tag LOCUS_38830 5650 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 9079 5681 gene locus_tag LOCUS_38840 9079 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 10357 9092 gene locus_tag LOCUS_38850 10357 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 12636 10414 gene locus_tag LOCUS_38860 12636 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 14570 12636 gene locus_tag LOCUS_38870 14570 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 14880 14620 gene locus_tag LOCUS_38880 14880 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 15736 14846 gene locus_tag LOCUS_38890 15736 14846 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_38890 16950 15775 gene locus_tag LOCUS_38900 16950 15775 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_38900 18444 16966 gene locus_tag LOCUS_38910 18444 16966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 19056 20405 gene locus_tag LOCUS_38920 19056 20405 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_38920 20788 21648 gene locus_tag LOCUS_38930 20788 21648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 21659 22987 gene locus_tag LOCUS_38940 21659 22987 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_38940 23002 24114 gene locus_tag LOCUS_38950 23002 24114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 24515 24841 gene locus_tag LOCUS_38960 24515 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 25480 24989 gene locus_tag LOCUS_38970 25480 24989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 26208 25579 gene locus_tag LOCUS_38980 26208 25579 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_38980 28665 26362 gene locus_tag LOCUS_38990 28665 26362 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_38990 >Feature sequence0090 337 1101 gene locus_tag LOCUS_39000 337 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 1398 1129 gene locus_tag LOCUS_39010 1398 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 1546 2838 gene locus_tag LOCUS_39020 1546 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 2838 3518 gene locus_tag LOCUS_39030 gene cmk 2838 3518 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_39030 3523 4194 gene locus_tag LOCUS_39040 3523 4194 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_39040 5243 4467 gene locus_tag LOCUS_39050 5243 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 5844 5629 gene locus_tag LOCUS_39060 5844 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 6399 6013 gene locus_tag LOCUS_39070 6399 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 7605 8300 gene locus_tag LOCUS_39080 7605 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 8481 8843 gene locus_tag LOCUS_39090 8481 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 8840 9745 gene locus_tag LOCUS_39100 8840 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 9738 11297 gene locus_tag LOCUS_39110 9738 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 14731 12080 gene locus_tag LOCUS_39120 14731 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 15026 16333 gene locus_tag LOCUS_39130 15026 16333 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_39130 16533 17864 gene locus_tag LOCUS_39140 16533 17864 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921627.1 protein_id gnl|my_center|LOCUS_39140 17914 19113 gene locus_tag LOCUS_39150 17914 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 20131 19154 gene locus_tag LOCUS_39160 20131 19154 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_39160 21551 20268 gene locus_tag LOCUS_39170 21551 20268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122044.1 protein_id gnl|my_center|LOCUS_39170 22040 23035 gene locus_tag LOCUS_39180 gene xerD 22040 23035 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_39180 23090 25396 gene locus_tag LOCUS_39190 23090 25396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 26054 26125 gene locus_tag LOCUS_t00850 26054 26125 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26263 27477 gene locus_tag LOCUS_39200 gene tuf 26263 27477 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143916.1 protein_id gnl|my_center|LOCUS_39200 27864 27938 gene locus_tag LOCUS_t00860 27864 27938 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 28012 28395 gene locus_tag LOCUS_39210 28012 28395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence0091 <1 560 gene locus_tag LOCUS_39220 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000675870.1:tyrosine-type recombinase/integrase 2017 578 gene locus_tag LOCUS_39230 2017 578 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045022.1 protein_id gnl|my_center|LOCUS_39230 3214 2075 gene locus_tag LOCUS_39240 3214 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 3966 3211 gene locus_tag LOCUS_39250 3966 3211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023853.1 protein_id gnl|my_center|LOCUS_39250 5174 3963 gene locus_tag LOCUS_39260 5174 3963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068184.1 protein_id gnl|my_center|LOCUS_39260 5608 5171 gene locus_tag LOCUS_39270 5608 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 5994 5605 gene locus_tag LOCUS_39280 5994 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 7425 6001 gene locus_tag LOCUS_39290 7425 6001 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877655.1 protein_id gnl|my_center|LOCUS_39290 8809 7406 gene locus_tag LOCUS_39300 8809 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 9488 8802 gene locus_tag LOCUS_39310 9488 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 10587 9448 gene locus_tag LOCUS_39320 10587 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 13643 10584 gene locus_tag LOCUS_39330 13643 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 15225 14461 gene locus_tag LOCUS_39340 15225 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 16621 15536 gene locus_tag LOCUS_39350 16621 15536 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_39350 17741 16608 gene locus_tag LOCUS_39360 17741 16608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 17941 17738 gene locus_tag LOCUS_39370 17941 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 18610 23160 gene locus_tag LOCUS_39380 gene gltB 18610 23160 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_39380 23160 24587 gene locus_tag LOCUS_39390 23160 24587 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964981.1 protein_id gnl|my_center|LOCUS_39390 26556 25117 gene locus_tag LOCUS_39400 26556 25117 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_39400 27055 28095 gene locus_tag LOCUS_39410 27055 28095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 >Feature sequence0092 211 951 gene locus_tag LOCUS_39420 gene istB 211 951 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_39420 1523 2386 gene locus_tag LOCUS_39430 1523 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 2416 2856 gene locus_tag LOCUS_39440 2416 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 2922 4340 gene locus_tag LOCUS_39450 2922 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 4755 5045 gene locus_tag LOCUS_39460 4755 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 5629 5138 gene locus_tag LOCUS_39470 5629 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 6557 7117 gene locus_tag LOCUS_39480 6557 7117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 7198 8592 gene locus_tag LOCUS_39490 7198 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 8648 9151 gene locus_tag LOCUS_39500 8648 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 11099 9480 gene locus_tag LOCUS_39510 11099 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 11238 11089 gene locus_tag LOCUS_39520 11238 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 12145 11435 gene locus_tag LOCUS_39530 12145 11435 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176599.1 protein_id gnl|my_center|LOCUS_39530 12388 12149 gene locus_tag LOCUS_39540 12388 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 12835 13509 gene locus_tag LOCUS_39550 12835 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 14295 13633 gene locus_tag LOCUS_39560 14295 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 14374 14802 gene locus_tag LOCUS_39570 gene umuD 14374 14802 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882790.1 protein_id gnl|my_center|LOCUS_39570 14802 16055 gene locus_tag LOCUS_39580 14802 16055 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705848.1 protein_id gnl|my_center|LOCUS_39580 16548 16258 gene locus_tag LOCUS_39590 16548 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 17614 17087 gene locus_tag LOCUS_39600 17614 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 18167 17643 gene locus_tag LOCUS_39610 18167 17643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_39610 19136 18267 gene locus_tag LOCUS_39620 19136 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 19682 19218 gene locus_tag LOCUS_39630 19682 19218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464485.1 protein_id gnl|my_center|LOCUS_39630 20582 19731 gene locus_tag LOCUS_39640 20582 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39640 20902 20594 gene locus_tag LOCUS_39650 20902 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39650 21511 21044 gene locus_tag LOCUS_39660 21511 21044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 22561 21635 gene locus_tag LOCUS_39670 22561 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 23419 23039 gene locus_tag LOCUS_39680 23419 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 23867 23511 gene locus_tag LOCUS_39690 23867 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 24537 23983 gene locus_tag LOCUS_39700 24537 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 24900 24709 gene locus_tag LOCUS_39710 24900 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 25247 25068 gene locus_tag LOCUS_39720 25247 25068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 25842 25456 gene locus_tag LOCUS_39730 25842 25456 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 protein_id gnl|my_center|LOCUS_39730 26406 25942 gene locus_tag LOCUS_39740 26406 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 26978 26532 gene locus_tag LOCUS_39750 26978 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 27803 27117 gene locus_tag LOCUS_39760 27803 27117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 >Feature sequence0093 606 2486 gene locus_tag LOCUS_39770 gene sppA 606 2486 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080518.1 protein_id gnl|my_center|LOCUS_39770 3127 3666 gene locus_tag LOCUS_39780 3127 3666 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222027.1 protein_id gnl|my_center|LOCUS_39780 3670 4263 gene locus_tag LOCUS_39790 3670 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 4244 5614 gene locus_tag LOCUS_39800 4244 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 5721 6833 gene locus_tag LOCUS_39810 5721 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 6864 7616 gene locus_tag LOCUS_39820 6864 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 7674 8897 gene locus_tag LOCUS_39830 7674 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 9329 10276 gene locus_tag LOCUS_39840 9329 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 10431 10895 gene locus_tag LOCUS_39850 10431 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 11062 12456 gene locus_tag LOCUS_39860 11062 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 12512 12913 gene locus_tag LOCUS_39870 12512 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 13030 13476 gene locus_tag LOCUS_39880 13030 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 13460 13915 gene locus_tag LOCUS_39890 13460 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 15577 14669 gene locus_tag LOCUS_39900 15577 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 16618 16379 gene locus_tag LOCUS_39910 16618 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 18203 16938 gene locus_tag LOCUS_39920 18203 16938 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466568.1 protein_id gnl|my_center|LOCUS_39920 19510 18197 gene locus_tag LOCUS_39930 gene algD 19510 18197 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_39930 21930 19855 gene locus_tag LOCUS_39940 21930 19855 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_39940 22460 22299 gene locus_tag LOCUS_39950 22460 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 24001 22781 gene locus_tag LOCUS_39960 24001 22781 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963437.1 protein_id gnl|my_center|LOCUS_39960 24811 24014 gene locus_tag LOCUS_39970 24811 24014 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963436.1 protein_id gnl|my_center|LOCUS_39970 26765 25119 gene locus_tag LOCUS_39980 26765 25119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 27594 27022 gene locus_tag LOCUS_39990 27594 27022 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762480.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence0094 61 804 gene locus_tag LOCUS_40000 61 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1163 2503 gene locus_tag LOCUS_40010 1163 2503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_40010 2830 4818 gene locus_tag LOCUS_40020 2830 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4938 7658 gene locus_tag LOCUS_40030 4938 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 7771 8100 gene locus_tag LOCUS_40040 7771 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 8155 10410 gene locus_tag LOCUS_40050 8155 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 11639 10503 gene locus_tag LOCUS_40060 11639 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 11999 13441 gene locus_tag LOCUS_40070 11999 13441 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081553.1 protein_id gnl|my_center|LOCUS_40070 13504 15279 gene locus_tag LOCUS_40080 13504 15279 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_40080 15809 15360 gene locus_tag LOCUS_40090 15809 15360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 16052 15825 gene locus_tag LOCUS_40100 16052 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 16372 16052 gene locus_tag LOCUS_40110 16372 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 16455 16658 gene locus_tag LOCUS_40120 16455 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 17277 18242 gene locus_tag LOCUS_40130 17277 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 18578 19678 gene locus_tag LOCUS_40140 18578 19678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 19709 20911 gene locus_tag LOCUS_40150 gene metK 19709 20911 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_40150 21014 21577 gene locus_tag LOCUS_40160 21014 21577 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_40160 21580 22206 gene locus_tag LOCUS_40170 21580 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 22173 23483 gene locus_tag LOCUS_40180 22173 23483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 25221 23611 gene locus_tag LOCUS_40190 gene purH 25221 23611 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_40190 26447 25335 gene locus_tag LOCUS_40200 26447 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 26773 26477 gene locus_tag LOCUS_40210 26773 26477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence0095 478 1191 gene locus_tag LOCUS_40220 gene modA 478 1191 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948645.1 protein_id gnl|my_center|LOCUS_40220 1303 1773 gene locus_tag LOCUS_40230 1303 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 1773 2153 gene locus_tag LOCUS_40240 1773 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2153 2980 gene locus_tag LOCUS_40250 2153 2980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249669.1 protein_id gnl|my_center|LOCUS_40250 2977 3747 gene locus_tag LOCUS_40260 2977 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 4459 3803 gene locus_tag LOCUS_40270 4459 3803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902779.1 protein_id gnl|my_center|LOCUS_40270 5799 4513 gene locus_tag LOCUS_40280 5799 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 6821 5796 gene locus_tag LOCUS_40290 6821 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 10382 7014 gene locus_tag LOCUS_40300 10382 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 10917 12200 gene locus_tag LOCUS_40310 10917 12200 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_40310 12221 12481 gene locus_tag LOCUS_40320 12221 12481 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003502080.1 protein_id gnl|my_center|LOCUS_40320 12519 13913 gene locus_tag LOCUS_40330 12519 13913 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_40330 14984 13920 gene locus_tag LOCUS_40340 14984 13920 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_40340 15171 16718 gene locus_tag LOCUS_40350 15171 16718 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_40350 16719 17747 gene locus_tag LOCUS_40360 gene rbsC 16719 17747 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_40360 17753 18727 gene locus_tag LOCUS_40370 17753 18727 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764495.1 protein_id gnl|my_center|LOCUS_40370 18752 19174 gene locus_tag LOCUS_40380 18752 19174 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 protein_id gnl|my_center|LOCUS_40380 19203 20315 gene locus_tag LOCUS_40390 19203 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 20529 21851 gene locus_tag LOCUS_40400 20529 21851 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_40400 22229 23038 gene locus_tag LOCUS_40410 22229 23038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_40410 23072 23926 gene locus_tag LOCUS_40420 23072 23926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_40420 23969 26845 gene locus_tag LOCUS_40430 23969 26845 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_40430 27222 26947 gene locus_tag LOCUS_40440 27222 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 >Feature sequence0096 222 491 gene locus_tag LOCUS_40450 222 491 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_40450 946 527 gene locus_tag LOCUS_40460 946 527 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_40460 3024 982 gene locus_tag LOCUS_40470 3024 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 3914 3066 gene locus_tag LOCUS_40480 3914 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 7034 4128 gene locus_tag LOCUS_40490 7034 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 7454 7852 gene locus_tag LOCUS_40500 7454 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 7836 9134 gene locus_tag LOCUS_40510 7836 9134 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_40510 9247 9816 gene locus_tag LOCUS_40520 9247 9816 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_40520 9984 11159 gene locus_tag LOCUS_40530 9984 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 11500 11207 gene locus_tag LOCUS_40540 11500 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 12018 11797 gene locus_tag LOCUS_40550 12018 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 12519 12139 gene locus_tag LOCUS_40560 12519 12139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117780.1 protein_id gnl|my_center|LOCUS_40560 13246 12614 gene locus_tag LOCUS_40570 13246 12614 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_40570 13862 13380 gene locus_tag LOCUS_40580 13862 13380 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143557.1 protein_id gnl|my_center|LOCUS_40580 14486 14283 gene locus_tag LOCUS_40590 gene cspC 14486 14283 CDS product cold shock-like protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874276.1 protein_id gnl|my_center|LOCUS_40590 15041 14763 gene locus_tag LOCUS_40600 15041 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 15764 17002 gene locus_tag LOCUS_40610 15764 17002 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399796.1 protein_id gnl|my_center|LOCUS_40610 17097 18302 gene locus_tag LOCUS_40620 17097 18302 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_40620 18420 19268 gene locus_tag LOCUS_40630 18420 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 19384 20841 gene locus_tag LOCUS_40640 19384 20841 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_40640 25491 20842 gene locus_tag LOCUS_40650 25491 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 25856 27163 gene locus_tag LOCUS_40660 25856 27163 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_40660 >Feature sequence0097 1929 679 gene locus_tag LOCUS_40670 gene ahbC 1929 679 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_40670 3071 1962 gene locus_tag LOCUS_40680 gene ahbD 3071 1962 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_40680 4375 3068 gene locus_tag LOCUS_40690 gene hemA 4375 3068 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_40690 5267 4395 gene locus_tag LOCUS_40700 5267 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 5781 5281 gene locus_tag LOCUS_40710 5781 5281 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_40710 6033 6968 gene locus_tag LOCUS_40720 gene hemC 6033 6968 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939176.1 protein_id gnl|my_center|LOCUS_40720 6919 7080 gene locus_tag LOCUS_40730 6919 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 7255 11715 gene locus_tag LOCUS_40740 7255 11715 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392708.1 protein_id gnl|my_center|LOCUS_40740 11708 12139 gene locus_tag LOCUS_40750 11708 12139 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_40750 12136 12696 gene locus_tag LOCUS_40760 12136 12696 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940769.1 protein_id gnl|my_center|LOCUS_40760 12693 13565 gene locus_tag LOCUS_40770 12693 13565 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_40770 13562 14230 gene locus_tag LOCUS_40780 13562 14230 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_40780 14227 15147 gene locus_tag LOCUS_40790 14227 15147 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392705.1 protein_id gnl|my_center|LOCUS_40790 15247 15732 gene locus_tag LOCUS_40800 gene nuoE 15247 15732 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_40800 15738 17582 gene locus_tag LOCUS_40810 gene nuoF 15738 17582 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_40810 17586 20291 gene locus_tag LOCUS_40820 gene fdhF 17586 20291 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_40820 22174 20369 gene locus_tag LOCUS_40830 22174 20369 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_40830 23407 22199 gene locus_tag LOCUS_40840 23407 22199 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_40840 26780 23418 gene locus_tag LOCUS_40850 26780 23418 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_40850 >Feature sequence0098 261 2240 gene locus_tag LOCUS_40860 gene feoB 261 2240 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_40860 2250 2924 gene locus_tag LOCUS_40870 2250 2924 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942031.1 protein_id gnl|my_center|LOCUS_40870 6916 3119 gene locus_tag LOCUS_40880 6916 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 8353 7007 gene locus_tag LOCUS_40890 8353 7007 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_40890 11188 8381 gene locus_tag LOCUS_40900 11188 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 11572 12336 gene locus_tag LOCUS_40910 11572 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 12333 13118 gene locus_tag LOCUS_40920 12333 13118 CDS product C-GCAxxG-C-C family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812774.1 protein_id gnl|my_center|LOCUS_40920 13157 14503 gene locus_tag LOCUS_40930 13157 14503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_40930 15093 15893 gene locus_tag LOCUS_40940 15093 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 15934 17121 gene locus_tag LOCUS_40950 15934 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 18607 17183 gene locus_tag LOCUS_40960 18607 17183 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 protein_id gnl|my_center|LOCUS_40960 20319 18610 gene locus_tag LOCUS_40970 20319 18610 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584082.1 protein_id gnl|my_center|LOCUS_40970 21406 20399 gene locus_tag LOCUS_40980 21406 20399 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_40980 22254 21433 gene locus_tag LOCUS_40990 22254 21433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 22518 25808 gene locus_tag LOCUS_41000 22518 25808 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_41000 26051 26665 gene locus_tag LOCUS_41010 26051 26665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 >Feature sequence0099 1454 2323 gene locus_tag LOCUS_41020 1454 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4427 2397 gene locus_tag LOCUS_41030 4427 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 6106 4715 gene locus_tag LOCUS_41040 6106 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 6388 6807 gene locus_tag LOCUS_41050 6388 6807 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_41050 6851 7570 gene locus_tag LOCUS_41060 6851 7570 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023861.1 protein_id gnl|my_center|LOCUS_41060 7677 9284 gene locus_tag LOCUS_41070 7677 9284 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120288.1 protein_id gnl|my_center|LOCUS_41070 9394 12978 gene locus_tag LOCUS_41080 gene smc 9394 12978 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_41080 14125 13175 gene locus_tag LOCUS_41090 14125 13175 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_41090 15387 14143 gene locus_tag LOCUS_41100 15387 14143 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674227.1 protein_id gnl|my_center|LOCUS_41100 17460 15412 gene locus_tag LOCUS_41110 17460 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 18441 17584 gene locus_tag LOCUS_41120 18441 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 19148 18465 gene locus_tag LOCUS_41130 gene larB 19148 18465 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_41130 20097 19732 gene locus_tag LOCUS_41140 20097 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 21007 20174 gene locus_tag LOCUS_41150 21007 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 22194 21148 gene locus_tag LOCUS_41160 gene tsaD 22194 21148 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_41160 22349 22894 gene locus_tag LOCUS_41170 22349 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 22891 23142 gene locus_tag LOCUS_41180 22891 23142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 23226 23624 gene locus_tag LOCUS_41190 23226 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 24316 23657 gene locus_tag LOCUS_41200 24316 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 25330 24365 gene locus_tag LOCUS_41210 25330 24365 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140932.1 protein_id gnl|my_center|LOCUS_41210 26258 25338 gene locus_tag LOCUS_41220 26258 25338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 26752 26570 gene locus_tag LOCUS_41230 26752 26570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence0100 468 1007 gene locus_tag LOCUS_41240 468 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 1757 2290 gene locus_tag LOCUS_41250 1757 2290 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_41250 2378 2899 gene locus_tag LOCUS_41260 2378 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 2902 3393 gene locus_tag LOCUS_41270 2902 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 3396 5996 gene locus_tag LOCUS_41280 3396 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 6229 7602 gene locus_tag LOCUS_41290 6229 7602 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_41290 7664 8758 gene locus_tag LOCUS_41300 7664 8758 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_41300 8835 11033 gene locus_tag LOCUS_41310 8835 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 11189 12175 gene locus_tag LOCUS_41320 11189 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 12302 13192 gene locus_tag LOCUS_41330 12302 13192 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792911.1 protein_id gnl|my_center|LOCUS_41330 13314 14564 gene locus_tag LOCUS_41340 13314 14564 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_41340 14557 16059 gene locus_tag LOCUS_41350 14557 16059 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819246.1 protein_id gnl|my_center|LOCUS_41350 16115 17350 gene locus_tag LOCUS_41360 16115 17350 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_41360 18594 17374 gene locus_tag LOCUS_41370 18594 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 18856 19857 gene locus_tag LOCUS_41380 18856 19857 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_41380 19887 21359 gene locus_tag LOCUS_41390 19887 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 21759 23375 gene locus_tag LOCUS_41400 21759 23375 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_41400 23398 25209 gene locus_tag LOCUS_41410 23398 25209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 25764 25291 gene locus_tag LOCUS_41420 25764 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 26506 25841 gene locus_tag LOCUS_41430 26506 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 >Feature sequence0101 2013 2447 gene locus_tag LOCUS_41440 2013 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3073 4062 gene locus_tag LOCUS_41450 3073 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 4892 5743 gene locus_tag LOCUS_41460 4892 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5736 5915 gene locus_tag LOCUS_41470 5736 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 6459 7145 gene locus_tag LOCUS_41480 6459 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 7142 8260 gene locus_tag LOCUS_41490 7142 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 8217 9740 gene locus_tag LOCUS_41500 8217 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 9963 11771 gene locus_tag LOCUS_41510 9963 11771 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310915.1 protein_id gnl|my_center|LOCUS_41510 11895 13178 gene locus_tag LOCUS_41520 11895 13178 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_41520 13334 13984 gene locus_tag LOCUS_41530 13334 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 14044 14397 gene locus_tag LOCUS_41540 14044 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 14467 14724 gene locus_tag LOCUS_41550 14467 14724 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_41550 14822 15739 gene locus_tag LOCUS_41560 14822 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 16086 18080 gene locus_tag LOCUS_41570 gene asnB 16086 18080 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 protein_id gnl|my_center|LOCUS_41570 18108 19712 gene locus_tag LOCUS_41580 18108 19712 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 protein_id gnl|my_center|LOCUS_41580 19709 20704 gene locus_tag LOCUS_41590 gene nadE 19709 20704 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976175.1 protein_id gnl|my_center|LOCUS_41590 21213 22808 gene locus_tag LOCUS_41600 21213 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 24764 23766 gene locus_tag LOCUS_41610 24764 23766 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_41610 24935 25951 gene locus_tag LOCUS_41620 24935 25951 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970910.1 protein_id gnl|my_center|LOCUS_41620 >Feature sequence0102 1328 2272 gene locus_tag LOCUS_41630 1328 2272 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_41630 2436 4082 gene locus_tag LOCUS_41640 2436 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 4250 6832 gene locus_tag LOCUS_41650 4250 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 6838 7566 gene locus_tag LOCUS_41660 6838 7566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582813.1 protein_id gnl|my_center|LOCUS_41660 7579 8028 gene locus_tag LOCUS_41670 gene dtd 7579 8028 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_41670 8142 9020 gene locus_tag LOCUS_41680 gene argB 8142 9020 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_41680 9088 10269 gene locus_tag LOCUS_41690 9088 10269 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_41690 10269 11180 gene locus_tag LOCUS_41700 gene argF 10269 11180 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_41700 11197 11820 gene locus_tag LOCUS_41710 11197 11820 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_41710 11944 13446 gene locus_tag LOCUS_41720 11944 13446 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_41720 13632 16004 gene locus_tag LOCUS_41730 gene topA 13632 16004 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_41730 17732 16950 gene locus_tag LOCUS_41740 17732 16950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 18566 17787 gene locus_tag LOCUS_41750 18566 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 19338 18577 gene locus_tag LOCUS_41760 19338 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 19511 19831 gene locus_tag LOCUS_41770 19511 19831 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_41770 20211 20846 gene locus_tag LOCUS_41780 20211 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 20922 21218 gene locus_tag LOCUS_41790 20922 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 21340 21894 gene locus_tag LOCUS_41800 21340 21894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 21995 23359 gene locus_tag LOCUS_41810 21995 23359 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_41810 23817 25346 gene locus_tag LOCUS_41820 23817 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence0103 2309 3367 gene locus_tag LOCUS_41830 2309 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 3389 4444 gene locus_tag LOCUS_41840 3389 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 5239 4466 gene locus_tag LOCUS_41850 gene fabG 5239 4466 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_41850 5390 6499 gene locus_tag LOCUS_41860 5390 6499 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005392234.1 protein_id gnl|my_center|LOCUS_41860 6532 7614 gene locus_tag LOCUS_41870 6532 7614 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764572.1 protein_id gnl|my_center|LOCUS_41870 9194 7647 gene locus_tag LOCUS_41880 gene xylB 9194 7647 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 protein_id gnl|my_center|LOCUS_41880 10028 9225 gene locus_tag LOCUS_41890 10028 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41890 10262 10029 gene locus_tag LOCUS_41900 10262 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 10518 11621 gene locus_tag LOCUS_41910 gene rhaT 10518 11621 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767241.1 protein_id gnl|my_center|LOCUS_41910 14056 11603 gene locus_tag LOCUS_41920 14056 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 14276 15130 gene locus_tag LOCUS_41930 14276 15130 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_41930 15149 16210 gene locus_tag LOCUS_41940 15149 16210 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_41940 16434 18257 gene locus_tag LOCUS_41950 16434 18257 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_41950 18822 19199 gene locus_tag LOCUS_41960 18822 19199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 19189 19647 gene locus_tag LOCUS_41970 19189 19647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377010.1 protein_id gnl|my_center|LOCUS_41970 19680 20039 gene locus_tag LOCUS_41980 gene bldG 19680 20039 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_41980 20036 20902 gene locus_tag LOCUS_41990 20036 20902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_41990 20928 21791 gene locus_tag LOCUS_42000 20928 21791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_42000 21836 23050 gene locus_tag LOCUS_42010 21836 23050 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328526.1 protein_id gnl|my_center|LOCUS_42010 23258 24895 gene locus_tag LOCUS_42020 23258 24895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 25120 25674 gene locus_tag LOCUS_42030 25120 25674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 25882 26127 gene locus_tag LOCUS_42040 25882 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence0104 5559 2260 gene locus_tag LOCUS_42050 5559 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 7054 5621 gene locus_tag LOCUS_42060 7054 5621 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_42060 8553 7219 gene locus_tag LOCUS_42070 8553 7219 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_42070 9874 8540 gene locus_tag LOCUS_42080 9874 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 10265 11551 gene locus_tag LOCUS_42090 10265 11551 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_42090 11621 12961 gene locus_tag LOCUS_42100 11621 12961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_42100 13200 14030 gene locus_tag LOCUS_42110 13200 14030 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121783.1 protein_id gnl|my_center|LOCUS_42110 14591 14791 gene locus_tag LOCUS_42120 14591 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 14818 15249 gene locus_tag LOCUS_42130 14818 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 18653 15426 gene locus_tag LOCUS_42140 gene lacZ 18653 15426 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_42140 19349 18891 gene locus_tag LOCUS_42150 19349 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 22373 19428 gene locus_tag LOCUS_42160 22373 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 23669 23022 gene locus_tag LOCUS_42170 23669 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 24383 23673 gene locus_tag LOCUS_42180 24383 23673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 25096 24380 gene locus_tag LOCUS_42190 25096 24380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_42190 26148 25168 gene locus_tag LOCUS_42200 26148 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence0105 971 306 gene locus_tag LOCUS_42210 971 306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397598.1 protein_id gnl|my_center|LOCUS_42210 1883 1029 gene locus_tag LOCUS_42220 1883 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 2429 1944 gene locus_tag LOCUS_42230 2429 1944 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_42230 3952 2549 gene locus_tag LOCUS_42240 3952 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 5309 4035 gene locus_tag LOCUS_42250 gene leuC 5309 4035 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880579.1 protein_id gnl|my_center|LOCUS_42250 6924 5359 gene locus_tag LOCUS_42260 6924 5359 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_42260 8075 10105 gene locus_tag LOCUS_42270 8075 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 10352 10702 gene locus_tag LOCUS_42280 10352 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 11439 10993 gene locus_tag LOCUS_42290 11439 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 13893 12040 gene locus_tag LOCUS_42300 13893 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 14213 15052 gene locus_tag LOCUS_42310 14213 15052 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_42310 15237 17000 gene locus_tag LOCUS_42320 15237 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 17226 17702 gene locus_tag LOCUS_42330 17226 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 17929 18420 gene locus_tag LOCUS_42340 17929 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 18570 19034 gene locus_tag LOCUS_42350 18570 19034 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023053.1 protein_id gnl|my_center|LOCUS_42350 20141 19176 gene locus_tag LOCUS_42360 20141 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 20282 20431 gene locus_tag LOCUS_42370 20282 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 20558 21856 gene locus_tag LOCUS_42380 20558 21856 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_42380 22054 23220 gene locus_tag LOCUS_42390 22054 23220 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_42390 23266 25467 gene locus_tag LOCUS_42400 23266 25467 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_42400 >Feature sequence0106 397 1455 gene locus_tag LOCUS_42410 397 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 1532 5203 gene locus_tag LOCUS_42420 1532 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537155.1 protein_id gnl|my_center|LOCUS_42420 5261 6667 gene locus_tag LOCUS_42430 5261 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 7370 16813 gene locus_tag LOCUS_42440 7370 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 16984 17787 gene locus_tag LOCUS_42450 16984 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 17787 19610 gene locus_tag LOCUS_42460 17787 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 19603 21549 gene locus_tag LOCUS_42470 19603 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 22530 21793 gene locus_tag LOCUS_42480 22530 21793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 22908 23666 gene locus_tag LOCUS_42490 22908 23666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 25609 23684 gene locus_tag LOCUS_42500 25609 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 >Feature sequence0107 67 384 gene locus_tag LOCUS_42510 67 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 372 1244 gene locus_tag LOCUS_42520 372 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 1345 1418 gene locus_tag LOCUS_t00870 1345 1418 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1461 3059 gene locus_tag LOCUS_42530 1461 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 5519 3105 gene locus_tag LOCUS_42540 5519 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 8790 5560 gene locus_tag LOCUS_42550 8790 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 9877 8894 gene locus_tag LOCUS_42560 9877 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 10095 9913 gene locus_tag LOCUS_42570 10095 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 10311 13607 gene locus_tag LOCUS_42580 10311 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 14391 13639 gene locus_tag LOCUS_42590 14391 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 15078 14566 gene locus_tag LOCUS_42600 15078 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 15373 16287 gene locus_tag LOCUS_42610 15373 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 16287 16919 gene locus_tag LOCUS_42620 16287 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 16916 17542 gene locus_tag LOCUS_42630 gene nqrD 16916 17542 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883072.1 protein_id gnl|my_center|LOCUS_42630 17539 18141 gene locus_tag LOCUS_42640 gene nqrE 17539 18141 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401432.1 protein_id gnl|my_center|LOCUS_42640 18168 19271 gene locus_tag LOCUS_42650 gene nqrF 18168 19271 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 protein_id gnl|my_center|LOCUS_42650 19293 19745 gene locus_tag LOCUS_42660 19293 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 21229 19817 gene locus_tag LOCUS_42670 21229 19817 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325301.1 protein_id gnl|my_center|LOCUS_42670 21540 21229 gene locus_tag LOCUS_42680 21540 21229 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_42680 22686 21553 gene locus_tag LOCUS_42690 22686 21553 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_42690 25254 22717 gene locus_tag LOCUS_42700 25254 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence0108 1195 836 gene locus_tag LOCUS_42710 1195 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 1969 1271 gene locus_tag LOCUS_42720 1969 1271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020206.1 protein_id gnl|my_center|LOCUS_42720 5182 2540 gene locus_tag LOCUS_42730 5182 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 5793 5182 gene locus_tag LOCUS_42740 5793 5182 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_42740 5967 7787 gene locus_tag LOCUS_42750 5967 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 7866 8465 gene locus_tag LOCUS_42760 7866 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 8617 10278 gene locus_tag LOCUS_42770 8617 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141929.1 protein_id gnl|my_center|LOCUS_42770 10860 10705 gene locus_tag LOCUS_42780 10860 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 11458 13713 gene locus_tag LOCUS_42790 11458 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 14953 16434 gene locus_tag LOCUS_42800 14953 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 19131 16780 gene locus_tag LOCUS_42810 gene secA2 19131 16780 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_42810 19801 19490 gene locus_tag LOCUS_42820 19801 19490 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532486.1 protein_id gnl|my_center|LOCUS_42820 20399 19788 gene locus_tag LOCUS_42830 20399 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 20961 21518 gene locus_tag LOCUS_42840 20961 21518 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_42840 21742 24315 gene locus_tag LOCUS_42850 21742 24315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 24564 25619 gene locus_tag LOCUS_42860 24564 25619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence0109 1352 291 gene locus_tag LOCUS_42870 1352 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 2223 1486 gene locus_tag LOCUS_42880 2223 1486 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_42880 2347 3459 gene locus_tag LOCUS_42890 2347 3459 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 protein_id gnl|my_center|LOCUS_42890 3650 6295 gene locus_tag LOCUS_42900 gene gyrA 3650 6295 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_42900 6327 7283 gene locus_tag LOCUS_42910 6327 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 7429 7905 gene locus_tag LOCUS_42920 7429 7905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059405.1 protein_id gnl|my_center|LOCUS_42920 7972 9765 gene locus_tag LOCUS_42930 7972 9765 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_42930 9668 9886 gene locus_tag LOCUS_42940 9668 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 10245 9883 gene locus_tag LOCUS_42950 10245 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_42950 10519 12348 gene locus_tag LOCUS_42960 10519 12348 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814343.1 protein_id gnl|my_center|LOCUS_42960 12478 12750 gene locus_tag LOCUS_42970 12478 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 12884 13837 gene locus_tag LOCUS_42980 12884 13837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 14209 15651 gene locus_tag LOCUS_42990 14209 15651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 15689 16804 gene locus_tag LOCUS_43000 gene lptG 15689 16804 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933214.1 protein_id gnl|my_center|LOCUS_43000 18149 16863 gene locus_tag LOCUS_43010 18149 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 19903 18587 gene locus_tag LOCUS_43020 gene thiC 19903 18587 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_43020 21345 20161 gene locus_tag LOCUS_43030 21345 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 22508 21420 gene locus_tag LOCUS_43040 22508 21420 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_43040 23647 22529 gene locus_tag LOCUS_43050 gene pelA 23647 22529 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_43050 24137 25081 gene locus_tag LOCUS_43060 24137 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 >Feature sequence0110 394 1086 gene locus_tag LOCUS_43070 394 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 1093 2043 gene locus_tag LOCUS_43080 1093 2043 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039670.1 protein_id gnl|my_center|LOCUS_43080 2056 2235 gene locus_tag LOCUS_43090 2056 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 2312 2644 gene locus_tag LOCUS_43100 2312 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 2654 5008 gene locus_tag LOCUS_43110 2654 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 5008 5148 gene locus_tag LOCUS_43120 5008 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 5149 5439 gene locus_tag LOCUS_43130 5149 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 5449 5997 gene locus_tag LOCUS_43140 5449 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 6013 7212 gene locus_tag LOCUS_43150 6013 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 7263 7976 gene locus_tag LOCUS_43160 7263 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 7979 8203 gene locus_tag LOCUS_43170 7979 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 8889 8245 gene locus_tag LOCUS_43180 8889 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 9735 9121 gene locus_tag LOCUS_43190 9735 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 10147 9953 gene locus_tag LOCUS_43200 10147 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 10300 10626 gene locus_tag LOCUS_43210 10300 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 10992 10654 gene locus_tag LOCUS_43220 10992 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 11717 10992 gene locus_tag LOCUS_43230 11717 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 11879 12391 gene locus_tag LOCUS_43240 11879 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 12391 12747 gene locus_tag LOCUS_43250 12391 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 12874 13332 gene locus_tag LOCUS_43260 12874 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 13332 13745 gene locus_tag LOCUS_43270 13332 13745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 13757 14959 gene locus_tag LOCUS_43280 13757 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 14959 15339 gene locus_tag LOCUS_43290 14959 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 15366 15644 gene locus_tag LOCUS_43300 15366 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 15631 17580 gene locus_tag LOCUS_43310 15631 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 17577 18059 gene locus_tag LOCUS_43320 17577 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 18050 18556 gene locus_tag LOCUS_43330 18050 