>Feature sequence001 1490 543 gene locus_tag LOCUS_00010 1490 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3699 1570 gene locus_tag LOCUS_00020 3699 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 7910 3834 gene locus_tag LOCUS_00030 7910 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 8278 10314 gene locus_tag LOCUS_00040 gene ygjK 8278 10314 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_00040 11465 10611 gene locus_tag LOCUS_00050 11465 10611 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_00050 12742 11483 gene locus_tag LOCUS_00060 12742 11483 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_00060 15382 12773 gene locus_tag LOCUS_00070 15382 12773 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_00070 15579 18518 gene locus_tag LOCUS_00080 15579 18518 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_00080 18526 19998 gene locus_tag LOCUS_00090 gene fucP 18526 19998 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_00090 20136 20948 gene locus_tag LOCUS_00100 20136 20948 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_00100 21124 21936 gene locus_tag LOCUS_00110 21124 21936 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_00110 21899 22153 gene locus_tag LOCUS_00120 21899 22153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 22116 22310 gene locus_tag LOCUS_00130 22116 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 22418 22663 gene locus_tag LOCUS_00140 22418 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22682 25249 gene locus_tag LOCUS_00150 22682 25249 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_00150 25573 26979 gene locus_tag LOCUS_00160 25573 26979 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097214.1 protein_id gnl|my_center|LOCUS_00160 27492 27064 gene locus_tag LOCUS_00170 27492 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 29716 27566 gene locus_tag LOCUS_00180 29716 27566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 30178 30609 gene locus_tag LOCUS_00190 30178 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 31597 30791 gene locus_tag LOCUS_00200 gene agaR 31597 30791 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_00200 31805 33007 gene locus_tag LOCUS_00210 31805 33007 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 1989 964 gene locus_tag LOCUS_00220 gene obgE 1989 964 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_00220 2999 2046 gene locus_tag LOCUS_00230 2999 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 3872 3027 gene locus_tag LOCUS_00240 gene murI 3872 3027 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_00240 5422 3992 gene locus_tag LOCUS_00250 5422 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 5695 6465 gene locus_tag LOCUS_00260 5695 6465 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00260 6466 6600 gene locus_tag LOCUS_00270 6466 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6597 7862 gene locus_tag LOCUS_00280 6597 7862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_00280 8976 7936 gene locus_tag LOCUS_00290 8976 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 12539 9024 gene locus_tag LOCUS_00300 12539 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 15560 12594 gene locus_tag LOCUS_00310 15560 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 19211 15897 gene locus_tag LOCUS_00320 19211 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 19387 19208 gene locus_tag LOCUS_00330 19387 19208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 22051 19532 gene locus_tag LOCUS_00340 22051 19532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 23166 22147 gene locus_tag LOCUS_00350 23166 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 26470 23252 gene locus_tag LOCUS_00360 26470 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 29220 26485 gene locus_tag LOCUS_00370 29220 26485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 31661 29481 gene locus_tag LOCUS_00380 31661 29481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence003 <1 882 gene locus_tag LOCUS_00390 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973447.1:DSD1 family PLP-dependent enzyme 903 1286 gene locus_tag LOCUS_00400 903 1286 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262045.1 protein_id gnl|my_center|LOCUS_00400 3198 1315 gene locus_tag LOCUS_00410 3198 1315 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_00410 3866 3252 gene locus_tag LOCUS_00420 3866 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 3987 8168 gene locus_tag LOCUS_00430 3987 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8217 9122 gene locus_tag LOCUS_00440 8217 9122 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_00440 9164 10966 gene locus_tag LOCUS_00450 9164 10966 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_00450 10963 11580 gene locus_tag LOCUS_00460 gene plsY 10963 11580 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_00460 12997 11621 gene locus_tag LOCUS_00470 12997 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 13385 12990 gene locus_tag LOCUS_00480 13385 12990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 14774 13479 gene locus_tag LOCUS_00490 14774 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 15441 14794 gene locus_tag LOCUS_00500 15441 14794 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080648.1 protein_id gnl|my_center|LOCUS_00500 15956 15477 gene locus_tag LOCUS_00510 15956 15477 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_00510 17128 16019 gene locus_tag LOCUS_00520 17128 16019 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_00520 20438 17247 gene locus_tag LOCUS_00530 gene carB 20438 17247 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_00530 21846 20677 gene locus_tag LOCUS_00540 gene carA 21846 20677 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_00540 22530 21952 gene locus_tag LOCUS_00550 22530 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 22669 23115 gene locus_tag LOCUS_00560 22669 23115 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_00560 23582 25042 gene locus_tag LOCUS_00570 23582 25042 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088214.1 protein_id gnl|my_center|LOCUS_00570 25592 25095 gene locus_tag LOCUS_00580 25592 25095 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329720.1 protein_id gnl|my_center|LOCUS_00580 28930 25607 gene locus_tag LOCUS_00590 28930 25607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 29376 30392 gene locus_tag LOCUS_00600 29376 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 31649 30456 gene locus_tag LOCUS_00610 31649 30456 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872211.1 protein_id gnl|my_center|LOCUS_00610 32975 31734 gene locus_tag LOCUS_00620 32975 31734 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_00620 >Feature sequence004 175 1188 gene locus_tag LOCUS_00630 gene plsX 175 1188 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_00630 1181 2191 gene locus_tag LOCUS_00640 1181 2191 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_00640 2348 3274 gene locus_tag LOCUS_00650 gene fabD 2348 3274 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_00650 3271 4014 gene locus_tag LOCUS_00660 gene fabG 3271 4014 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_00660 4057 4290 gene locus_tag LOCUS_00670 gene acpP 4057 4290 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_00670 4559 5800 gene locus_tag LOCUS_00680 gene fabF 4559 5800 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412652.1 protein_id gnl|my_center|LOCUS_00680 5856 6659 gene locus_tag LOCUS_00690 gene rncS 5856 6659 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_00690 6874 8142 gene locus_tag LOCUS_00700 6874 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8203 9330 gene locus_tag LOCUS_00710 8203 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9337 10590 gene locus_tag LOCUS_00720 9337 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10590 12023 gene locus_tag LOCUS_00730 10590 12023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12020 13162 gene locus_tag LOCUS_00740 12020 13162 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_00740 13444 14244 gene locus_tag LOCUS_00750 13444 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 14362 15390 gene locus_tag LOCUS_00760 14362 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 15383 17086 gene locus_tag LOCUS_00770 15383 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 17299 19743 gene locus_tag LOCUS_00780 17299 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 19769 21106 gene locus_tag LOCUS_00790 gene clcA 19769 21106 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_00790 21156 21638 gene locus_tag LOCUS_00800 21156 21638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 22038 22481 gene locus_tag LOCUS_00810 22038 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 22828 22415 gene locus_tag LOCUS_00820 22828 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 24283 22838 gene locus_tag LOCUS_00830 24283 22838 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_00830 25645 24293 gene locus_tag LOCUS_00840 gene trkA 25645 24293 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_00840 26684 25653 gene locus_tag LOCUS_00850 26684 25653 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_00850 28424 26844 gene locus_tag LOCUS_00860 28424 26844 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_00860 28670 31141 gene locus_tag LOCUS_00870 28670 31141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 31340 32494 gene locus_tag LOCUS_00880 31340 32494 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence005 1033 125 gene locus_tag LOCUS_00890 gene porV 1033 125 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_00890 2117 1098 gene locus_tag LOCUS_00900 2117 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 3587 2133 gene locus_tag LOCUS_00910 3587 2133 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_00910 4839 3628 gene locus_tag LOCUS_00920 4839 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5746 4862 gene locus_tag LOCUS_00930 5746 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6699 5797 gene locus_tag LOCUS_00940 6699 5797 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_00940 12969 6712 gene locus_tag LOCUS_00950 12969 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13236 14690 gene locus_tag LOCUS_00960 13236 14690 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_00960 14702 15778 gene locus_tag LOCUS_00970 14702 15778 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838596.1 protein_id gnl|my_center|LOCUS_00970 16375 15836 gene locus_tag LOCUS_00980 16375 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 16840 16403 gene locus_tag LOCUS_00990 16840 16403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00990 17389 16961 gene locus_tag LOCUS_01000 17389 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01000 18038 17424 gene locus_tag LOCUS_01010 gene rpsD 18038 17424 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_01010 18450 18058 gene locus_tag LOCUS_01020 gene rpsK 18450 18058 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_01020 18839 18468 gene locus_tag LOCUS_01030 gene rpsM 18839 18468 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_01030 19217 18996 gene locus_tag LOCUS_01040 gene infA 19217 18996 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_01040 19984 19235 gene locus_tag LOCUS_01050 gene map 19984 19235 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01050 21320 19995 gene locus_tag LOCUS_01060 gene secY 21320 19995 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_01060 21757 21317 gene locus_tag LOCUS_01070 gene rplO 21757 21317 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_01070 21967 21773 gene locus_tag LOCUS_01080 gene rpmD 21967 21773 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596229.1 protein_id gnl|my_center|LOCUS_01080 22498 21992 gene locus_tag LOCUS_01090 gene rpsE 22498 21992 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_01090 22849 22517 gene locus_tag LOCUS_01100 gene rplR 22849 22517 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258247.1 protein_id gnl|my_center|LOCUS_01100 23410 22868 gene locus_tag LOCUS_01110 gene rplF 23410 22868 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933827.1 protein_id gnl|my_center|LOCUS_01110 23833 23435 gene locus_tag LOCUS_01120 gene rpsH 23833 23435 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01120 24614 24054 gene locus_tag LOCUS_01130 gene rplE 24614 24054 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_01130 24969 24637 gene locus_tag LOCUS_01140 gene rplX 24969 24637 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_01140 25358 24990 gene locus_tag LOCUS_01150 gene rplN 25358 24990 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_01150 25646 25371 gene locus_tag LOCUS_01160 gene rpsQ 25646 25371 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01160 25860 25639 gene locus_tag LOCUS_01170 25860 25639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 26283 25876 gene locus_tag LOCUS_01180 gene rplP 26283 25876 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_01180 26927 26295 gene locus_tag LOCUS_01190 gene rpsC 26927 26295 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_01190 27298 26957 gene locus_tag LOCUS_01200 gene rplV 27298 26957 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776372.1 protein_id gnl|my_center|LOCUS_01200 27604 27317 gene locus_tag LOCUS_01210 gene rpsS 27604 27317 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_01210 28443 27619 gene locus_tag LOCUS_01220 gene rplB 28443 27619 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_01220 28758 28462 gene locus_tag LOCUS_01230 gene rplW 28758 28462 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933840.1 protein_id gnl|my_center|LOCUS_01230 29384 28755 gene locus_tag LOCUS_01240 gene rplD 29384 28755 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_01240 30021 29404 gene locus_tag LOCUS_01250 gene rplC 30021 29404 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_01250 30359 30051 gene locus_tag LOCUS_01260 gene rpsJ 30359 30051 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence006 1442 711 gene locus_tag LOCUS_01270 gene truA 1442 711 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_01270 3808 1586 gene locus_tag LOCUS_01280 gene ccsA 3808 1586 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_01280 4176 3805 gene locus_tag LOCUS_01290 4176 3805 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256827.1 protein_id gnl|my_center|LOCUS_01290 5001 4342 gene locus_tag LOCUS_01300 5001 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5706 5047 gene locus_tag LOCUS_01310 5706 5047 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_01310 6313 5699 gene locus_tag LOCUS_01320 gene ccmA 6313 5699 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_01320 9285 6631 gene locus_tag LOCUS_01330 9285 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 11199 9667 gene locus_tag LOCUS_01340 11199 9667 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_01340 11755 11336 gene locus_tag LOCUS_01350 11755 11336 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_01350 13084 11915 gene locus_tag LOCUS_01360 13084 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 13407 13024 gene locus_tag LOCUS_01370 13407 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 14059 13565 gene locus_tag LOCUS_01380 14059 13565 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_01380 14469 14059 gene locus_tag LOCUS_01390 14469 14059 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_01390 15650 14493 gene locus_tag LOCUS_01400 15650 14493 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_01400 16770 15661 gene locus_tag LOCUS_01410 16770 15661 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_01410 17477 16746 gene locus_tag LOCUS_01420 17477 16746 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946447.1 protein_id gnl|my_center|LOCUS_01420 18458 17496 gene locus_tag LOCUS_01430 18458 17496 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897260.1 protein_id gnl|my_center|LOCUS_01430 20054 18465 gene locus_tag LOCUS_01440 20054 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 21588 20317 gene locus_tag LOCUS_01450 21588 20317 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_01450 23051 21585 gene locus_tag LOCUS_01460 23051 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 24516 23230 gene locus_tag LOCUS_01470 24516 23230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 26276 24669 gene locus_tag LOCUS_01480 26276 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 26798 27247 gene locus_tag LOCUS_01490 26798 27247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence007 267 1271 gene locus_tag LOCUS_01500 gene purR 267 1271 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201014.1 protein_id gnl|my_center|LOCUS_01500 1347 3254 gene locus_tag LOCUS_01510 1347 3254 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145060936.1 protein_id gnl|my_center|LOCUS_01510 3417 5369 gene locus_tag LOCUS_01520 3417 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5608 8262 gene locus_tag LOCUS_01530 5608 8262 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_01530 8323 9777 gene locus_tag LOCUS_01540 8323 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10066 10740 gene locus_tag LOCUS_01550 10066 10740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 10882 14025 gene locus_tag LOCUS_01560 10882 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 14083 16197 gene locus_tag LOCUS_01570 14083 16197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16213 17208 gene locus_tag LOCUS_01580 gene porQ 16213 17208 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_01580 17226 18452 gene locus_tag LOCUS_01590 17226 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 18519 19478 gene locus_tag LOCUS_01600 18519 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 19631 21163 gene locus_tag LOCUS_01610 19631 21163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 21175 22434 gene locus_tag LOCUS_01620 21175 22434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 22469 23494 gene locus_tag LOCUS_01630 22469 23494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 24284 23505 gene locus_tag LOCUS_01640 24284 23505 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886798.1 protein_id gnl|my_center|LOCUS_01640 25707 24394 gene locus_tag LOCUS_01650 gene acdA 25707 24394 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_01650 26849 25707 gene locus_tag LOCUS_01660 26849 25707 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770780.1 protein_id gnl|my_center|LOCUS_01660 28165 27476 gene locus_tag LOCUS_01670 28165 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 28394 28209 gene locus_tag LOCUS_01680 28394 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence008 1278 511 gene locus_tag LOCUS_01690 1278 511 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_01690 2676 1378 gene locus_tag LOCUS_01700 2676 1378 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_01700 2810 3787 gene locus_tag LOCUS_01710 2810 3787 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257574.1 protein_id gnl|my_center|LOCUS_01710 5135 3798 gene locus_tag LOCUS_01720 5135 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 5399 5614 gene locus_tag LOCUS_01730 5399 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 5645 6850 gene locus_tag LOCUS_01740 5645 6850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096548.