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 18690 18487 gene locus_tag LOCUS_43340 18690 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 18875 21637 gene locus_tag LOCUS_43350 18875 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 21637 23520 gene locus_tag LOCUS_43360 21637 23520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 23524 23784 gene locus_tag LOCUS_43370 23524 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 24169 23813 gene locus_tag LOCUS_43380 24169 23813 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140020.1 protein_id gnl|my_center|LOCUS_43380 24518 24162 gene locus_tag LOCUS_43390 24518 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 25047 24508 gene locus_tag LOCUS_43400 25047 24508 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_43400 25548 25102 gene locus_tag LOCUS_43410 gene ybcN 25548 25102 CDS product DNA base-flipping protein YbcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053004.1 protein_id gnl|my_center|LOCUS_43410 >Feature sequence0111 2129 147 gene locus_tag LOCUS_43420 2129 147 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_43420 2374 3318 gene locus_tag LOCUS_43430 2374 3318 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_43430 3321 4541 gene locus_tag LOCUS_43440 3321 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 4538 6586 gene locus_tag LOCUS_43450 4538 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 7348 6617 gene locus_tag LOCUS_43460 7348 6617 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_43460 7863 10589 gene locus_tag LOCUS_43470 7863 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 11141 10764 gene locus_tag LOCUS_43480 11141 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 11578 11348 gene locus_tag LOCUS_43490 11578 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 12054 11620 gene locus_tag LOCUS_43500 12054 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 12391 14109 gene locus_tag LOCUS_43510 12391 14109 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_43510 14106 15188 gene locus_tag LOCUS_43520 14106 15188 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_43520 16291 15275 gene locus_tag LOCUS_43530 16291 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 17041 16391 gene locus_tag LOCUS_43540 17041 16391 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021775.1 protein_id gnl|my_center|LOCUS_43540 17951 17031 gene locus_tag LOCUS_43550 17951 17031 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_43550 18401 17976 gene locus_tag LOCUS_43560 18401 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 20138 18573 gene locus_tag LOCUS_43570 20138 18573 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_43570 20420 22846 gene locus_tag LOCUS_43580 20420 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 22984 23739 gene locus_tag LOCUS_43590 22984 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 24307 23948 gene locus_tag LOCUS_43600 24307 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 24812 24387 gene locus_tag LOCUS_43610 24812 24387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 25171 24977 gene locus_tag LOCUS_43620 25171 24977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence0112 1093 2277 gene locus_tag LOCUS_43630 1093 2277 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_43630 2283 2933 gene locus_tag LOCUS_43640 gene plsY 2283 2933 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_43640 4268 2973 gene locus_tag LOCUS_43650 4268 2973 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_43650 5349 4447 gene locus_tag LOCUS_43660 5349 4447 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_43660 6872 6219 gene locus_tag LOCUS_43670 6872 6219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_43670 7018 6869 gene locus_tag LOCUS_43680 7018 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 11988 7324 gene locus_tag LOCUS_43690 11988 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 12719 12057 gene locus_tag LOCUS_43700 12719 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 13161 12817 gene locus_tag LOCUS_43710 13161 12817 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_43710 14657 13191 gene locus_tag LOCUS_43720 gene gatB 14657 13191 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_43720 16132 14666 gene locus_tag LOCUS_43730 gene gatA 16132 14666 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_43730 16831 16160 gene locus_tag LOCUS_43740 16831 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 17257 16943 gene locus_tag LOCUS_43750 gene gatC 17257 16943 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_43750 17595 17329 gene locus_tag LOCUS_43760 17595 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 20008 17834 gene locus_tag LOCUS_43770 20008 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 20818 20099 gene locus_tag LOCUS_43780 20818 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 21748 20870 gene locus_tag LOCUS_43790 21748 20870 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_43790 21834 22544 gene locus_tag LOCUS_43800 21834 22544 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582962.1 protein_id gnl|my_center|LOCUS_43800 22720 24159 gene locus_tag LOCUS_43810 22720 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 24889 24191 gene locus_tag LOCUS_43820 24889 24191 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_43820 25255 24992 gene locus_tag LOCUS_43830 25255 24992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence0113 971 2401 gene locus_tag LOCUS_43840 971 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 4059 4451 gene locus_tag LOCUS_43850 4059 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 7640 5127 gene locus_tag LOCUS_43860 7640 5127 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_43860 8334 8086 gene locus_tag LOCUS_43870 8334 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 8513 8728 gene locus_tag LOCUS_43880 8513 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 9179 9009 gene locus_tag LOCUS_43890 9179 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 10271 9507 gene locus_tag LOCUS_43900 10271 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 12729 11194 gene locus_tag LOCUS_43910 12729 11194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 15102 13048 gene locus_tag LOCUS_43920 15102 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 16863 15640 gene locus_tag LOCUS_43930 16863 15640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 17438 16860 gene locus_tag LOCUS_43940 17438 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 20833 17870 gene locus_tag LOCUS_43950 20833 17870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 21682 20909 gene locus_tag LOCUS_43960 21682 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 22007 23128 gene locus_tag LOCUS_43970 22007 23128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 <24998 23448 gene locus_tag LOCUS_43980 <24998 23448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein >Feature sequence0114 4244 1191 gene locus_tag LOCUS_43990 4244 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 5921 4509 gene locus_tag LOCUS_44000 5921 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 6253 7644 gene locus_tag LOCUS_44010 6253 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 7681 9240 gene locus_tag LOCUS_44020 7681 9240 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_44020 11278 9293 gene locus_tag LOCUS_44030 gene secA 11278 9293 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583762.1 protein_id gnl|my_center|LOCUS_44030 13691 11280 gene locus_tag LOCUS_44040 13691 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 15587 13707 gene locus_tag LOCUS_44050 15587 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 15705 18227 gene locus_tag LOCUS_44060 15705 18227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 19673 18309 gene locus_tag LOCUS_44070 19673 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 21078 19798 gene locus_tag LOCUS_44080 21078 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 22028 21156 gene locus_tag LOCUS_44090 22028 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 22895 22188 gene locus_tag LOCUS_44100 22895 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 23896 23162 gene locus_tag LOCUS_44110 23896 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 24519 24091 gene locus_tag LOCUS_44120 24519 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 >Feature sequence0115 530 736 gene locus_tag LOCUS_44130 530 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 1256 1044 gene locus_tag LOCUS_44140 1256 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 1349 2383 gene locus_tag LOCUS_44150 1349 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 2419 3030 gene locus_tag LOCUS_44160 2419 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 3020 4459 gene locus_tag LOCUS_44170 3020 4459 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_44170 4469 5614 gene locus_tag LOCUS_44180 4469 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_44180 7513 5549 gene locus_tag LOCUS_44190 7513 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 7758 7958 gene locus_tag LOCUS_44200 7758 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 7967 8389 gene locus_tag LOCUS_44210 7967 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 10585 8510 gene locus_tag LOCUS_44220 10585 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 11085 10588 gene locus_tag LOCUS_44230 11085 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 11467 11069 gene locus_tag LOCUS_44240 11467 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 12042 12476 gene locus_tag LOCUS_44250 12042 12476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 12525 13301 gene locus_tag LOCUS_44260 12525 13301 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_44260 13394 13882 gene locus_tag LOCUS_44270 13394 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 14509 14973 gene locus_tag LOCUS_44280 14509 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 15068 15451 gene locus_tag LOCUS_44290 15068 15451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 15483 16238 gene locus_tag LOCUS_44300 15483 16238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 16320 16709 gene locus_tag LOCUS_44310 16320 16709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 16793 17089 gene locus_tag LOCUS_44320 16793 17089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 17186 17503 gene locus_tag LOCUS_44330 17186 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 17581 17904 gene locus_tag LOCUS_44340 17581 17904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 18004 18138 gene locus_tag LOCUS_44350 18004 18138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 18175 18915 gene locus_tag LOCUS_44360 18175 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 19041 19925 gene locus_tag LOCUS_44370 19041 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 21446 20403 gene locus_tag LOCUS_44380 21446 20403 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_44380 22160 21972 gene locus_tag LOCUS_44390 22160 21972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 23061 22390 gene locus_tag LOCUS_44400 23061 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 23741 23061 gene locus_tag LOCUS_44410 23741 23061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 23868 23680 gene locus_tag LOCUS_44420 23868 23680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 23968 24201 gene locus_tag LOCUS_44430 23968 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence0116 726 169 gene locus_tag LOCUS_44440 726 169 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_44440 2326 971 gene locus_tag LOCUS_44450 2326 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 3803 2367 gene locus_tag LOCUS_44460 3803 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 4327 3899 gene locus_tag LOCUS_44470 4327 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 4812 4306 gene locus_tag LOCUS_44480 4812 4306 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_44480 5203 6423 gene locus_tag LOCUS_44490 5203 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 7798 6938 gene locus_tag LOCUS_44500 7798 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 12724 7937 gene locus_tag LOCUS_44510 12724 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 13110 12727 gene locus_tag LOCUS_44520 13110 12727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 14760 17312 gene locus_tag LOCUS_44530 14760 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 17686 17862 gene locus_tag LOCUS_44540 17686 17862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 17890 19089 gene locus_tag LOCUS_44550 17890 19089 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44550 21263 19233 gene locus_tag LOCUS_44560 gene fusA 21263 19233 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_44560 21582 21827 gene locus_tag LOCUS_44570 21582 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 23387 22302 gene locus_tag LOCUS_44580 23387 22302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 >Feature sequence0117 520 23 gene locus_tag LOCUS_44590 520 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 690 520 gene locus_tag LOCUS_44600 690 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 921 691 gene locus_tag LOCUS_44610 921 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 1281 1042 gene locus_tag LOCUS_44620 1281 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 1599 1384 gene locus_tag LOCUS_44630 1599 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 1786 1601 gene locus_tag LOCUS_44640 1786 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2262 1939 gene locus_tag LOCUS_44650 2262 1939 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175561.1 protein_id gnl|my_center|LOCUS_44650 2618 2262 gene locus_tag LOCUS_44660 2618 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 3406 2615 gene locus_tag LOCUS_44670 3406 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 5848 3902 gene locus_tag LOCUS_44680 5848 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 8538 5848 gene locus_tag LOCUS_44690 8538 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 10160 8535 gene locus_tag LOCUS_44700 10160 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 12246 10162 gene locus_tag LOCUS_44710 12246 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 12538 12224 gene locus_tag LOCUS_44720 12538 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 13173 12583 gene locus_tag LOCUS_44730 13173 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 14140 13184 gene locus_tag LOCUS_44740 14140 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 14628 14140 gene locus_tag LOCUS_44750 14628 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 14935 14621 gene locus_tag LOCUS_44760 14935 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 15817 14945 gene locus_tag LOCUS_44770 15817 14945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 16164 15814 gene locus_tag LOCUS_44780 16164 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 16643 16161 gene locus_tag LOCUS_44790 16643 16161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 17053 16625 gene locus_tag LOCUS_44800 17053 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 17175 17053 gene locus_tag LOCUS_44810 17175 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 17642 17223 gene locus_tag LOCUS_44820 17642 17223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 18615 17644 gene locus_tag LOCUS_44830 18615 17644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939006.1 protein_id gnl|my_center|LOCUS_44830 19288 18635 gene locus_tag LOCUS_44840 19288 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 19543 19734 gene locus_tag LOCUS_44850 19543 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 19735 20037 gene locus_tag LOCUS_44860 19735 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 20043 20222 gene locus_tag LOCUS_44870 20043 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 20219 20563 gene locus_tag LOCUS_44880 20219 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 20674 20889 gene locus_tag LOCUS_44890 20674 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 20900 21268 gene locus_tag LOCUS_44900 20900 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 21381 21863 gene locus_tag LOCUS_44910 21381 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 21873 22130 gene locus_tag LOCUS_44920 21873 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 22132 22425 gene locus_tag LOCUS_44930 22132 22425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 22422 22646 gene locus_tag LOCUS_44940 22422 22646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 23807 22716 gene locus_tag LOCUS_44950 23807 22716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 >Feature sequence0118 87 1322 gene locus_tag LOCUS_44960 87 1322 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_44960 1535 2170 gene locus_tag LOCUS_44970 1535 2170 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_44970 2556 2768 gene locus_tag LOCUS_44980 2556 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 2761 3330 gene locus_tag LOCUS_44990 2761 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 3447 4178 gene locus_tag LOCUS_45000 3447 4178 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393577.1 protein_id gnl|my_center|LOCUS_45000 4355 5077 gene locus_tag LOCUS_45010 4355 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 5454 6245 gene locus_tag LOCUS_45020 gene dapB 5454 6245 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_45020 7154 6384 gene locus_tag LOCUS_45030 7154 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 9073 7205 gene locus_tag LOCUS_45040 gene glmS 9073 7205 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_45040 9174 9791 gene locus_tag LOCUS_45050 gene hisH 9174 9791 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_45050 9785 10549 gene locus_tag LOCUS_45060 gene hisF 9785 10549 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_45060 13736 10608 gene locus_tag LOCUS_45070 13736 10608 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_45070 14209 13760 gene locus_tag LOCUS_45080 14209 13760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893498.1 protein_id gnl|my_center|LOCUS_45080 15684 14269 gene locus_tag LOCUS_45090 15684 14269 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_45090 17175 15730 gene locus_tag LOCUS_45100 17175 15730 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_45100 17567 18748 gene locus_tag LOCUS_45110 gene ftsW 17567 18748 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_45110 18753 19145 gene locus_tag LOCUS_45120 18753 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 21959 19209 gene locus_tag LOCUS_45130 21959 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 22817 22068 gene locus_tag LOCUS_45140 22817 22068 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_45140 23376 23032 gene locus_tag LOCUS_45150 23376 23032 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence0119 815 1357 gene locus_tag LOCUS_45160 815 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 1341 1922 gene locus_tag LOCUS_45170 1341 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 2001 3173 gene locus_tag LOCUS_45180 2001 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 3321 4004 gene locus_tag LOCUS_45190 3321 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 4254 6134 gene locus_tag LOCUS_45200 4254 6134 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868773.1 protein_id gnl|my_center|LOCUS_45200 6200 7669 gene locus_tag LOCUS_45210 6200 7669 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922755.1 protein_id gnl|my_center|LOCUS_45210 7701 10109 gene locus_tag LOCUS_45220 7701 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 10147 11328 gene locus_tag LOCUS_45230 10147 11328 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_45230 11359 13011 gene locus_tag LOCUS_45240 gene putP 11359 13011 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_45240 13024 13899 gene locus_tag LOCUS_45250 13024 13899 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_45250 13935 14903 gene locus_tag LOCUS_45260 13935 14903 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388243.1 protein_id gnl|my_center|LOCUS_45260 15090 16880 gene locus_tag LOCUS_45270 15090 16880 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119625.1 protein_id gnl|my_center|LOCUS_45270 16877 17902 gene locus_tag LOCUS_45280 16877 17902 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391963.1 protein_id gnl|my_center|LOCUS_45280 18677 18060 gene locus_tag LOCUS_45290 gene lpoB 18677 18060 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 protein_id gnl|my_center|LOCUS_45290 19112 18681 gene locus_tag LOCUS_45300 19112 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 20532 19138 gene locus_tag LOCUS_45310 20532 19138 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612451.1 protein_id gnl|my_center|LOCUS_45310 20898 21125 gene locus_tag LOCUS_45320 20898 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 21914 21288 gene locus_tag LOCUS_45330 21914 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 22974 22174 gene locus_tag LOCUS_45340 22974 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 >Feature sequence0120 374 1219 gene locus_tag LOCUS_45350 374 1219 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371638.1 protein_id gnl|my_center|LOCUS_45350 1404 2183 gene locus_tag LOCUS_45360 1404 2183 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_45360 2422 3300 gene locus_tag LOCUS_45370 gene dapF 2422 3300 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_45370 3636 3295 gene locus_tag LOCUS_45380 3636 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 4041 5162 gene locus_tag LOCUS_45390 4041 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 5193 6578 gene locus_tag LOCUS_45400 5193 6578 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_45400 8156 7047 gene locus_tag LOCUS_45410 8156 7047 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_45410 9340 8207 gene locus_tag LOCUS_45420 9340 8207 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_45420 9916 9584 gene locus_tag LOCUS_45430 9916 9584 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383518.1 protein_id gnl|my_center|LOCUS_45430 10248 11666 gene locus_tag LOCUS_45440 10248 11666 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_45440 14436 11962 gene locus_tag LOCUS_45450 14436 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45450 14676 14593 gene locus_tag LOCUS_t00880 14676 14593 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14876 15460 gene locus_tag LOCUS_45460 14876 15460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 15812 15417 gene locus_tag LOCUS_45470 15812 15417 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_45470 18882 15919 gene locus_tag LOCUS_45480 18882 15919 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_45480 20574 19048 gene locus_tag LOCUS_45490 gene rho 20574 19048 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_45490 21455 20841 gene locus_tag LOCUS_45500 gene coaE 21455 20841 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_45500 >Feature sequence0121 228 55 gene locus_tag LOCUS_45510 228 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 602 1723 gene locus_tag LOCUS_45520 602 1723 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294576.1 protein_id gnl|my_center|LOCUS_45520 1947 3353 gene locus_tag LOCUS_45530 1947 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 3534 3950 gene locus_tag LOCUS_45540 3534 3950 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_45540 4361 4176 gene locus_tag LOCUS_45550 4361 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 4777 4610 gene locus_tag LOCUS_45560 4777 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 6604 4916 gene locus_tag LOCUS_45570 6604 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 7214 7534 gene locus_tag LOCUS_45580 7214 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 7634 10096 gene locus_tag LOCUS_45590 7634 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 10219 10365 gene locus_tag LOCUS_45600 10219 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 10561 11322 gene locus_tag LOCUS_45610 10561 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 12755 11382 gene locus_tag LOCUS_45620 12755 11382 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_45620 13586 12768 gene locus_tag LOCUS_45630 13586 12768 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008656119.1 protein_id gnl|my_center|LOCUS_45630 15882 13708 gene locus_tag LOCUS_45640 gene pnp 15882 13708 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_45640 16285 16019 gene locus_tag LOCUS_45650 gene rpsO 16285 16019 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_45650 16887 17702 gene locus_tag LOCUS_45660 16887 17702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_45660 17763 19304 gene locus_tag LOCUS_45670 17763 19304 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_45670 19333 20760 gene locus_tag LOCUS_45680 19333 20760 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970484.1 protein_id gnl|my_center|LOCUS_45680 20976 21155 gene locus_tag LOCUS_45690 20976 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 21512 22423 gene locus_tag LOCUS_45700 21512 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 >Feature sequence0122 102 4568 gene locus_tag LOCUS_45710 102 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 4992 4750 gene locus_tag LOCUS_45720 4992 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 6357 5038 gene locus_tag LOCUS_45730 6357 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 7712 6438 gene locus_tag LOCUS_45740 7712 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 8508 7738 gene locus_tag LOCUS_45750 8508 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 9462 8512 gene locus_tag LOCUS_45760 9462 8512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_45760 10518 9616 gene locus_tag LOCUS_45770 10518 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 12450 10546 gene locus_tag LOCUS_45780 12450 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 13127 12447 gene locus_tag LOCUS_45790 13127 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 13464 13129 gene locus_tag LOCUS_45800 13464 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 16013 13749 gene locus_tag LOCUS_45810 gene ptsP 16013 13749 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941826.1 protein_id gnl|my_center|LOCUS_45810 16227 17150 gene locus_tag LOCUS_45820 16227 17150 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_45820 17274 20324 gene locus_tag LOCUS_45830 17274 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 21680 20334 gene locus_tag LOCUS_45840 21680 20334 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_45840 22432 21692 gene locus_tag LOCUS_45850 22432 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 22692 22429 gene locus_tag LOCUS_45860 22692 22429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 >Feature sequence0123 882 1886 gene locus_tag LOCUS_45870 882 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 3333 2155 gene locus_tag LOCUS_45880 3333 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 4366 3353 gene locus_tag LOCUS_45890 4366 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 4872 9308 gene locus_tag LOCUS_45900 4872 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 9464 12700 gene locus_tag LOCUS_45910 9464 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 12787 13968 gene locus_tag LOCUS_45920 12787 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 14199 14017 gene locus_tag LOCUS_45930 14199 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 15599 14199 gene locus_tag LOCUS_45940 gene panF 15599 14199 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_45940 16748 15669 gene locus_tag LOCUS_45950 16748 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 17087 16758 gene locus_tag LOCUS_45960 17087 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 17688 17116 gene locus_tag LOCUS_45970 17688 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 18329 17919 gene locus_tag LOCUS_45980 18329 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 19566 18382 gene locus_tag LOCUS_45990 19566 18382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 20174 19590 gene locus_tag LOCUS_46000 20174 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 20416 20171 gene locus_tag LOCUS_46010 20416 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 20890 22206 gene locus_tag LOCUS_46020 20890 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 >Feature sequence0124 623 2101 gene locus_tag LOCUS_46030 623 2101 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_46030 2355 3833 gene locus_tag LOCUS_46040 2355 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 3917 5548 gene locus_tag LOCUS_46050 3917 5548 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_46050 6897 5614 gene locus_tag LOCUS_46060 6897 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 7738 7220 gene locus_tag LOCUS_46070 7738 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 9398 7971 gene locus_tag LOCUS_46080 9398 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 9656 10651 gene locus_tag LOCUS_46090 9656 10651 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_46090 11650 10781 gene locus_tag LOCUS_46100 11650 10781 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_46100 11829 12875 gene locus_tag LOCUS_46110 11829 12875 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_46110 12979 13758 gene locus_tag LOCUS_46120 12979 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 13751 14581 gene locus_tag LOCUS_46130 13751 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 15256 14636 gene locus_tag LOCUS_46140 15256 14636 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_46140 15546 16193 gene locus_tag LOCUS_46150 15546 16193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 17707 16235 gene locus_tag LOCUS_46160 17707 16235 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_46160 18822 17836 gene locus_tag LOCUS_46170 18822 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 19108 20673 gene locus_tag LOCUS_46180 19108 20673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 22195 20924 gene locus_tag LOCUS_46190 22195 20924 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097908.1 protein_id gnl|my_center|LOCUS_46190 22561 22274 gene locus_tag LOCUS_46200 22561 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 >Feature sequence0125 700 1527 gene locus_tag LOCUS_46210 700 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 2536 1574 gene locus_tag LOCUS_46220 2536 1574 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_46220 2789 5386 gene locus_tag LOCUS_46230 2789 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 5445 7535 gene locus_tag LOCUS_46240 5445 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_46240 9742 7574 gene locus_tag LOCUS_46250 9742 7574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 10059 12566 gene locus_tag LOCUS_46260 10059 12566 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_46260 15892 12605 gene locus_tag LOCUS_46270 15892 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 17573 15894 gene locus_tag LOCUS_46280 17573 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 18686 17712 gene locus_tag LOCUS_46290 18686 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 19426 20274 gene locus_tag LOCUS_46300 19426 20274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969420.1 protein_id gnl|my_center|LOCUS_46300 20401 21213 gene locus_tag LOCUS_46310 20401 21213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_46310 21655 22293 gene locus_tag LOCUS_46320 21655 22293 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_46320 >Feature sequence0126 718 281 gene locus_tag LOCUS_46330 718 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 1476 1673 gene locus_tag LOCUS_46340 1476 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 1755 2861 gene locus_tag LOCUS_46350 1755 2861 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_46350 2858 6058 gene locus_tag LOCUS_46360 gene drmD 2858 6058 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_46360 6058 10149 gene locus_tag LOCUS_46370 6058 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_46370 10179 11591 gene locus_tag LOCUS_46380 10179 11591 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 protein_id gnl|my_center|LOCUS_46380 11588 12577 gene locus_tag LOCUS_46390 11588 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016656.1 protein_id gnl|my_center|LOCUS_46390 12747 16697 gene locus_tag LOCUS_46400 gene drmA 12747 16697 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_46400 16694 18541 gene locus_tag LOCUS_46410 16694 18541 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_46410 18534 19325 gene locus_tag LOCUS_46420 gene drmC 18534 19325 CDS product DISARM system phospholipase D-like protein DrmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028205216.1 protein_id gnl|my_center|LOCUS_46420 20703 20293 gene locus_tag LOCUS_46430 20703 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 21723 21052 gene locus_tag LOCUS_46440 21723 21052 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391060.1 protein_id gnl|my_center|LOCUS_46440 21926 21723 gene locus_tag LOCUS_46450 21926 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 >Feature sequence0127 437 1834 gene locus_tag LOCUS_46460 437 1834 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_46460 3031 1910 gene locus_tag LOCUS_46470 3031 1910 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921817.1 protein_id gnl|my_center|LOCUS_46470 3546 3289 gene locus_tag LOCUS_46480 3546 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 4374 3721 gene locus_tag LOCUS_46490 4374 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 5741 4440 gene locus_tag LOCUS_46500 5741 4440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_46500 7102 5780 gene locus_tag LOCUS_46510 7102 5780 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_46510 7339 7265 gene locus_tag LOCUS_t00890 7339 7265 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7728 8105 gene locus_tag LOCUS_46520 7728 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 8425 11130 gene locus_tag LOCUS_46530 gene ppdK 8425 11130 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_46530 11474 11614 gene locus_tag LOCUS_46540 11474 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 14190 11611 gene locus_tag LOCUS_46550 gene clpB 14190 11611 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_46550 14598 15473 gene locus_tag LOCUS_46560 14598 15473 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_46560 16063 15674 gene locus_tag LOCUS_46570 16063 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 19716 16093 gene locus_tag LOCUS_46580 19716 16093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 21389 19824 gene locus_tag LOCUS_46590 21389 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 21823 21668 gene locus_tag LOCUS_46600 21823 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence0128 119 1795 gene locus_tag LOCUS_46610 119 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 2216 1932 gene locus_tag LOCUS_46620 2216 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 3587 6193 gene locus_tag LOCUS_46630 3587 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 6406 8040 gene locus_tag LOCUS_46640 6406 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 8623 9162 gene locus_tag LOCUS_46650 8623 9162 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_46650 9159 11093 gene locus_tag LOCUS_46660 9159 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 11257 12516 gene locus_tag LOCUS_46670 11257 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 12668 14185 gene locus_tag LOCUS_46680 12668 14185 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_46680 14187 15617 gene locus_tag LOCUS_46690 14187 15617 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_46690 15637 15927 gene locus_tag LOCUS_46700 15637 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46700 15958 16425 gene locus_tag LOCUS_46710 15958 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 16607 18769 gene locus_tag LOCUS_46720 16607 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 19335 19850 gene locus_tag LOCUS_46730 19335 19850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 20290 21057 gene locus_tag LOCUS_46740 20290 21057 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438533.1 protein_id gnl|my_center|LOCUS_46740 21787 21281 gene locus_tag LOCUS_46750 21787 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 >Feature sequence0129 718 284 gene locus_tag LOCUS_46760 718 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 2180 861 gene locus_tag LOCUS_46770 2180 861 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_46770 3509 2181 gene locus_tag LOCUS_46780 gene fabF 3509 2181 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689969.1 protein_id gnl|my_center|LOCUS_46780 4018 3509 gene locus_tag LOCUS_46790 4018 3509 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_46790 4458 4063 gene locus_tag LOCUS_46800 4458 4063 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_46800 5012 4530 gene locus_tag LOCUS_46810 5012 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 5185 5694 gene locus_tag LOCUS_46820 5185 5694 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_46820 6709 5747 gene locus_tag LOCUS_46830 6709 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 6916 8970 gene locus_tag LOCUS_46840 6916 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 8970 9860 gene locus_tag LOCUS_46850 8970 9860 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_46850 9914 11215 gene locus_tag LOCUS_46860 gene hflK 9914 11215 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_46860 11266 13191 gene locus_tag LOCUS_46870 11266 13191 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_46870 13216 14475 gene locus_tag LOCUS_46880 13216 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 14468 15823 gene locus_tag LOCUS_46890 14468 15823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 15842 17623 gene locus_tag LOCUS_46900 15842 17623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 17683 19806 gene locus_tag LOCUS_46910 17683 19806 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_46910 >Feature sequence0130 208 1704 gene locus_tag LOCUS_46920 208 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 2138 3160 gene locus_tag LOCUS_46930 2138 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 3305 3835 gene locus_tag LOCUS_46940 3305 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 3842 4732 gene locus_tag LOCUS_46950 3842 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 6184 4814 gene locus_tag LOCUS_46960 6184 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 6508 6212 gene locus_tag LOCUS_46970 6508 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 7459 6593 gene locus_tag LOCUS_46980 7459 6593 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582857.1 protein_id gnl|my_center|LOCUS_46980 7727 7479 gene locus_tag LOCUS_46990 7727 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 7922 7828 gene locus_tag LOCUS_t00900 7922 7828 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11380 8117 gene locus_tag LOCUS_47000 11380 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 11910 12821 gene locus_tag LOCUS_47010 11910 12821 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941981.1 protein_id gnl|my_center|LOCUS_47010 13363 12989 gene locus_tag LOCUS_47020 13363 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 15249 13633 gene locus_tag LOCUS_47030 15249 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 16123 15335 gene locus_tag LOCUS_47040 16123 15335 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_47040 17502 16120 gene locus_tag LOCUS_47050 17502 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 18488 17499 gene locus_tag LOCUS_47060 18488 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 19765 18506 gene locus_tag LOCUS_47070 19765 18506 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392956.1 protein_id gnl|my_center|LOCUS_47070 20597 19794 gene locus_tag LOCUS_47080 20597 19794 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927080.1 protein_id gnl|my_center|LOCUS_47080 21430 20642 gene locus_tag LOCUS_47090 21430 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 >Feature sequence0131 31 735 gene locus_tag LOCUS_47100 31 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1142 3310 gene locus_tag LOCUS_47110 1142 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 3449 4726 gene locus_tag LOCUS_47120 3449 4726 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_47120 5015 5218 gene locus_tag LOCUS_47130 5015 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5385 6623 gene locus_tag LOCUS_47140 5385 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 8120 6747 gene locus_tag LOCUS_47150 8120 6747 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_47150 8394 8639 gene locus_tag LOCUS_47160 8394 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 8675 10108 gene locus_tag LOCUS_47170 8675 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 10280 12892 gene locus_tag LOCUS_47180 10280 12892 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_47180 12913 13410 gene locus_tag LOCUS_47190 12913 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 13410 14375 gene locus_tag LOCUS_47200 13410 14375 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_47200 14435 15040 gene locus_tag LOCUS_47210 14435 15040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 15085 15660 gene locus_tag LOCUS_47220 15085 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 15722 16930 gene locus_tag LOCUS_47230 15722 16930 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966083.1 protein_id gnl|my_center|LOCUS_47230 17876 17322 gene locus_tag LOCUS_47240 17876 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 19661 17898 gene locus_tag LOCUS_47250 19661 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 19834 19658 gene locus_tag LOCUS_47260 19834 19658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 20915 19866 gene locus_tag LOCUS_47270 20915 19866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence0132 1248 1709 gene locus_tag LOCUS_47280 gene sixA 1248 1709 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_47280 3055 1742 gene locus_tag LOCUS_47290 3055 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 5395 3482 gene locus_tag LOCUS_47300 5395 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 5739 6257 gene locus_tag LOCUS_47310 5739 6257 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966472.1 protein_id gnl|my_center|LOCUS_47310 10178 6306 gene locus_tag LOCUS_47320 10178 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 11592 10528 gene locus_tag LOCUS_47330 11592 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 11758 12771 gene locus_tag LOCUS_47340 11758 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 13961 12882 gene locus_tag LOCUS_47350 13961 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 14503 13958 gene locus_tag LOCUS_47360 14503 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 15402 14644 gene locus_tag LOCUS_47370 15402 14644 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_47370 15926 15489 gene locus_tag LOCUS_47380 15926 15489 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_47380 16802 15981 gene locus_tag LOCUS_47390 16802 15981 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_47390 17846 16821 gene locus_tag LOCUS_47400 17846 16821 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_47400 18802 17843 gene locus_tag LOCUS_47410 18802 17843 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_47410 19069 19590 gene locus_tag LOCUS_47420 19069 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 21444 19750 gene locus_tag LOCUS_47430 21444 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence0133 535 1893 gene locus_tag LOCUS_47440 535 1893 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_47440 1954 1879 gene locus_tag LOCUS_t00910 1954 1879 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2191 4197 gene locus_tag LOCUS_47450 gene ligA 2191 4197 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_47450 4224 5324 gene locus_tag LOCUS_47460 gene ribD 4224 5324 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880032.1 protein_id gnl|my_center|LOCUS_47460 5386 6399 gene locus_tag LOCUS_47470 5386 6399 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_47470 6647 6390 gene locus_tag LOCUS_47480 6647 6390 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_47480 6867 6634 gene locus_tag LOCUS_47490 6867 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 7383 9029 gene locus_tag LOCUS_47500 7383 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 9237 9701 gene locus_tag LOCUS_47510 9237 9701 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_47510 10874 9786 gene locus_tag LOCUS_47520 10874 9786 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_47520 12311 11001 gene locus_tag LOCUS_47530 12311 11001 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_47530 12586 13152 gene locus_tag LOCUS_47540 12586 13152 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527960.1 protein_id gnl|my_center|LOCUS_47540 13149 13586 gene locus_tag LOCUS_47550 13149 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 13618 14844 gene locus_tag LOCUS_47560 13618 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 16386 14911 gene locus_tag LOCUS_47570 gene gltA 16386 14911 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_47570 17295 16447 gene locus_tag LOCUS_47580 17295 16447 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_47580 18413 17490 gene locus_tag LOCUS_47590 18413 17490 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_47590 18644 18417 gene locus_tag LOCUS_47600 18644 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 19612 18647 gene locus_tag LOCUS_47610 gene trpS 19612 18647 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_47610 21125 19782 gene locus_tag LOCUS_47620 21125 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 >Feature sequence0134 2327 462 gene locus_tag LOCUS_47630 gene recQ 2327 462 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_47630 2478 3626 gene locus_tag LOCUS_47640 2478 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 3788 4075 gene locus_tag LOCUS_47650 3788 4075 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_47650 6194 4089 gene locus_tag LOCUS_47660 6194 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 6642 9632 gene locus_tag LOCUS_47670 6642 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 11016 9715 gene locus_tag LOCUS_47680 11016 9715 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_47680 12770 11337 gene locus_tag LOCUS_47690 12770 11337 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_47690 13561 12776 gene locus_tag LOCUS_47700 13561 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 15003 13588 gene locus_tag LOCUS_47710 15003 13588 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118056.1 protein_id gnl|my_center|LOCUS_47710 16157 15102 gene locus_tag LOCUS_47720 16157 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 16521 18149 gene locus_tag LOCUS_47730 16521 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 18545 19696 gene locus_tag LOCUS_47740 gene pdxB 18545 19696 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699136.1 protein_id gnl|my_center|LOCUS_47740 19686 20555 gene locus_tag LOCUS_47750 gene folP 19686 20555 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_47750 20552 21091 gene locus_tag LOCUS_47760 20552 21091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 >Feature sequence0135 316 708 gene locus_tag LOCUS_47770 316 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 1242 2942 gene locus_tag LOCUS_47780 gene groL 1242 2942 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_47780 3104 4468 gene locus_tag LOCUS_47790 3104 4468 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_47790 4509 4799 gene locus_tag LOCUS_47800 gene groES 4509 4799 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_47800 4878 6497 gene locus_tag LOCUS_47810 gene groL 4878 6497 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_47810 6552 7679 gene locus_tag LOCUS_47820 gene dnaJ 6552 7679 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_47820 7679 8284 gene locus_tag LOCUS_47830 gene grpE 7679 8284 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_47830 8290 8631 gene locus_tag LOCUS_47840 8290 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 8791 9876 gene locus_tag LOCUS_47850 8791 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 9904 10305 gene locus_tag LOCUS_47860 9904 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 10360 10836 gene locus_tag LOCUS_47870 10360 10836 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966757.1 protein_id gnl|my_center|LOCUS_47870 10962 11315 gene locus_tag LOCUS_47880 10962 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 11308 11856 gene locus_tag LOCUS_47890 11308 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 12081 13343 gene locus_tag LOCUS_47900 12081 13343 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_47900 13909 13370 gene locus_tag LOCUS_47910 13909 13370 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_47910 14952 13963 gene locus_tag LOCUS_47920 14952 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 15569 14949 gene locus_tag LOCUS_47930 gene rpoE 15569 14949 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 protein_id gnl|my_center|LOCUS_47930 17996 15816 gene locus_tag LOCUS_47940 17996 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 19688 18075 gene locus_tag