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01740 7253 9466 gene locus_tag LOCUS_01750 7253 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9726 10187 gene locus_tag LOCUS_01760 gene smpB 9726 10187 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_01760 10358 11572 gene locus_tag LOCUS_01770 gene tyrS 10358 11572 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_01770 12435 11599 gene locus_tag LOCUS_01780 12435 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 13627 12518 gene locus_tag LOCUS_01790 gene alr 13627 12518 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396112.1 protein_id gnl|my_center|LOCUS_01790 14890 13631 gene locus_tag LOCUS_01800 gene lysA 14890 13631 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_01800 15598 15023 gene locus_tag LOCUS_01810 15598 15023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 16360 15677 gene locus_tag LOCUS_01820 16360 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01820 16605 18755 gene locus_tag LOCUS_01830 16605 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 18898 20796 gene locus_tag LOCUS_01840 18898 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20924 21880 gene locus_tag LOCUS_01850 20924 21880 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_01850 23561 21966 gene locus_tag LOCUS_01860 23561 21966 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_01860 25285 23690 gene locus_tag LOCUS_01870 25285 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 26578 25298 gene locus_tag LOCUS_01880 gene hflX 26578 25298 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_01880 27575 26757 gene locus_tag LOCUS_01890 27575 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01890 28061 27621 gene locus_tag LOCUS_01900 28061 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01900 28451 28191 gene locus_tag LOCUS_01910 28451 28191 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143646.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence009 558 2783 gene locus_tag LOCUS_01920 gene topA 558 2783 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_01920 2850 3749 gene locus_tag LOCUS_01930 gene xerC 2850 3749 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765425.1 protein_id gnl|my_center|LOCUS_01930 3773 4093 gene locus_tag LOCUS_01940 3773 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4190 5176 gene locus_tag LOCUS_01950 gene hprK 4190 5176 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_01950 5173 5559 gene locus_tag LOCUS_01960 5173 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5567 6043 gene locus_tag LOCUS_01970 5567 6043 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_01970 6063 6938 gene locus_tag LOCUS_01980 6063 6938 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_01980 7006 7079 gene locus_tag LOCUS_t00010 7006 7079 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7246 8103 gene locus_tag LOCUS_01990 7246 8103 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817227.1 protein_id gnl|my_center|LOCUS_01990 8291 9331 gene locus_tag LOCUS_02000 8291 9331 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230352.1 protein_id gnl|my_center|LOCUS_02000 9362 12046 gene locus_tag LOCUS_02010 9362 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12068 13159 gene locus_tag LOCUS_02020 12068 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 13213 13431 gene locus_tag LOCUS_02030 13213 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 13498 15090 gene locus_tag LOCUS_02040 13498 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 15098 16129 gene locus_tag LOCUS_02050 15098 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 16177 17844 gene locus_tag LOCUS_02060 16177 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 18007 19554 gene locus_tag LOCUS_02070 18007 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 19556 19741 gene locus_tag LOCUS_02080 19556 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 19890 21302 gene locus_tag LOCUS_02090 gene nhaC 19890 21302 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261868.1 protein_id gnl|my_center|LOCUS_02090 21328 22668 gene locus_tag LOCUS_02100 21328 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 22862 25474 gene locus_tag LOCUS_02110 22862 25474 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_02110 26783 25593 gene locus_tag LOCUS_02120 26783 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 <27532 26786 gene locus_tag LOCUS_02130 <27532 26786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942079.1:tetratricopeptide repeat protein >Feature sequence010 368 868 gene locus_tag LOCUS_02140 368 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1148 4093 gene locus_tag LOCUS_02150 1148 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 4157 6145 gene locus_tag LOCUS_02160 4157 6145 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023875.1 protein_id gnl|my_center|LOCUS_02160 6164 6802 gene locus_tag LOCUS_02170 6164 6802 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_02170 7124 8209 gene locus_tag LOCUS_02180 7124 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 13153 8285 gene locus_tag LOCUS_02190 13153 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 14248 13466 gene locus_tag LOCUS_02200 14248 13466 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942203.1 protein_id gnl|my_center|LOCUS_02200 14838 14404 gene locus_tag LOCUS_02210 14838 14404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 15297 14872 gene locus_tag LOCUS_02220 15297 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 16648 15719 gene locus_tag LOCUS_02230 16648 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 18305 16794 gene locus_tag LOCUS_02240 18305 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 19966 18911 gene locus_tag LOCUS_02250 19966 18911 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_02250 21014 19977 gene locus_tag LOCUS_02260 21014 19977 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121661.1 protein_id gnl|my_center|LOCUS_02260 22280 21057 gene locus_tag LOCUS_02270 22280 21057 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_02270 23870 22296 gene locus_tag LOCUS_02280 23870 22296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 24386 23907 gene locus_tag LOCUS_02290 24386 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence011 <1 2626 gene locus_tag LOCUS_02300 <1 2626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein 3630 2659 gene locus_tag LOCUS_02310 3630 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3865 3686 gene locus_tag LOCUS_02320 3865 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02320 5302 3926 gene locus_tag LOCUS_02330 5302 3926 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02330 5626 5339 gene locus_tag LOCUS_02340 gene gatC 5626 5339 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_02340 6676 5762 gene locus_tag LOCUS_02350 6676 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7757 6810 gene locus_tag LOCUS_02360 7757 6810 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_02360 8751 7819 gene locus_tag LOCUS_02370 8751 7819 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_02370 9217 8903 gene locus_tag LOCUS_02380 9217 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 9492 9214 gene locus_tag LOCUS_02390 9492 9214 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_02390 9764 9489 gene locus_tag LOCUS_02400 9764 9489 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_02400 10952 9783 gene locus_tag LOCUS_02410 10952 9783 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_02410 11909 10974 gene locus_tag LOCUS_02420 11909 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12287 12081 gene locus_tag LOCUS_02430 12287 12081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13243 12341 gene locus_tag LOCUS_02440 13243 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 19249 13430 gene locus_tag LOCUS_02450 19249 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 21452 19404 gene locus_tag LOCUS_02460 21452 19404 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_02460 21644 22861 gene locus_tag LOCUS_02470 21644 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 22945 24144 gene locus_tag LOCUS_02480 22945 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence012 <1 1506 gene locus_tag LOCUS_02490 <1 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter 1553 1894 gene locus_tag LOCUS_02500 1553 1894 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_02500 2638 4224 gene locus_tag LOCUS_02510 2638 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4844 5434 gene locus_tag LOCUS_02520 4844 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5434 6246 gene locus_tag LOCUS_02530 5434 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6259 7386 gene locus_tag LOCUS_02540 6259 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142454231.1 protein_id gnl|my_center|LOCUS_02540 7431 8591 gene locus_tag LOCUS_02550 7431 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 9029 8751 gene locus_tag LOCUS_02560 9029 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10190 9054 gene locus_tag LOCUS_02570 10190 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10640 10227 gene locus_tag LOCUS_02580 10640 10227 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086272.1 protein_id gnl|my_center|LOCUS_02580 11335 12525 gene locus_tag LOCUS_02590 11335 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 12575 13762 gene locus_tag LOCUS_02600 12575 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13777 14397 gene locus_tag LOCUS_02610 13777 14397 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272276.1 protein_id gnl|my_center|LOCUS_02610 14540 14713 gene locus_tag LOCUS_02620 14540 14713 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_02620 14790 16505 gene locus_tag LOCUS_02630 gene ptsI 14790 16505 CDS product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623159.1 protein_id gnl|my_center|LOCUS_02630 16586 16765 gene locus_tag LOCUS_02640 16586 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 16793 17056 gene locus_tag LOCUS_02650 16793 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17097 17567 gene locus_tag LOCUS_02660 17097 17567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18939 17686 gene locus_tag LOCUS_02670 18939 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 19361 19747 gene locus_tag LOCUS_02680 19361 19747 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_02680 19852 20067 gene locus_tag LOCUS_02690 19852 20067 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence013 674 18 gene locus_tag LOCUS_02700 674 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1926 940 gene locus_tag LOCUS_02710 1926 940 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_02710 2652 2122 gene locus_tag LOCUS_02720 2652 2122 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_02720 2998 2912 gene locus_tag LOCUS_t00020 2998 2912 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3395 3006 gene locus_tag LOCUS_02730 3395 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4238 3456 gene locus_tag LOCUS_02740 gene tpiA 4238 3456 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_02740 5242 4259 gene locus_tag LOCUS_02750 5242 4259 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02750 5455 5246 gene locus_tag LOCUS_02760 5455 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02760 6828 5827 gene locus_tag LOCUS_02770 gene gap 6828 5827 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_02770 8658 7129 gene locus_tag LOCUS_02780 8658 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 9135 10448 gene locus_tag LOCUS_02790 9135 10448 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_02790 10458 11234 gene locus_tag LOCUS_02800 10458 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 11234 11806 gene locus_tag LOCUS_02810 gene yjjX 11234 11806 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_02810 11973 13001 gene locus_tag LOCUS_02820 gene add 11973 13001 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838307.1 protein_id gnl|my_center|LOCUS_02820 13436 13197 gene locus_tag LOCUS_02830 13436 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 15124 13529 gene locus_tag LOCUS_02840 gene bshC 15124 13529 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_02840 15879 15049 gene locus_tag LOCUS_02850 15879 15049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_02850 16837 15857 gene locus_tag LOCUS_02860 16837 15857 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_02860 17129 18316 gene locus_tag LOCUS_02870 17129 18316 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_02870 18617 19780 gene locus_tag LOCUS_02880 18617 19780 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_02880 <21256 19880 gene locus_tag LOCUS_02890 <21256 19880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence014 <1 1749 gene locus_tag LOCUS_02900 <1 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108531.1:hybrid sensor histidine kinase/response regulator transcription factor 1839 2426 gene locus_tag LOCUS_02910 1839 2426 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_02910 2413 2874 gene locus_tag LOCUS_02920 2413 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2871 3191 gene locus_tag LOCUS_02930 2871 3191 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582838.1 protein_id gnl|my_center|LOCUS_02930 3362 4705 gene locus_tag LOCUS_02940 3362 4705 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148136891.1 protein_id gnl|my_center|LOCUS_02940 4912 5358 gene locus_tag LOCUS_02950 4912 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5466 6161 gene locus_tag LOCUS_02960 gene bshB1 5466 6161 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_02960 6194 6646 gene locus_tag LOCUS_02970 6194 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6639 7529 gene locus_tag LOCUS_02980 gene xerD 6639 7529 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_02980 8185 7586 gene locus_tag LOCUS_02990 8185 7586 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948225.1 protein_id gnl|my_center|LOCUS_02990 8737 8207 gene locus_tag LOCUS_03000 8737 8207 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203641.1 protein_id gnl|my_center|LOCUS_03000 10587 8740 gene locus_tag LOCUS_03010 10587 8740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_03010 11351 10611 gene locus_tag LOCUS_03020 11351 10611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_03020 11837 11364 gene locus_tag LOCUS_03030 11837 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12650 12231 gene locus_tag LOCUS_03040 gene nikR 12650 12231 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_03040 12827 13192 gene locus_tag LOCUS_03050 12827 13192 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_03050 13182 13613 gene locus_tag LOCUS_03060 13182 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13788 15131 gene locus_tag LOCUS_03070 13788 15131 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_03070 15170 16150 gene locus_tag LOCUS_03080 15170 16150 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_03080 