LOCUS_47950 19688 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 20638 20111 gene locus_tag LOCUS_47960 20638 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 >Feature sequence0136 773 21 gene locus_tag LOCUS_47970 773 21 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_47970 1901 783 gene locus_tag LOCUS_47980 1901 783 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_47980 2517 1987 gene locus_tag LOCUS_47990 2517 1987 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_47990 3179 2622 gene locus_tag LOCUS_48000 3179 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48000 4860 3385 gene locus_tag LOCUS_48010 4860 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 5357 5172 gene locus_tag LOCUS_48020 5357 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 6202 5585 gene locus_tag LOCUS_48030 6202 5585 CDS product DUF3313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937553.1 protein_id gnl|my_center|LOCUS_48030 7369 6335 gene locus_tag LOCUS_48040 7369 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 9236 7383 gene locus_tag LOCUS_48050 gene atsA 9236 7383 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_48050 9900 9493 gene locus_tag LOCUS_48060 9900 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 10273 9920 gene locus_tag LOCUS_48070 10273 9920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 11799 10318 gene locus_tag LOCUS_48080 11799 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 12229 11930 gene locus_tag LOCUS_48090 12229 11930 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883059.1 protein_id gnl|my_center|LOCUS_48090 13458 12466 gene locus_tag LOCUS_48100 13458 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 15237 13543 gene locus_tag LOCUS_48110 15237 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 17934 15661 gene locus_tag LOCUS_48120 gene extM 17934 15661 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence0137 2226 55 gene locus_tag LOCUS_48130 2226 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 2638 3621 gene locus_tag LOCUS_48140 2638 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 4350 5048 gene locus_tag LOCUS_48150 4350 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 5138 5812 gene locus_tag LOCUS_48160 5138 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 5831 6511 gene locus_tag LOCUS_48170 5831 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 6514 8496 gene locus_tag LOCUS_48180 6514 8496 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_48180 8536 13896 gene locus_tag LOCUS_48190 8536 13896 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_48190 13927 14610 gene locus_tag LOCUS_48200 13927 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 14822 15739 gene locus_tag LOCUS_48210 14822 15739 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_48210 15796 16026 gene locus_tag LOCUS_48220 15796 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 16634 16422 gene locus_tag LOCUS_48230 16634 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 16567 17028 gene locus_tag LOCUS_48240 16567 17028 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_48240 17034 18155 gene locus_tag LOCUS_48250 17034 18155 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_48250 18148 19221 gene locus_tag LOCUS_48260 18148 19221 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_48260 >Feature sequence0138 2535 1345 gene locus_tag LOCUS_48270 2535 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 2987 4423 gene locus_tag LOCUS_48280 2987 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 5041 6432 gene locus_tag LOCUS_48290 5041 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 9606 6454 gene locus_tag LOCUS_48300 9606 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 12889 9641 gene locus_tag LOCUS_48310 12889 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 13376 14785 gene locus_tag LOCUS_48320 13376 14785 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_48320 17323 14900 gene locus_tag LOCUS_48330 17323 14900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 17937 18389 gene locus_tag LOCUS_48340 17937 18389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 18401 19729 gene locus_tag LOCUS_48350 18401 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 19742 19981 gene locus_tag LOCUS_48360 19742 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 >Feature sequence0139 710 63 gene locus_tag LOCUS_48370 710 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 1857 730 gene locus_tag LOCUS_48380 1857 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 3076 1901 gene locus_tag LOCUS_48390 3076 1901 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_48390 5677 3530 gene locus_tag LOCUS_48400 5677 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 8644 5795 gene locus_tag LOCUS_48410 8644 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 9119 9934 gene locus_tag LOCUS_48420 9119 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 10544 10056 gene locus_tag LOCUS_48430 10544 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 11544 10549 gene locus_tag LOCUS_48440 11544 10549 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_48440 12667 11864 gene locus_tag LOCUS_48450 12667 11864 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_48450 13612 12731 gene locus_tag LOCUS_48460 13612 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 14577 13783 gene locus_tag LOCUS_48470 14577 13783 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 protein_id gnl|my_center|LOCUS_48470 15975 14716 gene locus_tag LOCUS_48480 15975 14716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 16764 16579 gene locus_tag LOCUS_48490 16764 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 17218 18747 gene locus_tag LOCUS_48500 17218 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 >Feature sequence0140 194 415 gene locus_tag LOCUS_48510 194 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 1842 829 gene locus_tag LOCUS_48520 1842 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 2687 1842 gene locus_tag LOCUS_48530 2687 1842 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_48530 2857 3831 gene locus_tag LOCUS_48540 2857 3831 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_48540 3852 6848 gene locus_tag LOCUS_48550 3852 6848 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_48550 7963 6962 gene locus_tag LOCUS_48560 7963 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 9534 8992 gene locus_tag LOCUS_48570 9534 8992 CDS product arsinothricin resistance N-acetyltransferase ArsN1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 protein_id gnl|my_center|LOCUS_48570 10435 9587 gene locus_tag LOCUS_48580 gene pstB 10435 9587 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706615.1 protein_id gnl|my_center|LOCUS_48580 12163 11270 gene locus_tag LOCUS_48590 gene pstC 12163 11270 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_48590 12990 12160 gene locus_tag LOCUS_48600 12990 12160 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_48600 14291 13176 gene locus_tag LOCUS_48610 14291 13176 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_48610 16831 15578 gene locus_tag LOCUS_48620 16831 15578 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_48620 17505 16879 gene locus_tag LOCUS_48630 17505 16879 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948446.1 protein_id gnl|my_center|LOCUS_48630 18873 17563 gene locus_tag LOCUS_48640 18873 17563 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_48640 19488 19228 gene locus_tag LOCUS_48650 19488 19228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence0141 281 1624 gene locus_tag LOCUS_48660 281 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 1636 2049 gene locus_tag LOCUS_48670 1636 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 2247 2702 gene locus_tag LOCUS_48680 2247 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 2723 3139 gene locus_tag LOCUS_48690 2723 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 3130 4779 gene locus_tag LOCUS_48700 3130 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 4865 5209 gene locus_tag LOCUS_48710 4865 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 5308 5679 gene locus_tag LOCUS_48720 5308 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 5682 6989 gene locus_tag LOCUS_48730 5682 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 6986 10486 gene locus_tag LOCUS_48740 6986 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 10531 10992 gene locus_tag LOCUS_48750 10531 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 11005 13422 gene locus_tag LOCUS_48760 11005 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 13464 13760 gene locus_tag LOCUS_48770 13464 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 13766 16309 gene locus_tag LOCUS_48780 13766 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 16353 19574 gene locus_tag LOCUS_48790 16353 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 >Feature sequence0142 949 2157 gene locus_tag LOCUS_48800 949 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 2192 3658 gene locus_tag LOCUS_48810 2192 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 3715 4434 gene locus_tag LOCUS_48820 3715 4434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_48820 6103 4703 gene locus_tag LOCUS_48830 6103 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 7442 6108 gene locus_tag LOCUS_48840 7442 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 10149 7966 gene locus_tag LOCUS_48850 10149 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 11210 10179 gene locus_tag LOCUS_48860 11210 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 11772 11428 gene locus_tag LOCUS_48870 11772 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 11936 12262 gene locus_tag LOCUS_48880 11936 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 15198 12970 gene locus_tag LOCUS_48890 15198 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 16046 15273 gene locus_tag LOCUS_48900 16046 15273 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_48900 16424 17911 gene locus_tag LOCUS_48910 16424 17911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 17984 19456 gene locus_tag LOCUS_48920 17984 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence0143 <1 1497 gene locus_tag LOCUS_48930 <1 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000853744.1:type II secretion system ATPase GspE 1542 2654 gene locus_tag LOCUS_48940 1542 2654 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_48940 2666 3895 gene locus_tag LOCUS_48950 2666 3895 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 protein_id gnl|my_center|LOCUS_48950 3951 4439 gene locus_tag LOCUS_48960 3951 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 4465 5037 gene locus_tag LOCUS_48970 4465 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 5260 5333 gene locus_tag LOCUS_t00920 5260 5333 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6644 5307 gene locus_tag LOCUS_48980 6644 5307 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_48980 7952 6843 gene locus_tag LOCUS_48990 7952 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 8223 7987 gene locus_tag LOCUS_49000 8223 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 8668 8387 gene locus_tag LOCUS_49010 8668 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 9235 11334 gene locus_tag LOCUS_49020 9235 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 11497 12525 gene locus_tag LOCUS_49030 11497 12525 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085979762.1 protein_id gnl|my_center|LOCUS_49030 12596 15832 gene locus_tag LOCUS_49040 12596 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 16247 17629 gene locus_tag LOCUS_49050 16247 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 17888 19750 gene locus_tag LOCUS_49060 17888 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence0144 627 454 gene locus_tag LOCUS_49070 627 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 614 4132 gene locus_tag LOCUS_49080 614 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 9212 4593 gene locus_tag LOCUS_49090 9212 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 9660 9235 gene locus_tag LOCUS_49100 9660 9235 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_49100 14523 10405 gene locus_tag LOCUS_49110 14523 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 14830 16446 gene locus_tag LOCUS_49120 14830 16446 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_49120 17289 18212 gene locus_tag LOCUS_49130 17289 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 19512 18298 gene locus_tag LOCUS_49140 19512 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 >Feature sequence0145 2538 1243 gene locus_tag LOCUS_49150 2538 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 4057 3170 gene locus_tag LOCUS_49160 4057 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 4770 5303 gene locus_tag LOCUS_49170 4770 5303 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_49170 5311 5910 gene locus_tag LOCUS_49180 5311 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5907 7631 gene locus_tag LOCUS_49190 5907 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 11103 8155 gene locus_tag LOCUS_49200 11103 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 11720 11103 gene locus_tag LOCUS_49210 11720 11103 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_49210 11919 13580 gene locus_tag LOCUS_49220 11919 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 14177 15697 gene locus_tag LOCUS_49230 14177 15697 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665838.1 protein_id gnl|my_center|LOCUS_49230 17314 15803 gene locus_tag LOCUS_49240 17314 15803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 18360 18566 gene locus_tag LOCUS_49250 18360 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 18731 19114 gene locus_tag LOCUS_49260 18731 19114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 >Feature sequence0146 <1 1907 gene locus_tag LOCUS_49270 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein note possible pseudo, internal stop codon, frameshifted 1918 2526 gene locus_tag LOCUS_49280 gene fixJ 1918 2526 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918644.1 protein_id gnl|my_center|LOCUS_49280 2777 3751 gene locus_tag LOCUS_49290 2777 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 3948 4310 gene locus_tag LOCUS_49300 3948 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 4689 6059 gene locus_tag LOCUS_49310 4689 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 6106 8349 gene locus_tag LOCUS_49320 6106 8349 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_49320 8346 9176 gene locus_tag LOCUS_49330 8346 9176 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_49330 9173 11704 gene locus_tag LOCUS_49340 9173 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 11871 12422 gene locus_tag LOCUS_49350 11871 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 12577 13968 gene locus_tag LOCUS_49360 12577 13968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 14065 14247 gene locus_tag LOCUS_49370 14065 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 15828 16598 gene locus_tag LOCUS_49380 15828 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 17701 18624 gene locus_tag LOCUS_49390 17701 18624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 >Feature sequence0147 4528 2348 gene locus_tag LOCUS_49400 4528 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 4773 4567 gene locus_tag LOCUS_49410 4773 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 8085 4957 gene locus_tag LOCUS_49420 8085 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 10135 8753 gene locus_tag LOCUS_49430 gene mtaB 10135 8753 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_49430 10250 12520 gene locus_tag LOCUS_49440 10250 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 12590 14068 gene locus_tag LOCUS_49450 12590 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 14102 16273 gene locus_tag LOCUS_49460 14102 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 16636 17817 gene locus_tag LOCUS_49470 16636 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 17871 18884 gene locus_tag LOCUS_49480 17871 18884 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_49480 >Feature sequence0148 516 1775 gene locus_tag LOCUS_49490 516 1775 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_49490 1804 2727 gene locus_tag LOCUS_49500 1804 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 2761 3657 gene locus_tag LOCUS_49510 2761 3657 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_49510 4127 3798 gene locus_tag LOCUS_49520 4127 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 4763 6646 gene locus_tag LOCUS_49530 4763 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 6853 7368 gene locus_tag LOCUS_49540 6853 7368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 7872 8654 gene locus_tag LOCUS_49550 7872 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 8798 10966 gene locus_tag LOCUS_49560 8798 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 12021 10948 gene locus_tag LOCUS_49570 12021 10948 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_49570 13349 12060 gene locus_tag LOCUS_49580 13349 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 14753 13398 gene locus_tag LOCUS_49590 14753 13398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 15835 14804 gene locus_tag LOCUS_49600 15835 14804 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_49600 18022 15863 gene locus_tag LOCUS_49610 18022 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 >Feature sequence0149 234 677 gene locus_tag LOCUS_49620 234 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49620 652 1539 gene locus_tag LOCUS_49630 652 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49630 1918 9657 gene locus_tag LOCUS_49640 1918 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 9689 11047 gene locus_tag LOCUS_49650 9689 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 11028 11207 gene locus_tag LOCUS_49660 11028 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 11410 11180 gene locus_tag LOCUS_49670 11410 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 11718 12410 gene locus_tag LOCUS_49680 11718 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 12459 13352 gene locus_tag LOCUS_49690 12459 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 13372 13920 gene locus_tag LOCUS_49700 13372 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 13913 14128 gene locus_tag LOCUS_49710 13913 14128 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_49710 14174 16462 gene locus_tag LOCUS_49720 14174 16462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928889.1 protein_id gnl|my_center|LOCUS_49720 16686 16459 gene locus_tag LOCUS_49730 16686 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 17891 17088 gene locus_tag LOCUS_49740 17891 17088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 18092 18301 gene locus_tag LOCUS_49750 18092 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 >Feature sequence0150 556 918 gene locus_tag LOCUS_49760 556 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 983 1435 gene locus_tag LOCUS_49770 983 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142725.1 protein_id gnl|my_center|LOCUS_49770 1556 1631 gene locus_tag LOCUS_t00930 1556 1631 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1899 2888 gene locus_tag LOCUS_49780 1899 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 3325 4122 gene locus_tag LOCUS_49790 3325 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 4365 5075 gene locus_tag LOCUS_49800 gene ubiE 4365 5075 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_49800 5248 6213 gene locus_tag LOCUS_49810 5248 6213 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_49810 6359 7687 gene locus_tag LOCUS_49820 6359 7687 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_49820 8928 7789 gene locus_tag LOCUS_49830 8928 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 10427 9276 gene locus_tag LOCUS_49840 10427 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 10726 11550 gene locus_tag LOCUS_49850 10726 11550 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_49850 11581 12969 gene locus_tag LOCUS_49860 11581 12969 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_49860 12985 13530 gene locus_tag LOCUS_49870 12985 13530 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_49870 13536 16382 gene locus_tag LOCUS_49880 13536 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 17518 16442 gene locus_tag LOCUS_49890 17518 16442 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_49890 18075 18932 gene locus_tag LOCUS_49900 18075 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 >Feature sequence0151 1621 134 gene locus_tag LOCUS_49910 1621 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 3667 1667 gene locus_tag LOCUS_49920 3667 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 4048 5238 gene locus_tag LOCUS_49930 4048 5238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_49930 5274 6599 gene locus_tag LOCUS_49940 5274 6599 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_49940 6629 7636 gene locus_tag LOCUS_49950 6629 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 7709 10975 gene locus_tag LOCUS_49960 7709 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 10981 12516 gene locus_tag LOCUS_49970 10981 12516 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_49970 13816 12533 gene locus_tag LOCUS_49980 13816 12533 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_49980 15028 15867 gene locus_tag LOCUS_49990 15028 15867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 15897 16310 gene locus_tag LOCUS_50000 15897 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 16413 17456 gene locus_tag LOCUS_50010 16413 17456 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 protein_id gnl|my_center|LOCUS_50010 18900 17551 gene locus_tag LOCUS_50020 18900 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 >Feature sequence0152 948 2555 gene locus_tag LOCUS_50030 948 2555 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261533.1 protein_id gnl|my_center|LOCUS_50030 3056 2844 gene locus_tag LOCUS_50040 3056 2844 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_50040 3309 3049 gene locus_tag LOCUS_50050 3309 3049 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_50050 3929 5794 gene locus_tag LOCUS_50060 3929 5794 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_50060 5994 5728 gene locus_tag LOCUS_50070 5994 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 5885 7000 gene locus_tag LOCUS_50080 5885 7000 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965879.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50080 7222 8556 gene locus_tag LOCUS_50090 7222 8556 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_50090 8640 10568 gene locus_tag LOCUS_50100 8640 10568 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_50100 10648 10893 gene locus_tag LOCUS_50110 10648 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 11305 10991 gene locus_tag LOCUS_50120 11305 10991 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_50120 11493 11317 gene locus_tag LOCUS_50130 11493 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 12156 12905 gene locus_tag LOCUS_50140 12156 12905 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_50140 13107 14495 gene locus_tag LOCUS_50150 gene cls 13107 14495 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816416.1 protein_id gnl|my_center|LOCUS_50150 14551 15675 gene locus_tag LOCUS_50160 14551 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880001.1 protein_id gnl|my_center|LOCUS_50160 15748 17058 gene locus_tag LOCUS_50170 gene clcA 15748 17058 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 protein_id gnl|my_center|LOCUS_50170 17365 17763 gene locus_tag LOCUS_50180 17365 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 18726 17980 gene locus_tag LOCUS_50190 18726 17980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 >Feature sequence0153 618 1496 gene locus_tag LOCUS_50200 618 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50200 3878 2118 gene locus_tag LOCUS_50210 3878 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50210 4357 4022 gene locus_tag LOCUS_50220 4357 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 5130 4585 gene locus_tag LOCUS_50230 5130 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 6385 5204 gene locus_tag LOCUS_50240 6385 5204 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922445.1 protein_id gnl|my_center|LOCUS_50240 6577 6504 gene locus_tag LOCUS_t00940 6577 6504 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7070 6654 gene locus_tag LOCUS_50250 gene nikR 7070 6654 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_50250 7786 7076 gene locus_tag LOCUS_50260 7786 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 10094 8055 gene locus_tag LOCUS_50270 10094 8055 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_50270 10384 10557 gene locus_tag LOCUS_50280 10384 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50280 10570 11019 gene locus_tag LOCUS_50290 10570 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50290 13890 12589 gene locus_tag LOCUS_50300 gene hemL 13890 12589 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_50300 14093 16381 gene locus_tag LOCUS_50310 14093 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 16378 16788 gene locus_tag LOCUS_50320 16378 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 16785 17036 gene locus_tag LOCUS_50330 16785 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 17840 17130 gene locus_tag LOCUS_50340 17840 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 18347 18012 gene locus_tag LOCUS_50350 18347 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 18625 18428 gene locus_tag LOCUS_50360 18625 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 >Feature sequence0154 170 1099 gene locus_tag LOCUS_50370 170 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 1096 1770 gene locus_tag LOCUS_50380 1096 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 1826 4057 gene locus_tag LOCUS_50390 1826 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 4650 5495 gene locus_tag LOCUS_50400 4650 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 5865 10238 gene locus_tag LOCUS_50410 5865 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 10656 11843 gene locus_tag LOCUS_50420 10656 11843 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_50420 11977 12906 gene locus_tag LOCUS_50430 11977 12906 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_50430 12927 14144 gene locus_tag LOCUS_50440 12927 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 14249 16069 gene locus_tag LOCUS_50450 14249 16069 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533438.1 protein_id gnl|my_center|LOCUS_50450 16727 16326 gene locus_tag LOCUS_50460 16727 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 18832 17921 gene locus_tag LOCUS_50470 18832 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 >Feature sequence0155 141 452 gene locus_tag LOCUS_50480 141 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 1686 598 gene locus_tag LOCUS_50490 1686 598 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_50490 2018 2659 gene locus_tag LOCUS_50500 2018 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 2652 3038 gene locus_tag LOCUS_50510 2652 3038 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_50510 3372 4754 gene locus_tag LOCUS_50520 gene creD 3372 4754 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214632.1 protein_id gnl|my_center|LOCUS_50520 7131 5059 gene locus_tag LOCUS_50530 7131 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 8471 7158 gene locus_tag LOCUS_50540 8471 7158 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886329.1 protein_id gnl|my_center|LOCUS_50540 9612 8611 gene locus_tag LOCUS_50550 9612 8611 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_50550 10699 9680 gene locus_tag LOCUS_50560 10699 9680 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_50560 11556 10702 gene locus_tag LOCUS_50570 gene speB 11556 10702 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_50570 12133 11582 gene locus_tag LOCUS_50580 12133 11582 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_50580 13429 12368 gene locus_tag LOCUS_50590 13429 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 13784 15151 gene locus_tag LOCUS_50600 13784 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 15156 16340 gene locus_tag LOCUS_50610 15156 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 16820 17689 gene locus_tag LOCUS_50620 16820 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 18286 17726 gene locus_tag LOCUS_50630 18286 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 >Feature sequence0156 <1 1220 gene locus_tag LOCUS_50640 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921428.1:general secretion pathway protein GspD 1442 10909 gene locus_tag LOCUS_50650 1442 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50650 12400 11078 gene locus_tag LOCUS_50660 12400 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 13754 12468 gene locus_tag LOCUS_50670 gene aroA 13754 12468 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_50670 15314 13836 gene locus_tag LOCUS_50680 15314 13836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 17085 15316 gene locus_tag LOCUS_50690 17085 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 17373 17900 gene locus_tag LOCUS_50700 gene pyrR 17373 17900 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_50700 17980 18939 gene locus_tag LOCUS_50710 17980 18939 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_50710 >Feature sequence0157 4328 2151 gene locus_tag LOCUS_50720 4328 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 4931 4761 gene locus_tag LOCUS_50730 4931 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 7050 4933 gene locus_tag LOCUS_50740 7050 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 10349 7542 gene locus_tag LOCUS_50750 10349 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 12919 10766 gene locus_tag LOCUS_50760 12919 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50760 13288 14280 gene locus_tag LOCUS_50770 13288 14280 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919405.1 protein_id gnl|my_center|LOCUS_50770 14885 15523 gene locus_tag LOCUS_50780 14885 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 15771 16439 gene locus_tag LOCUS_50790 15771 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 16439 17911 gene locus_tag LOCUS_50800 16439 17911 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_50800 >Feature sequence0158 2782 1451 gene locus_tag LOCUS_50810 2782 1451 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_50810 4833 2884 gene locus_tag LOCUS_50820 4833 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 6181 4853 gene locus_tag LOCUS_50830 6181 4853 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_50830 7885 6392 gene locus_tag LOCUS_50840 7885 6392 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804122.1 protein_id gnl|my_center|LOCUS_50840 8419 10164 gene locus_tag LOCUS_50850 8419 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 10425 11879 gene locus_tag LOCUS_50860 10425 11879 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_50860 12210 12941 gene locus_tag LOCUS_50870 12210 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 13235 13987 gene locus_tag LOCUS_50880 13235 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 14031 16160 gene locus_tag LOCUS_50890 14031 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 16610 17635 gene locus_tag LOCUS_50900 16610 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 >Feature sequence0159 <1 1831 gene locus_tag LOCUS_50910 <1 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065037.1:disaggregatase related repeat-containing protein 2314 1931 gene locus_tag LOCUS_50920 2314 1931 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942961.1 protein_id gnl|my_center|LOCUS_50920 2703 3386 gene locus_tag LOCUS_50930 2703 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 3541 4368 gene locus_tag LOCUS_50940 3541 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 5635 4439 gene locus_tag LOCUS_50950 5635 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 5854 5654 gene locus_tag LOCUS_50960 5854 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 6118 6867 gene locus_tag LOCUS_50970 6118 6867 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_50970 7436 6969 gene locus_tag LOCUS_50980 7436 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 9574 8210 gene locus_tag LOCUS_50990 9574 8210 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_50990 10993 9701 gene locus_tag LOCUS_51000 10993 9701 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_51000 11074 11144 gene locus_tag LOCUS_t00950 11074 11144 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11456 11929 gene locus_tag LOCUS_51010 gene mraZ 11456 11929 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_51010 11949 12158 gene locus_tag LOCUS_51020 11949 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 12192 13184 gene locus_tag LOCUS_51030 gene rsmH 12192 13184 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_51030 13248 14135 gene locus_tag LOCUS_51040 13248 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 14583 16160 gene locus_tag LOCUS_51050 14583 16160 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_51050 16271 17350 gene locus_tag LOCUS_51060 16271 17350 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704825.1 protein_id gnl|my_center|LOCUS_51060 <18766 17363 gene locus_tag LOCUS_51070 <18766 17363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932253.1:penicillin-binding protein 2 >Feature sequence0160 1517 45 gene locus_tag LOCUS_51080 1517 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 3249 1807 gene locus_tag LOCUS_51090 3249 1807 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_51090 4217 3264 gene locus_tag LOCUS_51100 4217 3264 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_51100 4771 4367 gene locus_tag LOCUS_51110 4771 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 5128 4940 gene locus_tag LOCUS_51120 5128 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 5631 5212 gene locus_tag LOCUS_51130 5631 5212 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_51130 8895 5650 gene locus_tag LOCUS_51140 8895 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 9350 8892 gene locus_tag LOCUS_51150 9350 8892 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_51150 10067 9351 gene locus_tag LOCUS_51160 10067 9351 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_51160 10411 10067 gene locus_tag LOCUS_51170 10411 10067 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_51170 11342 10398 gene locus_tag LOCUS_51180 11342 10398 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_51180 11715 11353 gene locus_tag LOCUS_51190 11715 11353 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_51190 14783 11712 gene locus_tag LOCUS_51200 14783 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 15194 14811 gene locus_tag LOCUS_51210 15194 14811 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_51210 16088 15207 gene locus_tag LOCUS_51220 16088 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 16991 16131 gene locus_tag LOCUS_51230 16991 16131 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_51230 17651 17073 gene locus_tag LOCUS_51240 17651 17073 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_51240 >Feature sequence0161 1194 2051 gene locus_tag LOCUS_51250 1194 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 2544 2245 gene locus_tag LOCUS_51260 2544 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 3483 2566 gene locus_tag LOCUS_51270 3483 2566 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_51270 4245 3574 gene locus_tag LOCUS_51280 4245 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 4747 6711 gene locus_tag LOCUS_51290 4747 6711 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_51290 7063 8529 gene locus_tag LOCUS_51300 gene mttB 7063 8529 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_51300 10228 8603 gene locus_tag LOCUS_51310 10228 8603 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 protein_id gnl|my_center|LOCUS_51310 10714 10977 gene locus_tag LOCUS_51320 10714 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 11757 11437 gene locus_tag LOCUS_51330 11757 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 14551 11786 gene locus_tag LOCUS_51340 14551 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 14954 15466 gene locus_tag LOCUS_51350 14954 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 17467 15452 gene locus_tag LOCUS_51360 17467 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 18419 17778 gene locus_tag LOCUS_51370 18419 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 >Feature sequence0162 2544 1387 gene locus_tag LOCUS_51380 2544 1387 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_51380 2718 4319 gene locus_tag LOCUS_51390 2718 4319 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_51390 4589 5314 gene locus_tag LOCUS_51400 4589 5314 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_51400 5348 5572 gene locus_tag LOCUS_51410 5348 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 5569 7404 gene locus_tag LOCUS_51420 5569 7404 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_51420 7432 8748 gene locus_tag LOCUS_51430 gene egsA 7432 8748 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_51430 9035 10534 gene locus_tag LOCUS_51440 9035 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 11189 12997 gene locus_tag LOCUS_51450 11189 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 13245 13418 gene locus_tag LOCUS_51460 13245 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 14273 13614 gene locus_tag LOCUS_51470 14273 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 15170 14469 gene locus_tag LOCUS_51480 15170 14469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51480 15643 15170 gene locus_tag LOCUS_51490 15643 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 16380 18122 gene locus_tag LOCUS_51500 16380 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 >Feature sequence0163 166 2733 gene locus_tag LOCUS_51510 166 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 2970 3134 gene locus_tag LOCUS_51520 2970 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 3110 5023 gene locus_tag LOCUS_51530 3110 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 5455 7440 gene locus_tag LOCUS_51540 5455 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 7752 10199 gene locus_tag LOCUS_51550 7752 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 10324 12417 gene locus_tag LOCUS_51560 10324 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 14295 12622 gene locus_tag LOCUS_51570 14295 12622 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_51570 15625 14300 gene locus_tag LOCUS_51580 15625 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 >Feature sequence0164 697 437 gene locus_tag LOCUS_51590 697 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 878 744 gene locus_tag LOCUS_51600 878 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 2246 891 gene locus_tag LOCUS_51610 2246 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 3790 2849 gene locus_tag LOCUS_51620 3790 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 4125 3844 gene locus_tag LOCUS_51630 4125 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 4326 4156 gene locus_tag LOCUS_51640 4326 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 5683 4499 gene locus_tag LOCUS_51650 5683 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 6002 6466 gene locus_tag LOCUS_51660 6002 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51660 6683 6892 gene locus_tag LOCUS_51670 6683 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_51670 7372 6866 gene locus_tag LOCUS_51680 7372 6866 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921436.1 protein_id gnl|my_center|LOCUS_51680 8615 7572 gene locus_tag LOCUS_51690 8615 7572 CDS product ligand-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022099.1 protein_id gnl|my_center|LOCUS_51690 10451 8787 gene locus_tag LOCUS_51700 10451 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 11183 10683 gene locus_tag LOCUS_51710 11183 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 11373 11197 gene locus_tag LOCUS_51720 11373 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51720 12017 11370 gene locus_tag LOCUS_51730 12017 11370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51730 14485 12830 gene locus_tag LOCUS_51740 14485 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 15776 14514 gene locus_tag LOCUS_51750 15776 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 16759 15887 gene locus_tag LOCUS_51760 16759 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 17596 16904 gene locus_tag LOCUS_51770 gene aqpZ 17596 16904 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_51770 >Feature sequence0165 470 2593 gene locus_tag LOCUS_51780 470 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 2907 5075 gene locus_tag LOCUS_51790 2907 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 5582 6001 gene locus_tag LOCUS_51800 5582 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 6126 6290 gene locus_tag LOCUS_51810 6126 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 6370 8346 gene locus_tag LOCUS_51820 6370 8346 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_51820 8399 9148 gene locus_tag LOCUS_51830 8399 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 9167 9880 gene locus_tag LOCUS_51840 9167 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 10913 13039 gene locus_tag LOCUS_51850 10913 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 14284 13403 gene locus_tag LOCUS_51860 gene metF 14284 13403 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_51860 14926 15213 gene locus_tag LOCUS_51870 14926 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 15210 15647 gene locus_tag LOCUS_51880 15210 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 15672 16379 gene locus_tag LOCUS_51890 15672 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 16449 17273 gene locus_tag LOCUS_51900 16449 17273 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 protein_id gnl|my_center|LOCUS_51900 >Feature sequence0166 384 698 gene locus_tag LOCUS_51910 384 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 1594 833 gene locus_tag LOCUS_51920 gene hisF 1594 833 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_51920 1819 3366 gene locus_tag LOCUS_51930 1819 3366 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_51930 3528 4898 gene locus_tag LOCUS_51940 3528 4898 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_51940 4900 5718 gene locus_tag LOCUS_51950 4900 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 5842 7080 gene locus_tag LOCUS_51960 5842 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 7250 11221 gene locus_tag LOCUS_51970 7250 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 11208 11393 gene locus_tag LOCUS_51980 11208 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 11314 12822 gene locus_tag LOCUS_51990 11314 12822 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_51990 12836 14236 gene locus_tag LOCUS_52000 12836 14236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 >Feature sequence0167 596 117 gene locus_tag LOCUS_52010 596 117 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545311.1 protein_id gnl|my_center|LOCUS_52010 1041 586 gene locus_tag LOCUS_52020 1041 586 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393623.1 protein_id gnl|my_center|LOCUS_52020 1471 1016 gene locus_tag LOCUS_52030 gene moaC 1471 1016 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454438.1 protein_id gnl|my_center|LOCUS_52030 2438 1476 gene locus_tag LOCUS_52040 gene moaA 2438 1476 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_52040 3640 2465 gene locus_tag LOCUS_52050 3640 2465 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_52050 3883 4359 gene locus_tag LOCUS_52060 3883 4359 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_52060 4362 6512 gene locus_tag LOCUS_52070 4362 6512 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_52070 7805 6540 gene locus_tag LOCUS_52080 7805 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 8338 7946 gene locus_tag LOCUS_52090 8338 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 11481 8347 gene locus_tag LOCUS_52100 11481 8347 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_52100 13757 11502 gene locus_tag LOCUS_52110 13757 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 15136 13760 gene locus_tag LOCUS_52120 15136 13760 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_52120 15722 15288 gene locus_tag LOCUS_52130 15722 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 16567 15842 gene locus_tag LOCUS_52140 16567 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence0168 194 643 gene locus_tag LOCUS_52150 194 643 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_52150 621 1418 gene locus_tag LOCUS_52160 621 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 1345 1875 gene locus_tag LOCUS_52170 1345 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 2052 2561 gene locus_tag LOCUS_52180 2052 2561 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_52180 3419 2673 gene locus_tag LOCUS_52190 3419 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 4854 3526 gene locus_tag LOCUS_52200 4854 3526 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_52200 5047 4964 gene locus_tag LOCUS_t00960 5047 4964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6608 5238 gene locus_tag LOCUS_52210 6608 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 6935 7399 gene locus_tag LOCUS_52220 gene ribE 6935 7399 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_52220 7481 7849 gene locus_tag LOCUS_52230 gene nusB 7481 7849 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_52230 7909 9252 gene locus_tag LOCUS_52240 7909 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 9427 9789 gene locus_tag LOCUS_52250 9427 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 9922 10125 gene locus_tag LOCUS_52260 9922 10125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 10375 10746 gene locus_tag LOCUS_52270 10375 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 11687 10869 gene locus_tag LOCUS_52280 11687 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 12647 11730 gene locus_tag LOCUS_52290 12647 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 13427 12699 gene locus_tag LOCUS_52300 13427 12699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 13710 16382 gene locus_tag LOCUS_52310 13710 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 >Feature sequence0169 1705 614 gene locus_tag LOCUS_52320 1705 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 2810 2040 gene locus_tag LOCUS_52330 2810 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 3094 2816 gene locus_tag LOCUS_52340 3094 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 4079 3483 gene locus_tag LOCUS_52350 4079 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 4799 4173 gene locus_tag LOCUS_52360 4799 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 6007 8322 gene locus_tag LOCUS_52370 6007 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 8796 11072 gene locus_tag LOCUS_52380 8796 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 11126 14005 gene locus_tag LOCUS_52390 11126 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 14365 16560 gene locus_tag LOCUS_52400 14365 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 >Feature sequence0170 3734 1233 gene locus_tag LOCUS_52410 3734 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 4030 5070 gene locus_tag LOCUS_52420 4030 5070 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_52420 5099 6706 gene locus_tag LOCUS_52430 5099 6706 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_52430 6777 7688 gene locus_tag LOCUS_52440 6777 7688 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_52440 8288 9502 gene locus_tag LOCUS_52450 8288 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 9531 11078 gene locus_tag LOCUS_52460 9531 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 11355 12362 gene locus_tag LOCUS_52470 11355 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 14454 12979 gene locus_tag LOCUS_52480 14454 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52480 14444 14968 gene locus_tag LOCUS_52490 14444 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 15324 15527 gene locus_tag LOCUS_52500 15324 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 >Feature sequence0171 490 335 gene locus_tag LOCUS_52510 490 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 467 631 gene locus_tag LOCUS_52520 467 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 634 1659 gene locus_tag LOCUS_52530 634 1659 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_52530 2168 3331 gene locus_tag LOCUS_52540 2168 3331 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_52540 4060 3653 gene locus_tag LOCUS_52550 4060 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 5151 4144 gene locus_tag LOCUS_52560 5151 4144 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_52560 5972 5199 gene locus_tag LOCUS_52570 5972 5199 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_52570 6683 5994 gene locus_tag LOCUS_52580 gene udk 6683 5994 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768807.1 protein_id gnl|my_center|LOCUS_52580 6958 8160 gene locus_tag LOCUS_52590 6958 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 8213 9457 gene locus_tag LOCUS_52600 8213 9457 