16316 19417 gene locus_tag LOCUS_03090 16316 19417 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_03090 19552 19893 gene locus_tag LOCUS_03100 19552 19893 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_03100 20075 20641 gene locus_tag LOCUS_03110 20075 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 20736 21077 gene locus_tag LOCUS_03120 20736 21077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03120 >Feature sequence015 1882 2646 gene locus_tag LOCUS_03130 1882 2646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357819.1 protein_id gnl|my_center|LOCUS_03130 2694 3077 gene locus_tag LOCUS_03140 2694 3077 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_03140 3149 3925 gene locus_tag LOCUS_03150 3149 3925 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_03150 4065 4601 gene locus_tag LOCUS_03160 4065 4601 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_03160 4725 5093 gene locus_tag LOCUS_03170 4725 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5166 6362 gene locus_tag LOCUS_03180 5166 6362 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_03180 6547 7359 gene locus_tag LOCUS_03190 6547 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 7317 7982 gene locus_tag LOCUS_03200 7317 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 8164 8733 gene locus_tag LOCUS_03210 gene amrA 8164 8733 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_03210 8730 9662 gene locus_tag LOCUS_03220 8730 9662 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_03220 10084 9677 gene locus_tag LOCUS_03230 10084 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10727 12049 gene locus_tag LOCUS_03240 10727 12049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_03240 12050 12517 gene locus_tag LOCUS_03250 12050 12517 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258016.1 protein_id gnl|my_center|LOCUS_03250 12792 12598 gene locus_tag LOCUS_03260 12792 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14028 12793 gene locus_tag LOCUS_03270 14028 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 14753 14232 gene locus_tag LOCUS_03280 14753 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 15554 14952 gene locus_tag LOCUS_03290 15554 14952 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_03290 16650 15634 gene locus_tag LOCUS_03300 16650 15634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 18108 16906 gene locus_tag LOCUS_03310 18108 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 19840 18395 gene locus_tag LOCUS_03320 19840 18395 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_03320 20711 19902 gene locus_tag LOCUS_03330 20711 19902 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence016 384 1751 gene locus_tag LOCUS_03340 384 1751 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_03340 1732 2388 gene locus_tag LOCUS_03350 1732 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2657 4999 gene locus_tag LOCUS_03360 2657 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5002 6723 gene locus_tag LOCUS_03370 gene recN 5002 6723 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933282.1 protein_id gnl|my_center|LOCUS_03370 6810 7469 gene locus_tag LOCUS_03380 6810 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7694 8734 gene locus_tag LOCUS_03390 7694 8734 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971088.1 protein_id gnl|my_center|LOCUS_03390 8856 9728 gene locus_tag LOCUS_03400 gene cas6 8856 9728 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_03400 9988 12852 gene locus_tag LOCUS_03410 9988 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 12975 13658 gene locus_tag LOCUS_03420 12975 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 13674 14450 gene locus_tag LOCUS_03430 13674 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 14447 14713 gene locus_tag LOCUS_03440 14447 14713 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_03440 14703 16469 gene locus_tag LOCUS_03450 gene ptsP 14703 16469 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494171.1 protein_id gnl|my_center|LOCUS_03450 16480 17208 gene locus_tag LOCUS_03460 16480 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03460 17157 17519 gene locus_tag LOCUS_03470 17157 17519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 17933 19078 gene locus_tag LOCUS_03480 gene metK 17933 19078 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence017 782 27 gene locus_tag LOCUS_03490 782 27 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_03490 1888 785 gene locus_tag LOCUS_03500 1888 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2994 1885 gene locus_tag LOCUS_03510 2994 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_03510 3151 4158 gene locus_tag LOCUS_03520 3151 4158 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_03520 4242 4586 gene locus_tag LOCUS_03530 4242 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4734 6086 gene locus_tag LOCUS_03540 gene glmM 4734 6086 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_03540 6273 6551 gene locus_tag LOCUS_03550 6273 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6610 7437 gene locus_tag LOCUS_03560 gene deoC 6610 7437 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_03560 7454 8776 gene locus_tag LOCUS_03570 7454 8776 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_03570 8782 9576 gene locus_tag LOCUS_03580 gene rsgA 8782 9576 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 protein_id gnl|my_center|LOCUS_03580 9714 10223 gene locus_tag LOCUS_03590 9714 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10337 10816 gene locus_tag LOCUS_03600 10337 10816 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_03600 10863 11411 gene locus_tag LOCUS_03610 10863 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 11446 13407 gene locus_tag LOCUS_03620 gene nosZ 11446 13407 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_03620 13486 14073 gene locus_tag LOCUS_03630 13486 14073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 14077 14514 gene locus_tag LOCUS_03640 14077 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 14664 14954 gene locus_tag LOCUS_03650 14664 14954 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_03650 14944 15267 gene locus_tag LOCUS_03660 14944 15267 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_03660 15357 16613 gene locus_tag LOCUS_03670 15357 16613 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_03670 16600 17307 gene locus_tag LOCUS_03680 16600 17307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_03680 17300 18082 gene locus_tag LOCUS_03690 17300 18082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 18176 19642 gene locus_tag LOCUS_03700 18176 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 19669 20559 gene locus_tag LOCUS_03710 19669 20559 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence018 <1 2493 gene locus_tag LOCUS_03720 <1 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203196.1:carboxypeptidase-like regulatory domain-containing protein 2459 3679 gene locus_tag LOCUS_03730 2459 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3716 5218 gene locus_tag LOCUS_03740 3716 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5282 7051 gene locus_tag LOCUS_03750 5282 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7088 7900 gene locus_tag LOCUS_03760 7088 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7982 10207 gene locus_tag LOCUS_03770 7982 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311265.1 protein_id gnl|my_center|LOCUS_03770 10268 11158 gene locus_tag LOCUS_03780 10268 11158 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767082.1 protein_id gnl|my_center|LOCUS_03780 11169 11837 gene locus_tag LOCUS_03790 11169 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789206.1 protein_id gnl|my_center|LOCUS_03790 11837 12853 gene locus_tag LOCUS_03800 11837 12853 CDS product DUF4857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203193.1 protein_id gnl|my_center|LOCUS_03800 13104 15029 gene locus_tag LOCUS_03810 13104 15029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 15168 16262 gene locus_tag LOCUS_03820 15168 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 16513 16755 gene locus_tag LOCUS_03830 16513 16755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 16782 18059 gene locus_tag LOCUS_03840 16782 18059 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_03840 18099 18896 gene locus_tag LOCUS_03850 18099 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 <19843 18886 gene locus_tag LOCUS_03860 <19843 18886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258696.1:pyridoxal-dependent decarboxylase >Feature sequence019 4167 3757 gene locus_tag LOCUS_03870 4167 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 4364 4164 gene locus_tag LOCUS_03880 4364 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5982 4603 gene locus_tag LOCUS_03890 5982 4603 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_03890 6290 5994 gene locus_tag LOCUS_03900 6290 5994 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_03900 7446 6292 gene locus_tag LOCUS_03910 7446 6292 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_03910 7792 9021 gene locus_tag LOCUS_03920 7792 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 8925 9386 gene locus_tag LOCUS_03930 8925 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9350 10150 gene locus_tag LOCUS_03940 9350 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 10468 12204 gene locus_tag LOCUS_03950 10468 12204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 12218 12421 gene locus_tag LOCUS_03960 12218 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 12424 13323 gene locus_tag LOCUS_03970 12424 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 13320 14456 gene locus_tag LOCUS_03980 13320 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 14527 15381 gene locus_tag LOCUS_03990 14527 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 15378 16892 gene locus_tag LOCUS_04000 15378 16892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_04000 16938 18020 gene locus_tag LOCUS_04010 16938 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 18035 19174 gene locus_tag LOCUS_04020 18035 19174 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_04020 19722 19471 gene locus_tag LOCUS_04030 19722 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence020 327 536 gene locus_tag LOCUS_04040 327 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04040 780 1133 gene locus_tag LOCUS_04050 780 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04050 1161 1799 gene locus_tag LOCUS_04060 1161 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04060 2120 3091 gene locus_tag LOCUS_04070 2120 3091 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680329.1 protein_id gnl|my_center|LOCUS_04070 3385 4059 gene locus_tag LOCUS_04080 3385 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4188 5000 gene locus_tag LOCUS_04090 4188 5000 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808840.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04090 5010 5159 gene locus_tag LOCUS_04100 5010 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5448 6446 gene locus_tag LOCUS_04110 5448 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455036.1 protein_id gnl|my_center|LOCUS_04110 6512 7657 gene locus_tag LOCUS_04120 6512 7657 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095433.1 protein_id gnl|my_center|LOCUS_04120 7671 8762 gene locus_tag LOCUS_04130 7671 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 8780 10189 gene locus_tag LOCUS_04140 gene oprB 8780 10189 CDS product efflux RND transporter outer membrane subunit OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204905.1 protein_id gnl|my_center|LOCUS_04140 10284 10970 gene locus_tag LOCUS_04150 10284 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 11127 12029 gene locus_tag LOCUS_04160 11127 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 12446 13237 gene locus_tag LOCUS_04170 12446 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 13749 13976 gene locus_tag LOCUS_04180 13749 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14018 14296 gene locus_tag LOCUS_04190 14018 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 14453 14650 gene locus_tag LOCUS_04200 14453 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 14682 15713 gene locus_tag LOCUS_04210 14682 15713 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_04210 15710 15943 gene locus_tag LOCUS_04220 15710 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 15959 16408 gene locus_tag LOCUS_04230 15959 16408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence021 2066 363 gene locus_tag LOCUS_04240 2066 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4028 2259 gene locus_tag LOCUS_04250 4028 2259 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_04250 4744 4025 gene locus_tag LOCUS_04260 4744 4025 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_04260 5908 4790 gene locus_tag LOCUS_04270 5908 4790 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_04270 6466 6002 gene locus_tag LOCUS_04280 6466 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 7599 6463 gene locus_tag LOCUS_04290 7599 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 9209 7596 gene locus_tag LOCUS_04300 9209 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 9813 9271 gene locus_tag LOCUS_04310 9813 9271 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_04310 11235 9826 gene locus_tag LOCUS_04320 gene rlmD 11235 9826 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_04320 12157 11204 gene locus_tag LOCUS_04330 12157 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04330 12652 12167 gene locus_tag LOCUS_04340 12652 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 12874 12713 gene locus_tag LOCUS_04350 12874 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13921 12878 gene locus_tag LOCUS_04360 13921 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 15778 14249 gene locus_tag LOCUS_04370 15778 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 17253 15775 gene locus_tag LOCUS_04380 17253 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 18343 17378 gene locus_tag LOCUS_04390 18343 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence022 576 1229 gene locus_tag LOCUS_04400 gene ftsE 576 1229 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_04400 1226 2086 gene locus_tag LOCUS_04410 1226 2086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926835.1 protein_id gnl|my_center|LOCUS_04410 2219 3247 gene locus_tag LOCUS_04420 gene hrcA 2219 3247 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405071.1 protein_id gnl|my_center|LOCUS_04420 3299 3778 gene locus_tag LOCUS_04430 3299 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04430 3928 5082 gene locus_tag LOCUS_04440 gene dnaJ 3928 5082 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_04440 5177 5395 gene locus_tag LOCUS_04450 5177 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8429 5784 gene locus_tag LOCUS_04460 8429 5784 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_04460 10439 8556 gene locus_tag LOCUS_04470 10439 8556 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_04470 10707 10462 gene locus_tag LOCUS_04480 10707 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11252 10902 gene locus_tag LOCUS_04490 11252 10902 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_04490 11581 12141 gene locus_tag LOCUS_04500 11581 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12151 14562 gene locus_tag LOCUS_04510 12151 14562 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948260.1 protein_id gnl|my_center|LOCUS_04510 15104 17002 gene locus_tag LOCUS_04520 15104 17002 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_04520 17485 18777 gene locus_tag LOCUS_04530 17485 18777 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence023 3082 2522 gene locus_tag LOCUS_04540 3082 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04540 3445 3086 gene locus_tag LOCUS_04550 3445 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04550 4195 3749 gene locus_tag LOCUS_04560 4195 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5169 4549 gene locus_tag LOCUS_04570 5169 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5871 5218 gene locus_tag LOCUS_04580 5871 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7560 5923 gene locus_tag LOCUS_04590 7560 5923 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943836.1 protein_id gnl|my_center|LOCUS_04590 9585 7621 gene locus_tag LOCUS_04600 9585 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10161 9634 gene locus_tag LOCUS_04610 10161 9634 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943840.1 protein_id gnl|my_center|LOCUS_04610 11300 10218 gene locus_tag LOCUS_04620 11300 10218 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943839.1 protein_id gnl|my_center|LOCUS_04620 12022 11408 gene locus_tag LOCUS_04630 12022 11408 CDS product cytochrome C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136516188.1 protein_id gnl|my_center|LOCUS_04630 12949 12410 gene locus_tag LOCUS_04640 12949 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04640 13674 12928 gene locus_tag LOCUS_04650 13674 12928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04650 15061 13667 gene locus_tag LOCUS_04660 15061 13667 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943547.1 protein_id gnl|my_center|LOCUS_04660 16504 15185 gene locus_tag LOCUS_04670 16504 15185 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 17856 16879 gene locus_tag LOCUS_04680 17856 16879 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence024 4057 4392 gene locus_tag LOCUS_04690 4057 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 4418 5074 gene locus_tag LOCUS_04700 4418 5074 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_04700 5097 5654 gene locus_tag LOCUS_04710 5097 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5683 6171 gene locus_tag LOCUS_04720 5683 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6211 7281 gene locus_tag LOCUS_04730 6211 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7383 9140 gene locus_tag LOCUS_04740 gene aspS 7383 9140 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_04740 9247 9528 gene locus_tag LOCUS_04750 9247 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 9566 10411 gene locus_tag LOCUS_04760 9566 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10473 11504 gene locus_tag LOCUS_04770 10473 11504 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04770 11556 12743 gene locus_tag LOCUS_04780 11556 12743 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_04780 12752 13603 gene locus_tag LOCUS_04790 12752 13603 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_04790 13607 14053 gene locus_tag LOCUS_04800 gene nusB 13607 14053 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_04800 14111 14512 gene locus_tag LOCUS_04810 14111 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04810 14519 14824 gene locus_tag LOCUS_04820 14519 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04820 14836 17799 gene locus_tag LOCUS_04830 gene secA 14836 17799 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_04830 <18741 17902 gene locus_tag LOCUS_04840 <18741 17902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase >Feature sequence025 617 3457 gene locus_tag LOCUS_04850 617 3457 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_04850 3656 5296 gene locus_tag LOCUS_04860 3656 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_04860 5668 8574 gene locus_tag LOCUS_04870 5668 8574 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_04870 8628 9257 gene locus_tag LOCUS_04880 8628 9257 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_04880 9408 10400 gene locus_tag LOCUS_04890 9408 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 10507 11067 gene locus_tag LOCUS_04900 10507 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 11218 11817 gene locus_tag LOCUS_04910 11218 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12010 14208 gene locus_tag LOCUS_04920 12010 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 14820 16811 gene locus_tag LOCUS_04930 14820 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence026 1874 1680 gene locus_tag LOCUS_04940 1874 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3347 2424 gene locus_tag LOCUS_04950 3347 2424 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_04950 3536 4459 gene locus_tag LOCUS_04960 3536 4459 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_04960 4658 5692 gene locus_tag LOCUS_04970 4658 5692 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_04970 5755 6561 gene locus_tag LOCUS_04980 gene mreC 5755 6561 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894316.1 protein_id gnl|my_center|LOCUS_04980 6659 7030 gene locus_tag LOCUS_04990 6659 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7034 8908 gene locus_tag LOCUS_05000 gene mrdA 7034 8908 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_05000 8908 10128 gene locus_tag LOCUS_05010 gene rodA 8908 10128 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_05010 10219 11085 gene locus_tag LOCUS_05020 10219 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 11604 11858 gene locus_tag LOCUS_05030 11604 11858 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_05030 11833 12075 gene locus_tag LOCUS_05040 11833 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_05040 12429 12701 gene locus_tag LOCUS_05050 12429 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 12698 13483 gene locus_tag LOCUS_05060 12698 13483 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119056.1 protein_id gnl|my_center|LOCUS_05060 14885 13692 gene locus_tag LOCUS_05070 gene ftsZ 14885 13692 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731982.1 protein_id gnl|my_center|LOCUS_05070 16221 14941 gene locus_tag LOCUS_05080 gene ftsA 16221 14941 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_05080 17006 16218 gene locus_tag LOCUS_05090 17006 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 <17747 17003 gene locus_tag LOCUS_05100 <17747 17003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943693.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence027 2255 33 gene locus_tag LOCUS_05110 2255 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3297 2362 gene locus_tag LOCUS_05120 3297 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3935 3294 gene locus_tag LOCUS_05130 3935 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4427 4065 gene locus_tag LOCUS_05140 4427 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 4680 4979 gene locus_tag LOCUS_05150 4680 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4969 7122 gene locus_tag LOCUS_05160 gene feoB 4969 7122 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_05160 7631 8392 gene locus_tag LOCUS_05170 7631 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8426 11695 gene locus_tag LOCUS_05180 8426 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05180 11713 13563 gene locus_tag LOCUS_05190 11713 13563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05190 >Feature sequence028 2353 2850 gene locus_tag LOCUS_05200 2353 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3049 4032 gene locus_tag LOCUS_05210 gene pdxA 3049 4032 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 protein_id gnl|my_center|LOCUS_05210 4423 8055 gene locus_tag LOCUS_05220 gene metH 4423 8055 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_05220 8220 8909 gene locus_tag LOCUS_05230 8220 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_05230 9788 9270 gene locus_tag LOCUS_05240 9788 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10040 10168 gene locus_tag LOCUS_05250 10040 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 10788 11552 gene locus_tag LOCUS_05260 10788 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 11663 11980 gene locus_tag LOCUS_05270 11663 11980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 12728 12042 gene locus_tag LOCUS_05280 gene queC 12728 12042 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_05280 13084 12725 gene locus_tag LOCUS_05290 gene queF 13084 12725 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_05290 14556 13234 gene locus_tag LOCUS_05300 14556 13234 CDS product IS1182-like element ISMac2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021981.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 14810 14514 gene locus_tag LOCUS_05310 14810 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15916 15200 gene locus_tag LOCUS_05320 gene queE 15916 15200 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_05320 16297 15932 gene locus_tag LOCUS_05330 gene queD 16297 15932 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_05330 17070 16426 gene locus_tag LOCUS_05340 17070 16426 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence029 <1 1161 gene locus_tag LOCUS_05350 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228453.1:(Fe-S)-binding protein 1510 5670 gene locus_tag LOCUS_05360 1510 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 5685 8009 gene locus_tag LOCUS_05370 gene bamA 5685 8009 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_05370 8094 8618 gene locus_tag LOCUS_05380 8094 8618 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766991.1 protein_id gnl|my_center|LOCUS_05380 8631 9665 gene locus_tag LOCUS_05390 gene lpxD 8631 9665 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_05390 9679 11085 gene locus_tag LOCUS_05400 9679 11085 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_05400 11101 11874 gene locus_tag LOCUS_05410 gene lpxA 11101 11874 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_05410 11858 12679 gene locus_tag LOCUS_05420 11858 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12737 13597 gene locus_tag LOCUS_05430 12737 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 13630 14946 gene locus_tag LOCUS_05440 gene rseP 13630 14946 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence030 112 798 gene locus_tag LOCUS_05450 112 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1014 1868 gene locus_tag LOCUS_05460 1014 1868 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_05460 1870 3171 gene locus_tag LOCUS_05470 gene nrfD 1870 3171 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_05470 3150 3848 gene locus_tag LOCUS_05480 3150 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3941 5605 gene locus_tag LOCUS_05490 3941 5605 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_05490 5876 7234 gene locus_tag LOCUS_05500 5876 7234 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_05500 7227 7766 gene locus_tag LOCUS_05510 7227 7766 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_05510 10041 7756 gene locus_tag LOCUS_05520 10041 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 11878 10046 gene locus_tag LOCUS_05530 11878 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 12415 11882 gene locus_tag LOCUS_05540 12415 11882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 13577 12399 gene locus_tag LOCUS_05550 13577 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 13856 14143 gene locus_tag LOCUS_05560 13856 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 14162 15550 gene locus_tag LOCUS_05570 14162 15550 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931886.1 protein_id gnl|my_center|LOCUS_05570 15805 16062 gene locus_tag LOCUS_05580 15805 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence031 1000 5322 gene locus_tag LOCUS_05590 1000 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence032 <1 2095 gene locus_tag LOCUS_05600 <1 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095699.1:efflux transporter outer membrane subunit OpmH 2256 3362 gene locus_tag LOCUS_05610 gene vexC 2256 3362 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069849.1 protein_id gnl|my_center|LOCUS_05610 3369 6545 gene locus_tag LOCUS_05620 3369 6545 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261805.1 protein_id gnl|my_center|LOCUS_05620 6554 7228 gene locus_tag LOCUS_05630 6554 7228 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_05630 7511 8833 gene locus_tag LOCUS_05640 gene glnA 7511 8833 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173386.1 protein_id gnl|my_center|LOCUS_05640 9210 8935 gene locus_tag LOCUS_05650 9210 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 10272 9262 gene locus_tag LOCUS_05660 10272 9262 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_05660 12433 10256 gene locus_tag LOCUS_05670 12433 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 13853 12438 gene locus_tag LOCUS_05680 13853 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 14217 13870 gene locus_tag LOCUS_05690 14217 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 15230 14214 gene locus_tag LOCUS_05700 15230 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15859 15329 gene locus_tag LOCUS_05710 15859 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence033 1613 801 gene locus_tag LOCUS_05720 1613 801 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_05720 2964 1813 gene locus_tag LOCUS_05730 2964 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3171 4754 gene locus_tag LOCUS_05740 3171 4754 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_05740 5571 4756 gene locus_tag LOCUS_05750 5571 4756 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_05750 6088 5810 gene locus_tag LOCUS_05760 6088 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6593 6126 gene locus_tag LOCUS_05770 6593 6126 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931994.1 protein_id gnl|my_center|LOCUS_05770 7354 6644 gene locus_tag LOCUS_05780 7354 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8524 7784 gene locus_tag LOCUS_05790 8524 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 9296 8643 gene locus_tag LOCUS_05800 9296 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11350 9449 gene locus_tag LOCUS_05810 11350 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12336 11959 gene locus_tag LOCUS_05820 12336 11959 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935061.1 protein_id gnl|my_center|LOCUS_05820 15007 12353 gene locus_tag LOCUS_05830 15007 12353 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_05830 <15735 15235 gene locus_tag LOCUS_05840 <15735 15235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768338.1:selenide, water dikinase SelD >Feature sequence034 334 408 gene locus_tag LOCUS_t00030 334 408 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 441 623 gene locus_tag LOCUS_05850 441 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 653 1198 gene locus_tag LOCUS_05860 gene nusG 653 1198 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_05860 1216 1638 gene locus_tag LOCUS_05870 gene rplK 1216 1638 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_05870 1665 2369 gene locus_tag LOCUS_05880 gene rplA 1665 2369 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_05880 2381 2893 gene locus_tag LOCUS_05890 gene rplJ 2381 2893 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_05890 2921 3298 gene locus_tag LOCUS_05900 gene rplL 2921 3298 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_05900 3341 7117 gene locus_tag LOCUS_05910 gene rpoB 3341 7117 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_05910 7201 9948 gene locus_tag LOCUS_05920 7201 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05920 9967 10260 gene locus_tag LOCUS_05930 9967 10260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05930 10273 11418 gene locus_tag LOCUS_05940 10273 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05940 11490 11864 gene locus_tag LOCUS_05950 gene rpsL 11490 11864 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_05950 11888 12358 gene locus_tag LOCUS_05960 gene rpsG 11888 12358 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_05960 12368 14467 gene locus_tag LOCUS_05970 gene fusA 12368 14467 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence035 197 1729 gene locus_tag LOCUS_05980 197 1729 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_05980 2029 3324 gene locus_tag LOCUS_05990 2029 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4662 3340 gene locus_tag LOCUS_06000 gene nhaA 4662 3340 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_06000 5104 6294 gene locus_tag LOCUS_06010 gene flhF 5104 6294 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_06010 6482 8359 gene locus_tag LOCUS_06020 6482 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8400 9353 gene locus_tag LOCUS_06030 8400 9353 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_06030 9994 9350 gene locus_tag LOCUS_06040 9994 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 10740 9991 gene locus_tag LOCUS_06050 10740 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 11242 10730 gene locus_tag LOCUS_06060 11242 10730 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_06060 11477 13861 gene locus_tag LOCUS_06070 11477 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence036 2556 2110 gene locus_tag LOCUS_06080 2556 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3501 2557 gene locus_tag LOCUS_06090 3501 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3976 4494 gene locus_tag LOCUS_06100 3976 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5949 4582 gene locus_tag LOCUS_06110 5949 4582 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_06110 7333 6095 gene locus_tag LOCUS_06120 7333 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 10270 7349 gene locus_tag LOCUS_06130 10270 7349 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_06130 10642 10935 gene locus_tag LOCUS_06140 10642 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 11062 12642 gene locus_tag LOCUS_06150 11062 12642 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_06150 12729 13067 gene locus_tag LOCUS_06160 12729 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13260 15014 gene locus_tag LOCUS_06170 13260 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence037 354 902 gene locus_tag LOCUS_06180 354 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 904 1563 gene locus_tag LOCUS_06190 904 1563 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989760.1 protein_id gnl|my_center|LOCUS_06190 2353 1532 gene locus_tag LOCUS_06200 2353 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3158 2379 gene locus_tag LOCUS_06210 3158 2379 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_06210 4559 3276 gene locus_tag LOCUS_06220 gene hisS 4559 3276 