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_52600 9461 10888 gene locus_tag LOCUS_52610 9461 10888 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839414.1 protein_id gnl|my_center|LOCUS_52610 11134 12294 gene locus_tag LOCUS_52620 gene dinB 11134 12294 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_52620 13048 13821 gene locus_tag LOCUS_52630 gene rfbF 13048 13821 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435696.1 protein_id gnl|my_center|LOCUS_52630 13829 14881 gene locus_tag LOCUS_52640 13829 14881 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 protein_id gnl|my_center|LOCUS_52640 14895 16151 gene locus_tag LOCUS_52650 14895 16151 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_52650 >Feature sequence0172 1961 1155 gene locus_tag LOCUS_52660 1961 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 2515 2369 gene locus_tag LOCUS_52670 2515 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 4312 2783 gene locus_tag LOCUS_52680 4312 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 6234 4234 gene locus_tag LOCUS_52690 6234 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 6648 7625 gene locus_tag LOCUS_52700 6648 7625 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_52700 7630 9993 gene locus_tag LOCUS_52710 7630 9993 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_52710 10075 11754 gene locus_tag LOCUS_52720 10075 11754 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_52720 11837 13717 gene locus_tag LOCUS_52730 11837 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 13722 15110 gene locus_tag LOCUS_52740 13722 15110 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_52740 15140 16003 gene locus_tag LOCUS_52750 15140 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 >Feature sequence0173 15 194 gene locus_tag LOCUS_52760 15 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 196 1233 gene locus_tag LOCUS_52770 196 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 2729 1368 gene locus_tag LOCUS_52780 2729 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 2938 4233 gene locus_tag LOCUS_52790 2938 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 4230 5906 gene locus_tag LOCUS_52800 4230 5906 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_52800 6182 8263 gene locus_tag LOCUS_52810 6182 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52810 8328 9656 gene locus_tag LOCUS_52820 8328 9656 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_52820 10588 9812 gene locus_tag LOCUS_52830 10588 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 10718 10912 gene locus_tag LOCUS_52840 10718 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 12009 11617 gene locus_tag LOCUS_52850 12009 11617 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417583.1 protein_id gnl|my_center|LOCUS_52850 12893 12333 gene locus_tag LOCUS_52860 12893 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52860 13351 15405 gene locus_tag LOCUS_52870 13351 15405 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_52870 >Feature sequence0174 605 423 gene locus_tag LOCUS_52880 605 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_52880 720 887 gene locus_tag LOCUS_52890 720 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 1151 942 gene locus_tag LOCUS_52900 1151 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 1210 2208 gene locus_tag LOCUS_52910 1210 2208 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_52910 2565 3494 gene locus_tag LOCUS_52920 2565 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 3934 4221 gene locus_tag LOCUS_52930 3934 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 4208 5485 gene locus_tag LOCUS_52940 4208 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 5463 6419 gene locus_tag LOCUS_52950 5463 6419 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_52950 6423 7733 gene locus_tag LOCUS_52960 6423 7733 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259740.1 protein_id gnl|my_center|LOCUS_52960 8742 7750 gene locus_tag LOCUS_52970 8742 7750 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_52970 9572 8739 gene locus_tag LOCUS_52980 9572 8739 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256259.1 protein_id gnl|my_center|LOCUS_52980 10005 10919 gene locus_tag LOCUS_52990 10005 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52990 10971 11864 gene locus_tag LOCUS_53000 10971 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 13725 12061 gene locus_tag LOCUS_53010 13725 12061 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_53010 14702 14121 gene locus_tag LOCUS_53020 gene hxlB 14702 14121 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_53020 <15801 14680 gene locus_tag LOCUS_53030 <15801 14680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878362.1:bifunctional hexulose-6-phosphate synthase/ribonuclease regulator >Feature sequence0175 <1 3546 gene locus_tag LOCUS_53040 <1 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061304.1:PQQ-binding-like beta-propeller repeat protein 4295 3591 gene locus_tag LOCUS_53050 4295 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 5508 4420 gene locus_tag LOCUS_53060 gene mgrA 5508 4420 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_53060 7903 5720 gene locus_tag LOCUS_53070 7903 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 8335 11109 gene locus_tag LOCUS_53080 8335 11109 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_53080 11120 12385 gene locus_tag LOCUS_53090 11120 12385 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_53090 13901 12441 gene locus_tag LOCUS_53100 13901 12441 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_53100 14780 15271 gene locus_tag LOCUS_53110 14780 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 >Feature sequence0176 352 2280 gene locus_tag LOCUS_53120 352 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 2294 11017 gene locus_tag LOCUS_53130 2294 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 11181 11438 gene locus_tag LOCUS_53140 11181 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 11597 12322 gene locus_tag LOCUS_53150 11597 12322 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_53150 12663 13331 gene locus_tag LOCUS_53160 12663 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 13328 13528 gene locus_tag LOCUS_53170 13328 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 13757 14080 gene locus_tag LOCUS_53180 13757 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 14335 15012 gene locus_tag LOCUS_53190 14335 15012 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_53190 >Feature sequence0177 592 1428 gene locus_tag LOCUS_53200 592 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426730.1 protein_id gnl|my_center|LOCUS_53200 1450 2700 gene locus_tag LOCUS_53210 1450 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53210 2743 3012 gene locus_tag LOCUS_53220 2743 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 2999 3466 gene locus_tag LOCUS_53230 2999 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53230 3475 3936 gene locus_tag LOCUS_53240 3475 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 3936 5321 gene locus_tag LOCUS_53250 3936 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 5314 5847 gene locus_tag LOCUS_53260 5314 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 5844 6671 gene locus_tag LOCUS_53270 5844 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 6664 7185 gene locus_tag LOCUS_53280 6664 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 7178 7846 gene locus_tag LOCUS_53290 7178 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53290 7846 9153 gene locus_tag LOCUS_53300 7846 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 9153 11036 gene locus_tag LOCUS_53310 9153 11036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53310 11037 13376 gene locus_tag LOCUS_53320 11037 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 13651 13406 gene locus_tag LOCUS_53330 13651 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 13835 13644 gene locus_tag LOCUS_53340 13835 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 14013 13828 gene locus_tag LOCUS_53350 14013 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53350 14450 14133 gene locus_tag LOCUS_53360 14450 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 14628 14443 gene locus_tag LOCUS_53370 14628 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 14867 14625 gene locus_tag LOCUS_53380 14867 14625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 >Feature sequence0178 90 836 gene locus_tag LOCUS_53390 90 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 1157 2431 gene locus_tag LOCUS_53400 gene dnaN 1157 2431 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_53400 2505 2852 gene locus_tag LOCUS_53410 2505 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 2938 5415 gene locus_tag LOCUS_53420 gene gyrB 2938 5415 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882923.1 protein_id gnl|my_center|LOCUS_53420 6589 5495 gene locus_tag LOCUS_53430 6589 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 7875 6670 gene locus_tag LOCUS_53440 7875 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 8612 7887 gene locus_tag LOCUS_53450 8612 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 9130 8609 gene locus_tag LOCUS_53460 9130 8609 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_53460 9386 10117 gene locus_tag LOCUS_53470 9386 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 10307 12016 gene locus_tag LOCUS_53480 gene putP 10307 12016 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_53480 12102 12608 gene locus_tag LOCUS_53490 12102 12608 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135550050.1 protein_id gnl|my_center|LOCUS_53490 12605 13525 gene locus_tag LOCUS_53500 12605 13525 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_53500 13522 13956 gene locus_tag LOCUS_53510 13522 13956 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172297.1 protein_id gnl|my_center|LOCUS_53510 14009 14323 gene locus_tag LOCUS_53520 14009 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence0179 298 1128 gene locus_tag LOCUS_53530 298 1128 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065281.1 protein_id gnl|my_center|LOCUS_53530 1278 2279 gene locus_tag LOCUS_53540 1278 2279 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_53540 2289 3029 gene locus_tag LOCUS_53550 gene truA 2289 3029 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_53550 3052 4227 gene locus_tag LOCUS_53560 3052 4227 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_53560 4254 4625 gene locus_tag LOCUS_53570 4254 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 4676 5092 gene locus_tag LOCUS_53580 4676 5092 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200957.1 protein_id gnl|my_center|LOCUS_53580 5195 5728 gene locus_tag LOCUS_53590 5195 5728 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_53590 7066 5672 gene locus_tag LOCUS_53600 7066 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 10217 7191 gene locus_tag LOCUS_53610 10217 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 10872 10312 gene locus_tag LOCUS_53620 gene frr 10872 10312 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_53620 11627 10893 gene locus_tag LOCUS_53630 gene pyrH 11627 10893 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880427.1 protein_id gnl|my_center|LOCUS_53630 12581 11715 gene locus_tag LOCUS_53640 gene tsf 12581 11715 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_53640 13579 12701 gene locus_tag LOCUS_53650 gene rpsB 13579 12701 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_53650 14339 13926 gene locus_tag LOCUS_53660 14339 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 >Feature sequence0180 3549 1975 gene locus_tag LOCUS_53670 3549 1975 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_53670 5001 3583 gene locus_tag LOCUS_53680 5001 3583 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_53680 5476 6822 gene locus_tag LOCUS_53690 5476 6822 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53690 7214 6999 gene locus_tag LOCUS_53700 7214 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 7822 11883 gene locus_tag LOCUS_53710 7822 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53710 12083 13171 gene locus_tag LOCUS_53720 12083 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 13283 14524 gene locus_tag LOCUS_53730 13283 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 >Feature sequence0181 1855 656 gene locus_tag LOCUS_53740 1855 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 3700 2663 gene locus_tag LOCUS_53750 3700 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 4395 5138 gene locus_tag LOCUS_53760 4395 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 5266 6603 gene locus_tag LOCUS_53770 5266 6603 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_53770 6629 7258 gene locus_tag LOCUS_53780 6629 7258 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_53780 7255 9060 gene locus_tag LOCUS_53790 7255 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 9033 9488 gene locus_tag LOCUS_53800 9033 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 9493 10116 gene locus_tag LOCUS_53810 9493 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 10257 10817 gene locus_tag LOCUS_53820 10257 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 10801 12603 gene locus_tag LOCUS_53830 10801 12603 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_53830 12818 14593 gene locus_tag LOCUS_53840 12818 14593 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_53840 >Feature sequence0182 440 829 gene locus_tag LOCUS_53850 440 829 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929155.1 protein_id gnl|my_center|LOCUS_53850 826 6432 gene locus_tag LOCUS_53860 826 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 7621 6653 gene locus_tag LOCUS_53870 7621 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 8604 7696 gene locus_tag LOCUS_53880 8604 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 10500 8809 gene locus_tag LOCUS_53890 10500 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 10901 10596 gene locus_tag LOCUS_53900 10901 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 10834 12732 gene locus_tag LOCUS_53910 10834 12732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 13566 12796 gene locus_tag LOCUS_53920 13566 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 14441 13563 gene locus_tag LOCUS_53930 14441 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 >Feature sequence0183 712 1458 gene locus_tag LOCUS_53940 712 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 3446 2118 gene locus_tag LOCUS_53950 3446 2118 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_53950 3574 3807 gene locus_tag LOCUS_53960 3574 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 3922 5964 gene locus_tag LOCUS_53970 3922 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 8231 5994 gene locus_tag LOCUS_53980 8231 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 9881 8409 gene locus_tag LOCUS_53990 9881 8409 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_53990 10417 12060 gene locus_tag LOCUS_54000 10417 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 11990 12226 gene locus_tag LOCUS_54010 11990 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 12471 13412 gene locus_tag LOCUS_54020 12471 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 >Feature sequence0184 2052 1450 gene locus_tag LOCUS_54030 2052 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54030 4841 2052 gene locus_tag LOCUS_54040 4841 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 5085 4834 gene locus_tag LOCUS_54050 5085 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 5731 5072 gene locus_tag LOCUS_54060 5731 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 6267 5728 gene locus_tag LOCUS_54070 6267 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 7751 6288 gene locus_tag LOCUS_54080 7751 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 8932 7808 gene locus_tag LOCUS_54090 8932 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 9380 8946 gene locus_tag LOCUS_54100 9380 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 9834 9424 gene locus_tag LOCUS_54110 9834 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 10052 9870 gene locus_tag LOCUS_54120 10052 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 11030 10113 gene locus_tag LOCUS_54130 11030 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 11121 11049 gene locus_tag LOCUS_t00970 11121 11049 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11751 11122 gene locus_tag LOCUS_54140 11751 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207910.1 protein_id gnl|my_center|LOCUS_54140 12402 11761 gene locus_tag LOCUS_54150 12402 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 12893 12399 gene locus_tag LOCUS_54160 12893 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 13258 12944 gene locus_tag LOCUS_54170 13258 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54170 13801 13343 gene locus_tag LOCUS_54180 13801 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence0185 41 481 gene locus_tag LOCUS_54190 41 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 541 1260 gene locus_tag LOCUS_54200 541 1260 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860330.1 protein_id gnl|my_center|LOCUS_54200 1271 1738 gene locus_tag LOCUS_54210 1271 1738 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_54210 1780 3189 gene locus_tag LOCUS_54220 1780 3189 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132123697.1 protein_id gnl|my_center|LOCUS_54220 3227 4474 gene locus_tag LOCUS_54230 3227 4474 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_54230 4884 7043 gene locus_tag LOCUS_54240 4884 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 7809 7186 gene locus_tag LOCUS_54250 7809 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 8346 7912 gene locus_tag LOCUS_54260 8346 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54260 11677 8408 gene locus_tag LOCUS_54270 11677 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54270 11902 12963 gene locus_tag LOCUS_54280 gene rlmN 11902 12963 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_54280 12956 13906 gene locus_tag LOCUS_54290 gene pfkB 12956 13906 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112874.1 protein_id gnl|my_center|LOCUS_54290 >Feature sequence0186 1826 726 gene locus_tag LOCUS_54300 gene proB 1826 726 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_54300 1996 2466 gene locus_tag LOCUS_54310 1996 2466 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_54310 3401 2526 gene locus_tag LOCUS_54320 3401 2526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 protein_id gnl|my_center|LOCUS_54320 3650 3994 gene locus_tag LOCUS_54330 3650 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54330 4911 4012 gene locus_tag LOCUS_54340 4911 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 5118 5840 gene locus_tag LOCUS_54350 5118 5840 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021349.1 protein_id gnl|my_center|LOCUS_54350 5915 7318 gene locus_tag LOCUS_54360 5915 7318 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 protein_id gnl|my_center|LOCUS_54360 7441 7512 gene locus_tag LOCUS_t00980 7441 7512 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7767 9335 gene locus_tag LOCUS_54370 gene tig 7767 9335 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_54370 9536 10282 gene locus_tag LOCUS_54380 9536 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 10346 10981 gene locus_tag LOCUS_54390 gene clpP 10346 10981 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_54390 11011 11667 gene locus_tag LOCUS_54400 11011 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 11787 12782 gene locus_tag LOCUS_54410 11787 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 >Feature sequence0187 2360 3577 gene locus_tag LOCUS_54420 2360 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 6088 3887 gene locus_tag LOCUS_54430 6088 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 8356 6125 gene locus_tag LOCUS_54440 8356 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54440 10973 8751 gene locus_tag LOCUS_54450 10973 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 13905 11038 gene locus_tag LOCUS_54460 13905 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 14240 13974 gene locus_tag LOCUS_54470 14240 13974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 >Feature sequence0188 1858 311 gene locus_tag LOCUS_54480 1858 311 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117783.1 protein_id gnl|my_center|LOCUS_54480 5012 1872 gene locus_tag LOCUS_54490 5012 1872 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117787.1 protein_id gnl|my_center|LOCUS_54490 6304 5087 gene locus_tag LOCUS_54500 6304 5087 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615854.1 protein_id gnl|my_center|LOCUS_54500 6333 6671 gene locus_tag LOCUS_54510 6333 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 7713 9038 gene locus_tag LOCUS_54520 7713 9038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_54520 9315 9521 gene locus_tag LOCUS_54530 9315 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 9559 12621 gene locus_tag LOCUS_54540 9559 12621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 13355 12684 gene locus_tag LOCUS_54550 13355 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 >Feature sequence0189 123 1400 gene locus_tag LOCUS_54560 123 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 2618 1635 gene locus_tag LOCUS_54570 2618 1635 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_54570 2895 4208 gene locus_tag LOCUS_54580 gene wbpA 2895 4208 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_54580 4228 5334 gene locus_tag LOCUS_54590 4228 5334 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_54590 5345 5893 gene locus_tag LOCUS_54600 5345 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 5979 7259 gene locus_tag LOCUS_54610 5979 7259 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_54610 7414 7692 gene locus_tag LOCUS_54620 7414 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 7741 8691 gene locus_tag LOCUS_54630 7741 8691 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403405.1 protein_id gnl|my_center|LOCUS_54630 8868 10529 gene locus_tag LOCUS_54640 8868 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 10414 11049 gene locus_tag LOCUS_54650 10414 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 11156 12733 gene locus_tag LOCUS_54660 11156 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 12993 13538 gene locus_tag LOCUS_54670 12993 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 >Feature sequence0190 423 1259 gene locus_tag LOCUS_54680 423 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 1655 1347 gene locus_tag LOCUS_54690 1655 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54690 2150 1716 gene locus_tag LOCUS_54700 2150 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 2656 3513 gene locus_tag LOCUS_54710 2656 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 3749 4321 gene locus_tag LOCUS_54720 3749 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 5879 4449 gene locus_tag LOCUS_54730 5879 4449 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_54730 7494 6028 gene locus_tag LOCUS_54740 gene putP 7494 6028 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016145.1 protein_id gnl|my_center|LOCUS_54740 9695 7581 gene locus_tag LOCUS_54750 9695 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 11395 9815 gene locus_tag LOCUS_54760 11395 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 11615 12331 gene locus_tag LOCUS_54770 11615 12331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 >Feature sequence0191 276 97 gene locus_tag LOCUS_54780 276 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54780 620 270 gene locus_tag LOCUS_54790 620 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 1234 2883 gene locus_tag LOCUS_54800 1234 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 2905 3651 gene locus_tag LOCUS_54810 2905 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 3751 4950 gene locus_tag LOCUS_54820 3751 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 4973 5671 gene locus_tag LOCUS_54830 4973 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 9905 5739 gene locus_tag LOCUS_54840 9905 5739 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022493.1 protein_id gnl|my_center|LOCUS_54840 10791 9895 gene locus_tag LOCUS_54850 10791 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 11572 11042 gene locus_tag LOCUS_54860 11572 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 12158 11889 gene locus_tag LOCUS_54870 12158 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 12339 12734 gene locus_tag LOCUS_54880 12339 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 >Feature sequence0192 479 1438 gene locus_tag LOCUS_54890 479 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 2384 1455 gene locus_tag LOCUS_54900 2384 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 5347 2561 gene locus_tag LOCUS_54910 5347 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 5554 5925 gene locus_tag LOCUS_54920 5554 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 6714 5935 gene locus_tag LOCUS_54930 6714 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54930 8055 6787 gene locus_tag LOCUS_54940 gene murA 8055 6787 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_54940 8682 8497 gene locus_tag LOCUS_54950 8682 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 9114 11123 gene locus_tag LOCUS_54960 9114 11123 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766740.1 protein_id gnl|my_center|LOCUS_54960 12800 11256 gene locus_tag LOCUS_54970 12800 11256 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_54970 >Feature sequence0193 668 2398 gene locus_tag LOCUS_54980 668 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 4605 2479 gene locus_tag LOCUS_54990 4605 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 5089 6036 gene locus_tag LOCUS_55000 5089 6036 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_55000 7465 6068 gene locus_tag LOCUS_55010 7465 6068 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_55010 7658 7837 gene locus_tag LOCUS_55020 7658 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 7956 8528 gene locus_tag LOCUS_55030 7956 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55030 8807 10147 gene locus_tag LOCUS_55040 8807 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 12033 10243 gene locus_tag LOCUS_55050 12033 10243 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_55050 >Feature sequence0194 4339 5034 gene locus_tag LOCUS_55060 4339 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 5213 6055 gene locus_tag LOCUS_55070 gene nfo 5213 6055 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097964.1 protein_id gnl|my_center|LOCUS_55070 6152 8803 gene locus_tag LOCUS_55080 6152 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 8955 9629 gene locus_tag LOCUS_55090 8955 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 9846 10256 gene locus_tag LOCUS_55100 9846 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 10691 10362 gene locus_tag LOCUS_55110 10691 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 11296 12201 gene locus_tag LOCUS_55120 gene cysD 11296 12201 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760694.1 protein_id gnl|my_center|LOCUS_55120 >Feature sequence0195 <1 903 gene locus_tag LOCUS_55130 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921320.1:DUF1592 domain-containing protein 1138 2415 gene locus_tag LOCUS_55140 1138 2415 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_55140 7472 2943 gene locus_tag LOCUS_55150 7472 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 8113 8409 gene locus_tag LOCUS_55160 8113 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 8524 9870 gene locus_tag LOCUS_55170 8524 9870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_55170 11080 9917 gene locus_tag LOCUS_55180 11080 9917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 11574 11203 gene locus_tag LOCUS_55190 11574 11203 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_55190 11826 11626 gene locus_tag LOCUS_55200 11826 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 >Feature sequence0196 193 41 gene locus_tag LOCUS_55210 193 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 242 478 gene locus_tag LOCUS_55220 242 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 754 1014 gene locus_tag LOCUS_55230 754 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 1011 3326 gene locus_tag LOCUS_55240 1011 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 3825 5339 gene locus_tag LOCUS_55250 3825 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 5336 5263 gene locus_tag LOCUS_t00990 5336 5263 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6340 5561 gene locus_tag LOCUS_55260 6340 5561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_55260 7753 6437 gene locus_tag LOCUS_55270 7753 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 8995 7964 gene locus_tag LOCUS_55280 8995 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 10067 8967 gene locus_tag LOCUS_55290 10067 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 10830 10543 gene locus_tag LOCUS_55300 10830 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 12681 12121 gene locus_tag LOCUS_55310 12681 12121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 >Feature sequence0197 5748 1936 gene locus_tag LOCUS_55320 5748 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 6312 5950 gene locus_tag LOCUS_55330 6312 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 6499 6293 gene locus_tag LOCUS_55340 6499 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 7978 6638 gene locus_tag LOCUS_55350 gene ltrA 7978 6638 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393716.1 protein_id gnl|my_center|LOCUS_55350 8342 7995 gene locus_tag LOCUS_55360 8342 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 10027 8750 gene locus_tag LOCUS_55370 10027 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 11286 10291 gene locus_tag LOCUS_55380 11286 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 11581 11348 gene locus_tag LOCUS_55390 11581 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 >Feature sequence0198 406 1686 gene locus_tag LOCUS_55400 gene hisS 406 1686 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_55400 1843 2865 gene locus_tag LOCUS_55410 1843 2865 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_55410 2941 3456 gene locus_tag LOCUS_55420 2941 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 3641 4048 gene locus_tag LOCUS_55430 3641 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 4098 4646 gene locus_tag LOCUS_55440 gene rsmD 4098 4646 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_55440 4643 5869 gene locus_tag LOCUS_55450 4643 5869 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_55450 5894 8209 gene locus_tag LOCUS_55460 5894 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_55460 8215 9378 gene locus_tag LOCUS_55470 8215 9378 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_55470 9529 10944 gene locus_tag LOCUS_55480 9529 10944 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295834.1 protein_id gnl|my_center|LOCUS_55480 10944 12083 gene locus_tag LOCUS_55490 10944 12083 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208542.1 protein_id gnl|my_center|LOCUS_55490 >Feature sequence0199 <1 1498 gene locus_tag LOCUS_55500 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118059.1:sulfatase 3195 1846 gene locus_tag LOCUS_55510 3195 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55510 3980 3234 gene locus_tag LOCUS_55520 3980 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 4931 6427 gene locus_tag LOCUS_55530 4931 6427 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_55530 6877 8151 gene locus_tag LOCUS_55540 6877 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 9995 8778 gene locus_tag LOCUS_55550 9995 8778 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_55550 10405 11946 gene locus_tag LOCUS_55560 10405 11946 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_55560 >Feature sequence0200 2167 3528 gene locus_tag LOCUS_55570 2167 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 4154 6973 gene locus_tag LOCUS_55580 4154 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 7108 8853 gene locus_tag LOCUS_55590 gene ggt 7108 8853 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_55590 8942 10612 gene locus_tag LOCUS_55600 8942 10612 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084630422.1 protein_id gnl|my_center|LOCUS_55600 11480 10620 gene locus_tag LOCUS_55610 11480 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 <12518 11608 gene locus_tag LOCUS_55620 <12518 11608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922558.1:SMP-30/gluconolactonase/LRE family protein >Feature sequence0201 24 521 gene locus_tag LOCUS_55630 24 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 599 1078 gene locus_tag LOCUS_55640 599 1078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925827.1 protein_id gnl|my_center|LOCUS_55640 1188 2237 gene locus_tag LOCUS_55650 1188 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 2483 2920 gene locus_tag LOCUS_55660 2483 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55660 3416 4204 gene locus_tag LOCUS_55670 3416 4204 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_55670 4380 5975 gene locus_tag LOCUS_55680 4380 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55680 6705 7268 gene locus_tag LOCUS_55690 6705 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 7990 9474 gene locus_tag LOCUS_55700 7990 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 10315 10761 gene locus_tag LOCUS_55710 10315 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 10856 12127 gene locus_tag LOCUS_55720 10856 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55720 >Feature sequence0202 651 842 gene locus_tag LOCUS_55730 651 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 848 2341 gene locus_tag LOCUS_55740 848 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 2407 2333 gene locus_tag LOCUS_t01000 2407 2333 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3368 2550 gene locus_tag LOCUS_55750 3368 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 4464 3409 gene locus_tag LOCUS_55760 4464 3409 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_55760 5578 5006 gene locus_tag LOCUS_55770 5578 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55770 5968 6594 gene locus_tag LOCUS_55780 5968 6594 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_55780 7079 6708 gene locus_tag LOCUS_55790 7079 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 7687 9390 gene locus_tag LOCUS_55800 7687 9390 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_55800 10553 9651 gene locus_tag LOCUS_55810 10553 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55810 11380 10610 gene locus_tag LOCUS_55820 11380 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 11969 11367 gene locus_tag LOCUS_55830 11969 11367 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_55830 >Feature sequence0203 129 1496 gene locus_tag LOCUS_55840 129 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55840 1511 1855 gene locus_tag LOCUS_55850 1511 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55850 1938 3434 gene locus_tag LOCUS_55860 1938 3434 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_55860 3437 6730 gene locus_tag LOCUS_55870 3437 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 6723 8276 gene locus_tag LOCUS_55880 6723 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 8389 9945 gene locus_tag LOCUS_55890 8389 9945 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_55890 9948 11441 gene locus_tag LOCUS_55900 9948 11441 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_55900 11827 11483 gene locus_tag LOCUS_55910 11827 11483 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_55910 >Feature sequence0204 654 2219 gene locus_tag LOCUS_55920 654 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 2216 4144 gene locus_tag LOCUS_55930 2216 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 4472 7438 gene locus_tag LOCUS_55940 4472 7438 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197443608.1 protein_id gnl|my_center|LOCUS_55940 8562 9809 gene locus_tag LOCUS_55950 8562 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 10575 11312 gene locus_tag LOCUS_55960 10575 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55960 >Feature sequence0205 630 157 gene locus_tag LOCUS_55970 gene rpsG 630 157 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_55970 1050 679 gene locus_tag LOCUS_55980 gene rpsL 1050 679 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_55980 5382 1087 gene locus_tag LOCUS_55990 gene rpoC 5382 1087 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333812.1 protein_id gnl|my_center|LOCUS_55990 9265 5432 gene locus_tag LOCUS_56000 gene rpoB 9265 5432 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340662.1 protein_id gnl|my_center|LOCUS_56000 9862 9362 gene locus_tag LOCUS_56010 9862 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 10513 9980 gene locus_tag LOCUS_56020 gene rplJ 10513 9980 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_56020 11224 10547 gene locus_tag LOCUS_56030 gene rplA 11224 10547 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_56030 11680 11255 gene locus_tag LOCUS_56040 gene rplK 11680 11255 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870243.1 protein_id gnl|my_center|LOCUS_56040 >Feature sequence0206 499 305 gene locus_tag LOCUS_56050 499 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 1215 2579 gene locus_tag LOCUS_56060 1215 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 2644 2865 gene locus_tag LOCUS_56070 2644 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 2997 4406 gene locus_tag LOCUS_56080 2997 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56080 6758 4824 gene locus_tag LOCUS_56090 6758 4824 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 protein_id gnl|my_center|LOCUS_56090 7777 6851 gene locus_tag LOCUS_56100 7777 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 8344 11256 gene locus_tag LOCUS_56110 8344 11256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 11864 11505 gene locus_tag LOCUS_56120 11864 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 11948 12097 gene locus_tag LOCUS_56130 11948 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56130 >Feature sequence0207 1892 4057 gene locus_tag LOCUS_56140 1892 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 4322 8812 gene locus_tag LOCUS_56150 4322 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 9989 8838 gene locus_tag LOCUS_56160 9989 8838 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_56160 10327 10019 gene locus_tag LOCUS_56170 10327 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56170 >Feature sequence0208 482 1819 gene locus_tag LOCUS_56180 482 1819 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_56180 1907 3586 gene locus_tag LOCUS_56190 1907 3586 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_56190 3598 4935 gene locus_tag LOCUS_56200 3598 4935 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_56200 4958 6580 gene locus_tag LOCUS_56210 4958 6580 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384301.1 protein_id gnl|my_center|LOCUS_56210 6596 7993 gene locus_tag LOCUS_56220 6596 7993 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_56220 8012 9403 gene locus_tag LOCUS_56230 8012 9403 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_56230 9422 10609 gene locus_tag LOCUS_56240 9422 10609 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533002.1 protein_id gnl|my_center|LOCUS_56240 10782 11003 gene locus_tag LOCUS_56250 10782 11003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 11027 11881 gene locus_tag LOCUS_56260 11027 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_56260 >Feature sequence0209 1601 177 gene locus_tag LOCUS_56270 1601 177 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_56270 1982 2938 gene locus_tag LOCUS_56280 1982 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 3181 3384 gene locus_tag LOCUS_56290 3181 3384 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558414.1 protein_id gnl|my_center|LOCUS_56290 5866 3593 gene locus_tag LOCUS_56300 5866 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 6453 7823 gene locus_tag LOCUS_56310 6453 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 7980 9245 gene locus_tag LOCUS_56320 7980 9245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 9327 10856 gene locus_tag LOCUS_56330 9327 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 >Feature sequence0210 1689 394 gene locus_tag LOCUS_56340 1689 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 2231 1686 gene locus_tag LOCUS_56350 2231 1686 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_56350 2423 2701 gene locus_tag LOCUS_56360 2423 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 3339 5147 gene locus_tag LOCUS_56370 3339 5147 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966827.1 protein_id gnl|my_center|LOCUS_56370 5619 6605 gene locus_tag LOCUS_56380 5619 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 6677 7396 gene locus_tag LOCUS_56390 6677 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56390 7737 9176 gene locus_tag LOCUS_56400 7737 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 9819 9661 gene locus_tag LOCUS_56410 9819 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 10090 11808 gene locus_tag LOCUS_56420 10090 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 >Feature sequence0211 553 4203 gene locus_tag LOCUS_56430 553 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56430 5796 4423 gene locus_tag LOCUS_56440 5796 4423 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_56440 7504 5927 gene locus_tag LOCUS_56450 gene cimA 7504 5927 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_56450 8304 7768 gene locus_tag LOCUS_56460 8304 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 11425 8699 gene locus_tag LOCUS_56470 11425 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 >Feature sequence0212 1466 156 gene locus_tag LOCUS_56480 1466 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 2702 1524 gene locus_tag LOCUS_56490 2702 1524 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_56490 3083 2736 gene locus_tag LOCUS_56500 3083 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 4891 3083 gene locus_tag LOCUS_56510 4891 3083 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_56510 5729 5556 gene locus_tag LOCUS_56520 5729 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 6861 5773 gene locus_tag LOCUS_56530 6861 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 7954 7001 gene locus_tag LOCUS_56540 7954 7001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_56540 9010 8054 gene locus_tag LOCUS_56550 9010 8054 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_56550 11355 11861 gene locus_tag LOCUS_56560 11355 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 >Feature sequence0213 593 219 gene locus_tag LOCUS_56570 593 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 2352 607 gene locus_tag LOCUS_56580 2352 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 4908 2398 gene locus_tag LOCUS_56590 4908 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 8686 4901 gene locus_tag LOCUS_56600 8686 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 9099 8740 gene locus_tag LOCUS_56610 9099 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56610 9329 9144 gene locus_tag LOCUS_56620 9329 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 9679 9530 gene locus_tag LOCUS_56630 9679 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 10162 9875 gene locus_tag LOCUS_56640 10162 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 10768 10268 gene locus_tag LOCUS_56650 10768 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 11546 11337 gene locus_tag LOCUS_56660 11546 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence0214 <1 812 gene locus_tag LOCUS_56670 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943259.1:SpoIID/LytB domain-containing protein 700 1908 gene locus_tag LOCUS_56680 gene tgt 700 1908 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_56680 2006 2416 gene locus_tag LOCUS_56690 2006 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 2492 6160 gene locus_tag LOCUS_56700 2492 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56700 6207 6638 gene locus_tag LOCUS_56710 6207 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 7471 6716 gene locus_tag LOCUS_56720 gene pgl 7471 6716 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_56720 10972 7724 gene locus_tag LOCUS_56730 10972 7724 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_56730 <11696 10973 gene locus_tag LOCUS_56740 <11696 10973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071226.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0215 1632 199 gene locus_tag LOCUS_56750 1632 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 2787 1699 gene locus_tag LOCUS_56760 2787 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 3004 3618 gene locus_tag LOCUS_56770 3004 3618 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120732.1 protein_id gnl|my_center|LOCUS_56770 3618 6116 gene locus_tag LOCUS_56780 3618 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 7849 6479 gene locus_tag LOCUS_56790 7849 6479 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_56790 8261 8563 gene locus_tag LOCUS_56800 8261 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 8890 9333 gene locus_tag LOCUS_56810 8890 9333 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_56810 9564 10439 gene locus_tag LOCUS_56820 9564 10439 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_56820 >Feature sequence0216 388 3165 gene locus_tag LOCUS_56830 388 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 3785 6283 gene locus_tag LOCUS_56840 3785 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 6774 7868 gene locus_tag LOCUS_56850 6774 7868 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_56850 9098 8178 gene locus_tag LOCUS_56860 9098 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 10541 9345 gene locus_tag LOCUS_56870 10541 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 >Feature sequence0217 1862 582 gene locus_tag LOCUS_56880 1862 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 2938 1862 gene locus_tag LOCUS_56890 2938 1862 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_56890 4176 2968 gene locus_tag LOCUS_56900 4176 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 5143 4214 gene locus_tag LOCUS_56910 5143 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 5916 5155 gene locus_tag LOCUS_56920 5916 5155 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_56920 6981 5947 gene locus_tag LOCUS_56930 6981 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 10417 7076 gene locus_tag LOCUS_56940 10417 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 >Feature sequence0218 <1 738 gene locus_tag LOCUS_56950 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444330.1:cation diffusion facilitator family transporter 1030 761 gene locus_tag LOCUS_56960 1030 761 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037342.1 protein_id gnl|my_center|LOCUS_56960 1185 3284 gene locus_tag LOCUS_56970 1185 3284 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_56970 3287 5158 gene locus_tag LOCUS_56980 3287 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 5167 6303 gene locus_tag LOCUS_56990 5167 6303 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941879.1 protein_id gnl|my_center|LOCUS_56990 7698 6379 gene locus_tag LOCUS_57000 7698 6379 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943127.1 protein_id gnl|my_center|LOCUS_57000 9757 7778 gene locus_tag LOCUS_57010 gene acs 9757 7778 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_57010 10570 9803 gene locus_tag LOCUS_57020 10570 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 >Feature sequence0219 688 2373 gene locus_tag LOCUS_57030 688 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 2370 3167 gene locus_tag LOCUS_57040 2370 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 3318 9404 gene locus_tag LOCUS_57050 3318 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 11070 9712 gene locus_tag LOCUS_57060 11070 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 >Feature sequence0220 390 620 gene locus_tag LOCUS_57070 390 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 617 934 gene locus_tag LOCUS_57080 617 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 938 1195 gene locus_tag LOCUS_57090 938 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 1293 1928 gene locus_tag LOCUS_57100 1293 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 1915 2637 gene locus_tag LOCUS_57110 1915 2637 CDS product protein mom inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528251.1 protein_id gnl|my_center|LOCUS_57110 3206 2847 gene locus_tag LOCUS_57120 3206 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 3351 3707 gene locus_tag LOCUS_57130 3351 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 3679 4941 gene locus_tag LOCUS_57140 3679 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 4954 6582 gene locus_tag LOCUS_57150 4954 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 6579 6734 gene locus_tag LOCUS_57160 6579 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 6727 7479 gene locus_tag LOCUS_57170 6727 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 7476 7763 gene locus_tag LOCUS_57180 7476 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 7763 8263 gene locus_tag LOCUS_57190 7763 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 8612 9268 gene locus_tag LOCUS_57200 8612 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 9288 10892 gene locus_tag LOCUS_57210 9288 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 >Feature sequence0221 10090 8504 gene locus_tag LOCUS_57220 10090 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 10354 10127 gene locus_tag LOCUS_57230 10354 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 >Feature sequence0222 68 1432 gene locus_tag LOCUS_57240 68 1432 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_57240 1472 2368 gene locus_tag LOCUS_57250 1472 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 2356 3408 gene locus_tag LOCUS_57260 2356 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 3460 4848 gene locus_tag LOCUS_57270 3460 4848 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_57270 4893 5597 gene locus_tag LOCUS_57280 4893 5597 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_57280 5661 7145 gene locus_tag LOCUS_57290 5661 7145 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_57290 7312 8094 gene locus_tag LOCUS_57300 7312 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57300 8116 8925 gene locus_tag LOCUS_57310 8116 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57310 9046 9810 gene locus_tag LOCUS_57320 9046 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57320 9826 10686 gene locus_tag LOCUS_57330 9826 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 >Feature sequence0223 <1 3128 gene locus_tag LOCUS_57340 <1 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein 3316 7269 gene locus_tag LOCUS_57350 3316 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 7394 8131 gene locus_tag LOCUS_57360 7394 8131 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615599.1 protein_id gnl|my_center|LOCUS_57360 9816 8161 gene locus_tag LOCUS_57370 9816 8161 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_57370 10956 9967 gene locus_tag LOCUS_57380 10956 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 >Feature sequence0224 8 952 gene locus_tag LOCUS_57390 8 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57390 990 914 gene locus_tag LOCUS_t01010 990 914 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1171 998 gene locus_tag LOCUS_57400 1171 998 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392923.1 protein_id gnl|my_center|LOCUS_57400 3798 1408 gene locus_tag LOCUS_57410 3798 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 5458 3959 gene locus_tag LOCUS_57420 gene murJ 5458 3959 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_57420 6792 5608 gene locus_tag LOCUS_57430 gene mrdB 6792 5608 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_57430 7439 8323 gene locus_tag LOCUS_57440 7439 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57440 8528 9136 gene locus_tag LOCUS_57450 8528 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 10515 9187 gene locus_tag LOCUS_57460 10515 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 >Feature sequence0225 1463 264 gene locus_tag LOCUS_57470 1463 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 2134 3519 gene locus_tag LOCUS_57480 2134 3519 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921866.1 protein_id gnl|my_center|LOCUS_57480 3813 3604 gene locus_tag LOCUS_57490 3813 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57490 3901 4926 gene locus_tag LOCUS_57500 3901 4926 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57500 5113 5622 gene locus_tag LOCUS_57510 5113 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 5656 7947 gene locus_tag LOCUS_57520 5656 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 10837 8267 gene locus_tag LOCUS_57530 10837 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 >Feature sequence0226 1477 494 gene locus_tag LOCUS_57540 1477 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 2543 1737 gene locus_tag LOCUS_57550 2543 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 3357 2557 gene locus_tag LOCUS_57560 3357 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 4213 3371 gene locus_tag LOCUS_57570 4213 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 6214 4682 gene locus_tag LOCUS_57580 6214 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57580 6833 6570 gene locus_tag LOCUS_57590 6833 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 7485 9137 gene locus_tag LOCUS_57600 7485 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 9218 10465 gene locus_tag LOCUS_57610 9218 10465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_57610 >Feature sequence0227 113 268 gene locus_tag LOCUS_57620 113 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 698 291 gene locus_tag LOCUS_57630 698 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57630 912 1406 gene locus_tag LOCUS_57640 912 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57640 1497 2294 gene locus_tag LOCUS_57650 1497 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57650 2666 3250 gene locus_tag LOCUS_57660 2666 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 4162 3467 gene locus_tag LOCUS_57670 4162 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 6688 4601 gene locus_tag LOCUS_57680 6688 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 7211 8185 gene locus_tag LOCUS_57690 7211 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 8262 9830 gene locus_tag LOCUS_57700 8262 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 10162 10980 gene locus_tag LOCUS_57710 10162 10980 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_57710 >Feature sequence0228 20 736 gene locus_tag LOCUS_57720 20 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 762 2141 gene locus_tag LOCUS_57730 762 2141 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_57730 2463 5279 gene locus_tag LOCUS_57740 2463 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 5294 6775 gene locus_tag LOCUS_57750 5294 6775 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919393.1 protein_id gnl|my_center|LOCUS_57750 6830 8248 gene locus_tag LOCUS_57760 6830 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 8342 9904 gene locus_tag LOCUS_57770 8342 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 >Feature sequence0229 336 2084 gene locus_tag LOCUS_57780 336 2084 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_57780 2121 3395 gene locus_tag LOCUS_57790 2121 3395 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_57790 3475 3903 gene locus_tag LOCUS_57800 gene gspG 3475 3903 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_57800 4003 4590 gene locus_tag LOCUS_57810 4003 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57810 4587 5000 gene locus_tag LOCUS_57820 4587 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57820 5006 5788 gene locus_tag LOCUS_57830 5006 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 5826 7070 gene locus_tag LOCUS_57840 5826 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 7070 8518 gene locus_tag LOCUS_57850 7070 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 8546 9067 gene locus_tag LOCUS_57860 8546 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57860 9085 9867 gene locus_tag LOCUS_57870 9085 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 9900 10706 gene locus_tag LOCUS_57880 9900 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 >Feature sequence0230 3896 675 gene locus_tag LOCUS_57890 3896 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 4948 6195 gene locus_tag LOCUS_57900 4948 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 6710 7945 gene locus_tag LOCUS_57910 6710 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 7912 10404 gene locus_tag LOCUS_57920 7912 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 >Feature sequence0231 1781 3010 gene locus_tag LOCUS_57930 1781 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_57930 3164 4168 gene locus_tag LOCUS_57940 3164 4168 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_57940 4169 6202 gene locus_tag LOCUS_57950 4169 6202 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_57950 8055 6175 gene locus_tag LOCUS_57960 8055 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 10204 8063 gene locus_tag LOCUS_57970 10204 8063 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_57970 >Feature sequence0232 192 2327 gene locus_tag LOCUS_57980 192 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 2569 3387 gene locus_tag LOCUS_57990 2569 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 3441 4289 gene locus_tag LOCUS_58000 3441 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 5418 4585 gene locus_tag LOCUS_58010 5418 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 5742 6626 gene locus_tag LOCUS_58020 5742 6626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463551.1 protein_id gnl|my_center|LOCUS_58020 7230 9962 gene locus_tag LOCUS_58030 7230 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 10036 10398 gene locus_tag LOCUS_58040 10036 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 >Feature sequence0233 536 348 gene locus_tag LOCUS_58050 536 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 606 1493 gene locus_tag LOCUS_58060 606 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58060 1673 2263 gene locus_tag LOCUS_58070 1673 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 3182 2331 gene locus_tag LOCUS_58080 3182 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 5730 3184 gene locus_tag LOCUS_58090 5730 3184 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_58090 6392 5760 gene locus_tag LOCUS_58100 6392 5760 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_58100 7952 6480 gene locus_tag LOCUS_58110 gene guaB 7952 6480 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_58110 10552 8336 gene locus_tag LOCUS_58120 10552 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 >Feature sequence0234 229 1575 gene locus_tag LOCUS_58130 229 1575 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_58130 1693 3222 gene locus_tag LOCUS_58140 1693 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58140 3287 4306 gene locus_tag LOCUS_58150 3287 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 4748 4416 gene locus_tag LOCUS_58160 4748 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58160 5147 5356 gene locus_tag LOCUS_58170 5147 5356 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_58170 5958 8012 gene locus_tag LOCUS_58180 5958 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 8307 8864 gene locus_tag LOCUS_58190 8307 8864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 9687 10598 gene locus_tag LOCUS_58200 9687 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 >Feature sequence0235 <1 2044 gene locus_tag LOCUS_58210 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097352.1:type II secretion system secretin GspD 2131 3573 gene locus_tag LOCUS_58220 2131 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 3811 5220 gene locus_tag LOCUS_58230 3811 5220 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_58230 5217 5390 gene locus_tag LOCUS_58240 5217 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 6428 5436 gene locus_tag LOCUS_58250 6428 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 6698 7786 gene locus_tag LOCUS_58260 6698 7786 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_58260 7941 8378 gene locus_tag LOCUS_58270 gene ruvX 7941 8378 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969171.1 protein_id gnl|my_center|LOCUS_58270 9718 8486 gene locus_tag LOCUS_58280 9718 8486 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_58280 10494 10324 gene locus_tag LOCUS_58290 10494 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 >Feature sequence0236 1620 2483 gene locus_tag LOCUS_58300 1620 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 2500 4263 gene locus_tag LOCUS_58310 2500 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58310 4579 4899 gene locus_tag LOCUS_58320 4579 4899 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_58320 5062 6081 gene locus_tag LOCUS_58330 5062 6081 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_58330 8191 6143 gene locus_tag LOCUS_58340 8191 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045679460.1 protein_id gnl|my_center|LOCUS_58340 10019 8352 gene locus_tag LOCUS_58350 10019 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58350 >Feature sequence0237 1713 382 gene locus_tag LOCUS_58360 1713 382 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_58360 4968 2608 gene locus_tag LOCUS_58370 4968 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 6711 5077 gene locus_tag LOCUS_58380 6711 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 8058 7831 gene locus_tag LOCUS_58390 8058 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 8744 8139 gene locus_tag LOCUS_58400 8744 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 8978 9229 gene locus_tag LOCUS_58410 8978 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58410 9530 10165 gene locus_tag LOCUS_58420 9530 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 >Feature sequence0238 160 1524 gene locus_tag LOCUS_58430 160 1524 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_58430 4870 1982 gene locus_tag LOCUS_58440 4870 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 5235 5531 gene locus_tag LOCUS_58450 5235 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58450 7154 5721 gene locus_tag LOCUS_58460 7154 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58460 8778 7810 gene locus_tag LOCUS_58470 8778 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 10179 8785 gene locus_tag LOCUS_58480 10179 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 >Feature sequence0239 276 509 gene locus_tag LOCUS_58490 276 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 509 1135 gene locus_tag LOCUS_58500 509 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 1140 2543 gene locus_tag LOCUS_58510 1140 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 4951 3350 gene locus_tag LOCUS_58520 4951 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 5233 4964 gene locus_tag LOCUS_58530 5233 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58530 6391 5360 gene locus_tag LOCUS_58540 6391 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 7350 6478 gene locus_tag LOCUS_58550 7350 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 <10309 7605 gene locus_tag LOCUS_58560 <10309 7605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941370.1:P-loop NTPase fold protein >Feature sequence0240 1145 279 gene locus_tag LOCUS_58570 1145 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 2074 1184 gene locus_tag LOCUS_58580 2074 1184 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847999.1 protein_id gnl|my_center|LOCUS_58580 3449 2172 gene locus_tag LOCUS_58590 3449 2172 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083077.1 protein_id gnl|my_center|LOCUS_58590 3959 3462 gene locus_tag LOCUS_58600 3959 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58600 4348 5220 gene locus_tag LOCUS_58610 4348 5220 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_58610 6573 5560 gene locus_tag LOCUS_58620 6573 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 7036 6728 gene locus_tag LOCUS_58630 7036 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 <10050 7504 gene locus_tag LOCUS_58640 <10050 7504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022771536.1:DUF1566 domain-containing protein >Feature sequence0241 3880 599 gene locus_tag LOCUS_58650 3880 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 5074 4013 gene locus_tag LOCUS_58660 5074 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 5567 5061 gene locus_tag LOCUS_58670 5567 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 7600 5738 gene locus_tag LOCUS_58680 7600 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 8937 7675 gene locus_tag LOCUS_58690 gene ahcY 8937 7675 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_58690 9910 9092 gene locus_tag LOCUS_58700 9910 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 >Feature sequence0242 706 284 gene locus_tag LOCUS_58710 706 284 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_58710 2147 759 gene locus_tag LOCUS_58720 gene xylE 2147 759 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_58720 4113 2176 gene locus_tag LOCUS_58730 4113 2176 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_58730 6310 4151 gene locus_tag LOCUS_58740 6310 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 7639 6344 gene locus_tag LOCUS_58750 7639 6344 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801343.1 protein_id gnl|my_center|LOCUS_58750 7950 9134 gene locus_tag LOCUS_58760 7950 9134 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_58760 <9900 9156 gene locus_tag LOCUS_58770 <9900 9156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775719.1:glucosamine-6-phosphate deaminase >Feature sequence0243 1136 72 gene locus_tag LOCUS_58780 1136 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 1493 2752 gene locus_tag LOCUS_58790 1493 2752 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_58790 2814 4499 gene locus_tag LOCUS_58800 2814 4499 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_58800 4499 5662 gene locus_tag LOCUS_58810 4499 5662 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108907.1 protein_id gnl|my_center|LOCUS_58810 7782 5686 gene locus_tag LOCUS_58820 gene fusA 7782 5686 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120445.1 protein_id gnl|my_center|LOCUS_58820 9732 8659 gene locus_tag LOCUS_58830 9732 8659 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_58830 >Feature sequence0244 3640 1526 gene locus_tag LOCUS_58840 3640 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 4011 5228 gene locus_tag LOCUS_58850 gene dprA 4011 5228 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_58850 5590 6213 gene locus_tag LOCUS_58860 5590 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 6876 6451 gene locus_tag LOCUS_58870 6876 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 7385 9784 gene locus_tag LOCUS_58880 7385 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 >Feature sequence0245 1027 41 gene locus_tag LOCUS_58890 gene xerC 1027 41 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_58890 1390 2814 gene locus_tag LOCUS_58900 1390 2814 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080829.1 protein_id gnl|my_center|LOCUS_58900 2882 3232 gene locus_tag LOCUS_58910 2882 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 3741 4346 gene locus_tag LOCUS_58920 3741 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 4520 4813 gene locus_tag LOCUS_58930 4520 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 6591 5968 gene locus_tag LOCUS_58940 6591 5968 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528999.1 protein_id gnl|my_center|LOCUS_58940 6753 7883 gene locus_tag LOCUS_58950 6753 7883 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 protein_id gnl|my_center|LOCUS_58950 7916 9346 gene locus_tag LOCUS_58960 7916 9346 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037944.1 protein_id gnl|my_center|LOCUS_58960 >Feature sequence0246 590 1492 gene locus_tag LOCUS_58970 gene chbG 590 1492 CDS product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722720.1 protein_id gnl|my_center|LOCUS_58970 1533 1763 gene locus_tag LOCUS_58980 1533 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 1763 3037 gene locus_tag LOCUS_58990 1763 3037 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_58990 3068 4111 gene locus_tag LOCUS_59000 3068 4111 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_59000 4131 5192 gene locus_tag LOCUS_59010 4131 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 5238 6254 gene locus_tag LOCUS_59020 5238 6254 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868853.1 protein_id gnl|my_center|LOCUS_59020 7068 6286 gene locus_tag LOCUS_59030 7068 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 8667 7315 gene locus_tag LOCUS_59040 8667 7315 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_59040 <9778 8651 gene locus_tag LOCUS_59050 <9778 8651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924828.1:sensor histidine kinase >Feature sequence0247 <1 1788 gene locus_tag LOCUS_59060 <1 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108189.1:carboxypeptidase-like regulatory domain-containing protein 2592 1948 gene locus_tag LOCUS_59070 2592 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 3224 4183 gene locus_tag LOCUS_59080 3224 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_59080 4316 4702 gene locus_tag LOCUS_59090 4316 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 5227 4739 gene locus_tag LOCUS_59100 5227 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 6433 5426 gene locus_tag LOCUS_59110 6433 5426 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_59110 6960 6430 gene locus_tag LOCUS_59120 6960 6430 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_59120 7281 8246 gene locus_tag LOCUS_59130 7281 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 8331 8492 gene locus_tag LOCUS_59140 8331 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 8498 8743 gene locus_tag LOCUS_59150 8498 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 8740 9663 gene locus_tag LOCUS_59160 8740 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 >Feature sequence0248 1414 3612 gene locus_tag LOCUS_59170 1414 3612 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_59170 3653 4351 gene locus_tag LOCUS_59180 3653 4351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_59180 4359 5738 gene locus_tag LOCUS_59190 4359 5738 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966847.1 protein_id gnl|my_center|LOCUS_59190 5811 6869 gene locus_tag LOCUS_59200 5811 6869 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_59200 7499 8500 gene locus_tag LOCUS_59210 7499 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 8566 9282 gene locus_tag LOCUS_59220 8566 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 >Feature sequence0249 393 2582 gene locus_tag LOCUS_59230 393 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 3591 6416 gene locus_tag LOCUS_59240 3591 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59240 6760 7158 gene locus_tag LOCUS_59250 6760 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59250 7219 7689 gene locus_tag LOCUS_59260 7219 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59260 8256 9275 gene locus_tag LOCUS_59270 8256 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59270 >Feature sequence0250 87 485 gene locus_tag LOCUS_59280 gene rpsH 87 485 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_59280 485 1066 gene locus_tag LOCUS_59290 gene rplF 485 1066 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_59290 1083 1448 gene locus_tag LOCUS_59300 gene rplR 1083 1448 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_59300 1484 1990 gene locus_tag LOCUS_59310 gene rpsE 1484 1990 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331210.1 protein_id gnl|my_center|LOCUS_59310 2021 2464 gene locus_tag LOCUS_59320 gene rplO 2021 2464 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262321.1 protein_id gnl|my_center|LOCUS_59320 2556 3917 gene locus_tag LOCUS_59330 gene secY 2556 3917 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_59330 3914 4567 gene locus_tag LOCUS_59340 3914 4567 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_59340 4608 5384 gene locus_tag LOCUS_59350 gene map 4608 5384 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869907.1 protein_id gnl|my_center|LOCUS_59350 5457 5672 gene locus_tag LOCUS_59360 gene infA 5457 5672 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829792.1 protein_id gnl|my_center|LOCUS_59360 5879 6262 gene locus_tag LOCUS_59370 gene rpsM 5879 6262 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_59370 6312 6692 gene locus_tag LOCUS_59380 gene rpsK 6312 6692 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_59380 6737 7369 gene locus_tag LOCUS_59390 gene rpsD 6737 7369 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_59390 7461 8468 gene locus_tag LOCUS_59400 7461 8468 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_59400 8532 9071 gene locus_tag LOCUS_59410 gene rplQ 8532 9071 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_59410 9160 9576 gene locus_tag LOCUS_59420 9160 9576 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_59420 >Feature sequence0251 <1 2013 gene locus_tag LOCUS_59430 <1 2013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545225.1:elongation factor G 2488 2802 gene locus_tag LOCUS_59440 gene rpsJ 2488 2802 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_59440 2841 3491 gene locus_tag LOCUS_59450 gene rplC 2841 3491 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_59450 3491 4150 gene locus_tag LOCUS_59460 gene rplD 3491 4150 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_59460 4162 4440 gene locus_tag LOCUS_59470 gene rplW 4162 4440 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_59470 4457 5308 gene locus_tag LOCUS_59480 gene rplB 4457 5308 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_59480 5350 5619 gene locus_tag LOCUS_59490 gene rpsS 5350 5619 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_59490 5660 6208 gene locus_tag LOCUS_59500 5660 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 6232 7074 gene locus_tag LOCUS_59510 gene rpsC 6232 7074 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_59510 7137 7556 gene locus_tag LOCUS_59520 gene rplP 7137 7556 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_59520 7571 7756 gene locus_tag LOCUS_59530 gene rpmC 7571 7756 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_59530 7796 8056 gene locus_tag LOCUS_59540 gene rpsQ 7796 8056 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 protein_id gnl|my_center|LOCUS_59540 8073 8459 gene locus_tag LOCUS_59550 gene rplN 8073 8459 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_59550 8482 8814 gene locus_tag LOCUS_59560 gene rplX 8482 8814 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_59560 8874 9434 gene locus_tag LOCUS_59570 gene rplE 8874 9434 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081811.1 protein_id gnl|my_center|LOCUS_59570 >Feature sequence0252 848 2158 gene locus_tag LOCUS_59580 848 2158 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_59580 2136 3212 gene locus_tag LOCUS_59590 2136 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 3918 5678 gene locus_tag LOCUS_59600 3918 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 6153 6803 gene locus_tag LOCUS_59610 6153 6803 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_59610 8151 6811 gene locus_tag LOCUS_59620 gene rimO 8151 6811 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_59620 >Feature sequence0253 1043 387 gene locus_tag LOCUS_59630 1043 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 3024 1087 gene locus_tag LOCUS_59640 3024 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 3608 3138 gene locus_tag LOCUS_59650 3608 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 4761 3793 gene locus_tag LOCUS_59660 4761 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 5608 4895 gene locus_tag LOCUS_59670 5608 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 6903 5821 gene locus_tag LOCUS_59680 6903 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 7830 7609 gene locus_tag LOCUS_59690 7830 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 7942 8832 gene locus_tag LOCUS_59700 7942 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 9467 8844 gene locus_tag LOCUS_59710 9467 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 >Feature sequence0254 725 2857 gene locus_tag LOCUS_59720 gene glgX 725 2857 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978922.1 protein_id gnl|my_center|LOCUS_59720 3730 3272 gene locus_tag LOCUS_59730 3730 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59730 4297 4052 gene locus_tag LOCUS_59740 4297 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 4389 4655 gene locus_tag LOCUS_59750 4389 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 4701 5132 gene locus_tag LOCUS_59760 4701 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59760 5653 5225 gene locus_tag LOCUS_59770 5653 5225 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085192.1 protein_id gnl|my_center|LOCUS_59770 7228 5717 gene locus_tag LOCUS_59780 7228 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 7978 7793 gene locus_tag LOCUS_59790 7978 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 9051 8173 gene locus_tag LOCUS_59800 9051 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59800 9459 9154 gene locus_tag LOCUS_59810 9459 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59810 >Feature sequence0255 979 767 gene locus_tag LOCUS_59820 979 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 1147 1857 gene locus_tag LOCUS_59830 1147 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 2396 2809 gene locus_tag LOCUS_59840 2396 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 3225 7712 gene locus_tag LOCUS_59850 3225 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 7961 8974 gene locus_tag LOCUS_59860 7961 8974 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225050.1 protein_id gnl|my_center|LOCUS_59860 >Feature sequence0256 156 695 gene locus_tag LOCUS_59870 156 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 692 4606 gene locus_tag LOCUS_59880 692 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59880 5132 5680 gene locus_tag LOCUS_59890 5132 5680 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_59890 5673 6269 gene locus_tag LOCUS_59900 5673 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 6338 7636 gene locus_tag LOCUS_59910 6338 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 7850 8854 gene locus_tag LOCUS_59920 7850 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 8873 9187 gene locus_tag LOCUS_59930 8873 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 >Feature sequence0257 481 867 gene locus_tag LOCUS_59940 481 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 1220 2905 gene locus_tag LOCUS_59950 1220 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 3133 4662 gene locus_tag LOCUS_59960 3133 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 4746 5621 gene locus_tag LOCUS_59970 4746 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 6455 5805 gene locus_tag LOCUS_59980 6455 5805 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763022.1 protein_id gnl|my_center|LOCUS_59980 7473 6634 gene locus_tag LOCUS_59990 7473 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 >Feature sequence0258 1933 644 gene locus_tag LOCUS_60000 1933 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 2095 3417 gene locus_tag LOCUS_60010 2095 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 3398 3940 gene locus_tag LOCUS_60020 3398 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 4018 6045 gene locus_tag LOCUS_60030 gene ftsH 4018 6045 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_60030 6285 7910 gene locus_tag LOCUS_60040 6285 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 7922 8605 gene locus_tag LOCUS_60050 gene nth 7922 8605 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_60050 >Feature sequence0259 309 136 gene locus_tag LOCUS_60060 309 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 2656 572 gene locus_tag LOCUS_60070 2656 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60070 5108 2661 gene locus_tag LOCUS_60080 5108 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 6591 5410 gene locus_tag LOCUS_60090 6591 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 6712 6512 gene locus_tag LOCUS_60100 6712 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 8287 6860 gene locus_tag LOCUS_60110 8287 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 8826 8284 gene locus_tag LOCUS_60120 8826 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 >Feature sequence0260 22 900 gene locus_tag LOCUS_60130 22 900 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_60130 5469 1117 gene locus_tag LOCUS_60140 5469 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 6484 5621 gene locus_tag LOCUS_60150 6484 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60150 7163 7837 gene locus_tag LOCUS_60160 7163 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 <9130 8211 gene locus_tag LOCUS_60170 <9130 8211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040680916.1:IS91 family transposase >Feature sequence0261 324 887 gene locus_tag LOCUS_60180 324 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 892 3225 gene locus_tag LOCUS_60190 892 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 3229 4251 gene locus_tag LOCUS_60200 3229 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 4280 4981 gene locus_tag LOCUS_60210 4280 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 5006 5641 gene locus_tag LOCUS_60220 5006 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60220 5645 6325 gene locus_tag LOCUS_60230 5645 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 6399 7157 gene locus_tag LOCUS_60240 6399 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 >Feature sequence0262 1964 510 gene locus_tag LOCUS_60250 1964 510 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_60250 2646 1987 gene locus_tag LOCUS_60260 2646 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 5780 2643 gene locus_tag LOCUS_60270 5780 2643 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122351.1 protein_id gnl|my_center|LOCUS_60270 6993 5842 gene locus_tag LOCUS_60280 6993 5842 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940505.1 protein_id gnl|my_center|LOCUS_60280 8499 7033 gene locus_tag LOCUS_60290 8499 7033 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_60290 >Feature sequence0263 <1 2570 gene locus_tag LOCUS_60300 <1 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase 2812 3015 gene locus_tag LOCUS_60310 2812 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 3031 3276 gene locus_tag LOCUS_60320 3031 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023563.1 protein_id gnl|my_center|LOCUS_60320 5117 3933 gene locus_tag LOCUS_60330 5117 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_60330 5908 5114 gene locus_tag LOCUS_60340 5908 5114 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_60340 8282 5913 gene locus_tag LOCUS_60350 8282 5913 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_60350 >Feature sequence0264 1711 50 gene locus_tag LOCUS_60360 1711 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60360 2414 1899 gene locus_tag LOCUS_60370 2414 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 2859 2425 gene locus_tag LOCUS_60380 2859 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 3157 2981 gene locus_tag LOCUS_60390 3157 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 3939 3154 gene locus_tag LOCUS_60400 3939 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60400 4810 4091 gene locus_tag LOCUS_60410 4810 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 5808 5116 gene locus_tag LOCUS_60420 5808 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 6293 5988 gene locus_tag LOCUS_60430 6293 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 6779 6417 gene locus_tag LOCUS_60440 6779 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 7581 6907 gene locus_tag LOCUS_60450 7581 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 7935 8537 gene locus_tag LOCUS_60460 7935 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 >Feature sequence0265 80 349 gene locus_tag LOCUS_60470 80 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 1453 626 gene locus_tag LOCUS_60480 1453 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 1762 2103 gene locus_tag LOCUS_60490 1762 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 2358 2576 gene locus_tag LOCUS_60500 2358 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 2743 3216 gene locus_tag LOCUS_60510 2743 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 3227 3772 gene locus_tag LOCUS_60520 3227 3772 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531326.1 protein_id gnl|my_center|LOCUS_60520 3772 3972 gene locus_tag LOCUS_60530 3772 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 4879 4100 gene locus_tag LOCUS_60540 4879 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 5342 4905 gene locus_tag LOCUS_60550 5342 4905 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_60550 5565 6767 gene locus_tag LOCUS_60560 5565 6767 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920728.1 protein_id gnl|my_center|LOCUS_60560 6901 7305 gene locus_tag LOCUS_60570 6901 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 7770 7351 gene locus_tag LOCUS_60580 7770 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 8415 8720 gene locus_tag LOCUS_60590 8415 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 >Feature sequence0266 710 255 gene locus_tag LOCUS_60600 710 255 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_60600 2198 879 gene locus_tag LOCUS_60610 2198 879 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_60610 3158 2199 gene locus_tag LOCUS_60620 3158 2199 CDS product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761173.1 protein_id gnl|my_center|LOCUS_60620 3754 3203 gene locus_tag LOCUS_60630 3754 3203 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_60630 7802 3972 gene locus_tag LOCUS_60640 7802 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 >Feature sequence0267 543 3443 gene locus_tag LOCUS_60650 gene uvrA 543 3443 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257559.1 protein_id gnl|my_center|LOCUS_60650 4321 5520 gene locus_tag LOCUS_60660 4321 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 5637 5548 gene locus_tag LOCUS_t01020 5637 5548 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5853 6383 gene locus_tag LOCUS_60670 5853 6383 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_60670 6404 6763 gene locus_tag LOCUS_60680 6404 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 6798 7199 gene locus_tag LOCUS_60690 6798 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 7212 7409 gene locus_tag LOCUS_60700 7212 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 7476 7892 gene locus_tag LOCUS_60710 7476 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60710 8381 7905 gene locus_tag LOCUS_60720 gene tadA 8381 7905 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_60720 >Feature sequence0268 848 480 gene locus_tag LOCUS_60730 848 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60730 957 1256 gene locus_tag LOCUS_60740 957 1256 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883059.1 protein_id gnl|my_center|LOCUS_60740 1628 1269 gene locus_tag LOCUS_60750 1628 1269 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_60750 3011 1737 gene locus_tag LOCUS_60760 3011 1737 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_60760 4304 7630 gene locus_tag LOCUS_60770 4304 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 7623 8513 gene locus_tag LOCUS_60780 7623 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60780 >Feature sequence0269 250 2505 gene locus_tag LOCUS_60790 250 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 2847 5612 gene locus_tag LOCUS_60800 2847 5612 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038019.1 protein_id gnl|my_center|LOCUS_60800 >Feature sequence0270 1201 1767 gene locus_tag LOCUS_60810 gene sigW 1201 1767 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_60810 1757 2455 gene locus_tag LOCUS_60820 1757 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 2494 5661 gene locus_tag LOCUS_60830 2494 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 6643 6023 gene locus_tag LOCUS_60840 6643 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 8020 6767 gene locus_tag LOCUS_60850 8020 6767 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_60850 >Feature sequence0271 446 177 gene locus_tag LOCUS_60860 446 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 1523 564 gene locus_tag LOCUS_60870 1523 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 1880 2077 gene locus_tag LOCUS_60880 1880 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 2835 2416 gene locus_tag LOCUS_60890 2835 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184134.1 protein_id gnl|my_center|LOCUS_60890 3430 4275 gene locus_tag LOCUS_60900 3430 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 5747 4410 gene locus_tag LOCUS_60910 5747 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60910 7218 5788 gene locus_tag LOCUS_60920 7218 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 7744 7310 gene locus_tag LOCUS_60930 7744 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 8238 7723 gene locus_tag LOCUS_60940 8238 7723 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_60940 >Feature sequence0272 >Feature sequence0273 2815 3442 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atatcagcccgctatcgggactgacgaatctgac >Feature sequence0274 1444 3570 gene locus_tag LOCUS_60950 1444 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 5499 3943 gene locus_tag LOCUS_60960 5499 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 6214 7521 gene locus_tag LOCUS_60970 6214 7521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_60970 >Feature sequence0275 2 718 gene locus_tag LOCUS_60980 2 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 765 1322 gene locus_tag LOCUS_60990 765 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119839.1 protein_id gnl|my_center|LOCUS_60990 1393 2748 gene locus_tag LOCUS_61000 1393 2748 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_61000 5679 3403 gene locus_tag LOCUS_61010 5679 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61010 6283 5765 gene locus_tag LOCUS_61020 6283 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 7119 6403 gene locus_tag LOCUS_61030 7119 6403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_61030 7742 7251 gene locus_tag LOCUS_61040 7742 7251 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963868.1 protein_id gnl|my_center|LOCUS_61040 >Feature sequence0276 1039 452 gene locus_tag LOCUS_61050 1039 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61050 2301 2050 gene locus_tag LOCUS_61060 2301 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 2291 4897 gene locus_tag LOCUS_61070 2291 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 7260 5125 gene locus_tag LOCUS_61080 7260 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 >Feature sequence0277 2878 857 gene locus_tag LOCUS_61090 2878 857 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070134174.1 protein_id gnl|my_center|LOCUS_61090 4316 2883 gene locus_tag LOCUS_61100 4316 2883 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200769.1 protein_id gnl|my_center|LOCUS_61100 4773 4294 gene locus_tag LOCUS_61110 4773 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689093.1 protein_id gnl|my_center|LOCUS_61110 5033 4779 gene locus_tag LOCUS_61120 5033 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 6414 5035 gene locus_tag LOCUS_61130 6414 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 7967 6411 gene locus_tag LOCUS_61140 7967 6411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 >Feature sequence0278 1565 1125 gene locus_tag LOCUS_61150 1565 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 4699 1829 gene locus_tag LOCUS_61160 4699 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 <8070 6091 gene locus_tag LOCUS_61170 <8070 6091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950866.1:ATP-dependent helicase >Feature sequence0279 142 366 gene locus_tag LOCUS_61180 142 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 448 1218 gene locus_tag LOCUS_61190 448 1218 CDS product type-2 restriction enzyme DpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418960.1 protein_id gnl|my_center|LOCUS_61190 1340 2155 gene locus_tag LOCUS_61200 1340 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 3388 2327 gene locus_tag LOCUS_61210 3388 2327 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 protein_id gnl|my_center|LOCUS_61210 3684 5084 gene locus_tag LOCUS_61220 3684 5084 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_61220 6502 5123 gene locus_tag LOCUS_61230 gene miaB 6502 5123 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_61230 7597 6506 gene locus_tag LOCUS_61240 gene rsgA 7597 6506 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107648.1 protein_id gnl|my_center|LOCUS_61240 >Feature sequence0280 2321 351 gene locus_tag LOCUS_61250 2321 351 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61250 2651 2328 gene locus_tag LOCUS_61260 2651 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61260 3851 2892 gene locus_tag LOCUS_61270 3851 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 5412 4150 gene locus_tag LOCUS_61280 5412 4150 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965879.1 protein_id gnl|my_center|LOCUS_61280 7590 5650 gene locus_tag LOCUS_61290 7590 5650 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_61290 >Feature sequence0281 1566 118 gene locus_tag LOCUS_61300 1566 118 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_61300 3185 2994 gene locus_tag LOCUS_61310 3185 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61310 3651 3196 gene locus_tag LOCUS_61320 3651 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 4507 3791 gene locus_tag LOCUS_61330 4507 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 4847 4536 gene locus_tag LOCUS_61340 4847 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 5346 4894 gene locus_tag LOCUS_61350 5346 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 5667 5392 gene locus_tag LOCUS_61360 5667 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 5998 5753 gene locus_tag LOCUS_61370 5998 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 <7881 6099 gene locus_tag LOCUS_61380 <7881 6099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460899.