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_06220 6171 4951 gene locus_tag LOCUS_06230 6171 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 6441 6226 gene locus_tag LOCUS_06240 6441 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6921 6586 gene locus_tag LOCUS_06250 6921 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987057.1 protein_id gnl|my_center|LOCUS_06250 7400 6927 gene locus_tag LOCUS_06260 7400 6927 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_06260 7523 7981 gene locus_tag LOCUS_06270 7523 7981 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 protein_id gnl|my_center|LOCUS_06270 7971 8933 gene locus_tag LOCUS_06280 7971 8933 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_06280 8938 9426 gene locus_tag LOCUS_06290 8938 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9772 9401 gene locus_tag LOCUS_06300 9772 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 9896 11206 gene locus_tag LOCUS_06310 9896 11206 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_06310 11245 11481 gene locus_tag LOCUS_06320 11245 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 11481 12224 gene locus_tag LOCUS_06330 11481 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 12455 13921 gene locus_tag LOCUS_06340 12455 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence038 1286 420 gene locus_tag LOCUS_06350 1286 420 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_06350 3246 1390 gene locus_tag LOCUS_06360 3246 1390 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_06360 3595 3251 gene locus_tag LOCUS_06370 3595 3251 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_06370 5299 3614 gene locus_tag LOCUS_06380 5299 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6397 5435 gene locus_tag LOCUS_06390 gene galE 6397 5435 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984071.1 protein_id gnl|my_center|LOCUS_06390 7701 6475 gene locus_tag LOCUS_06400 7701 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 8735 7728 gene locus_tag LOCUS_06410 8735 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8880 9077 gene locus_tag LOCUS_06420 gene rpmB 8880 9077 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546135.1 protein_id gnl|my_center|LOCUS_06420 10389 9103 gene locus_tag LOCUS_06430 10389 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 11418 10702 gene locus_tag LOCUS_06440 11418 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 12746 11445 gene locus_tag LOCUS_06450 gene rimO 12746 11445 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_06450 13654 12743 gene locus_tag LOCUS_06460 gene ftsY 13654 12743 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404898.1 protein_id gnl|my_center|LOCUS_06460 14754 13789 gene locus_tag LOCUS_06470 14754 13789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence039 1861 353 gene locus_tag LOCUS_06480 1861 353 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_06480 3835 1871 gene locus_tag LOCUS_06490 3835 1871 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_06490 4356 4739 gene locus_tag LOCUS_06500 4356 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 4825 5595 gene locus_tag LOCUS_06510 4825 5595 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024629.1 protein_id gnl|my_center|LOCUS_06510 5937 8303 gene locus_tag LOCUS_06520 5937 8303 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_06520 8307 9326 gene locus_tag LOCUS_06530 8307 9326 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 protein_id gnl|my_center|LOCUS_06530 9454 10485 gene locus_tag LOCUS_06540 9454 10485 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_06540 10564 11490 gene locus_tag LOCUS_06550 10564 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11604 11807 gene locus_tag LOCUS_06560 11604 11807 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_06560 11818 12495 gene locus_tag LOCUS_06570 11818 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 12495 12752 gene locus_tag LOCUS_06580 12495 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 12783 12971 gene locus_tag LOCUS_06590 12783 12971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence040 <1 1344 gene locus_tag LOCUS_06600 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798918.1:family 10 glycosylhydrolase 1393 1602 gene locus_tag LOCUS_06610 1393 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1703 2284 gene locus_tag LOCUS_06620 1703 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 2410 4089 gene locus_tag LOCUS_06630 2410 4089 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612392.1 protein_id gnl|my_center|LOCUS_06630 4906 4325 gene locus_tag LOCUS_06640 4906 4325 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_06640 5337 8966 gene locus_tag LOCUS_06650 5337 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 10119 8974 gene locus_tag LOCUS_06660 10119 8974 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_06660 10873 10109 gene locus_tag LOCUS_06670 10873 10109 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_06670 11000 11278 gene locus_tag LOCUS_06680 11000 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 11710 11234 gene locus_tag LOCUS_06690 11710 11234 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_06690 11799 13571 gene locus_tag LOCUS_06700 11799 13571 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 protein_id gnl|my_center|LOCUS_06700 13795 14982 gene locus_tag LOCUS_06710 gene megL 13795 14982 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence041 100 1119 gene locus_tag LOCUS_06720 100 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2152 1133 gene locus_tag LOCUS_06730 2152 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5074 2207 gene locus_tag LOCUS_06740 5074 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7703 5103 gene locus_tag LOCUS_06750 7703 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9039 7978 gene locus_tag LOCUS_06760 9039 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9965 9237 gene locus_tag LOCUS_06770 9965 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10321 10989 gene locus_tag LOCUS_06780 10321 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 11184 12194 gene locus_tag LOCUS_06790 11184 12194 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_06790 12206 12931 gene locus_tag LOCUS_06800 12206 12931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13205 13005 gene locus_tag LOCUS_06810 13205 13005 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_06810 14438 13404 gene locus_tag LOCUS_06820 gene recA 14438 13404 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence042 1019 1495 gene locus_tag LOCUS_06830 1019 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1500 2525 gene locus_tag LOCUS_06840 1500 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3082 2528 gene locus_tag LOCUS_06850 3082 2528 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_06850 3400 4122 gene locus_tag LOCUS_06860 3400 4122 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_06860 4139 4753 gene locus_tag LOCUS_06870 4139 4753 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_06870 5276 6979 gene locus_tag LOCUS_06880 5276 6979 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928548.1 protein_id gnl|my_center|LOCUS_06880 7219 10026 gene locus_tag LOCUS_06890 7219 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10053 12854 gene locus_tag LOCUS_06900 10053 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 12868 13884 gene locus_tag LOCUS_06910 gene porV 12868 13884 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence043 303 848 gene locus_tag LOCUS_06920 303 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 832 1440 gene locus_tag LOCUS_06930 832 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1450 1845 gene locus_tag LOCUS_06940 1450 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4509 2479 gene locus_tag LOCUS_06950 4509 2479 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869356.1 protein_id gnl|my_center|LOCUS_06950 5626 4604 gene locus_tag LOCUS_06960 5626 4604 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263666.1 protein_id gnl|my_center|LOCUS_06960 5868 6584 gene locus_tag LOCUS_06970 5868 6584 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 protein_id gnl|my_center|LOCUS_06970 10427 6669 gene locus_tag LOCUS_06980 10427 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 12459 10705 gene locus_tag LOCUS_06990 12459 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12691 13395 gene locus_tag LOCUS_07000 12691 13395 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_07000 13523 14158 gene locus_tag LOCUS_07010 13523 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence044 1222 266 gene locus_tag LOCUS_07020 1222 266 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_07020 1498 2169 gene locus_tag LOCUS_07030 1498 2169 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_07030 2209 2433 gene locus_tag LOCUS_07040 2209 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3481 2558 gene locus_tag LOCUS_07050 3481 2558 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07050 4066 3596 gene locus_tag LOCUS_07060 gene ribE 4066 3596 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811752.1 protein_id gnl|my_center|LOCUS_07060 5319 4081 gene locus_tag LOCUS_07070 5319 4081 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_07070 5975 5316 gene locus_tag LOCUS_07080 gene ribE 5975 5316 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 protein_id gnl|my_center|LOCUS_07080 7081 5972 gene locus_tag LOCUS_07090 gene ribD 7081 5972 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943609.1 protein_id gnl|my_center|LOCUS_07090 8469 7732 gene locus_tag LOCUS_07100 8469 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 8584 9351 gene locus_tag LOCUS_07110 8584 9351 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_07110 9341 9916 gene locus_tag LOCUS_07120 9341 9916 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_07120 10044 11501 gene locus_tag LOCUS_07130 10044 11501 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_07130 11704 13056 gene locus_tag LOCUS_07140 11704 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 13060 13383 gene locus_tag LOCUS_07150 13060 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence045 2563 1208 gene locus_tag LOCUS_07160 2563 1208 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082154.1 protein_id gnl|my_center|LOCUS_07160 3488 2604 gene locus_tag LOCUS_07170 3488 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5458 3647 gene locus_tag LOCUS_07180 5458 3647 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_07180 7461 5527 gene locus_tag LOCUS_07190 7461 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10726 7478 gene locus_tag LOCUS_07200 10726 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 11924 10878 gene locus_tag LOCUS_07210 11924 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 14324 11946 gene locus_tag LOCUS_07220 14324 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence046 747 1877 gene locus_tag LOCUS_07230 747 1877 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_07230 1907 2068 gene locus_tag LOCUS_07240 1907 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2261 4468 gene locus_tag LOCUS_07250 2261 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4492 4779 gene locus_tag LOCUS_07260 4492 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4914 5066 gene locus_tag LOCUS_07270 4914 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5506 6744 gene locus_tag LOCUS_07280 5506 6744 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_07280 7525 6848 gene locus_tag LOCUS_07290 7525 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8663 7569 gene locus_tag LOCUS_07300 8663 7569 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_07300 9833 12796 gene locus_tag LOCUS_07310 9833 12796 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_07310 12809 13375 gene locus_tag LOCUS_07320 12809 13375 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922701.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence047 2043 1552 gene locus_tag LOCUS_07330 2043 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 4093 2348 gene locus_tag LOCUS_07340 4093 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 5307 4159 gene locus_tag LOCUS_07350 5307 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7136 5424 gene locus_tag LOCUS_07360 7136 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8117 7164 gene locus_tag LOCUS_07370 8117 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9564 8278 gene locus_tag LOCUS_07380 9564 8278 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_07380 10367 9579 gene locus_tag LOCUS_07390 10367 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 12148 10442 gene locus_tag LOCUS_07400 12148 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 <14201 12257 gene locus_tag LOCUS_07410 <14201 12257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402849.1:transcription-repair coupling factor >Feature sequence048 333 773 gene locus_tag LOCUS_07420 333 773 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_07420 776 1858 gene locus_tag LOCUS_07430 776 1858 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931995.1 protein_id gnl|my_center|LOCUS_07430 1872 3170 gene locus_tag LOCUS_07440 1872 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3455 4573 gene locus_tag LOCUS_07450 3455 4573 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388916.1 protein_id gnl|my_center|LOCUS_07450 4573 6300 gene locus_tag LOCUS_07460 4573 6300 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_07460 6300 6989 gene locus_tag LOCUS_07470 gene cybH 6300 6989 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932460.1 protein_id gnl|my_center|LOCUS_07470 7024 7440 gene locus_tag LOCUS_07480 7024 7440 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296886.1 protein_id gnl|my_center|LOCUS_07480 7488 8042 gene locus_tag LOCUS_07490 7488 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8797 8039 gene locus_tag LOCUS_07500 8797 8039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_07500 9568 8798 gene locus_tag LOCUS_07510 9568 8798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_07510 12667 9578 gene locus_tag LOCUS_07520 12667 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 12806 13147 gene locus_tag LOCUS_07530 12806 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence049 1217 606 gene locus_tag LOCUS_07540 1217 606 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_07540 1396 3450 gene locus_tag LOCUS_07550 1396 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3847 4383 gene locus_tag LOCUS_07560 3847 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 4560 5690 gene locus_tag LOCUS_07570 4560 5690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_07570 6482 5697 gene locus_tag LOCUS_07580 6482 5697 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_07580 6848 6483 gene locus_tag LOCUS_07590 6848 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8211 6991 gene locus_tag LOCUS_07600 8211 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_07600 8999 8211 gene locus_tag LOCUS_07610 8999 8211 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_07610 9565 8996 gene locus_tag LOCUS_07620 9565 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 11880 9568 gene locus_tag LOCUS_07630 11880 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12544 11963 gene locus_tag LOCUS_07640 12544 11963 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_07640 12820 13503 gene locus_tag LOCUS_07650 12820 13503 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence050 2878 2018 gene locus_tag LOCUS_07660 2878 2018 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261591.1 protein_id gnl|my_center|LOCUS_07660 4470 2893 gene locus_tag LOCUS_07670 4470 2893 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_07670 5453 4476 gene locus_tag LOCUS_07680 5453 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7223 5469 gene locus_tag LOCUS_07690 7223 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 7592 7266 gene locus_tag LOCUS_07700 7592 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 7868 7704 gene locus_tag LOCUS_07710 7868 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8207 9286 gene locus_tag LOCUS_07720 8207 9286 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093830137.1 protein_id gnl|my_center|LOCUS_07720 9541 10239 gene locus_tag LOCUS_07730 9541 10239 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_07730 10243 10743 gene locus_tag LOCUS_07740 10243 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_07740 11099 13546 gene locus_tag LOCUS_07750 11099 13546 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence051 2180 1155 gene locus_tag LOCUS_07760 2180 1155 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_07760 3160 2183 gene locus_tag LOCUS_07770 3160 2183 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_07770 4037 3315 gene locus_tag LOCUS_07780 4037 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 5454 4159 gene locus_tag LOCUS_07790 5454 4159 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933254.1 protein_id gnl|my_center|LOCUS_07790 5902 5465 gene locus_tag LOCUS_07800 gene rpiB 5902 5465 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932728.1 protein_id gnl|my_center|LOCUS_07800 7180 5912 gene locus_tag LOCUS_07810 7180 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8413 7205 gene locus_tag LOCUS_07820 8413 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9673 8633 gene locus_tag LOCUS_07830 9673 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10299 9727 gene locus_tag LOCUS_07840 gene gmhB 10299 9727 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_07840 11770 10292 gene locus_tag LOCUS_07850 11770 10292 CDS product starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933668.1 protein_id gnl|my_center|LOCUS_07850 12660 11968 gene locus_tag LOCUS_07860 12660 11968 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_07860 13838 12729 gene locus_tag LOCUS_07870 13838 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence052 <1 787 gene locus_tag LOCUS_07880 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942111.1:NADP-dependent isocitrate dehydrogenase 851 2749 gene locus_tag LOCUS_07890 gene uvrC 851 2749 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_07890 2978 3652 gene locus_tag LOCUS_07900 2978 3652 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_07900 3693 5117 gene locus_tag LOCUS_07910 3693 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6680 5487 gene locus_tag LOCUS_07920 gene dinB 6680 5487 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_07920 6803 7333 gene locus_tag LOCUS_07930 6803 7333 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351315.1 protein_id gnl|my_center|LOCUS_07930 8210 7380 gene locus_tag LOCUS_07940 8210 7380 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_07940 8531 8803 gene locus_tag LOCUS_07950 8531 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8891 9706 gene locus_tag LOCUS_07960 8891 9706 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404190.1 protein_id gnl|my_center|LOCUS_07960 9706 10137 gene locus_tag LOCUS_07970 9706 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10413 11396 gene locus_tag LOCUS_07980 10413 11396 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_07980 11412 12188 gene locus_tag LOCUS_07990 11412 12188 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263399.