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence0282 2459 234 gene locus_tag LOCUS_61390 2459 234 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230913.1 protein_id gnl|my_center|LOCUS_61390 3529 2864 gene locus_tag LOCUS_61400 3529 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 3759 4718 gene locus_tag LOCUS_61410 3759 4718 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_61410 4718 5683 gene locus_tag LOCUS_61420 gene miaA 4718 5683 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_61420 5703 7385 gene locus_tag LOCUS_61430 5703 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 >Feature sequence0283 1181 30 gene locus_tag LOCUS_61440 1181 30 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_61440 3339 1327 gene locus_tag LOCUS_61450 3339 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 4455 3616 gene locus_tag LOCUS_61460 4455 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61460 4722 5519 gene locus_tag LOCUS_61470 4722 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 5673 6230 gene locus_tag LOCUS_61480 5673 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 6278 6757 gene locus_tag LOCUS_61490 6278 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 6754 7632 gene locus_tag LOCUS_61500 6754 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61500 >Feature sequence0284 575 1747 gene locus_tag LOCUS_61510 575 1747 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_61510 1747 2868 gene locus_tag LOCUS_61520 1747 2868 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_61520 3463 5622 gene locus_tag LOCUS_61530 3463 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 >Feature sequence0285 1515 376 gene locus_tag LOCUS_61540 1515 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 2803 2120 gene locus_tag LOCUS_61550 2803 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 3726 2800 gene locus_tag LOCUS_61560 3726 2800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_61560 4654 5451 gene locus_tag LOCUS_61570 4654 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 5448 6242 gene locus_tag LOCUS_61580 5448 6242 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_61580 6265 6501 gene locus_tag LOCUS_61590 6265 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 6558 6959 gene locus_tag LOCUS_61600 6558 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 >Feature sequence0286 681 346 gene locus_tag LOCUS_61610 681 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 649 1047 gene locus_tag LOCUS_61620 649 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 1078 2853 gene locus_tag LOCUS_61630 1078 2853 CDS product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_61630 2928 3209 gene locus_tag LOCUS_61640 2928 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 3341 3715 gene locus_tag LOCUS_61650 3341 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 3742 4137 gene locus_tag LOCUS_61660 3742 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 4166 4876 gene locus_tag LOCUS_61670 4166 4876 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_61670 4887 5816 gene locus_tag LOCUS_61680 4887 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 5829 6506 gene locus_tag LOCUS_61690 5829 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 6891 7628 gene locus_tag LOCUS_61700 6891 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 >Feature sequence0287 1582 392 gene locus_tag LOCUS_61710 1582 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 3988 1691 gene locus_tag LOCUS_61720 3988 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 4575 4000 gene locus_tag LOCUS_61730 4575 4000 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_61730 5076 5450 gene locus_tag LOCUS_61740 5076 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 5519 6640 gene locus_tag LOCUS_61750 5519 6640 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002745544.1 protein_id gnl|my_center|LOCUS_61750 6768 6992 gene locus_tag LOCUS_61760 6768 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61760 7106 7603 gene locus_tag LOCUS_61770 7106 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 >Feature sequence0288 778 706 gene locus_tag LOCUS_t01030 778 706 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 994 919 gene locus_tag LOCUS_t01040 994 919 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1775 2095 gene locus_tag LOCUS_61780 1775 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 6840 2104 gene locus_tag LOCUS_61790 6840 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61790 7487 6840 gene locus_tag LOCUS_61800 7487 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61800 >Feature sequence0289 473 30 gene locus_tag LOCUS_61810 473 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 1045 470 gene locus_tag LOCUS_61820 1045 470 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_61820 2336 1167 gene locus_tag LOCUS_61830 2336 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61830 2821 2333 gene locus_tag LOCUS_61840 2821 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 3354 2824 gene locus_tag LOCUS_61850 gene rpoE 3354 2824 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_61850 4423 5418 gene locus_tag LOCUS_61860 4423 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 6574 5426 gene locus_tag LOCUS_61870 6574 5426 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_61870 >Feature sequence0290 432 1652 gene locus_tag LOCUS_61880 432 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61880 4022 1827 gene locus_tag LOCUS_61890 4022 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 4467 5231 gene locus_tag LOCUS_61900 4467 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 5893 5687 gene locus_tag LOCUS_61910 5893 5687 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807785.1 protein_id gnl|my_center|LOCUS_61910 6276 6094 gene locus_tag LOCUS_61920 6276 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907541.1 protein_id gnl|my_center|LOCUS_61920 >Feature sequence0291 <1 1365 gene locus_tag LOCUS_61930 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 2448 1753 gene locus_tag LOCUS_61940 2448 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 3334 3543 gene locus_tag LOCUS_61950 3334 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 3700 3894 gene locus_tag LOCUS_61960 3700 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 <7330 4841 gene locus_tag LOCUS_61970 <7330 4841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase >Feature sequence0292 205 1413 gene locus_tag LOCUS_61980 205 1413 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_61980 1607 2014 gene locus_tag LOCUS_61990 1607 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 2584 3072 gene locus_tag LOCUS_62000 2584 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 3086 3553 gene locus_tag LOCUS_62010 3086 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 3584 5119 gene locus_tag LOCUS_62020 3584 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 5212 6753 gene locus_tag LOCUS_62030 5212 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 >Feature sequence0293 353 78 gene locus_tag LOCUS_62040 gene rpsT 353 78 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721915.1 protein_id gnl|my_center|LOCUS_62040 1800 394 gene locus_tag LOCUS_62050 1800 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 1991 3259 gene locus_tag LOCUS_62060 1991 3259 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_62060 3360 3986 gene locus_tag LOCUS_62070 3360 3986 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_62070 5194 4064 gene locus_tag LOCUS_62080 5194 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 6464 5424 gene locus_tag LOCUS_62090 6464 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 >Feature sequence0294 2916 298 gene locus_tag LOCUS_62100 2916 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 3308 3036 gene locus_tag LOCUS_62110 3308 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 5202 3427 gene locus_tag LOCUS_62120 5202 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 5478 5729 gene locus_tag LOCUS_62130 5478 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 6992 5757 gene locus_tag LOCUS_62140 6992 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 >Feature sequence0295 788 321 gene locus_tag LOCUS_62150 788 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 1249 785 gene locus_tag LOCUS_62160 1249 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 1725 1342 gene locus_tag LOCUS_62170 1725 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 2105 3769 gene locus_tag LOCUS_62180 2105 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 4267 4533 gene locus_tag LOCUS_62190 4267 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 5015 7078 gene locus_tag LOCUS_62200 5015 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 >Feature sequence0296 4475 2448 gene locus_tag LOCUS_62210 4475 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 4987 6468 gene locus_tag LOCUS_62220 4987 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 <7101 6553 gene locus_tag LOCUS_62230 <7101 6553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922709.1:sulfatase >Feature sequence0297 1073 555 gene locus_tag LOCUS_62240 1073 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 2843 1386 gene locus_tag LOCUS_62250 2843 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 4352 3576 gene locus_tag LOCUS_62260 4352 3576 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806888.1 protein_id gnl|my_center|LOCUS_62260 4660 4403 gene locus_tag LOCUS_62270 4660 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62270 6192 5248 gene locus_tag LOCUS_62280 6192 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 6743 6228 gene locus_tag LOCUS_62290 6743 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 >Feature sequence0298 1336 374 gene locus_tag LOCUS_62300 1336 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 1859 1527 gene locus_tag LOCUS_62310 1859 1527 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_62310 2978 1872 gene locus_tag LOCUS_62320 2978 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62320 4220 2997 gene locus_tag LOCUS_62330 4220 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 4634 5422 gene locus_tag LOCUS_62340 4634 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 5715 6473 gene locus_tag LOCUS_62350 5715 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 6993 6634 gene locus_tag LOCUS_62360 6993 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 >Feature sequence0299 4248 1909 gene locus_tag LOCUS_62370 4248 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 5951 4695 gene locus_tag LOCUS_62380 5951 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 >Feature sequence0300 617 378 gene locus_tag LOCUS_62390 617 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 1407 1754 gene locus_tag LOCUS_62400 1407 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 2273 3511 gene locus_tag LOCUS_62410 2273 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62410 3605 3883 gene locus_tag LOCUS_62420 3605 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 3919 4074 gene locus_tag LOCUS_62430 3919 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 4183 4488 gene locus_tag LOCUS_62440 4183 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 5340 6158 gene locus_tag LOCUS_62450 5340 6158 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064948.1 protein_id gnl|my_center|LOCUS_62450 6164 6769 gene locus_tag LOCUS_62460 6164 6769 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943772.1 protein_id gnl|my_center|LOCUS_62460 >Feature sequence0301 297 602 gene locus_tag LOCUS_62470 297 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 844 1086 gene locus_tag LOCUS_62480 844 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 1158 1337 gene locus_tag LOCUS_62490 1158 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 2822 3343 gene locus_tag LOCUS_62500 2822 3343 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365842.1 protein_id gnl|my_center|LOCUS_62500 4069 5217 gene locus_tag LOCUS_62510 4069 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 5866 5381 gene locus_tag LOCUS_62520 5866 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62520 <6988 6337 gene locus_tag LOCUS_62530 <6988 6337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140237.1:response regulator >Feature sequence0302 553 855 gene locus_tag LOCUS_62540 553 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 1122 1496 gene locus_tag LOCUS_62550 1122 1496 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318897.1 protein_id gnl|my_center|LOCUS_62550 1584 3017 gene locus_tag LOCUS_62560 gene nifS 1584 3017 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_62560 4179 3772 gene locus_tag LOCUS_62570 4179 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 4566 4970 gene locus_tag LOCUS_62580 4566 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 5031 5399 gene locus_tag LOCUS_62590 5031 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 6178 5801 gene locus_tag LOCUS_62600 6178 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62600 6798 6592 gene locus_tag LOCUS_62610 6798 6592 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966272.1 protein_id gnl|my_center|LOCUS_62610 >Feature sequence0303 431 4090 gene locus_tag LOCUS_62620 431 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62620 4142 4525 gene locus_tag LOCUS_62630 4142 4525 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330483.1 protein_id gnl|my_center|LOCUS_62630 4518 5498 gene locus_tag LOCUS_62640 4518 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 5495 6679 gene locus_tag LOCUS_62650 5495 6679 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_62650 >Feature sequence0304 250 2130 gene locus_tag LOCUS_62660 250 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62660 >Feature sequence0305 381 172 gene locus_tag LOCUS_62670 381 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 1129 2748 gene locus_tag LOCUS_62680 1129 2748 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072380637.1 protein_id gnl|my_center|LOCUS_62680 3000 4007 gene locus_tag LOCUS_62690 3000 4007 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263350.1 protein_id gnl|my_center|LOCUS_62690 5389 6870 gene locus_tag LOCUS_62700 5389 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 >Feature sequence0306 1314 1150 gene locus_tag LOCUS_62710 1314 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 1313 2272 gene locus_tag LOCUS_62720 1313 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 2265 3392 gene locus_tag LOCUS_62730 2265 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 3454 4752 gene locus_tag LOCUS_62740 3454 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 4754 6478 gene locus_tag LOCUS_62750 4754 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403737.1 protein_id gnl|my_center|LOCUS_62750 >Feature sequence0307 2174 168 gene locus_tag LOCUS_62760 2174 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 5712 2857 gene locus_tag LOCUS_62770 5712 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62770 6371 6299 gene locus_tag LOCUS_t01050 6371 6299 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0308 673 326 gene locus_tag LOCUS_62780 673 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62780 1277 1591 gene locus_tag LOCUS_62790 1277 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 2003 1533 gene locus_tag LOCUS_62800 2003 1533 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_62800 2411 2112 gene locus_tag LOCUS_62810 2411 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 2879 3586 gene locus_tag LOCUS_62820 2879 3586 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_62820 3902 4345 gene locus_tag LOCUS_62830 3902 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 4329 4751 gene locus_tag LOCUS_62840 4329 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 4921 6474 gene locus_tag LOCUS_62850 4921 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 >Feature sequence0309 432 1586 gene locus_tag LOCUS_62860 432 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 1890 2417 gene locus_tag LOCUS_62870 1890 2417 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_62870 2414 4012 gene locus_tag LOCUS_62880 2414 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880 4123 3953 gene locus_tag LOCUS_62890 4123 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 4489 6174 gene locus_tag LOCUS_62900 4489 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62900 >Feature sequence0310 415 687 gene locus_tag LOCUS_62910 415 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 932 1243 gene locus_tag LOCUS_62920 932 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 1620 1970 gene locus_tag LOCUS_62930 1620 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62930 2221 5703 gene locus_tag LOCUS_62940 2221 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 5909 6319 gene locus_tag LOCUS_62950 5909 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 >Feature sequence0311 293 1987 gene locus_tag LOCUS_62960 293 1987 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_62960 2474 3922 gene locus_tag LOCUS_62970 2474 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 4345 4124 gene locus_tag LOCUS_62980 4345 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 4533 5993 gene locus_tag LOCUS_62990 4533 5993 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_62990 >Feature sequence0312 459 740 gene locus_tag LOCUS_63000 459 740 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_63000 737 1012 gene locus_tag LOCUS_63010 737 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63010 1188 2084 gene locus_tag LOCUS_63020 1188 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63020 2274 4208 gene locus_tag LOCUS_63030 2274 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63030 4293 5780 gene locus_tag LOCUS_63040 4293 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 6323 6640 gene locus_tag LOCUS_63050 6323 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 >Feature sequence0313 <1 1198 gene locus_tag LOCUS_63060 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442661.1:sialate O-acetylesterase 1257 2459 gene locus_tag LOCUS_63070 gene argJ 1257 2459 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_63070 2649 5051 gene locus_tag LOCUS_63080 2649 5051 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_63080 5304 5774 gene locus_tag LOCUS_63090 5304 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 5835 6125 gene locus_tag LOCUS_63100 5835 6125 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 protein_id gnl|my_center|LOCUS_63100 >Feature sequence0314 944 1279 gene locus_tag LOCUS_63110 944 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 1421 1810 gene locus_tag LOCUS_63120 1421 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 1826 1960 gene locus_tag LOCUS_63130 1826 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 2144 3583 gene locus_tag LOCUS_63140 2144 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 3580 3894 gene locus_tag LOCUS_63150 3580 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 3895 5016 gene locus_tag LOCUS_63160 3895 5016 CDS product zonular occludens toxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037227.1 protein_id gnl|my_center|LOCUS_63160 5387 5184 gene locus_tag LOCUS_63170 5387 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 5976 5785 gene locus_tag LOCUS_63180 5976 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 >Feature sequence0315 1070 90 gene locus_tag LOCUS_63190 1070 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 1684 1211 gene locus_tag LOCUS_63200 1684 1211 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_63200 5324 1836 gene locus_tag LOCUS_63210 5324 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 5913 5353 gene locus_tag LOCUS_63220 gene efp 5913 5353 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626516.1 protein_id gnl|my_center|LOCUS_63220 >Feature sequence0316 180 689 gene locus_tag LOCUS_63230 180 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 686 2020 gene locus_tag LOCUS_63240 686 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 2249 3601 gene locus_tag LOCUS_63250 2249 3601 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 protein_id gnl|my_center|LOCUS_63250 3765 4766 gene locus_tag LOCUS_63260 3765 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 4785 6143 gene locus_tag LOCUS_63270 4785 6143 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 protein_id gnl|my_center|LOCUS_63270 >Feature sequence0317 1991 285 gene locus_tag LOCUS_63280 1991 285 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946763.1 protein_id gnl|my_center|LOCUS_63280 3322 2408 gene locus_tag LOCUS_63290 3322 2408 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114361.1 protein_id gnl|my_center|LOCUS_63290 4862 3441 gene locus_tag LOCUS_63300 4862 3441 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_63300 6390 4957 gene locus_tag LOCUS_63310 6390 4957 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087506.1 protein_id gnl|my_center|LOCUS_63310 >Feature sequence0318 2526 877 gene locus_tag LOCUS_63320 2526 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 3169 2534 gene locus_tag LOCUS_63330 3169 2534 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172412315.1 protein_id gnl|my_center|LOCUS_63330 3889 3671 gene locus_tag LOCUS_63340 3889 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63340 4760 5710 gene locus_tag LOCUS_63350 4760 5710 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221064.1 protein_id gnl|my_center|LOCUS_63350 6213 5950 gene locus_tag LOCUS_63360 6213 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_63360 >Feature sequence0319 64 198 gene locus_tag LOCUS_63370 64 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 644 1933 gene locus_tag LOCUS_63380 644 1933 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_63380 2114 3190 gene locus_tag LOCUS_63390 2114 3190 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_63390 3494 4897 gene locus_tag LOCUS_63400 3494 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 5065 5844 gene locus_tag LOCUS_63410 5065 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 >Feature sequence0320 330 1613 gene locus_tag LOCUS_63420 gene ywaD 330 1613 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 protein_id gnl|my_center|LOCUS_63420 2167 1820 gene locus_tag LOCUS_63430 2167 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 2409 2900 gene locus_tag LOCUS_63440 2409 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 2986 3606 gene locus_tag LOCUS_63450 2986 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 3687 4088 gene locus_tag LOCUS_63460 3687 4088 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_63460 4165 4380 gene locus_tag LOCUS_63470 4165 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 4479 4826 gene locus_tag LOCUS_63480 4479 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 4902 5327 gene locus_tag LOCUS_63490 4902 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 5404 5946 gene locus_tag LOCUS_63500 5404 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63500 >Feature sequence0321 717 1382 gene locus_tag LOCUS_63510 717 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63510 1412 3187 gene locus_tag LOCUS_63520 1412 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 3342 4583 gene locus_tag LOCUS_63530 3342 4583 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_63530 5861 4971 gene locus_tag LOCUS_63540 5861 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63540 >Feature sequence0322 2244 322 gene locus_tag LOCUS_63550 2244 322 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_63550 2783 3595 gene locus_tag LOCUS_63560 2783 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_63560 4467 3613 gene locus_tag LOCUS_63570 4467 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 4681 5226 gene locus_tag LOCUS_63580 4681 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 <6190 5223 gene locus_tag LOCUS_63590 <6190 5223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119574.1:porin >Feature sequence0323 2658 538 gene locus_tag LOCUS_63600 2658 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 4904 2925 gene locus_tag LOCUS_63610 4904 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 >Feature sequence0324 489 2687 gene locus_tag LOCUS_63620 489 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 3558 5957 gene locus_tag LOCUS_63630 3558 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 >Feature sequence0325 5631 3736 gene locus_tag LOCUS_63640 5631 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 >Feature sequence0326 1975 53 gene locus_tag LOCUS_63650 gene selB 1975 53 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937806.1 protein_id gnl|my_center|LOCUS_63650 3396 1981 gene locus_tag LOCUS_63660 gene selA 3396 1981 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 protein_id gnl|my_center|LOCUS_63660 3751 4275 gene locus_tag LOCUS_63670 3751 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63670 >Feature sequence0327 624 10 gene locus_tag LOCUS_63680 624 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63680 1592 1335 gene locus_tag LOCUS_63690 1592 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 1950 1789 gene locus_tag LOCUS_63700 1950 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 2819 1977 gene locus_tag LOCUS_63710 2819 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 4384 2816 gene locus_tag LOCUS_63720 4384 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 4865 5047 gene locus_tag LOCUS_63730 4865 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 5805 5245 gene locus_tag LOCUS_63740 5805 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_63740 >Feature sequence0328 288 73 gene locus_tag LOCUS_63750 288 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 547 278 gene locus_tag LOCUS_63760 547 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 799 1302 gene locus_tag LOCUS_63770 gene exeG 799 1302 CDS product GspG family T2SS major pseudopilin variant ExeG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_63770 1564 1767 gene locus_tag LOCUS_63780 1564 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63780 2310 3401 gene locus_tag LOCUS_63790 2310 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63790 3404 4732 gene locus_tag LOCUS_63800 3404 4732 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940561.1 protein_id gnl|my_center|LOCUS_63800 >Feature sequence0329 453 220 gene locus_tag LOCUS_63810 453 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63810 1266 742 gene locus_tag LOCUS_63820 1266 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 1579 1259 gene locus_tag LOCUS_63830 1579 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 1968 1588 gene locus_tag LOCUS_63840 1968 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 2530 1970 gene locus_tag LOCUS_63850 2530 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 5678 2673 gene locus_tag LOCUS_63860 5678 2673 CDS product Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153164114.1 protein_id gnl|my_center|LOCUS_63860 >Feature sequence0330 3169 53 gene locus_tag LOCUS_63870 3169 53 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_63870 4572 3166 gene locus_tag LOCUS_63880 4572 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 5007 4612 gene locus_tag LOCUS_63890 5007 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63890 5238 5017 gene locus_tag LOCUS_63900 5238 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 5543 5238 gene locus_tag LOCUS_63910 5543 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 >Feature sequence0331 17 205 gene locus_tag LOCUS_63920 17 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 261 785 gene locus_tag LOCUS_63930 261 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 877 1464 gene locus_tag LOCUS_63940 877 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 1714 2361 gene locus_tag LOCUS_63950 1714 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 3233 3033 gene locus_tag LOCUS_63960 3233 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 4828 3443 gene locus_tag LOCUS_63970 4828 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 <5904 4816 gene locus_tag LOCUS_63980 <5904 4816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918922.1:DUF4139 domain-containing protein >Feature sequence0332 1710 2147 gene locus_tag LOCUS_63990 1710 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63990 2158 2583 gene locus_tag LOCUS_64000 2158 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 2587 3006 gene locus_tag LOCUS_64010 2587 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64010 3510 3914 gene locus_tag LOCUS_64020 3510 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 3911 5425 gene locus_tag LOCUS_64030 3911 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 >Feature sequence0333 103 2280 gene locus_tag LOCUS_64040 103 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 2504 4630 gene locus_tag LOCUS_64050 2504 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64050 >Feature sequence0334 1062 337 gene locus_tag LOCUS_64060 gene istB 1062 337 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_64060 2662 1097 gene locus_tag LOCUS_64070 gene istA 2662 1097 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_64070 2979 4049 gene locus_tag LOCUS_64080 2979 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 4137 4628 gene locus_tag LOCUS_64090 4137 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 4597 5634 gene locus_tag LOCUS_64100 4597 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64100 >Feature sequence0335 517 972 gene locus_tag LOCUS_64110 517 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 1755 3992 gene locus_tag LOCUS_64120 1755 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64120 4381 5352 gene locus_tag LOCUS_64130 4381 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 >Feature sequence0336 558 1196 gene locus_tag LOCUS_64140 558 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64140 1238 2605 gene locus_tag LOCUS_64150 1238 2605 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_64150 3902 2676 gene locus_tag LOCUS_64160 3902 2676 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122402.1 protein_id gnl|my_center|LOCUS_64160 4790 3942 gene locus_tag LOCUS_64170 4790 3942 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_64170 5646 4771 gene locus_tag LOCUS_64180 5646 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 >Feature sequence0337 658 1272 gene locus_tag LOCUS_64190 658 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 2819 1347 gene locus_tag LOCUS_64200 2819 1347 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_64200 2975 4357 gene locus_tag LOCUS_64210 2975 4357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_64210 5672 4380 gene locus_tag LOCUS_64220 5672 4380 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_64220 >Feature sequence0338 1545 2093 gene locus_tag LOCUS_64230 1545 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 2096 2251 gene locus_tag LOCUS_64240 2096 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64240 2254 3678 gene locus_tag LOCUS_64250 2254 3678 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200769.1 protein_id gnl|my_center|LOCUS_64250 3666 5291 gene locus_tag LOCUS_64260 3666 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 5288 5719 gene locus_tag LOCUS_64270 5288 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 >Feature sequence0339 1744 323 gene locus_tag LOCUS_64280 1744 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 3278 1800 gene locus_tag LOCUS_64290 3278 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 4915 3536 gene locus_tag LOCUS_64300 4915 3536 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_64300 5657 4941 gene locus_tag LOCUS_64310 5657 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 >Feature sequence0340 <5613 1245 gene locus_tag LOCUS_64320 <5613 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086395912.1:DUF6359 domain-containing protein >Feature sequence0341 1515 331 gene locus_tag LOCUS_64330 gene tuf 1515 331 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 protein_id gnl|my_center|LOCUS_64330 3692 1578 gene locus_tag LOCUS_64340 gene fusA 3692 1578 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261077.1 protein_id gnl|my_center|LOCUS_64340 4190 3720 gene locus_tag LOCUS_64350 gene rpsG 4190 3720 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_64350 4662 4288 gene locus_tag LOCUS_64360 gene rpsL 4662 4288 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070612.1 protein_id gnl|my_center|LOCUS_64360 <5609 4856 gene locus_tag LOCUS_64370 <5609 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070611.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0342 26 1201 gene locus_tag LOCUS_64380 26 1201 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962956.1 protein_id gnl|my_center|LOCUS_64380 1198 1749 gene locus_tag LOCUS_64390 1198 1749 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987925.1 protein_id gnl|my_center|LOCUS_64390 2714 1785 gene locus_tag LOCUS_64400 2714 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 2806 4200 gene locus_tag LOCUS_64410 2806 4200 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390339.1 protein_id gnl|my_center|LOCUS_64410 4202 4489 gene locus_tag LOCUS_64420 4202 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 4501 4695 gene locus_tag LOCUS_64430 4501 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 >Feature sequence0343 215 484 gene locus_tag LOCUS_64440 215 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 716 1213 gene locus_tag LOCUS_64450 716 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 1497 1258 gene locus_tag LOCUS_64460 1497 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 1699 1899 gene locus_tag LOCUS_64470 1699 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 2339 5395 gene locus_tag LOCUS_64480 2339 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 >Feature sequence0344 1035 358 gene locus_tag LOCUS_64490 1035 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 2705 1032 gene locus_tag LOCUS_64500 2705 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 3277 2711 gene locus_tag LOCUS_64510 3277 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 3578 3285 gene locus_tag LOCUS_64520 3578 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 4278 3634 gene locus_tag LOCUS_64530 4278 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 4813 5505 gene locus_tag LOCUS_64540 4813 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 >Feature sequence0345 260 1579 gene locus_tag LOCUS_64550 260 1579 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_64550 1616 2443 gene locus_tag LOCUS_64560 1616 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 3420 2446 gene locus_tag LOCUS_64570 3420 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 4398 3454 gene locus_tag LOCUS_64580 4398 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 <5502 4478 gene locus_tag LOCUS_64590 <5502 4478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016207.1:ankyrin repeat domain-containing protein >Feature sequence0346 1581 202 gene locus_tag LOCUS_64600 1581 202 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_64600 2261 1578 gene locus_tag LOCUS_64610 2261 1578 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_64610 4007 2649 gene locus_tag LOCUS_64620 4007 2649 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_64620 <5494 4103 gene locus_tag LOCUS_64630 <5494 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein >Feature sequence0347 60 1799 gene locus_tag LOCUS_64640 60 1799 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_64640 2073 3353 gene locus_tag LOCUS_64650 2073 3353 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922245.1 protein_id gnl|my_center|LOCUS_64650 3436 5196 gene locus_tag LOCUS_64660 3436 5196 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_64660 >Feature sequence0348 601 1080 gene locus_tag LOCUS_64670 601 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 1067 2662 gene locus_tag LOCUS_64680 1067 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64680 2665 2919 gene locus_tag LOCUS_64690 2665 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 2916 3320 gene locus_tag LOCUS_64700 2916 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64700 3542 4219 gene locus_tag LOCUS_64710 3542 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 4506 5183 gene locus_tag LOCUS_64720 4506 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64720 >Feature sequence0349 2769 772 gene locus_tag LOCUS_64730 2769 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 3185 4777 gene locus_tag LOCUS_64740 3185 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 >Feature sequence0350 3642 142 gene locus_tag LOCUS_64750 3642 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 5187 3832 gene locus_tag LOCUS_64760 5187 3832 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_64760 >Feature sequence0351 <1 962 gene locus_tag LOCUS_64770 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879160.1:vitamin B12-dependent ribonucleotide reductase 1462 2448 gene locus_tag LOCUS_64780 1462 2448 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_64780 2477 4804 gene locus_tag LOCUS_64790 2477 4804 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022610.1 protein_id gnl|my_center|LOCUS_64790 4804 5046 gene locus_tag LOCUS_64800 4804 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 >Feature sequence0352 2193 3311 gene locus_tag LOCUS_64810 2193 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 >Feature sequence0353 262 609 gene locus_tag LOCUS_64820 262 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64820 591 1178 gene locus_tag LOCUS_64830 591 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 1586 2242 gene locus_tag LOCUS_64840 1586 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 2442 3074 gene locus_tag LOCUS_64850 2442 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 3175 3540 gene locus_tag LOCUS_64860 3175 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 4061 4300 gene locus_tag LOCUS_64870 4061 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64870 4422 4661 gene locus_tag LOCUS_64880 4422 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 >Feature sequence0354 501 88 gene locus_tag LOCUS_64890 501 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64890 2453 501 gene locus_tag LOCUS_64900 2453 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 3623 2595 gene locus_tag LOCUS_64910 3623 2595 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 protein_id gnl|my_center|LOCUS_64910 5037 3724 gene locus_tag LOCUS_64920 5037 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 >Feature sequence0355 2138 507 gene locus_tag LOCUS_64930 2138 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 4764 2236 gene locus_tag LOCUS_64940 4764 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 5165 4962 gene locus_tag LOCUS_64950 5165 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 >Feature sequence0356 1613 789 gene locus_tag LOCUS_64960 1613 789 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_64960 <5251 1687 gene locus_tag LOCUS_64970 <5251 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208353729.1:amino acid adenylation domain-containing protein >Feature sequence0357 <1 851 gene locus_tag LOCUS_64980 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921627.1:Gfo/Idh/MocA family oxidoreductase 863 1756 gene locus_tag LOCUS_64990 863 1756 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_64990 1805 3211 gene locus_tag LOCUS_65000 1805 3211 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038065.1 protein_id gnl|my_center|LOCUS_65000 3827 3594 gene locus_tag LOCUS_65010 3827 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 >Feature sequence0358 160 1131 gene locus_tag LOCUS_65020 160 1131 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_65020 1128 2048 gene locus_tag LOCUS_65030 1128 2048 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_65030 2208 3932 gene locus_tag LOCUS_65040 2208 3932 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_65040 <5201 4256 gene locus_tag LOCUS_65050 <5201 4256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence0359 63 1934 gene locus_tag LOCUS_65060 63 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65060 2340 3650 gene locus_tag LOCUS_65070 2340 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 4643 3840 gene locus_tag LOCUS_65080 4643 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 >Feature sequence0360 <1 2065 gene locus_tag LOCUS_65090 <1 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144060.1:serine/threonine-protein kinase 2937 2665 gene locus_tag LOCUS_65100 2937 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65100 3001 4521 gene locus_tag LOCUS_65110 3001 4521 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_65110 >Feature sequence0361 813 292 gene locus_tag LOCUS_65120 813 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 3751 1940 gene locus_tag LOCUS_65130 3751 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 4474 3953 gene locus_tag LOCUS_65140 4474 3953 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337982.1 protein_id gnl|my_center|LOCUS_65140 >Feature sequence0362 583 200 gene locus_tag LOCUS_65150 583 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 998 573 gene locus_tag LOCUS_65160 998 573 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_65160 2013 1762 gene locus_tag LOCUS_65170 2013 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 2584 2258 gene locus_tag LOCUS_65180 2584 2258 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_65180 3185 2571 gene locus_tag LOCUS_65190 3185 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 <5016 3577 gene locus_tag LOCUS_65200 <5016 3577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928965.1:CHAT domain-containing protein >Feature sequence0363 4195 986 gene locus_tag LOCUS_65210 4195 986 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_65210 >Feature sequence0364 762 304 gene locus_tag LOCUS_65220 762 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 881 762 gene locus_tag LOCUS_65230 881 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 1290 892 gene locus_tag LOCUS_65240 1290 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 1603 1274 gene locus_tag LOCUS_65250 1603 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 1938 1603 gene locus_tag LOCUS_65260 1938 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 2420 1938 gene locus_tag LOCUS_65270 2420 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175168236.1 protein_id gnl|my_center|LOCUS_65270 3521 2421 gene locus_tag LOCUS_65280 3521 2421 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207062.1 protein_id gnl|my_center|LOCUS_65280 3653 3525 gene locus_tag LOCUS_65290 3653 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 4840 3701 gene locus_tag LOCUS_65300 4840 3701 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 protein_id gnl|my_center|LOCUS_65300 >Feature sequence0365 <1 642 gene locus_tag LOCUS_65310 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704029.1:slipin family protein 762 1781 gene locus_tag LOCUS_65320 gene rtcA 762 1781 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052686.1 protein_id gnl|my_center|LOCUS_65320 1769 2974 gene locus_tag LOCUS_65330 1769 2974 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_65330 3042 3209 gene locus_tag LOCUS_65340 3042 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 3742 3834 gene locus_tag LOCUS_t01060 3742 3834 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3903 3983 gene locus_tag LOCUS_t01070 3903 3983 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4006 4081 gene locus_tag LOCUS_t01080 4006 4081 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4083 4161 gene locus_tag LOCUS_t01090 4083 4161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4173 4247 gene locus_tag LOCUS_t01100 4173 4247 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4251 4327 gene locus_tag LOCUS_t01110 4251 4327 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4375 4452 gene locus_tag LOCUS_t01120 4375 4452 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4490 4564 gene locus_tag LOCUS_t01130 4490 4564 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0366 1379 126 gene locus_tag LOCUS_65350 1379 126 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267981.1 protein_id gnl|my_center|LOCUS_65350 1692 1360 gene locus_tag LOCUS_65360 1692 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 2595 1729 gene locus_tag LOCUS_65370 2595 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 3148 2714 gene locus_tag LOCUS_65380 3148 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 3354 3145 gene locus_tag LOCUS_65390 3354 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 3565 3368 gene locus_tag LOCUS_65400 3565 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 4035 3562 gene locus_tag LOCUS_65410 4035 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 4312 4040 gene locus_tag LOCUS_65420 4312 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 4492 4313 gene locus_tag LOCUS_65430 4492 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 4851 4489 gene locus_tag LOCUS_65440 4851 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 >Feature sequence0367 <1 3231 gene locus_tag LOCUS_65450 <1 3231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964980.1:glutamate synthase large subunit 3262 4686 gene locus_tag LOCUS_65460 3262 4686 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964981.1 protein_id gnl|my_center|LOCUS_65460 >Feature sequence0368 357 2411 gene locus_tag LOCUS_65470 357 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 2609 3727 gene locus_tag LOCUS_65480 2609 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 >Feature sequence0369 988 416 gene locus_tag LOCUS_65490 988 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 1901 1047 gene locus_tag LOCUS_65500 1901 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 4475 2115 gene locus_tag LOCUS_65510 4475 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 >Feature sequence0370 185 532 gene locus_tag LOCUS_65520 185 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 529 1101 gene locus_tag LOCUS_65530 529 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 1091 1519 gene locus_tag LOCUS_65540 1091 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 1519 1770 gene locus_tag LOCUS_65550 1519 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 1868 2983 gene locus_tag LOCUS_65560 1868 2983 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_65560 2980 3705 gene locus_tag LOCUS_65570 2980 3705 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_65570 3656 3937 gene locus_tag LOCUS_65580 3656 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 4076 4297 gene locus_tag LOCUS_65590 4076 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 >Feature sequence0371 705 289 gene locus_tag LOCUS_65600 705 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 978 1589 gene locus_tag LOCUS_65610 978 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 1582 2358 gene locus_tag LOCUS_65620 1582 2358 CDS product DUF1670 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860303.1 protein_id gnl|my_center|LOCUS_65620 2351 2620 gene locus_tag LOCUS_65630 2351 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 3679 2777 gene locus_tag LOCUS_65640 3679 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 4642 3731 gene locus_tag LOCUS_65650 4642 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 >Feature sequence0372 2523 3254 gene locus_tag LOCUS_65660 gene tsaB 2523 3254 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 protein_id gnl|my_center|LOCUS_65660 3893 3519 gene locus_tag LOCUS_65670 3893 3519 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393092.1 protein_id gnl|my_center|LOCUS_65670 <4665 4032 gene locus_tag LOCUS_65680 <4665 4032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein >Feature sequence0373 <1 3081 gene locus_tag LOCUS_65690 <1 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438022.1:formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme 3810 4148 gene locus_tag LOCUS_65700 3810 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 >Feature sequence0374 238 3192 gene locus_tag LOCUS_65710 238 3192 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053741.1 protein_id gnl|my_center|LOCUS_65710 4151 3222 gene locus_tag LOCUS_65720 4151 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 >Feature sequence0375 528 3122 gene locus_tag LOCUS_65730 528 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 3787 3368 gene locus_tag LOCUS_65740 3787 3368 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257840.1 protein_id gnl|my_center|LOCUS_65740 4246 3890 gene locus_tag LOCUS_65750 gene fliS 4246 3890 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_65750 >Feature sequence0376 474 2525 gene locus_tag LOCUS_65760 474 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 2959 3156 gene locus_tag LOCUS_65770 2959 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 3714 3187 gene locus_tag LOCUS_65780 3714 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65780 4330 3851 gene locus_tag LOCUS_65790 4330 3851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233402.1 protein_id gnl|my_center|LOCUS_65790 >Feature sequence0377 2074 971 gene locus_tag LOCUS_65800 2074 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 2870 2511 gene locus_tag LOCUS_65810 2870 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65810 3755 2904 gene locus_tag LOCUS_65820 3755 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65820 4037 3798 gene locus_tag LOCUS_65830 4037 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65830 >Feature sequence0378 69 623 gene locus_tag LOCUS_65840 69 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 891 2240 gene locus_tag LOCUS_65850 891 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 2474 3925 gene locus_tag LOCUS_65860 2474 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65860 >Feature sequence0379 4263 1573 gene locus_tag LOCUS_65870 4263 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 >Feature sequence0380 397 2751 gene locus_tag LOCUS_65880 397 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 2821 4236 gene locus_tag LOCUS_65890 2821 4236 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_65890 >Feature sequence0381 405 4052 gene locus_tag LOCUS_65900 405 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65900 >Feature sequence0382 1704 1468 gene locus_tag LOCUS_65910 1704 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 >Feature sequence0383 567 1769 gene locus_tag LOCUS_65920 567 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 2268 2059 gene locus_tag LOCUS_65930 2268 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65930 2654 3046 gene locus_tag LOCUS_65940 2654 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 3293 3913 gene locus_tag LOCUS_65950 3293 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 >Feature sequence0384 777 103 gene locus_tag LOCUS_65960 777 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65960 1307 789 gene locus_tag LOCUS_65970 1307 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 1494 1748 gene locus_tag LOCUS_65980 1494 1748 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_65980 1841 2527 gene locus_tag LOCUS_65990 1841 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 2609 3025 gene locus_tag LOCUS_66000 2609 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 3647 4066 gene locus_tag LOCUS_66010 3647 4066 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863690.1 protein_id gnl|my_center|LOCUS_66010 4155 4310 gene locus_tag LOCUS_66020 4155 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 >Feature sequence0385 4058 3915 gene locus_tag LOCUS_66030 4058 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66030 >Feature sequence0386 386 126 gene locus_tag LOCUS_66040 386 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 744 412 gene locus_tag LOCUS_66050 744 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 864 1136 gene locus_tag LOCUS_66060 864 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 1343 1555 gene locus_tag LOCUS_66070 1343 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 1552 1710 gene locus_tag LOCUS_66080 1552 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 2009 2779 gene locus_tag LOCUS_66090 2009 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 2985 4025 gene locus_tag LOCUS_66100 2985 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 >Feature sequence0387 651 2789 gene locus_tag LOCUS_66110 651 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 >Feature sequence0388 >Feature sequence0389 443 3988 gene locus_tag LOCUS_66120 gene nifJ 443 3988 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_66120 >Feature sequence0390 295 435 gene locus_tag LOCUS_66130 295 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 1358 1684 gene locus_tag LOCUS_66140 1358 1684 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_66140 1687 2001 gene locus_tag LOCUS_66150 1687 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 2117 2401 gene locus_tag LOCUS_66160 2117 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 3855 2869 gene locus_tag LOCUS_66170 3855 2869 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387740.1 protein_id gnl|my_center|LOCUS_66170 >Feature sequence0391 362 2899 gene locus_tag LOCUS_66180 362 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 3620 2928 gene locus_tag LOCUS_66190 3620 2928 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_66190 >Feature sequence0392 444 1136 gene locus_tag