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence053 1543 881 gene locus_tag LOCUS_08000 1543 881 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_08000 2581 1550 gene locus_tag LOCUS_08010 gene rlmN 2581 1550 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_08010 2722 3726 gene locus_tag LOCUS_08020 2722 3726 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_08020 4999 3749 gene locus_tag LOCUS_08030 4999 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9455 5433 gene locus_tag LOCUS_08040 gene porU 9455 5433 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_08040 11405 9651 gene locus_tag LOCUS_08050 11405 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 11631 11398 gene locus_tag LOCUS_08060 11631 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 13074 11791 gene locus_tag LOCUS_08070 gene eno 13074 11791 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_08070 <13840 13211 gene locus_tag LOCUS_08080 <13840 13211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107255.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence054 2352 1657 gene locus_tag LOCUS_08090 2352 1657 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_08090 4038 2470 gene locus_tag LOCUS_08100 4038 2470 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897308.1 protein_id gnl|my_center|LOCUS_08100 4380 4189 gene locus_tag LOCUS_08110 4380 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 4444 6030 gene locus_tag LOCUS_08120 4444 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08120 6109 6711 gene locus_tag LOCUS_08130 6109 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08130 7933 6899 gene locus_tag LOCUS_08140 7933 6899 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_08140 9446 8298 gene locus_tag LOCUS_08150 gene amrS 9446 8298 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_08150 10420 9443 gene locus_tag LOCUS_08160 10420 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10605 10967 gene locus_tag LOCUS_08170 10605 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 11074 11919 gene locus_tag LOCUS_08180 11074 11919 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_08180 11963 12805 gene locus_tag LOCUS_08190 11963 12805 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421593.1 protein_id gnl|my_center|LOCUS_08190 12802 13128 gene locus_tag LOCUS_08200 12802 13128 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892846.1 protein_id gnl|my_center|LOCUS_08200 <13822 13265 gene locus_tag LOCUS_08210 <13822 13265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108692.1:sulfatase >Feature sequence055 2275 770 gene locus_tag LOCUS_08220 2275 770 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_08220 2780 2283 gene locus_tag LOCUS_08230 gene def 2780 2283 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082176.1 protein_id gnl|my_center|LOCUS_08230 3134 2961 gene locus_tag LOCUS_08240 3134 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4400 3261 gene locus_tag LOCUS_08250 4400 3261 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_08250 5274 4510 gene locus_tag LOCUS_08260 gene whiG 5274 4510 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_08260 5667 6968 gene locus_tag LOCUS_08270 5667 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7174 7740 gene locus_tag LOCUS_08280 7174 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 8241 7813 gene locus_tag LOCUS_08290 8241 7813 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_08290 8320 8484 gene locus_tag LOCUS_08300 8320 8484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9563 8481 gene locus_tag LOCUS_08310 gene buk 9563 8481 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_08310 10477 9578 gene locus_tag LOCUS_08320 gene ptb 10477 9578 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_08320 11569 10541 gene locus_tag LOCUS_08330 11569 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 13451 11886 gene locus_tag LOCUS_08340 13451 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08340 >Feature sequence056 1084 365 gene locus_tag LOCUS_08350 1084 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1735 1400 gene locus_tag LOCUS_08360 gene bldG 1735 1400 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_08360 2654 1761 gene locus_tag LOCUS_08370 gene secF 2654 1761 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_08370 4577 2691 gene locus_tag LOCUS_08380 gene secD 4577 2691 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_08380 6952 4940 gene locus_tag LOCUS_08390 gene ligA 6952 4940 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_08390 7022 7189 gene locus_tag LOCUS_08400 7022 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7263 7892 gene locus_tag LOCUS_08410 7263 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 7892 8431 gene locus_tag LOCUS_08420 7892 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8573 9283 gene locus_tag LOCUS_08430 8573 9283 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_08430 9318 10331 gene locus_tag LOCUS_08440 9318 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08440 10616 11857 gene locus_tag LOCUS_08450 10616 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence057 2274 658 gene locus_tag LOCUS_08460 2274 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08460 3746 2277 gene locus_tag LOCUS_08470 3746 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 5016 3868 gene locus_tag LOCUS_08480 5016 3868 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_08480 5164 6432 gene locus_tag LOCUS_08490 5164 6432 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_08490 6598 7953 gene locus_tag LOCUS_08500 6598 7953 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_08500 8085 8624 gene locus_tag LOCUS_08510 8085 8624 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 protein_id gnl|my_center|LOCUS_08510 8672 9619 gene locus_tag LOCUS_08520 8672 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 9707 9937 gene locus_tag LOCUS_08530 9707 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9930 10271 gene locus_tag LOCUS_08540 9930 10271 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_08540 10310 10864 gene locus_tag LOCUS_08550 10310 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 <13219 11316 gene locus_tag LOCUS_08560 <13219 11316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838696.1:Na+/H+ antiporter NhaC family protein >Feature sequence058 2448 1426 gene locus_tag LOCUS_08570 2448 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3095 2727 gene locus_tag LOCUS_08580 3095 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3665 3195 gene locus_tag LOCUS_08590 3665 3195 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_08590 5098 3662 gene locus_tag LOCUS_08600 5098 3662 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_08600 8332 5195 gene locus_tag LOCUS_08610 8332 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence059 <1 557 gene locus_tag LOCUS_08620 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072483.1:TonB-dependent receptor 676 2352 gene locus_tag LOCUS_08630 676 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2652 5828 gene locus_tag LOCUS_08640 2652 5828 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_08640 5847 7613 gene locus_tag LOCUS_08650 5847 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7622 9055 gene locus_tag LOCUS_08660 7622 9055 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_08660 9059 9862 gene locus_tag LOCUS_08670 9059 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9880 10821 gene locus_tag LOCUS_08680 9880 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence060 1676 432 gene locus_tag LOCUS_08690 1676 432 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_08690 2131 1664 gene locus_tag LOCUS_08700 2131 1664 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_08700 2735 2124 gene locus_tag LOCUS_08710 gene pgsA 2735 2124 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_08710 3038 4402 gene locus_tag LOCUS_08720 3038 4402 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_08720 4440 5645 gene locus_tag LOCUS_08730 4440 5645 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_08730 5638 6366 gene locus_tag LOCUS_08740 5638 6366 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_08740 6359 7027 gene locus_tag LOCUS_08750 6359 7027 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_08750 7045 7662 gene locus_tag LOCUS_08760 gene nqrE 7045 7662 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_08760 7679 8905 gene locus_tag LOCUS_08770 gene nqrF 7679 8905 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_08770 9369 10193 gene locus_tag LOCUS_08780 9369 10193 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918821.1 protein_id gnl|my_center|LOCUS_08780 10332 11459 gene locus_tag LOCUS_08790 10332 11459 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_08790 11468 12214 gene locus_tag LOCUS_08800 11468 12214 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_08800 12671 12880 gene locus_tag LOCUS_08810 12671 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence061 <1 960 gene locus_tag LOCUS_08820 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770956.1:TRAP transporter substrate-binding protein 1091 1843 gene locus_tag LOCUS_08830 1091 1843 CDS product type 2 GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168004.1 protein_id gnl|my_center|LOCUS_08830 2331 1912 gene locus_tag LOCUS_08840 2331 1912 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115312693.1 protein_id gnl|my_center|LOCUS_08840 3377 2331 gene locus_tag LOCUS_08850 gene prs 3377 2331 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557131.1 protein_id gnl|my_center|LOCUS_08850 4199 3390 gene locus_tag LOCUS_08860 4199 3390 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_08860 4462 5856 gene locus_tag LOCUS_08870 gene lpdA 4462 5856 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_08870 6086 6691 gene locus_tag LOCUS_08880 6086 6691 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943859.1 protein_id gnl|my_center|LOCUS_08880 7072 8136 gene locus_tag LOCUS_08890 7072 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8871 8251 gene locus_tag LOCUS_08900 8871 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9357 8938 gene locus_tag LOCUS_08910 9357 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 9922 9392 gene locus_tag LOCUS_08920 9922 9392 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546005.1 protein_id gnl|my_center|LOCUS_08920 10554 10057 gene locus_tag LOCUS_08930 10554 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 11359 10565 gene locus_tag LOCUS_08940 11359 10565 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_08940 11711 11394 gene locus_tag LOCUS_08950 11711 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12081 11785 gene locus_tag LOCUS_08960 12081 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12832 12125 gene locus_tag LOCUS_08970 gene sfsA 12832 12125 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence062 278 838 gene locus_tag LOCUS_08980 gene idi 278 838 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_08980 1033 1578 gene locus_tag LOCUS_08990 1033 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1604 2290 gene locus_tag LOCUS_09000 1604 2290 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115306.1 protein_id gnl|my_center|LOCUS_09000 3212 2502 gene locus_tag LOCUS_09010 3212 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3797 3366 gene locus_tag LOCUS_09020 3797 3366 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972826.1 protein_id gnl|my_center|LOCUS_09020 4145 3801 gene locus_tag LOCUS_09030 4145 3801 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931828.1 protein_id gnl|my_center|LOCUS_09030 5477 4170 gene locus_tag LOCUS_09040 5477 4170 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931827.1 protein_id gnl|my_center|LOCUS_09040 7316 5847 gene locus_tag LOCUS_09050 7316 5847 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_09050 8851 7346 gene locus_tag LOCUS_09060 8851 7346 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_09060 10933 8885 gene locus_tag LOCUS_09070 gene nuoL 10933 8885 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_09070 11258 10953 gene locus_tag LOCUS_09080 gene nuoK 11258 10953 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_09080 11758 11255 gene locus_tag LOCUS_09090 11758 11255 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_09090 12653 12078 gene locus_tag LOCUS_09100 12653 12078 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932453.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence063 76 2 gene locus_tag LOCUS_t00040 76 2 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 663 142 gene locus_tag LOCUS_09110 gene apt 663 142 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_09110 968 693 gene locus_tag LOCUS_09120 968 693 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_09120 1419 970 gene locus_tag LOCUS_09130 1419 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2724 1429 gene locus_tag LOCUS_09140 gene asnS 2724 1429 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_09140 3912 2893 gene locus_tag LOCUS_09150 gene fbp 3912 2893 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_09150 4858 4022 gene locus_tag LOCUS_09160 4858 4022 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_09160 5956 4955 gene locus_tag LOCUS_09170 gene gpsA 5956 4955 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_09170 6605 5970 gene locus_tag LOCUS_09180 gene plsY 6605 5970 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_09180 7246 6698 gene locus_tag LOCUS_09190 7246 6698 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_09190 9103 7310 gene locus_tag LOCUS_09200 9103 7310 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_09200 9359 9180 gene locus_tag LOCUS_09210 9359 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 10400 9393 gene locus_tag LOCUS_09220 10400 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 12704 10422 gene locus_tag LOCUS_09230 gene mrfA 12704 10422 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence064 1104 334 gene locus_tag LOCUS_09240 1104 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1754 1107 gene locus_tag LOCUS_09250 1754 1107 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280308.1 protein_id gnl|my_center|LOCUS_09250 5163 1828 gene locus_tag LOCUS_09260 5163 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 5757 5464 gene locus_tag LOCUS_09270 5757 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_09270 8983 5888 gene locus_tag LOCUS_09280 8983 5888 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_09280 10026 8980 gene locus_tag LOCUS_09290 10026 8980 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_09290 11507 10119 gene locus_tag LOCUS_09300 11507 10119 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_09300 12140 11520 gene locus_tag LOCUS_09310 12140 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence065 1533 550 gene locus_tag LOCUS_09320 1533 550 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 1824 2678 gene locus_tag LOCUS_09330 1824 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2682 3326 gene locus_tag LOCUS_09340 2682 3326 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_09340 3348 3752 gene locus_tag LOCUS_09350 3348 3752 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_09350 3795 5093 gene locus_tag LOCUS_09360 3795 5093 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964316.1 protein_id gnl|my_center|LOCUS_09360 5110 5772 gene locus_tag LOCUS_09370 5110 5772 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096147.1 protein_id gnl|my_center|LOCUS_09370 5765 6571 gene locus_tag LOCUS_09380 gene mazG 5765 6571 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880171.1 protein_id gnl|my_center|LOCUS_09380 6585 7610 gene locus_tag LOCUS_09390 6585 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 7614 8963 gene locus_tag LOCUS_09400 7614 8963 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_09400 9163 9378 gene locus_tag LOCUS_09410 9163 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9391 9651 gene locus_tag LOCUS_09420 9391 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11571 9970 gene locus_tag LOCUS_09430 11571 9970 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence066 519 935 gene locus_tag LOCUS_09440 gene ndk 519 935 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_09440 932 2839 gene locus_tag LOCUS_09450 gene selB 932 2839 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_09450 2963 3448 gene locus_tag LOCUS_09460 2963 3448 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528293.1 protein_id gnl|my_center|LOCUS_09460 3478 4110 gene locus_tag LOCUS_09470 3478 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4172 5185 gene locus_tag LOCUS_09480 4172 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5206 5616 gene locus_tag LOCUS_09490 5206 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5967 6779 gene locus_tag LOCUS_09500 gene mutM 5967 6779 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_09500 6792 7598 gene locus_tag LOCUS_09510 6792 7598 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_09510 7600 8550 gene locus_tag LOCUS_09520 7600 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 8547 9563 gene locus_tag LOCUS_09530 gene tsaD 8547 9563 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_09530 9547 11691 gene locus_tag LOCUS_09540 9547 11691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence067 2813 189 gene locus_tag LOCUS_09550 2813 189 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_09550 3680 3063 gene locus_tag LOCUS_09560 3680 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3956 3780 gene locus_tag LOCUS_09570 3956 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5858 4080 gene locus_tag LOCUS_09580 5858 4080 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_09580 6158 7528 gene locus_tag LOCUS_09590 6158 7528 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_09590 7622 9124 gene locus_tag LOCUS_09600 7622 9124 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_09600 9352 11097 gene locus_tag LOCUS_09610 9352 11097 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence068 2134 1328 gene locus_tag LOCUS_09620 gene cdaA 2134 1328 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_09620 3550 2393 gene locus_tag LOCUS_09630 3550 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4556 3540 gene locus_tag LOCUS_09640 4556 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5117 4623 gene locus_tag LOCUS_09650 5117 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7607 5505 gene locus_tag LOCUS_09660 gene ftsH 7607 5505 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_09660 8245 7697 gene locus_tag LOCUS_09670 gene hpt 8245 7697 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_09670 9537 8242 gene locus_tag LOCUS_09680 gene tilS 9537 8242 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_09680 9735 9661 gene locus_tag LOCUS_t00050 9735 9661 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9846 9772 gene locus_tag LOCUS_t00060 9846 9772 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10136 11602 gene locus_tag LOCUS_09690 10136 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence069 3419 1275 gene locus_tag LOCUS_09700 3419 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 6486 3451 gene locus_tag LOCUS_09710 6486 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8044 6677 gene locus_tag LOCUS_09720 8044 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9363 8119 gene locus_tag LOCUS_09730 9363 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 10403 9420 gene locus_tag LOCUS_09740 10403 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11058 10456 gene locus_tag LOCUS_09750 11058 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence070 3410 1266 gene locus_tag LOCUS_09760 3410 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6476 3441 gene locus_tag LOCUS_09770 6476 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 8008 6641 gene locus_tag LOCUS_09780 8008 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 9341 8097 gene locus_tag LOCUS_09790 9341 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 10382 9399 gene locus_tag LOCUS_09800 10382 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 11038 10436 gene locus_tag LOCUS_09810 11038 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence071 740 1861 gene locus_tag LOCUS_09820 740 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1919 4759 gene locus_tag LOCUS_09830 1919 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4930 5745 gene locus_tag LOCUS_09840 4930 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5838 6548 gene locus_tag LOCUS_09850 5838 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 6608 7057 gene locus_tag LOCUS_09860 6608 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7063 7536 gene locus_tag LOCUS_09870 7063 7536 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_09870 7533 8822 gene locus_tag LOCUS_09880 7533 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 8855 9421 gene locus_tag LOCUS_09890 8855 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence072 2138 21 gene locus_tag LOCUS_09900 2138 21 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_09900 3438 2206 gene locus_tag LOCUS_09910 3438 2206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_09910 4675 3446 gene locus_tag LOCUS_09920 4675 3446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_09920 5380 4709 gene locus_tag LOCUS_09930 5380 4709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_09930 6575 5370 gene locus_tag LOCUS_09940 6575 5370 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_09940 8050 6629 gene locus_tag LOCUS_09950 8050 6629 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105888.1 protein_id gnl|my_center|LOCUS_09950 8727 8317 gene locus_tag LOCUS_09960 8727 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 10109 8727 gene locus_tag LOCUS_09970 10109 8727 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_09970 11360 10218 gene locus_tag LOCUS_09980 gene nifS 11360 10218 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence073 460 122 gene locus_tag LOCUS_09990 gene trxA 460 122 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_09990 938 675 gene locus_tag LOCUS_10000 938 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1516 935 gene locus_tag LOCUS_10010 1516 935 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_10010 1965 1624 gene locus_tag LOCUS_10020 1965 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 2447 2010 gene locus_tag LOCUS_10030 2447 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 3742 3134 gene locus_tag LOCUS_10040 3742 3134 CDS product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 protein_id gnl|my_center|LOCUS_10040 5179 3770 gene locus_tag LOCUS_10050 5179 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 6256 5180 gene locus_tag LOCUS_10060 6256 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6996 6463 gene locus_tag LOCUS_10070 gene cobO 6996 6463 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_10070 7908 7024 gene locus_tag LOCUS_10080 7908 7024 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_10080 8975 7905 gene locus_tag LOCUS_10090 8975 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_10090 11137 9014 gene locus_tag LOCUS_10100 11137 9014 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence074 425 192 gene locus_tag LOCUS_10110 425 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1031 807 gene locus_tag LOCUS_10120 1031 807 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391794.1 protein_id gnl|my_center|LOCUS_10120 1240 1028 gene locus_tag LOCUS_10130 1240 1028 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_10130 2169 1996 gene locus_tag LOCUS_10140 2169 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3562 2159 gene locus_tag LOCUS_10150 3562 2159 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10150 4687 3692 gene locus_tag LOCUS_10160 4687 3692 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224817.1 protein_id gnl|my_center|LOCUS_10160 5761 4700 gene locus_tag LOCUS_10170 5761 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6063 7625 gene locus_tag LOCUS_10180 6063 7625 CDS product IS5-like element ISLca3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_10180 8886 7762 gene locus_tag LOCUS_10190 8886 7762 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_10190 9071 9907 gene locus_tag LOCUS_10200 9071 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10200 9901 10443 gene locus_tag LOCUS_10210 9901 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 11117 10542 gene locus_tag LOCUS_10220 11117 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence075 1132 11 gene locus_tag LOCUS_10230 1132 11 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_10230 2949 1444 gene locus_tag LOCUS_10240 2949 1444 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_10240 4060 2984 gene locus_tag LOCUS_10250 4060 2984 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927125.1 protein_id gnl|my_center|LOCUS_10250 4294 6258 gene locus_tag LOCUS_10260 4294 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 6283 7512 gene locus_tag LOCUS_10270 6283 7512 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_10270 7607 7957 gene locus_tag LOCUS_10280 7607 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 8098 9636 gene locus_tag LOCUS_10290 8098 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9929 9723 gene locus_tag LOCUS_10300 9929 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 10453 9974 gene locus_tag LOCUS_10310 10453 9974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10310 10836 10417 gene locus_tag LOCUS_10320 10836 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 >Feature sequence076 <1 1001 gene locus_tag LOCUS_10330 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 1420 2022 gene locus_tag LOCUS_10340 1420 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2036 3130 gene locus_tag LOCUS_10350 2036 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3208 4224 gene locus_tag LOCUS_10360 3208 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4265 7000 gene locus_tag LOCUS_10370 4265 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 7109 10033 gene locus_tag LOCUS_10380 7109 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 10337 10846 gene locus_tag LOCUS_10390 10337 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence077 492 1931 gene locus_tag LOCUS_10400 gene gatB 492 1931 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_10400 1997 2776 gene locus_tag LOCUS_10410 1997 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2885 3655 gene locus_tag LOCUS_10420 2885 3655 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979498.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 3636 4244 gene locus_tag LOCUS_10430 3636 4244 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249905.1 protein_id gnl|my_center|LOCUS_10430 4251 4643 gene locus_tag LOCUS_10440 4251 4643 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546768.1 protein_id gnl|my_center|LOCUS_10440 4660 5862 gene locus_tag LOCUS_10450 4660 5862 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_10450 7288 5897 gene locus_tag LOCUS_10460 7288 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7801 7442 gene locus_tag LOCUS_10470 7801 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9948 7948 gene locus_tag LOCUS_10480 9948 7948 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_10480 10182 10574 gene locus_tag LOCUS_10490 10182 10574 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_10490 10619 10693 gene locus_tag LOCUS_t00070 10619 10693 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 <1 1149 gene locus_tag LOCUS_10500 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079042.1:response regulator 1188 2009 gene locus_tag LOCUS_10510 1188 2009 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463499.1 protein_id gnl|my_center|LOCUS_10510 2027 2587 gene locus_tag LOCUS_10520 2027 2587 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105137.1 protein_id gnl|my_center|LOCUS_10520 2606 3001 gene locus_tag LOCUS_10530 2606 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10530 3006 3227 gene locus_tag LOCUS_10540 3006 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10540 3324 4814 gene locus_tag LOCUS_10550 3324 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4907 5269 gene locus_tag LOCUS_10560 4907 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 5446 6795 gene locus_tag LOCUS_10570 gene rsmB 5446 6795 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_10570 6876 7163 gene locus_tag LOCUS_10580 6876 7163 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812626.1 protein_id gnl|my_center|LOCUS_10580 7147 7425 gene locus_tag LOCUS_10590 7147 7425 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968708.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence079 721 491 gene locus_tag LOCUS_10600 721 491 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_10600 1419 805 gene locus_tag LOCUS_10610 1419 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2775 1450 gene locus_tag LOCUS_10620 gene ffh 2775 1450 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_10620 3517 2993 gene locus_tag LOCUS_10630 3517 2993 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404141.1 protein_id gnl|my_center|LOCUS_10630 4621 3635 gene locus_tag LOCUS_10640 4621 3635 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_10640 5176 4880 gene locus_tag LOCUS_10650 5176 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 7493 5334 gene locus_tag LOCUS_10660 7493 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7684 8607 gene locus_tag LOCUS_10670 7684 8607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_10670 8604 9425 gene locus_tag LOCUS_10680 8604 9425 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061729.1 protein_id gnl|my_center|LOCUS_10680 9434 10399 gene locus_tag LOCUS_10690 9434 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence080 1015 188 gene locus_tag LOCUS_10700 1015 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10700 1549 1016 gene locus_tag LOCUS_10710 1549 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10710 3273 1546 gene locus_tag LOCUS_10720 3273 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 4658 3426 gene locus_tag LOCUS_10730 4658 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5927 4674 gene locus_tag LOCUS_10740 5927 4674 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_10740 6192 6437 gene locus_tag LOCUS_10750 6192 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 6460 7233 gene locus_tag LOCUS_10760 6460 7233 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_10760 7220 7570 gene locus_tag LOCUS_10770 7220 7570 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_10770 8015 7590 gene locus_tag LOCUS_10780 8015 7590 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_10780 8784 8101 gene locus_tag LOCUS_10790 8784 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9084 9935 gene locus_tag LOCUS_10800 9084 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10249 10073 gene locus_tag LOCUS_10810 10249 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 10704 10480 gene locus_tag LOCUS_10820 10704 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence081 262 1815 gene locus_tag LOCUS_10830 gene gpmI 262 1815 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022631.1 protein_id gnl|my_center|LOCUS_10830 1865 3073 gene locus_tag LOCUS_10840 1865 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3361 4836 gene locus_tag LOCUS_10850 gene trpE 3361 4836 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_10850 4833 5408 gene locus_tag LOCUS_10860 4833 5408 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_10860 5405 6415 gene locus_tag LOCUS_10870 gene trpD 5405 6415 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_10870 6423 7202 gene locus_tag LOCUS_10880 gene trpC 6423 7202 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_10880 7202 8977 gene locus_tag LOCUS_10890 7202 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 8982 9770 gene locus_tag LOCUS_10900 gene trpA 8982 9770 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence082 1488 3692 gene locus_tag LOCUS_10910 1488 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3705 4721 gene locus_tag LOCUS_10920 3705 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4733 6862 gene locus_tag LOCUS_10930 4733 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 7210 8130 gene locus_tag LOCUS_10940 7210 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence083 199 2148 gene locus_tag LOCUS_10950 199 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2267 2968 gene locus_tag LOCUS_10960 2267 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4261 2969 gene locus_tag LOCUS_10970 4261 2969 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10970 4893 4243 gene locus_tag LOCUS_10980 4893 4243 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_10980 6533 5082 gene locus_tag LOCUS_10990 6533 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 10462 6596 gene locus_tag LOCUS_11000 10462 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence084 207 1568 gene locus_tag LOCUS_11010 207 1568 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_11010 1612 3108 gene locus_tag LOCUS_11020 1612 3108 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_11020 3211 3960 gene locus_tag LOCUS_11030 3211 3960 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_11030 5620 3950 gene locus_tag LOCUS_11040 5620 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7532 5640 gene locus_tag LOCUS_11050 7532 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 9348 7579 gene locus_tag LOCUS_11060 9348 7579 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 protein_id gnl|my_center|LOCUS_11060 9793 9350 gene locus_tag LOCUS_11070 gene rsbW 9793 9350 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970573.1 protein_id gnl|my_center|LOCUS_11070 10190 9837 gene locus_tag LOCUS_11080 10190 9837 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884017.