LOCUS_66200 444 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 1421 3046 gene locus_tag LOCUS_66210 1421 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 3829 3197 gene locus_tag LOCUS_66220 3829 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 >Feature sequence0393 2 3358 gene locus_tag LOCUS_66230 2 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 >Feature sequence0394 <1 586 gene locus_tag LOCUS_66240 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898339.1:PadR family transcriptional regulator 678 1742 gene locus_tag LOCUS_66250 678 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 1765 2667 gene locus_tag LOCUS_66260 1765 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66260 2703 3566 gene locus_tag LOCUS_66270 2703 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 >Feature sequence0395 115 471 gene locus_tag LOCUS_66280 115 471 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104025169.1 protein_id gnl|my_center|LOCUS_66280 1399 506 gene locus_tag LOCUS_66290 1399 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66290 3031 1607 gene locus_tag LOCUS_66300 3031 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66300 3356 3021 gene locus_tag LOCUS_66310 3356 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 >Feature sequence0396 468 629 gene locus_tag LOCUS_66320 468 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66320 732 1787 gene locus_tag LOCUS_66330 732 1787 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_66330 2059 2652 gene locus_tag LOCUS_66340 2059 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 >Feature sequence0397 3238 1844 gene locus_tag LOCUS_66350 3238 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 >Feature sequence0398 1015 191 gene locus_tag LOCUS_66360 1015 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 3223 1667 gene locus_tag LOCUS_66370 3223 1667 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_66370 <3999 3307 gene locus_tag LOCUS_66380 <3999 3307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011946763.1:alkaline phosphatase family protein >Feature sequence0399 332 2482 gene locus_tag LOCUS_66390 332 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66390 >Feature sequence0400 1 1128 gene locus_tag LOCUS_66400 1 1128 CDS product IS701 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209648948.1 protein_id gnl|my_center|LOCUS_66400 1865 1272 gene locus_tag LOCUS_66410 1865 1272 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884084.1 protein_id gnl|my_center|LOCUS_66410 3955 1865 gene locus_tag LOCUS_66420 3955 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66420 >Feature sequence0401 846 3158 gene locus_tag LOCUS_66430 846 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66430 3304 3462 gene locus_tag LOCUS_66440 3304 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 >Feature sequence0402 3515 504 gene locus_tag LOCUS_66450 3515 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 >Feature sequence0403 1192 779 gene locus_tag LOCUS_66460 1192 779 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_66460 1380 3653 gene locus_tag LOCUS_66470 1380 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66470 >Feature sequence0404 1200 388 gene locus_tag LOCUS_66480 1200 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_66480 2627 1377 gene locus_tag LOCUS_66490 2627 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 3093 2932 gene locus_tag LOCUS_66500 3093 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 3546 3136 gene locus_tag LOCUS_66510 3546 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 3772 3539 gene locus_tag LOCUS_66520 3772 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 >Feature sequence0405 1853 699 gene locus_tag LOCUS_66530 1853 699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_66530 2532 1843 gene locus_tag LOCUS_66540 2532 1843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_66540 3750 2533 gene locus_tag LOCUS_66550 3750 2533 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_66550 >Feature sequence0406 1666 386 gene locus_tag LOCUS_66560 1666 386 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_66560 2812 1730 gene locus_tag LOCUS_66570 2812 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 3225 3392 gene locus_tag LOCUS_66580 3225 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 3469 3660 gene locus_tag LOCUS_66590 3469 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 >Feature sequence0407 76 195 gene locus_tag LOCUS_66600 76 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 192 884 gene locus_tag LOCUS_66610 gene nadD 192 884 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_66610 1768 2298 gene locus_tag LOCUS_66620 1768 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 3112 2330 gene locus_tag LOCUS_66630 3112 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66630 <3813 3109 gene locus_tag LOCUS_66640 <3813 3109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880876.1:zinc-binding dehydrogenase >Feature sequence0408 2957 261 gene locus_tag LOCUS_66650 2957 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66650 >Feature sequence0409 243 605 gene locus_tag LOCUS_66660 243 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66660 676 846 gene locus_tag LOCUS_66670 676 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 1561 1121 gene locus_tag LOCUS_66680 1561 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 2206 3558 gene locus_tag LOCUS_66690 2206 3558 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_66690 >Feature sequence0410 1240 977 gene locus_tag LOCUS_66700 1240 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66700 3113 1392 gene locus_tag LOCUS_66710 3113 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 3015 3245 gene locus_tag LOCUS_66720 3015 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 3573 3250 gene locus_tag LOCUS_66730 3573 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 >Feature sequence0411 676 128 gene locus_tag LOCUS_66740 676 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 946 875 gene locus_tag LOCUS_t01140 946 875 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2626 1061 gene locus_tag LOCUS_66750 2626 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 2902 3183 gene locus_tag LOCUS_66760 2902 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 3217 3633 gene locus_tag LOCUS_66770 3217 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 >Feature sequence0412 451 74 gene locus_tag LOCUS_66780 451 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 646 915 gene locus_tag LOCUS_66790 646 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 919 1140 gene locus_tag LOCUS_66800 919 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 1258 1449 gene locus_tag LOCUS_66810 1258 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 1522 1761 gene locus_tag LOCUS_66820 1522 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66820 1867 3648 gene locus_tag LOCUS_66830 1867 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 >Feature sequence0413 <1 1908 gene locus_tag LOCUS_66840 <1 1908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092005623.1:transketolase 1926 2684 gene locus_tag LOCUS_66850 gene pgl 1926 2684 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_66850 >Feature sequence0414 2523 2380 gene locus_tag LOCUS_66860 2523 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 3269 2475 gene locus_tag LOCUS_66870 3269 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 >Feature sequence0415 <1 558 gene locus_tag LOCUS_66880 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902280.1:RnfABCDGE type electron transport complex subunit G 542 1177 gene locus_tag LOCUS_66890 542 1177 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_66890 1190 1780 gene locus_tag LOCUS_66900 gene rsxA 1190 1780 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_66900 1777 2652 gene locus_tag LOCUS_66910 1777 2652 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_66910 <3723 2667 gene locus_tag LOCUS_66920 <3723 2667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897671.1:FAD:protein FMN transferase >Feature sequence0416 1698 1312 gene locus_tag LOCUS_66930 1698 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66930 2712 1792 gene locus_tag LOCUS_66940 2712 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 >Feature sequence0417 3334 131 gene locus_tag LOCUS_66950 3334 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 >Feature sequence0418 146 658 gene locus_tag LOCUS_66960 146 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 996 2402 gene locus_tag LOCUS_66970 996 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 2717 3166 gene locus_tag LOCUS_66980 2717 3166 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730707.1 protein_id gnl|my_center|LOCUS_66980 >Feature sequence0419 1626 1255 gene locus_tag LOCUS_66990 1626 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 2082 2558 gene locus_tag LOCUS_67000 2082 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 >Feature sequence0420 335 652 gene locus_tag LOCUS_67010 335 652 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_67010 609 908 gene locus_tag LOCUS_67020 609 908 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_67020 1062 2525 gene locus_tag LOCUS_67030 1062 2525 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787371.1 protein_id gnl|my_center|LOCUS_67030 2651 2848 gene locus_tag LOCUS_67040 2651 2848 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_67040 2845 3240 gene locus_tag LOCUS_67050 2845 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 >Feature sequence0421 105 1517 gene locus_tag LOCUS_67060 105 1517 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_67060 1671 3146 gene locus_tag LOCUS_67070 1671 3146 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_67070 >Feature sequence0422 235 1041 gene locus_tag LOCUS_67080 235 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67080 987 1139 gene locus_tag LOCUS_67090 987 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67090 1143 1628 gene locus_tag LOCUS_67100 1143 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 1612 2940 gene locus_tag LOCUS_67110 1612 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 3033 3533 gene locus_tag LOCUS_67120 3033 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 >Feature sequence0423 571 11 gene locus_tag LOCUS_67130 571 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 1372 734 gene locus_tag LOCUS_67140 1372 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67140 2490 1384 gene locus_tag LOCUS_67150 2490 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 <3567 2492 gene locus_tag LOCUS_67160 <3567 2492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023935.1:thiolase domain-containing protein >Feature sequence0424 1426 11 gene locus_tag LOCUS_67170 1426 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 1656 1519 gene locus_tag LOCUS_67180 1656 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 2049 1660 gene locus_tag LOCUS_67190 2049 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67190 3300 2071 gene locus_tag LOCUS_67200 3300 2071 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_67200 >Feature sequence0425 2863 260 gene locus_tag LOCUS_67210 2863 260 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144060.1 protein_id gnl|my_center|LOCUS_67210 3474 2863 gene locus_tag LOCUS_67220 3474 2863 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_67220 >Feature sequence0426 254 1348 gene locus_tag LOCUS_67230 254 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 1673 2287 gene locus_tag LOCUS_67240 1673 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 3203 2520 gene locus_tag LOCUS_67250 3203 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67250 3510 3325 gene locus_tag LOCUS_67260 3510 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67260 >Feature sequence0427 102 797 gene locus_tag LOCUS_67270 102 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 1044 1820 gene locus_tag LOCUS_67280 1044 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 2514 1858 gene locus_tag LOCUS_67290 2514 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67290 2888 2628 gene locus_tag LOCUS_67300 2888 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 3288 3109 gene locus_tag LOCUS_67310 3288 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 >Feature sequence0428 2619 355 gene locus_tag LOCUS_67320 2619 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 2817 3095 gene locus_tag LOCUS_67330 2817 3095 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109666.1 protein_id gnl|my_center|LOCUS_67330 >Feature sequence0429 1658 159 gene locus_tag LOCUS_67340 1658 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 2535 1636 gene locus_tag LOCUS_67350 2535 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 2943 2545 gene locus_tag LOCUS_67360 2943 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67360 >Feature sequence0430 307 750 gene locus_tag LOCUS_67370 307 750 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_67370 791 1735 gene locus_tag LOCUS_67380 791 1735 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_67380 1695 3164 gene locus_tag LOCUS_67390 1695 3164 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_67390 >Feature sequence0431 2219 570 gene locus_tag LOCUS_67400 gene pgi 2219 570 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_67400 2744 2391 gene locus_tag LOCUS_67410 2744 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 3178 2741 gene locus_tag LOCUS_67420 3178 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 3212 3346 gene locus_tag LOCUS_67430 3212 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67430 >Feature sequence0432 362 1858 gene locus_tag LOCUS_67440 362 1858 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_67440 >Feature sequence0433 198 1178 gene locus_tag LOCUS_67450 198 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018641672.1 protein_id gnl|my_center|LOCUS_67450 1147 1383 gene locus_tag LOCUS_67460 1147 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 1383 3176 gene locus_tag LOCUS_67470 1383 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67470 >Feature sequence0434 324 163 gene locus_tag LOCUS_67480 324 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67480 1138 419 gene locus_tag LOCUS_67490 1138 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67490 2258 1323 gene locus_tag LOCUS_67500 2258 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 2719 2597 gene locus_tag LOCUS_67510 2719 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 <3428 2724 gene locus_tag LOCUS_67520 <3428 2724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045033.1:transposase >Feature sequence0435 1101 337 gene locus_tag LOCUS_67530 gene istB 1101 337 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_67530 2570 1098 gene locus_tag LOCUS_67540 2570 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 2956 2567 gene locus_tag LOCUS_67550 2956 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67550 >Feature sequence0436 1235 267 gene locus_tag LOCUS_67560 1235 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 2609 1320 gene locus_tag LOCUS_67570 2609 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 3154 2606 gene locus_tag LOCUS_67580 3154 2606 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_67580 >Feature sequence0437 784 26 gene locus_tag LOCUS_67590 784 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 1046 822 gene locus_tag LOCUS_67600 1046 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 2115 1051 gene locus_tag LOCUS_67610 2115 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67610 >Feature sequence0438 >Feature sequence0439 <1 1284 gene locus_tag LOCUS_67620 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393716.1:group II intron reverse transcriptase/maturase 3143 1650 gene locus_tag LOCUS_67630 gene pepV 3143 1650 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371462.1 protein_id gnl|my_center|LOCUS_67630 >Feature sequence0440 2204 105 gene locus_tag LOCUS_67640 2204 105 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975516.1 protein_id gnl|my_center|LOCUS_67640 2718 2491 gene locus_tag LOCUS_67650 2718 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_67650 3255 2773 gene locus_tag LOCUS_67660 3255 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_67660 >Feature sequence0441 1074 820 gene locus_tag LOCUS_67670 1074 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 1537 2778 gene locus_tag LOCUS_67680 1537 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67680 >Feature sequence0442 269 1906 gene locus_tag LOCUS_67690 269 1906 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_67690 3002 2448 gene locus_tag LOCUS_67700 3002 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67700 >Feature sequence0443 1696 611 gene locus_tag LOCUS_67710 1696 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67710 2841 1822 gene locus_tag LOCUS_67720 2841 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 >Feature sequence0444 300 539 gene locus_tag LOCUS_67730 300 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 2815 689 gene locus_tag LOCUS_67740 2815 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 >Feature sequence0445 <3244 267 gene locus_tag LOCUS_67750 <3244 267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence0446 781 41 gene locus_tag LOCUS_67760 781 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67760 2227 839 gene locus_tag LOCUS_67770 gene gdhA 2227 839 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_67770 >Feature sequence0447 <1 3006 gene locus_tag LOCUS_67780 <1 3006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence0448 166 1503 gene locus_tag LOCUS_67790 166 1503 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162038636.1 protein_id gnl|my_center|LOCUS_67790 >Feature sequence0449 303 959 gene locus_tag LOCUS_67800 303 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67800 1241 2749 gene locus_tag LOCUS_67810 1241 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 >Feature sequence0450 2655 136 gene locus_tag LOCUS_67820 2655 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 >Feature sequence0451 >Feature sequence0452 1157 387 gene locus_tag LOCUS_67830 gene istB 1157 387 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_67830 2701 1148 gene locus_tag LOCUS_67840 2701 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 >Feature sequence0453 1146 418 gene locus_tag LOCUS_67850 1146 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 >Feature sequence0454 383 2029 gene locus_tag LOCUS_67860 383 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 2279 3013 gene locus_tag LOCUS_67870 2279 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 >Feature sequence0455 >Feature sequence0456 >Feature sequence0457 1164 229 gene locus_tag LOCUS_67880 1164 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 1532 1200 gene locus_tag LOCUS_67890 1532 1200 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545884.1 protein_id gnl|my_center|LOCUS_67890 1938 2945 gene locus_tag LOCUS_67900 1938 2945 CDS product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930147.1 protein_id gnl|my_center|LOCUS_67900 >Feature sequence0458 2301 874 gene locus_tag LOCUS_67910 2301 874 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_67910 2492 2298 gene locus_tag LOCUS_67920 2492 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67920 >Feature sequence0459 <1 763 gene locus_tag LOCUS_67930 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941773.1:S-methyl-5'-thioadenosine phosphorylase 1071 808 gene locus_tag LOCUS_67940 1071 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 <3082 1145 gene locus_tag LOCUS_67950 <3082 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776827.1:cbb3-type cytochrome c oxidase subunit I >Feature sequence0460 1242 2336 gene locus_tag LOCUS_67960 1242 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 >Feature sequence0461 1502 189 gene locus_tag LOCUS_67970 1502 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 >Feature sequence0462 >Feature sequence0463 599 958 gene locus_tag LOCUS_67980 599 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 973 1653 gene locus_tag LOCUS_67990 973 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 2873 1740 gene locus_tag LOCUS_68000 2873 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68000 >Feature sequence0464 33 236 gene locus_tag LOCUS_68010 33 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 2045 273 gene locus_tag LOCUS_68020 2045 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68020 >Feature sequence0465 40 633 gene locus_tag LOCUS_68030 40 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68030 672 1064 gene locus_tag LOCUS_68040 672 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68040 1569 2099 gene locus_tag LOCUS_68050 1569 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 2190 2471 gene locus_tag LOCUS_68060 2190 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68060 2474 2710 gene locus_tag LOCUS_68070 2474 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 2685 2933 gene locus_tag LOCUS_68080 2685 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 >Feature sequence0466 53 283 gene locus_tag LOCUS_68090 53 283 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_68090 759 959 gene locus_tag LOCUS_68100 759 959 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_68100 1216 1374 gene locus_tag LOCUS_68110 1216 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68110 1694 2404 gene locus_tag LOCUS_68120 1694 2404 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_68120 >Feature sequence0467 2766 937 gene locus_tag LOCUS_68130 2766 937 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_68130 >Feature sequence0468 244 1224 gene locus_tag LOCUS_68140 244 1224 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_68140 2661 1516 gene locus_tag LOCUS_68150 2661 1516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963526.1 protein_id gnl|my_center|LOCUS_68150 >Feature sequence0469 3 287 gene locus_tag LOCUS_68160 3 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68160 408 1103 gene locus_tag LOCUS_68170 gene gph 408 1103 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 protein_id gnl|my_center|LOCUS_68170 >Feature sequence0470 710 147 gene locus_tag LOCUS_68180 710 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 875 997 gene locus_tag LOCUS_68190 875 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 1188 2516 gene locus_tag LOCUS_68200 1188 2516 CDS product IS1380-like element ISCgl4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015202.1 protein_id gnl|my_center|LOCUS_68200 >Feature sequence0471 1556 591 gene locus_tag LOCUS_68210 1556 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 2320 1697 gene locus_tag LOCUS_68220 gene sigW 2320 1697 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_68220 2947 2810 gene locus_tag LOCUS_68230 2947 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 >Feature sequence0472 125 850 gene locus_tag LOCUS_68240 125 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 859 2181 gene locus_tag LOCUS_68250 859 2181 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141651.1 protein_id gnl|my_center|LOCUS_68250 2640 2867 gene locus_tag LOCUS_68260 2640 2867 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_68260 >Feature sequence0473 >Feature sequence0474 >Feature sequence0475 214 780 gene locus_tag LOCUS_68270 214 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 669 953 gene locus_tag LOCUS_68280 669 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68280 1302 2600 gene locus_tag LOCUS_68290 1302 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 >Feature sequence0476 629 144 gene locus_tag LOCUS_68300 629 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 1100 633 gene locus_tag LOCUS_68310 1100 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68310 1865 1143 gene locus_tag LOCUS_68320 1865 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 2347 1949 gene locus_tag LOCUS_68330 2347 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68330 >Feature sequence0477 996 322 gene locus_tag LOCUS_68340 996 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 2468 2737 gene locus_tag LOCUS_68350 2468 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 >Feature sequence0478 474 334 gene locus_tag LOCUS_68360 474 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 1632 541 gene locus_tag LOCUS_68370 1632 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68370 2197 2376 gene locus_tag LOCUS_68380 2197 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 2420 2719 gene locus_tag LOCUS_68390 2420 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68390 >Feature sequence0479 1468 587 gene locus_tag LOCUS_68400 1468 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68400 2909 2772 gene locus_tag LOCUS_68410 2909 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68410 >Feature sequence0480 26 964 gene locus_tag LOCUS_68420 gene speB 26 964 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_68420 1150 971 gene locus_tag LOCUS_68430 1150 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 1229 1999 gene locus_tag LOCUS_68440 1229 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 >Feature sequence0481 1548 1904 gene locus_tag LOCUS_68450 1548 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 1907 2344 gene locus_tag LOCUS_68460 1907 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 >Feature sequence0482 804 664 gene locus_tag LOCUS_68470 804 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68470 1206 1844 gene locus_tag LOCUS_68480 1206 1844 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495559.1 protein_id gnl|my_center|LOCUS_68480 2446 1898 gene locus_tag LOCUS_68490 2446 1898 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_68490 >Feature sequence0483 473 1147 gene locus_tag LOCUS_68500 473 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68500 >Feature sequence0484 1710 109 gene locus_tag LOCUS_68510 1710 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68510 2777 1800 gene locus_tag LOCUS_68520 2777 1800 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941622.1 protein_id gnl|my_center|LOCUS_68520 >Feature sequence0485 428 1612 gene locus_tag LOCUS_68530 428 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 >Feature sequence0486 20 283 gene locus_tag LOCUS_68540 20 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 285 566 gene locus_tag LOCUS_68550 285 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 582 851 gene locus_tag LOCUS_68560 582 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 851 1084 gene locus_tag LOCUS_68570 851 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68570 1086 1325 gene locus_tag LOCUS_68580 1086 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 1341 1643 gene locus_tag LOCUS_68590 1341 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 1892 2095 gene locus_tag LOCUS_68600 1892 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 2133 2372 gene locus_tag LOCUS_68610 2133 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 2581 2745 gene locus_tag LOCUS_68620 2581 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68620 >Feature sequence0487 615 262 gene locus_tag LOCUS_68630 gene rsfS 615 262 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_68630 <2889 823 gene locus_tag LOCUS_68640 <2889 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767612.1:sodium-translocating pyrophosphatase >Feature sequence0488 845 491 gene locus_tag LOCUS_tm00010 845 491 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2313 991 gene locus_tag LOCUS_68650 2313 991 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_68650 >Feature sequence0489 661 44 gene locus_tag LOCUS_68660 661 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 2102 1488 gene locus_tag LOCUS_68670 2102 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68670 2705 2370 gene locus_tag LOCUS_68680 2705 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 >Feature sequence0490 359 1045 gene locus_tag LOCUS_68690 359 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 2383 1181 gene locus_tag LOCUS_68700 2383 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68700 >Feature sequence0491 <1 1062 gene locus_tag LOCUS_68710 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 1614 1129 gene locus_tag LOCUS_68720 1614 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 <2848 1701 gene locus_tag LOCUS_68730 <2848 1701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942289.1:energy-dependent translational throttle protein EttA >Feature sequence0492 <1 1944 gene locus_tag LOCUS_68740 <1 1944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319769.1:formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme 1964 2602 gene locus_tag LOCUS_68750 1964 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 >Feature sequence0493 1822 578 gene locus_tag LOCUS_68760 1822 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68760 2361 1819 gene locus_tag LOCUS_68770 2361 1819 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_68770 >Feature sequence0494 312 575 gene locus_tag LOCUS_68780 312 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 629 1894 gene locus_tag LOCUS_68790 629 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 >Feature sequence0495 1050 1664 gene locus_tag LOCUS_68800 1050 1664 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839715.1 protein_id gnl|my_center|LOCUS_68800 1934 2749 gene locus_tag LOCUS_68810 1934 2749 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289101.1 protein_id gnl|my_center|LOCUS_68810 >Feature sequence0496 1762 1151 gene locus_tag LOCUS_68820 1762 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 2361 1759 gene locus_tag LOCUS_68830 2361 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 >Feature sequence0497 561 2354 gene locus_tag LOCUS_68840 561 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68840 2364 2663 gene locus_tag LOCUS_68850 2364 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 >Feature sequence0498 >Feature sequence0499 1117 89 gene locus_tag LOCUS_68860 gene cesB 1117 89 CDS product enantioselective carboxylesterase CesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246261.1 protein_id gnl|my_center|LOCUS_68860 1994 1122 gene locus_tag LOCUS_68870 1994 1122 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242638.1 protein_id gnl|my_center|LOCUS_68870 >Feature sequence0500 300 1577 gene locus_tag LOCUS_68880 300 1577 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_68880 2222 2401 gene locus_tag LOCUS_68890 2222 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 >Feature sequence0501 2256 1597 gene locus_tag LOCUS_68900 2256 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 >Feature sequence0502 867 1343 gene locus_tag LOCUS_68910 867 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 1433 1909 gene locus_tag LOCUS_68920 1433 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 2016 2384 gene locus_tag LOCUS_68930 2016 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68930 >Feature sequence0503 >Feature sequence0504 <1 1603 gene locus_tag LOCUS_68940 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073049.1:GAF domain-containing sensor histidine kinase >Feature sequence0505 668 844 gene locus_tag LOCUS_68950 668 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68950 837 2090 gene locus_tag LOCUS_68960 gene ltrA 837 2090 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_68960 >Feature sequence0506 32 214 gene locus_tag LOCUS_68970 32 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 502 1125 gene locus_tag LOCUS_68980 502 1125 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_68980 1266 2237 gene locus_tag LOCUS_68990 1266 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 >Feature sequence0507 362 874 gene locus_tag LOCUS_69000 362 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 871 2502 gene locus_tag LOCUS_69010 871 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 >Feature sequence0508 784 95 gene locus_tag LOCUS_69020 784 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 1647 781 gene locus_tag LOCUS_69030 1647 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 2047 1664 gene locus_tag LOCUS_69040 2047 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 >Feature sequence0509 1137 178 gene locus_tag LOCUS_69050 1137 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 2324 1557 gene locus_tag LOCUS_69060 2324 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 >Feature sequence0510 340 415 gene locus_tag LOCUS_t01150 340 415 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 881 965 gene locus_tag LOCUS_t01160 881 965 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1072 1146 gene locus_tag LOCUS_t01170 1072 1146 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1236 1311 gene locus_tag LOCUS_t01180 1236 1311 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0511 390 2459 gene locus_tag LOCUS_69070 390 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69070 >Feature sequence0512 560 2203 gene locus_tag LOCUS_69080 560 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 2288 2437 gene locus_tag LOCUS_69090 2288 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69090 >Feature sequence0513 281 1165 gene locus_tag LOCUS_69100 281 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 1158 2309 gene locus_tag LOCUS_69110 1158 2309 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_69110 >Feature sequence0514 2226 499 gene locus_tag LOCUS_69120 2226 499 CDS product IS1634-like element ISMac10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021311.1 protein_id gnl|my_center|LOCUS_69120 >Feature sequence0515 2381 75 gene locus_tag LOCUS_69130 2381 75 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980966.1 protein_id gnl|my_center|LOCUS_69130 >Feature sequence0516 <2560 1876 gene locus_tag LOCUS_69140 <2560 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence0517 989 1192 gene locus_tag LOCUS_69150 989 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69150 1204 1758 gene locus_tag LOCUS_69160 1204 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69160 >Feature sequence0518 902 138 gene locus_tag LOCUS_69170 gene istB 902 138 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_69170 2379 895 gene locus_tag LOCUS_69180 gene istA 2379 895 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_69180 >Feature sequence0519 108 341 gene locus_tag LOCUS_69190 108 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 404 631 gene locus_tag LOCUS_69200 404 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69200 631 789 gene locus_tag LOCUS_69210 631 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 786 980 gene locus_tag LOCUS_69220 786 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69220 1094 1402 gene locus_tag LOCUS_69230 1094 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69230 1625 1807 gene locus_tag LOCUS_69240 1625 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 >Feature sequence0520 1612 1346 gene locus_tag LOCUS_69250 1612 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 >Feature sequence0521 <1 1771 gene locus_tag LOCUS_69260 <1 1771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203027.1:DUF6531 domain-containing protein >Feature sequence0522 153 611 gene locus_tag LOCUS_69270 153 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 874 1095 gene locus_tag LOCUS_69280 874 1095 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_69280 1131 1586 gene locus_tag LOCUS_69290 1131 1586 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_69290 <2522 1669 gene locus_tag LOCUS_69300 <2522 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704814.1:ATP-dependent RNA helicase RhlE >Feature sequence0523 467 1630 gene locus_tag LOCUS_69310 467 1630 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_69310 2103 1747 gene locus_tag LOCUS_69320 2103 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 2220 2393 gene locus_tag LOCUS_69330 2220 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 >Feature sequence0524 1524 1180 gene locus_tag LOCUS_69340 1524 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 >Feature sequence0525 1764 277 gene locus_tag LOCUS_69350 1764 277 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144273.1 protein_id gnl|my_center|LOCUS_69350 2439 1897 gene locus_tag LOCUS_69360 2439 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 >Feature sequence0526 1420 725 gene locus_tag LOCUS_69370 1420 725 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_69370 1860 1417 gene locus_tag LOCUS_69380 1860 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69380 1951 2394 gene locus_tag LOCUS_69390 1951 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 >Feature sequence0527 493 2340 gene locus_tag LOCUS_69400 493 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 >Feature sequence0528 374 718 gene locus_tag LOCUS_69410 374 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69410 747 1562 gene locus_tag LOCUS_69420 747 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69420 1668 1979 gene locus_tag LOCUS_69430 1668 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69430 1976 2209 gene locus_tag LOCUS_69440 1976 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 >Feature sequence0529 64 1134 gene locus_tag LOCUS_69450 64 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 >Feature sequence0530 2338 701 gene locus_tag LOCUS_69460 2338 701 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_69460 >Feature sequence0531 1341 340 gene locus_tag LOCUS_69470 1341 340 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209270.1 protein_id gnl|my_center|LOCUS_69470 2248 1487 gene locus_tag LOCUS_69480 2248 1487 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_69480 >Feature sequence0532 >Feature sequence0533 820 1800 gene locus_tag LOCUS_69490 820 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69490 >Feature sequence0534 1370 387 gene locus_tag LOCUS_69500 1370 387 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225457.1 protein_id gnl|my_center|LOCUS_69500 2335 1622 gene locus_tag LOCUS_69510 2335 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69510 >Feature sequence0535 870 1106 gene locus_tag LOCUS_69520 870 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 2208 1120 gene locus_tag LOCUS_69530 2208 1120 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970739.1 protein_id gnl|my_center|LOCUS_69530 >Feature sequence0536 >Feature sequence0537 1219 92 gene locus_tag LOCUS_69540 1219 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69540 1889 2179 gene locus_tag LOCUS_69550 1889 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69550 >Feature sequence0538 935 114 gene locus_tag LOCUS_69560 935 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69560 1268 1951 gene locus_tag LOCUS_69570 1268 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 >Feature sequence0539 698 543 gene locus_tag LOCUS_69580 698 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 >Feature sequence0540 <1 593 gene locus_tag LOCUS_69590 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928885.1:tetratricopeptide repeat protein 703 2022 gene locus_tag LOCUS_69600 703 2022 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943049.1 protein_id gnl|my_center|LOCUS_69600 >Feature sequence0541 >Feature sequence0542 829 50 gene locus_tag LOCUS_69610 829 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69610 <2359 1022 gene locus_tag LOCUS_69620 <2359 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930331.1:methyl-accepting chemotaxis protein >Feature sequence0543 354 1961 gene locus_tag LOCUS_69630 354 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 >Feature sequence0544 332 1945 gene locus_tag LOCUS_69640 332 1945 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815792.1 protein_id gnl|my_center|LOCUS_69640 >Feature sequence0545 1925 228 gene locus_tag LOCUS_69650 1925 228 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_69650 >Feature sequence0546 >Feature sequence0547 >Feature sequence0548 1951 638 gene locus_tag LOCUS_69660 1951 638 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039667.1 protein_id gnl|my_center|LOCUS_69660 >Feature sequence0549 >Feature sequence0550 815 567 gene locus_tag LOCUS_69670 815 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 1963 1109 gene locus_tag LOCUS_69680 1963 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 >Feature sequence0551 1608 295 gene locus_tag LOCUS_69690 1608 295 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_69690 >Feature sequence0552 231 2141 gene locus_tag LOCUS_69700 231 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 >Feature sequence0553 1658 75 gene locus_tag LOCUS_69710 1658 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 >Feature sequence0554 336 1190 gene locus_tag LOCUS_69720 336 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 <2273 1410 gene locus_tag LOCUS_69730 <2273 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388844.1:Holliday junction branch migration DNA helicase RuvB >Feature sequence0555 >Feature sequence0556 >Feature sequence0557 786 214 gene locus_tag LOCUS_69740 786 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69740 <2249 1304 gene locus_tag LOCUS_69750 <2249 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003535031.1:amino acid ABC transporter substrate-binding protein >Feature sequence0558 755 498 gene locus_tag LOCUS_69760 755 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 990 802 gene locus_tag LOCUS_69770 990 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 1407 1216 gene locus_tag LOCUS_69780 1407 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 1645 1412 gene locus_tag LOCUS_69790 1645 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 1844 1638 gene locus_tag LOCUS_69800 1844 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69800 2201 1920 gene locus_tag LOCUS_69810 2201 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 >Feature sequence0559 <2226 860 gene locus_tag LOCUS_69820 <2226 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728910.1:pyruvate kinase >Feature sequence0560 251 1768 gene locus_tag LOCUS_69830 251 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 >Feature sequence0561 107 1873 gene locus_tag LOCUS_69840 107 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69840 >Feature sequence0562 1353 1949 gene locus_tag LOCUS_69850 1353 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 >Feature sequence0563 583 1056 gene locus_tag LOCUS_69860 583 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 1125 1892 gene locus_tag LOCUS_69870 1125 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69870 >Feature sequence0564 <2209 105 gene locus_tag LOCUS_69880 <2209 105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546425.1:lytic transglycosylase domain-containing protein >Feature sequence0565 <1 892 gene locus_tag LOCUS_69890 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005167652.1:PLP-dependent cysteine synthase family protein 1105 2193 gene locus_tag LOCUS_69900 1105 2193 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_69900 >Feature sequence0566 560 234 gene locus_tag LOCUS_69910 560 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 736 1233 gene locus_tag LOCUS_69920 736 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 1271 1774 gene locus_tag LOCUS_69930 1271 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 2019 2147 gene locus_tag LOCUS_69940 2019 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 >Feature sequence0567 269 1603 gene locus_tag LOCUS_69950 269 1603 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_69950 >Feature sequence0568 1544 1218 gene locus_tag LOCUS_69960 1544 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 >Feature sequence0569 >Feature sequence0570 1978 1223 gene locus_tag LOCUS_69970 1978 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69970 >Feature sequence0571 >Feature sequence0572 427 1695 gene locus_tag LOCUS_69980 427 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 >Feature sequence0573 298 486 gene locus_tag LOCUS_69990 298 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 496 639 gene locus_tag LOCUS_70000 496 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 1224 1430 gene locus_tag LOCUS_70010 1224 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70010 1666 2061 gene locus_tag LOCUS_70020 1666 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 >Feature sequence0574 489 1754 gene locus_tag LOCUS_70030 489 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 >Feature sequence0575 135 647 gene locus_tag LOCUS_70040 135 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70040 >Feature sequence0576 1724 285 gene locus_tag LOCUS_70050 1724 285 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105036.1 protein_id gnl|my_center|LOCUS_70050 >Feature sequence0577 <2154 484 gene locus_tag LOCUS_70060 <2154 484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122713.1:DUF2309 domain-containing protein >Feature sequence0578 >Feature sequence0579 1993 536 gene locus_tag LOCUS_70070 1993 536 CDS product IS66-like element ISRhru2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389933.1 protein_id gnl|my_center|LOCUS_70070 >Feature sequence0580 <1 2034 gene locus_tag LOCUS_70080 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022224.1:tetratricopeptide repeat protein >Feature sequence0581 1914 562 gene locus_tag LOCUS_70090 1914 562 CDS product ISNCY-like element ISRsp17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642802.1 protein_id gnl|my_center|LOCUS_70090 >Feature sequence0582 228 156 gene locus_tag LOCUS_t01190 228 156 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1856 390 gene locus_tag LOCUS_70100 1856 390 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_70100 >Feature sequence0583 223 1581 gene locus_tag LOCUS_70110 223 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70110 1754 1948 gene locus_tag LOCUS_70120 1754 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 >Feature sequence0584 1515 1333 gene locus_tag LOCUS_70130 1515 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70130 >Feature sequence0585 423 1712 gene locus_tag LOCUS_70140 423 1712 CDS product IS701-like element ISRba4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921909.1 protein_id gnl|my_center|LOCUS_70140 1773 1919 gene locus_tag LOCUS_70150 1773 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 >Feature sequence0586 45 1763 gene locus_tag LOCUS_70160 gene flgE 45 1763 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 protein_id gnl|my_center|LOCUS_70160 >Feature sequence0587 347 655 gene locus_tag LOCUS_70170 347 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 739 1827 gene locus_tag LOCUS_70180 739 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70180 1829 1984 gene locus_tag LOCUS_70190 1829 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 >Feature sequence0588 323 1108 gene locus_tag LOCUS_70200 323 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 1109 1399 gene locus_tag LOCUS_70210 1109 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 >Feature sequence0589 1943 687 gene locus_tag LOCUS_70220 1943 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 >Feature sequence0590 >Feature sequence0591 404 222 gene locus_tag LOCUS_70230 404 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 903 406 gene locus_tag LOCUS_70240 903 406 CDS product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951052.1 protein_id gnl|my_center|LOCUS_70240 1782 904 gene locus_tag LOCUS_70250 1782 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 >Feature sequence0592 1874 225 gene locus_tag LOCUS_70260 1874 225 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_70260 >Feature sequence0593 >Feature sequence0594 >Feature sequence0595 >Feature sequence0596 >Feature sequence0597 478 1200 gene locus_tag LOCUS_70270 478 1200 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201365204.1 protein_id gnl|my_center|LOCUS_70270 <2060 1222 gene locus_tag LOCUS_70280 <2060 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528040.1:haloalkane dehalogenase >Feature sequence0598 1348 74 gene locus_tag LOCUS_70290 1348 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 >Feature sequence0599 1527 610 gene locus_tag LOCUS_70300 1527 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 >Feature sequence0600 1475 237 gene locus_tag LOCUS_70310 gene ltrA 1475 237 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084848.1 protein_id gnl|my_center|LOCUS_70310 >Feature sequence0601 35 775 gene locus_tag LOCUS_70320 35 775 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 protein_id gnl|my_center|LOCUS_70320 854 1516 gene locus_tag LOCUS_70330 854 1516 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 protein_id gnl|my_center|LOCUS_70330 1586 1996 gene locus_tag LOCUS_70340 1586 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 >Feature sequence0602 360 1673 gene locus_tag LOCUS_70350 360 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 >Feature sequence0603 1364 396 gene locus_tag LOCUS_70360 1364 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70360 1753 1421 gene locus_tag LOCUS_70370 1753 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 >Feature sequence0604 1765 1938 gene locus_tag LOCUS_70380 1765 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 >Feature sequence0605 202 1608 gene locus_tag LOCUS_70390 202 1608 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971098.1 protein_id gnl|my_center|LOCUS_70390 >Feature sequence0606 >Feature sequence0607 >Feature sequence0608 >Feature sequence0609 309 1484 gene locus_tag LOCUS_70400 309 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 >Feature sequence0610 1461 277 gene locus_tag LOCUS_70410 1461 277 CDS product IS4-like element ISRba5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119601.1 protein_id gnl|my_center|LOCUS_70410 1605 1907 gene locus_tag LOCUS_70420 1605 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 >Feature sequence0611 >Feature sequence0612 >Feature sequence0613 175 1674 gene locus_tag LOCUS_70430 175 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 >Feature sequence0614 165 527 gene locus_tag LOCUS_70440 165 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70440 524 1522 gene locus_tag LOCUS_70450 524 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70450 >Feature sequence0615 <1 756 gene locus_tag LOCUS_70460 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942900.1:lipid A export permease/ATP-binding protein MsbA >Feature sequence0616 <1 608 gene locus_tag LOCUS_70470 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765307.1:arginine--tRNA ligase 681 1820 gene locus_tag LOCUS_70480 681 1820 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_70480 >Feature sequence0617 891 169 gene locus_tag LOCUS_70490 891 169 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211022.1 protein_id gnl|my_center|LOCUS_70490 1319 1200 gene locus_tag LOCUS_70500 1319 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 >Feature sequence0618 404 1393 gene locus_tag LOCUS_70510 404 1393 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225457.1 protein_id gnl|my_center|LOCUS_70510 >Feature sequence0619 377 754 gene locus_tag LOCUS_70520 377 754 CDS product IS3 family transposase ISGsu7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941222.1 protein_id gnl|my_center|LOCUS_70520 751 1647 gene locus_tag LOCUS_70530 751 1647 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941223.1 protein_id gnl|my_center|LOCUS_70530 >Feature sequence0620 1105 419 gene locus_tag LOCUS_70540 1105 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 >Feature sequence0621 >Feature sequence0622 139 1455 gene locus_tag LOCUS_70550 139 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 1717 1544 gene locus_tag LOCUS_70560 1717 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 >Feature sequence0623 >Feature sequence0624 1280 858 gene locus_tag LOCUS_70570 1280 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 1781 1482 gene locus_tag LOCUS_70580 1781 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70580 >Feature sequence0625 1390 554 gene locus_tag LOCUS_70590 1390 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 >Feature sequence0626 >Feature sequence0627 1138 200 gene locus_tag LOCUS_70600 1138 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 >Feature sequence0628 428 1678 gene locus_tag LOCUS_70610 428 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 >Feature sequence0629 <1 1141 gene locus_tag LOCUS_70620 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065037.1:disaggregatase related repeat-containing protein <1899 1318 gene locus_tag LOCUS_70630 <1899 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392521.1:2-hydroxyacyl-CoA dehydratase family protein >Feature sequence0630 >Feature sequence0631 623 1648 gene locus_tag LOCUS_70640 623 1648 CDS product IS630-like element ISDra3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480514.1 protein_id gnl|my_center|LOCUS_70640 >Feature sequence0632 161 442 gene locus_tag LOCUS_70650 161 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 966 592 gene locus_tag LOCUS_70660 966 592 CDS product diol dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727731.1 protein_id gnl|my_center|LOCUS_70660 <1893 979 gene locus_tag LOCUS_70670 <1893 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878616.1:propanediol/glycerol family dehydratase large subunit >Feature sequence0633 1132 578 gene locus_tag LOCUS_70680 1132 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 1790 1479 gene locus_tag LOCUS_70690 1790 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 >Feature sequence0634 1568 510 gene locus_tag LOCUS_70700 1568 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70700 >Feature sequence0635 387 1613 gene locus_tag LOCUS_70710 387 1613 CDS product IS5-like element ISRm13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969462.1 protein_id gnl|my_center|LOCUS_70710 >Feature sequence0636 399 220 gene locus_tag LOCUS_70720 399 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 569 372 gene locus_tag LOCUS_70730 569 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 735 559 gene locus_tag LOCUS_70740 735 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 1232 819 gene locus_tag LOCUS_70750 1232 819 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_70750 1438 1232 gene locus_tag LOCUS_70760 1438 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70760 1561 1439 gene locus_tag LOCUS_70770 1561 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70770 1800 1564 gene locus_tag LOCUS_70780 1800 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 >Feature sequence0637 <1 1627 gene locus_tag LOCUS_70790 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940210.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence0638 1205 753 gene locus_tag LOCUS_70800 1205 753 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_70800 <1870 1292 gene locus_tag LOCUS_70810 <1870 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022820.1:CoB-CoM heterodisulfide reductase HdrA2 >Feature sequence0639 351 1604 gene locus_tag LOCUS_70820 351 1604 CDS product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_70820 >Feature sequence0640 1224 1502 gene locus_tag LOCUS_70830 1224 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 >Feature sequence0641 >Feature sequence0642 >Feature sequence0643 <1846 526 gene locus_tag LOCUS_70840 <1846 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881159.1:aconitate hydratase >Feature sequence0644 1732 149 gene locus_tag LOCUS_70850 1732 149 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_70850 >Feature sequence0645 82 1038 gene locus_tag LOCUS_70860 82 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 1095 1304 gene locus_tag LOCUS_70870 1095 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70870 >Feature sequence0646 1600 281 gene locus_tag LOCUS_70880 1600 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70880 >Feature sequence0647 1328 423 gene locus_tag LOCUS_70890 1328 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 >Feature sequence0648 1520 135 gene locus_tag LOCUS_70900 1520 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70900 >Feature sequence0649 20 304 gene locus_tag LOCUS_70910 20 304 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_70910 1158 1706 gene locus_tag LOCUS_70920 1158 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70920 >Feature sequence0650 >Feature sequence0651 >Feature sequence0652 1 174 gene locus_tag LOCUS_70930 1 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 >Feature sequence0653 <1 1597 gene locus_tag LOCUS_70940 <1 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase >Feature sequence0654 1027 200 gene locus_tag LOCUS_70950 1027 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 1529 1341 gene locus_tag LOCUS_70960 1529 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70960 >Feature sequence0655 1117 158 gene locus_tag LOCUS_70970 1117 158 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104854.1 protein_id gnl|my_center|LOCUS_70970 1316 1110 gene locus_tag LOCUS_70980 1316 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 >Feature sequence0656 617 1510 gene locus_tag LOCUS_70990 617 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70990 >Feature sequence0657 1303 485 gene locus_tag LOCUS_71000 1303 485 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970853.1 protein_id gnl|my_center|LOCUS_71000 1652 1356 gene locus_tag LOCUS_71010 1652 1356 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140080.1 protein_id gnl|my_center|LOCUS_71010 >Feature sequence0658 >Feature sequence0659 >Feature sequence0660 36 1367 gene locus_tag LOCUS_71020 36 1367 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_71020 >Feature sequence0661 1492 884 gene locus_tag LOCUS_71030 1492 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71030 >Feature sequence0662 1352 129 gene locus_tag LOCUS_71040 1352 129 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_71040 >Feature sequence0663 >Feature sequence0664 >Feature sequence0665 159 629 gene locus_tag LOCUS_71050 159 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108568.1 protein_id gnl|my_center|LOCUS_71050 742 1590 gene locus_tag LOCUS_71060 742 1590 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_71060 >Feature sequence0666 469 828 gene locus_tag LOCUS_71070 469 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71070 <1749 846 gene locus_tag LOCUS_71080 <1749 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947219.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0667 1463 168 gene locus_tag LOCUS_71090 1463 168 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969439.1 protein_id gnl|my_center|LOCUS_71090 >Feature sequence0668 376 693 gene locus_tag LOCUS_71100 376 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71100 848 1207 gene locus_tag LOCUS_71110 848 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71110 1123 1443 gene locus_tag LOCUS_71120 1123 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71120 >Feature sequence0669 712 557 gene locus_tag LOCUS_71130 712 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71130 850 978 gene locus_tag LOCUS_71140 850 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 >Feature sequence0670 1486 602 gene locus_tag LOCUS_71150 1486 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71150 >Feature sequence0671 224 1543 gene locus_tag LOCUS_71160 224 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71160 >Feature sequence0672 73 342 gene locus_tag LOCUS_71170 73 342 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_71170 1424 426 gene locus_tag LOCUS_71180 1424 426 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222366.1 protein_id gnl|my_center|LOCUS_71180 >Feature sequence0673 >Feature sequence0674 507 1460 gene locus_tag LOCUS_71190 507 1460 CDS product IS1595-like element ISSod11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071113.1 protein_id gnl|my_center|LOCUS_71190 >Feature sequence0675 950 1120 gene locus_tag LOCUS_71200 950 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 >Feature sequence0676 335 1402 gene locus_tag LOCUS_71210 335 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71210 >Feature sequence0677 1408 17 gene locus_tag LOCUS_71220 1408 17 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963170.1 protein_id gnl|my_center|LOCUS_71220 >Feature sequence0678 1323 292 gene locus_tag LOCUS_71230 1323 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71230 >Feature sequence0679 312 1397 gene locus_tag LOCUS_71240 312 1397 CDS product IS481-like element ISSod13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073373.1 protein_id gnl|my_center|LOCUS_71240 >Feature sequence0680 480 295 gene locus_tag LOCUS_71250 480 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 >Feature sequence0681 896 186 gene locus_tag LOCUS_71260 896 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 1441 893 gene locus_tag LOCUS_71270 1441 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 >Feature sequence0682 139 639 gene locus_tag LOCUS_71280 139 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71280 >Feature sequence0683 1661 21 gene locus_tag LOCUS_71290 1661 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 >Feature sequence0684 1232 162 gene locus_tag LOCUS_71300 1232 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71300 >Feature sequence0685 249 524 gene locus_tag LOCUS_71310 249 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71310 662 1414 gene locus_tag LOCUS_71320 662 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71320 >Feature sequence0686 1500 184 gene locus_tag LOCUS_71330 1500 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71330 >Feature sequence0687 >Feature sequence0688 377 291 gene locus_tag LOCUS_t01200 377 291 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 469 1236 gene locus_tag LOCUS_71340 469 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 1296 1372 gene locus_tag LOCUS_t01210 1296 1372 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0689 679 1113 gene locus_tag LOCUS_71350 679 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 >Feature sequence0690 750 1241 gene locus_tag LOCUS_71360 750 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 1267 1488 gene locus_tag LOCUS_71370 1267 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71370 >Feature sequence0691 >Feature sequence0692 1 195 gene locus_tag LOCUS_71380 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71380 391 801 gene locus_tag LOCUS_71390 391 801 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_71390 885 1118 gene locus_tag LOCUS_71400 885 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 1109 1321 gene locus_tag LOCUS_71410 1109 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 >Feature sequence0693 1244 147 gene locus_tag LOCUS_71420 1244 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 1612 1208 gene locus_tag LOCUS_71430 1612 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 >Feature sequence0694 753 974 gene locus_tag LOCUS_71440 753 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 1251 1081 gene locus_tag LOCUS_71450 1251 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71450 1483 1259 gene locus_tag LOCUS_71460 1483 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71460 >Feature sequence0695 >Feature sequence0696 469 1356 gene locus_tag LOCUS_71470 469 1356 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_71470 >Feature sequence0697 <1660 261 gene locus_tag LOCUS_71480 <1660 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245322.1:catalase KatA >Feature sequence0698 108 272 gene locus_tag LOCUS_71490 108 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71490 >Feature sequence0699 622 191 gene locus_tag LOCUS_71500 622 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 1244 858 gene locus_tag LOCUS_71510 gene rpsK 1244 858 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943461.1 protein_id gnl|my_center|LOCUS_71510 1648 1319 gene locus_tag LOCUS_71520 gene rpsM 1648 1319 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_71520 >Feature sequence0700 288 1451 gene locus_tag LOCUS_71530 288 1451 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_71530 >Feature sequence0701 525 1265 gene locus_tag LOCUS_71540 525 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71540 1205 1432 gene locus_tag LOCUS_71550 1205 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71550 >Feature sequence0702 >Feature sequence0703 1028 324 gene locus_tag LOCUS_71560 1028 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71560 1435 1169 gene locus_tag LOCUS_71570 1435 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71570 >Feature sequence0704 315 635 gene locus_tag LOCUS_71580 315 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 1261 608 gene locus_tag LOCUS_71590 1261 608 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71590 >Feature sequence0705 668 850 gene locus_tag LOCUS_71600 668 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 840 1061 gene locus_tag LOCUS_71610 840 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 >Feature sequence0706 >Feature sequence0707 <1621 589 gene locus_tag LOCUS_71620 <1621 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262791.1:DNA-directed RNA polymerase subunit beta >Feature sequence0708 30 1142 gene locus_tag LOCUS_71630 30 1142 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_71630 >Feature sequence0709 371 1417 gene locus_tag LOCUS_71640 371 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 >Feature sequence0710 <1 663 gene locus_tag LOCUS_71650 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873593.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence0711 1137 1385 gene locus_tag LOCUS_71660 1137 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 >Feature sequence0712 >Feature sequence0713 >Feature sequence0714 1287 505 gene locus_tag LOCUS_71670 1287 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71670 1470 1315 gene locus_tag LOCUS_71680 1470 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71680 >Feature sequence0715 366 49 gene locus_tag LOCUS_71690 366 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71690 414 1370 gene locus_tag LOCUS_71700 414 1370 CDS product IS630-like element ISRm10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969941.1 protein_id gnl|my_center|LOCUS_71700 >Feature sequence0716 >Feature sequence0717 <1574 374 gene locus_tag LOCUS_71710 <1574 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398654.1:alpha-L-arabinofuranosidase AbfB >Feature sequence0718 442 1122 gene locus_tag LOCUS_71720 442 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 1289 1561 gene locus_tag LOCUS_71730 1289 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 >Feature sequence0719 76 5 gene locus_tag LOCUS_t01220 76 5 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 313 241 gene locus_tag LOCUS_t01230 313 241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 430 504 gene locus_tag LOCUS_t01240 430 504 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 864 935 gene locus_tag LOCUS_t01250 864 935 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1178 1262 gene locus_tag LOCUS_t01260 1178 1262 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0720 >Feature sequence0721 762 139 gene locus_tag LOCUS_71740 762 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71740 1271 798 gene locus_tag LOCUS_71750 1271 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71750 >Feature sequence0722 >Feature sequence0723 <1 1051 gene locus_tag LOCUS_71760 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262580.1:efflux RND transporter permease subunit >Feature sequence0724 1029 808 gene locus_tag LOCUS_71770 1029 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71770 1206 1403 gene locus_tag LOCUS_71780 1206 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71780 >Feature sequence0725 133 1254 gene locus_tag LOCUS_71790 133 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71790 1251 1487 gene locus_tag LOCUS_71800 1251 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71800 >Feature sequence0726 347 42 gene locus_tag LOCUS_71810 gene rpsN 347 42 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455658.1 protein_id gnl|my_center|LOCUS_71810 897 358 gene locus_tag LOCUS_71820 gene rplE 897 358 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 protein_id gnl|my_center|LOCUS_71820 1228 914 gene locus_tag LOCUS_71830 gene rplX 1228 914 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 protein_id gnl|my_center|LOCUS_71830 >Feature sequence0727 366 82 gene locus_tag LOCUS_71840 366 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71840 599 354 gene locus_tag LOCUS_71850 599 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71850 1266 901 gene locus_tag LOCUS_71860 1266 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71860 >Feature sequence0728 >Feature sequence0729 353 1087 gene locus_tag LOCUS_71870 353 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 >Feature sequence0730 412 179 gene locus_tag LOCUS_71880 412 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71880 780 589 gene locus_tag LOCUS_71890 780 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71890 >Feature sequence0731 >Feature sequence0732 1278 244 gene locus_tag LOCUS_71900 1278 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 >Feature sequence0733 >Feature sequence0734 >Feature sequence0735 481 741 gene locus_tag LOCUS_71910 481 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71910 738 1118 gene locus_tag LOCUS_71920 738 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 >Feature sequence0736 1004 177 gene locus_tag LOCUS_71930 1004 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71930 1288 1022 gene locus_tag LOCUS_71940 1288 1022 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 protein_id gnl|my_center|LOCUS_71940 >Feature sequence0737 732 1004 gene locus_tag LOCUS_71950 732 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 >Feature sequence0738 604 1230 gene locus_tag LOCUS_71960 604 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 >Feature sequence0739 >Feature sequence0740 >Feature sequence0741 9 1106 gene locus_tag LOCUS_71970 9 1106 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_71970 >Feature sequence0742 24 521 gene locus_tag LOCUS_71980 24 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71980 607 987 gene locus_tag LOCUS_71990 607 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 >Feature sequence0743 240 1448 gene locus_tag LOCUS_72000 240 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 >Feature sequence0744 1092 358 gene locus_tag LOCUS_72010 1092 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72010 >Feature sequence0745 <1503 915 gene locus_tag LOCUS_72020 <1503 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529194.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0746 445 1227 gene locus_tag LOCUS_72030 445 1227 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618766.1 protein_id gnl|my_center|LOCUS_72030 >Feature sequence0747 1227 124 gene locus_tag LOCUS_72040 1227 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72040 >Feature sequence0748 >Feature sequence0749 1295 144 gene locus_tag LOCUS_72050 1295 144 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120019338.1 protein_id gnl|my_center|LOCUS_72050 >Feature sequence0750 1206 286 gene locus_tag LOCUS_72060 1206 286 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156434651.1 protein_id gnl|my_center|LOCUS_72060 >Feature sequence0751 1139 285 gene locus_tag LOCUS_72070 1139 285 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_72070 >Feature sequence0752 131 604 gene locus_tag LOCUS_72080 131 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 1422 679 gene locus_tag LOCUS_72090 1422 679 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819071.1 protein_id gnl|my_center|LOCUS_72090 >Feature sequence0753 >Feature sequence0754 >Feature sequence0755 305 1084 gene locus_tag LOCUS_72100 305 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 >Feature sequence0756 167 1114 gene locus_tag LOCUS_72110 167 1114 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_72110 >Feature sequence0757 117 671 gene locus_tag LOCUS_72120 117 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72120 <1441 651 gene locus_tag LOCUS_72130 <1441 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199519479.1:IS3 family transposase >Feature sequence0758 >Feature sequence0759 95 1267 gene locus_tag LOCUS_72140 95 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 >Feature sequence0760 342 503 gene locus_tag LOCUS_72150 342 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72150 >Feature sequence0761 815 1252 gene locus_tag LOCUS_72160 815 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72160 >Feature sequence0762 653 186 gene locus_tag LOCUS_72170 653 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72170 1176 778 gene locus_tag LOCUS_72180 1176 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72180 >Feature sequence0763 337 879 gene locus_tag LOCUS_72190 337 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72190 948 1280 gene locus_tag LOCUS_72200 948 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72200 >Feature sequence0764 255 632 gene locus_tag LOCUS_72210 255 632 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420339.1 protein_id gnl|my_center|LOCUS_72210 1149 703 gene locus_tag LOCUS_72220 1149 703 CDS product DUF2703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940568.1 protein_id gnl|my_center|LOCUS_72220 >Feature sequence0765 858 574 gene locus_tag LOCUS_72230 858 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72230 >Feature sequence0766 <1412 212 gene locus_tag LOCUS_72240 <1412 212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082025.1:clostripain-related cysteine peptidase >Feature sequence0767 >Feature sequence0768 1267 437 gene locus_tag LOCUS_72250 1267 437 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_72250 >Feature sequence0769 1216 221 gene locus_tag LOCUS_72260 1216 221 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224817.1 protein_id gnl|my_center|LOCUS_72260 >Feature sequence0770 <1403 192 gene locus_tag LOCUS_72270 <1403 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768413.1:Y-family DNA polymerase >Feature sequence0771 1369 209 gene locus_tag LOCUS_72280 1369 209 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683294.1 protein_id gnl|my_center|LOCUS_72280 >Feature sequence0772 940 1209 gene locus_tag LOCUS_72290 940 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 >Feature sequence0773 550 1065 gene locus_tag LOCUS_72300 550 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 >Feature sequence0774 728 1237 gene locus_tag LOCUS_72310 728 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 >Feature sequence0775 >Feature sequence0776 >Feature sequence0777 474 965 gene locus_tag LOCUS_72320 474 965 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 protein_id gnl|my_center|LOCUS_72320 1126 1323 gene locus_tag LOCUS_72330 1126 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72330 >Feature sequence0778 229 402 gene locus_tag LOCUS_72340 229 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 529 1242 gene locus_tag LOCUS_72350 529 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 >Feature sequence0779 >Feature sequence0780 504 199 gene locus_tag LOCUS_72360 504 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72360 1202 522 gene locus_tag LOCUS_72370 1202 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72370 >Feature sequence0781 768 610 gene locus_tag LOCUS_72380 768 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 1173 994 gene locus_tag LOCUS_72390 1173 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 >Feature sequence0782 <1 1287 gene locus_tag LOCUS_72400 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114759.1:efflux transporter outer membrane subunit >Feature sequence0783 >Feature sequence0784 573 1139 gene locus_tag LOCUS_72410 573 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72410 >Feature sequence0785 >Feature sequence0786 >Feature sequence0787 >Feature sequence0788 83 664 gene locus_tag LOCUS_72420 83 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72420 >Feature sequence0789 1247 681 gene locus_tag LOCUS_72430 1247 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72430 >Feature sequence0790 1175 210 gene locus_tag LOCUS_72440 1175 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 >Feature sequence0791 <1 603 gene locus_tag LOCUS_72450 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046116577.1:peptidylprolyl isomerase 600 1112 gene locus_tag LOCUS_72460 600 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72460 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 >Feature sequence0796 325 107 gene locus_tag LOCUS_72470 325 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 >Feature sequence0797 >Feature sequence0798 >Feature sequence0799 447 905 gene locus_tag LOCUS_72480 447 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 >Feature sequence0800 >Feature sequence0801 >Feature sequence0802 >Feature sequence0803 664 509 gene locus_tag LOCUS_72490 664 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 702 1070 gene locus_tag LOCUS_72500 702 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72500 >Feature sequence0804 467 652 gene locus_tag LOCUS_72510 467 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 921 1097 gene locus_tag LOCUS_72520 921 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 >Feature sequence0805 81 359 gene locus_tag LOCUS_72530 81 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72530 385 621 gene locus_tag LOCUS_72540 385 621 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_72540 >Feature sequence0806 >Feature sequence0807 53 343 gene locus_tag LOCUS_72550 gene ihfA 53 343 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097001.1 protein_id gnl|my_center|LOCUS_72550 >Feature sequence0808 1105 191 gene locus_tag LOCUS_72560 1105 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 >Feature sequence0809 455 198 gene locus_tag LOCUS_72570 455 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72570 848 603 gene locus_tag LOCUS_72580 848 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 1099 968 gene locus_tag LOCUS_72590 1099 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 >Feature sequence0810 503 859 gene locus_tag LOCUS_72600 gene rpsM 503 859 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417266.1 protein_id gnl|my_center|LOCUS_72600 >Feature sequence0811 1039 101 gene locus_tag LOCUS_72610 1039 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 >Feature sequence0812 336 869 gene locus_tag LOCUS_72620 336 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 >Feature sequence0813 >Feature sequence0814 <1 1110 gene locus_tag LOCUS_72630 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480910.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence0815 >Feature sequence0816 >Feature sequence0817 <1219 712 gene locus_tag LOCUS_72640 <1219 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946282.1:succinate--CoA ligase subunit alpha >Feature sequence0818 166 1041 gene locus_tag LOCUS_72650 166 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 192 836 gene locus_tag LOCUS_72660 192 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 >Feature sequence0822 <1 698 gene locus_tag LOCUS_72670 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141117.1:NADP-dependent phosphogluconate dehydrogenase >Feature sequence0823 1183 206 gene locus_tag LOCUS_72680 1183 206 CDS product DUF1679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 protein_id gnl|my_center|LOCUS_72680 >Feature sequence0824 279 1019 gene locus_tag LOCUS_72690 279 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72690 >Feature sequence0825 1101 145 gene locus_tag LOCUS_72700 1101 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 >Feature sequence0826 >Feature sequence0827 >Feature sequence0828 >Feature sequence0829 >Feature sequence0830 <1192 521 gene locus_tag LOCUS_72710 <1192 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816933.1:fumarate hydratase >Feature sequence0831 67 516 gene locus_tag LOCUS_72720 67 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 1101 580 gene locus_tag LOCUS_72730 1101 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_72730 >Feature sequence0832 >Feature sequence0833 642 1130 gene locus_tag LOCUS_72740 642 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 >Feature sequence0834 167 667 gene locus_tag LOCUS_72750 167 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 >Feature sequence0835 438 1151 gene locus_tag LOCUS_72760 438 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 >Feature sequence0836 >Feature sequence0837 >Feature sequence0838 >Feature sequence0839 >Feature sequence0840 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 >Feature sequence0844 <1160 511 gene locus_tag LOCUS_72770 <1160 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940811.1:porphobilinogen synthase >Feature sequence0845 <1157 550 gene locus_tag LOCUS_72780 <1157 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence0846 >Feature sequence0847 810 193 gene locus_tag LOCUS_72790 810 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 >Feature sequence0848 >Feature sequence0849 >Feature sequence0850 >Feature sequence0851 857 177 gene locus_tag LOCUS_72800 857 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72800 >Feature sequence0852 >Feature sequence0853 710 192 gene locus_tag LOCUS_72810 710 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72810 871 1128 gene locus_tag LOCUS_72820 871 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72820 >Feature sequence0854 <1 734 gene locus_tag LOCUS_72830 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119671.1:transposase >Feature sequence0855 260 742 gene locus_tag LOCUS_72840 260 742 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514470.1 protein_id gnl|my_center|LOCUS_72840 642 1052 gene locus_tag LOCUS_72850 642 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 >Feature sequence0856 128 289 gene locus_tag LOCUS_72860 128 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 <1133 330 gene locus_tag LOCUS_72870 <1133 330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141444.1:TldD/PmbA family protein >Feature sequence0857 <1132 60 gene locus_tag LOCUS_72880 <1132 60 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942106.1:proline--tRNA ligase >Feature sequence0858 >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 >Feature sequence0862 >Feature sequence0863 >Feature sequence0864 >Feature sequence0865 1046 30 gene locus_tag LOCUS_72890 gene plsX 1046 30 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_72890 >Feature sequence0866 >Feature sequence0867 602 252 gene locus_tag LOCUS_72900 602 252 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071541.1 protein_id gnl|my_center|LOCUS_72900 >Feature sequence0868 863 465 gene locus_tag LOCUS_72910 863 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72910 >Feature sequence0869 794 982 gene locus_tag LOCUS_72920 794 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 >Feature sequence0873 24 929 gene locus_tag LOCUS_72930 24 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72930 >Feature sequence0874 >Feature sequence0875 >Feature sequence0876 >Feature sequence0877 789 649 gene locus_tag LOCUS_72940 789 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 1055 792 gene locus_tag LOCUS_72950 1055 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72950 >Feature sequence0878 >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 >Feature sequence0882 436 272 gene locus_tag LOCUS_72960 436 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72960 >Feature sequence0883 238 993 gene locus_tag LOCUS_72970 238 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72970 >Feature sequence0884 136 423 gene locus_tag LOCUS_72980 136 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72980 426 863 gene locus_tag LOCUS_72990 426 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72990 >Feature sequence0885 900 625 gene locus_tag LOCUS_73000 900 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 >Feature sequence0886 >Feature sequence0887 1051 242 gene locus_tag LOCUS_73010 1051 242 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_73010 >Feature sequence0888 649 1053 gene locus_tag LOCUS_73020 649 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065260.1 protein_id gnl|my_center|LOCUS_73020 >Feature sequence0889 388 152 gene locus_tag LOCUS_73030 388 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_73030 801 385 gene locus_tag LOCUS_73040 801 385 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_73040 >Feature sequence0890 >Feature sequence0891 >Feature sequence0892 242 508 gene locus_tag LOCUS_73050 242 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73050 >Feature sequence0893 >Feature sequence0894 938 141 gene locus_tag LOCUS_73060 938 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73060 >Feature sequence0895 >Feature sequence0896 <1019 138 gene locus_tag LOCUS_73070 <1019 138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978799.1:nucleoside hydrolase >Feature sequence0897 >Feature sequence0898 >Feature sequence0899 >Feature sequence0900 >Feature sequence0901 >Feature sequence0902 >Feature sequence0903 >Feature sequence0904 >Feature sequence0905 <1 698 gene locus_tag LOCUS_73080 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084122.1:glucose 1-dehydrogenase >Feature sequence0906 >Feature sequence0907 >Feature sequence0908 371 138 gene locus_tag LOCUS_73090 371 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73090 455 676 gene locus_tag LOCUS_73100 455 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 >Feature sequence0909 <1 750 gene locus_tag LOCUS_73110 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082414.1:phenazine antibiotic biosynthesis protein >Feature sequence0910 <1 603 gene locus_tag LOCUS_73120 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455478.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) 972 616 gene locus_tag LOCUS_73130 972 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 >Feature sequence0911 >Feature sequence0912 137 793 gene locus_tag LOCUS_73140 137 793 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_73140 >Feature sequence0913 220 396 gene locus_tag LOCUS_73150 220 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 432 881 gene locus_tag LOCUS_73160 432 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221998.1 protein_id gnl|my_center|LOCUS_73160 >Feature sequence0914 >Feature sequence0915 >Feature sequence0916 <1 909 gene locus_tag LOCUS_73170 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921083.1:fructose-bisphosphate aldolase class II >Feature sequence0917 >Feature sequence0918 >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 >Feature sequence0922 >Feature sequence0923 164 949 gene locus_tag LOCUS_73180 164 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 >Feature sequence0924 >Feature sequence0925 >Feature sequence0926 >Feature sequence0927 458 102 gene locus_tag LOCUS_73190 458 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 618 460 gene locus_tag LOCUS_73200 618 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73200 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 915 127 gene locus_tag LOCUS_73210 915 127 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_73210 >Feature sequence0932 213 446 gene locus_tag LOCUS_73220 213 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 >Feature sequence0933 621 809 gene locus_tag LOCUS_73230 621 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 >Feature sequence0934 555 319 gene locus_tag LOCUS_73240 555 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 >Feature sequence0935 >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 <1 843 gene locus_tag LOCUS_73250 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948640.1:formate/nitrite transporter family protein >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 >Feature sequence0946 1 234 gene locus_tag LOCUS_73260 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 244 453 gene locus_tag LOCUS_73270 244 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73270 >Feature sequence0947 >Feature sequence0948 >Feature sequence0949 <919 391 gene locus_tag LOCUS_73280 <919 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974233.1:IS21 family transposase >Feature sequence0950 <1 561 gene locus_tag LOCUS_73290 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein >Feature sequence0951 <919 299 gene locus_tag LOCUS_73300 <919 299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246384.1:alpha/beta hydrolase >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 <908 391 gene locus_tag LOCUS_73310 <908 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142886.1:pentapeptide repeat-containing protein >Feature sequence0955 >Feature sequence0956 >Feature sequence0957 449 135 gene locus_tag LOCUS_73320 449 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73320 743 462 gene locus_tag LOCUS_73330 743 462 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_73330 >Feature sequence0958 <1 739 gene locus_tag LOCUS_73340 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461546.1:precorrin-3B C(17)-methyltransferase >Feature sequence0959 488 357 gene locus_tag LOCUS_73350 488 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73350 >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 >Feature sequence0963 564 307 gene locus_tag LOCUS_73360 564 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73360 >Feature sequence0964 786 622 gene locus_tag LOCUS_73370 786 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73370 >Feature sequence0965 >Feature sequence0966 >Feature sequence0967 >Feature sequence0968 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 >Feature sequence0973 >Feature sequence0974 706 29 gene locus_tag LOCUS_73380 706 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73380 >Feature sequence0975 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 <877 220 gene locus_tag LOCUS_73390 <877 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18TV3:trimethylamine methyltransferase MttB >Feature sequence0979 276 22 gene locus_tag LOCUS_73400 276 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 475 344 gene locus_tag LOCUS_73410 475 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73410 >Feature sequence0987 144 389 gene locus_tag LOCUS_73420 144 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 395 580 gene locus_tag LOCUS_73430 395 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 >Feature sequence0988 347 838 gene locus_tag LOCUS_73440 347 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73440 >Feature sequence0989 >Feature sequence0990 >Feature sequence0991 >Feature sequence0992 563 36 gene locus_tag LOCUS_73450 563 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73450 >Feature sequence0993 >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 39 755 gene locus_tag LOCUS_73460 gene rph 39 755 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_73460 >Feature sequence0999 >Feature sequence1000 >Feature sequence1001 90 347 gene locus_tag LOCUS_73470 90 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 >Feature sequence1002 >Feature sequence1003 >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 >Feature sequence1008 >Feature sequence1009 789 592 gene locus_tag LOCUS_73480 789 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 >Feature sequence1010 >Feature sequence1011 646 233 gene locus_tag LOCUS_73490 646 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 >Feature sequence1017 >Feature sequence1018 >Feature sequence1019 428 682 gene locus_tag LOCUS_73500 428 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 >Feature sequence1020 262 534 gene locus_tag LOCUS_73510 262 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 >Feature sequence1021 >Feature sequence1022 >Feature sequence1023 >Feature sequence1024 >Feature sequence1025 >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 >Feature sequence1029 287 475 gene locus_tag LOCUS_73520 287 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73520 477 659 gene locus_tag LOCUS_73530 477 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73530 >Feature sequence1030 >Feature sequence1031 185 63 gene locus_tag LOCUS_73540 185 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73540 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 24 617 gene locus_tag LOCUS_73550 24 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 3 479 gene locus_tag LOCUS_73560 3 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73560 >Feature sequence1042 462 109 gene locus_tag LOCUS_73570 462 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73570 >Feature sequence1043 >Feature sequence1044 >Feature sequence1045 <1 504 gene locus_tag LOCUS_73580 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970904.1:tyrosine-type recombinase/integrase >Feature sequence1046 657 145 gene locus_tag LOCUS_73590 657 145 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294661.1 protein_id gnl|my_center|LOCUS_73590 >Feature sequence1047 >Feature sequence1048 >Feature sequence1049 >Feature sequence1050 <713 194 gene locus_tag LOCUS_73600 <713 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence1051 >Feature sequence1052 >Feature sequence1053 <1 594 gene locus_tag LOCUS_73610 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024495.1:group II intron reverse transcriptase/maturase >Feature sequence1054 709 296 gene locus_tag LOCUS_73620 709 296 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_73620 >Feature sequence1055 657 175 gene locus_tag LOCUS_73630 657 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73630 >Feature sequence1056 >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 >Feature sequence1060 >Feature sequence1061 >Feature sequence1062 >Feature sequence1063 >Feature sequence1064 >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 >Feature sequence1072 >Feature sequence1073 >Feature sequence1074 >Feature sequence1075 >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 376 227 gene locus_tag LOCUS_73640 376 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73640 >Feature sequence1079 <1 601 gene locus_tag LOCUS_73650 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257549.1:response regulator >Feature sequence1080 >Feature sequence1081 90 227 gene locus_tag LOCUS_73660 90 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73660 >Feature sequence1082 >Feature sequence1083 >Feature sequence1084 >Feature sequence1085 >Feature sequence1086 >Feature sequence1087 >Feature sequence1088 >Feature sequence1089 89 241 gene locus_tag LOCUS_73670 89 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 >Feature sequence1090 >Feature sequence1091 89 18 gene locus_tag LOCUS_t01270 89 18 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 273 349 gene locus_tag LOCUS_t01280 273 349 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 526 454 gene locus_tag LOCUS_t01290 526 454 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 576 648 gene locus_tag LOCUS_t01300 576 648 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1092 >Feature sequence1093 >Feature sequence1094 222 632 gene locus_tag LOCUS_73680 222 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73680 >Feature sequence1095 412 540 gene locus_tag LOCUS_73690 412 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 >Feature sequence1096 >Feature sequence1097 523 173 gene locus_tag LOCUS_73700 523 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 >Feature sequence1098 >Feature sequence1099 365 610 gene locus_tag LOCUS_73710 365 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73710 >Feature sequence1100 >Feature sequence1101 >Feature sequence1102 >Feature sequence1103 >Feature sequence1104 204 599 gene locus_tag LOCUS_73720 204 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73720 >Feature sequence1105 >Feature sequence1106 >Feature sequence1107 293 162 gene locus_tag LOCUS_73730 293 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73730 >Feature sequence1108 >Feature sequence1109 >Feature sequence1110 >Feature sequence1111 >Feature sequence1112 >Feature sequence1113 <1 559 gene locus_tag LOCUS_73740 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928885.1:tetratricopeptide repeat protein >Feature sequence1114 >Feature sequence1115 467 625 gene locus_tag LOCUS_73750 467 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 >Feature sequence1116 >Feature sequence1117 586 425 gene locus_tag LOCUS_73760 586 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73760 >Feature sequence1118 >Feature sequence1119 >Feature sequence1120 >Feature sequence1121 >Feature sequence1122 >Feature sequence1123 >Feature sequence1124 31 102 gene locus_tag LOCUS_t01310 31 102 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1125 >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 168 359 gene locus_tag LOCUS_73770 168 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73770 >Feature sequence1129 493 251 gene locus_tag LOCUS_73780 493 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 >Feature sequence1130 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 3 215 gene locus_tag LOCUS_73790 3 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 >Feature sequence1138 >Feature sequence1139 >Feature sequence1140 200 445 gene locus_tag LOCUS_73800 200 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 >Feature sequence1141 >Feature sequence1142 >Feature sequence1143 >Feature sequence1144 >Feature sequence1145 >Feature sequence1146 >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 >Feature sequence1150 >Feature sequence1151 >Feature sequence1152 >Feature sequence1153 >Feature sequence1154 >Feature sequence1155 >Feature sequence1156 >Feature sequence1157 >Feature sequence1158 >Feature sequence1159 >Feature sequence1160 >Feature sequence1161 >Feature sequence1162 >Feature sequence1163 >Feature sequence1164 >Feature sequence1165 174 329 gene locus_tag LOCUS_73810 174 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73810 >Feature sequence1166 >Feature sequence1167 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 >Feature sequence1175 >Feature sequence1176 328 146 gene locus_tag LOCUS_73820 328 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 >Feature sequence1177 >Feature sequence1178 >Feature sequence1179 >Feature sequence1180 >Feature sequence1181 >Feature sequence1182 381 13 gene locus_tag LOCUS_73830 381 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 >Feature sequence1183 >Feature sequence1184 >Feature sequence1185 >Feature sequence1186 432 31 gene locus_tag LOCUS_73840 432 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 >Feature sequence1187 >Feature sequence1188 >Feature sequence1189 >Feature sequence1190 >Feature sequence1191 >Feature sequence1192 >Feature sequence1193 >Feature sequence1194 >Feature sequence1195 >Feature sequence1196 >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 >Feature sequence1200 >Feature sequence1201 >Feature sequence1202 352 206 gene locus_tag LOCUS_73850 352 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 >Feature sequence1203 >Feature sequence1204 >Feature sequence1205 >Feature sequence1206 >Feature sequence1207 >Feature sequence1208 >Feature sequence1209 >Feature sequence1210 >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 >Feature sequence1214 >Feature sequence1215 >Feature sequence1216 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 >Feature sequence1220 >Feature sequence1221 >Feature sequence1222