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence085 631 1464 gene locus_tag LOCUS_11090 631 1464 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_11090 1528 1959 gene locus_tag LOCUS_11100 1528 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 4703 1995 gene locus_tag LOCUS_11110 4703 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 5046 5792 gene locus_tag LOCUS_11120 5046 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5922 7226 gene locus_tag LOCUS_11130 5922 7226 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656113.1 protein_id gnl|my_center|LOCUS_11130 7278 7673 gene locus_tag LOCUS_11140 7278 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8882 7746 gene locus_tag LOCUS_11150 8882 7746 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_11150 9607 8915 gene locus_tag LOCUS_11160 9607 8915 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence086 440 3172 gene locus_tag LOCUS_11170 440 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3223 6612 gene locus_tag LOCUS_11180 3223 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6638 7669 gene locus_tag LOCUS_11190 6638 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_11190 7787 9100 gene locus_tag LOCUS_11200 7787 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 9503 10353 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgtcttgatggaatatggggtaaaac >Feature sequence087 461 303 gene locus_tag LOCUS_11210 461 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 631 1341 gene locus_tag LOCUS_11220 631 1341 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790337.1 protein_id gnl|my_center|LOCUS_11220 2327 1362 gene locus_tag LOCUS_11230 gene cmoB 2327 1362 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764771.1 protein_id gnl|my_center|LOCUS_11230 3070 2345 gene locus_tag LOCUS_11240 gene cmoA 3070 2345 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_11240 3697 3074 gene locus_tag LOCUS_11250 3697 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 6637 3893 gene locus_tag LOCUS_11260 6637 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8082 6826 gene locus_tag LOCUS_11270 gene ahcY 8082 6826 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_11270 8263 8604 gene locus_tag LOCUS_11280 gene hypA 8263 8604 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_11280 8622 9464 gene locus_tag LOCUS_11290 gene hypB 8622 9464 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence088 69 662 gene locus_tag LOCUS_11300 69 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 830 1558 gene locus_tag LOCUS_11310 830 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1656 3308 gene locus_tag LOCUS_11320 1656 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3848 3408 gene locus_tag LOCUS_11330 3848 3408 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816355.1 protein_id gnl|my_center|LOCUS_11330 4435 3926 gene locus_tag LOCUS_11340 4435 3926 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_11340 4778 4461 gene locus_tag LOCUS_11350 4778 4461 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_11350 5564 4884 gene locus_tag LOCUS_11360 5564 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6799 5567 gene locus_tag LOCUS_11370 6799 5567 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_11370 7276 6824 gene locus_tag LOCUS_11380 7276 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9909 7549 gene locus_tag LOCUS_11390 9909 7549 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence089 301 1692 gene locus_tag LOCUS_11400 gene lysC 301 1692 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_11400 2173 1706 gene locus_tag LOCUS_11410 2173 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4204 2297 gene locus_tag LOCUS_11420 4204 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4944 4378 gene locus_tag LOCUS_11430 4944 4378 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_11430 5344 4931 gene locus_tag LOCUS_11440 5344 4931 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284305.1 protein_id gnl|my_center|LOCUS_11440 5507 6394 gene locus_tag LOCUS_11450 5507 6394 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_11450 6565 6873 gene locus_tag LOCUS_11460 6565 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7026 7799 gene locus_tag LOCUS_11470 7026 7799 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_11470 8395 9273 gene locus_tag LOCUS_11480 8395 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9982 9263 gene locus_tag LOCUS_11490 9982 9263 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_11490 10182 9991 gene locus_tag LOCUS_11500 10182 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence090 630 244 gene locus_tag LOCUS_11510 630 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 1635 733 gene locus_tag LOCUS_11520 1635 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11520 2714 1665 gene locus_tag LOCUS_11530 gene hemE 2714 1665 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444333.1 protein_id gnl|my_center|LOCUS_11530 3514 2738 gene locus_tag LOCUS_11540 3514 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4425 3511 gene locus_tag LOCUS_11550 gene hemC 4425 3511 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392763.1 protein_id gnl|my_center|LOCUS_11550 5702 4425 gene locus_tag LOCUS_11560 gene hemA 5702 4425 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_11560 6538 5714 gene locus_tag LOCUS_11570 6538 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6910 7332 gene locus_tag LOCUS_11580 6910 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7519 8802 gene locus_tag LOCUS_11590 7519 8802 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794276.1 protein_id gnl|my_center|LOCUS_11590 8879 10078 gene locus_tag LOCUS_11600 8879 10078 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence091 2591 132 gene locus_tag LOCUS_11610 2591 132 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927087.1 protein_id gnl|my_center|LOCUS_11610 3523 2795 gene locus_tag LOCUS_11620 3523 2795 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080870.1 protein_id gnl|my_center|LOCUS_11620 6238 3839 gene locus_tag LOCUS_11630 6238 3839 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461246.1 protein_id gnl|my_center|LOCUS_11630 7515 6244 gene locus_tag LOCUS_11640 7515 6244 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786054.1 protein_id gnl|my_center|LOCUS_11640 8638 7526 gene locus_tag LOCUS_11650 8638 7526 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405516.1 protein_id gnl|my_center|LOCUS_11650 <10071 8691 gene locus_tag LOCUS_11660 <10071 8691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000837178.1:glycosyl hydrolase family 18 protein >Feature sequence092 136 357 gene locus_tag LOCUS_11670 136 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 629 453 gene locus_tag LOCUS_11680 629 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1672 2565 gene locus_tag LOCUS_11690 1672 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2565 4247 gene locus_tag LOCUS_11700 2565 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4446 7835 gene locus_tag LOCUS_11710 4446 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8321 7980 gene locus_tag LOCUS_11720 8321 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 9119 8625 gene locus_tag LOCUS_11730 9119 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11730 9358 9116 gene locus_tag LOCUS_11740 9358 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 >Feature sequence093 296 916 gene locus_tag LOCUS_11750 296 916 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_11750 925 1842 gene locus_tag LOCUS_11760 925 1842 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_11760 1857 3359 gene locus_tag LOCUS_11770 1857 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5372 3432 gene locus_tag LOCUS_11780 5372 3432 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_11780 6129 5398 gene locus_tag LOCUS_11790 6129 5398 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_11790 7220 6138 gene locus_tag LOCUS_11800 7220 6138 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947763.1 protein_id gnl|my_center|LOCUS_11800 7846 7232 gene locus_tag LOCUS_11810 7846 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 8829 7849 gene locus_tag LOCUS_11820 8829 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 9526 9197 gene locus_tag LOCUS_11830 9526 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 9641 9566 gene locus_tag LOCUS_t00080 9641 9566 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10005 9784 gene locus_tag LOCUS_11840 10005 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence094 2687 342 gene locus_tag LOCUS_11850 2687 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11850 3607 2831 gene locus_tag LOCUS_11860 3607 2831 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_11860 3796 6591 gene locus_tag LOCUS_11870 3796 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7265 9583 gene locus_tag LOCUS_11880 7265 9583 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658985.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence095 1068 199 gene locus_tag LOCUS_11890 gene atpG 1068 199 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_11890 2591 1068 gene locus_tag LOCUS_11900 gene atpA 2591 1068 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_11900 3150 2617 gene locus_tag LOCUS_11910 gene atpH 3150 2617 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475836.1 protein_id gnl|my_center|LOCUS_11910 3661 3167 gene locus_tag LOCUS_11920 gene atpF 3661 3167 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552096.1 protein_id gnl|my_center|LOCUS_11920 3929 3690 gene locus_tag LOCUS_11930 gene atpE 3929 3690 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931714.1 protein_id gnl|my_center|LOCUS_11930 4862 4011 gene locus_tag LOCUS_11940 4862 4011 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931715.1 protein_id gnl|my_center|LOCUS_11940 5254 4859 gene locus_tag LOCUS_11950 5254 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5493 5254 gene locus_tag LOCUS_11960 5493 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5889 5500 gene locus_tag LOCUS_11970 5889 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6708 5899 gene locus_tag LOCUS_11980 6708 5899 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545938.1 protein_id gnl|my_center|LOCUS_11980 7588 6722 gene locus_tag LOCUS_11990 7588 6722 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933510.1 protein_id gnl|my_center|LOCUS_11990 8339 7575 gene locus_tag LOCUS_12000 8339 7575 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_12000 8577 9707 gene locus_tag LOCUS_12010 8577 9707 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence096 1738 785 gene locus_tag LOCUS_12020 1738 785 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_12020 7258 1742 gene locus_tag LOCUS_12030 7258 1742 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_12030 7950 7477 gene locus_tag LOCUS_12040 7950 7477 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_12040 8148 9089 gene locus_tag LOCUS_12050 8148 9089 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence097 <1 1116 gene locus_tag LOCUS_12060 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902151.1:alkaline phosphatase family protein 1238 1744 gene locus_tag LOCUS_12070 1238 1744 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_12070 1813 2049 gene locus_tag LOCUS_12080 1813 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2080 2811 gene locus_tag LOCUS_12090 2080 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2979 5681 gene locus_tag LOCUS_12100 2979 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5742 6863 gene locus_tag LOCUS_12110 5742 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8299 6875 gene locus_tag LOCUS_12120 gene lpdA 8299 6875 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_12120 9706 8372 gene locus_tag LOCUS_12130 9706 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence098 167 853 gene locus_tag LOCUS_12140 167 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 862 2304 gene locus_tag LOCUS_12150 862 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3564 2293 gene locus_tag LOCUS_12160 3564 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4061 3561 gene locus_tag LOCUS_12170 4061 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6983 4833 gene locus_tag LOCUS_12180 6983 4833 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 9370 7163 gene locus_tag LOCUS_12190 gene rnr 9370 7163 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence099 1146 697 gene locus_tag LOCUS_12200 1146 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1531 1169 gene locus_tag LOCUS_12210 1531 1169 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_12210 2301 1729 gene locus_tag LOCUS_12220 2301 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3960 2518 gene locus_tag LOCUS_12230 3960 2518 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12230 4179 4012 gene locus_tag LOCUS_12240 4179 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 4546 4746 gene locus_tag LOCUS_12250 4546 4746 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_12250 4961 7030 gene locus_tag LOCUS_12260 gene fusA 4961 7030 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_12260 7148 7657 gene locus_tag LOCUS_12270 7148 7657 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_12270 7666 8025 gene locus_tag LOCUS_12280 7666 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 8022 8894 gene locus_tag LOCUS_12290 8022 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12290 9042 9572 gene locus_tag LOCUS_12300 9042 9572 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence100 <1 700 gene locus_tag LOCUS_12310 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG 705 1157 gene locus_tag LOCUS_12320 705 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1202 2275 gene locus_tag LOCUS_12330 1202 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_12330 2531 3727 gene locus_tag LOCUS_12340 2531 3727 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 protein_id gnl|my_center|LOCUS_12340 3865 4623 gene locus_tag LOCUS_12350 3865 4623 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174408902.1 protein_id gnl|my_center|LOCUS_12350 4628 5545 gene locus_tag LOCUS_12360 4628 5545 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_12360 5744 6718 gene locus_tag LOCUS_12370 gene argF 5744 6718 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_12370 7061 8755 gene locus_tag LOCUS_12380 7061 8755 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403563.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence101 899 2014 gene locus_tag LOCUS_12390 899 2014 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_12390 3022 2042 gene locus_tag LOCUS_12400 3022 2042 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_12400 4144 3089 gene locus_tag LOCUS_12410 gene arsB 4144 3089 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_12410 4321 5916 gene locus_tag LOCUS_12420 4321 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6070 6876 gene locus_tag LOCUS_12430 6070 6876 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_12430 7275 8525 gene locus_tag LOCUS_12440 7275 8525 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_12440 8610 9200 gene locus_tag LOCUS_12450 8610 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence102 <1 767 gene locus_tag LOCUS_12460 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839168.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase 1043 1762 gene locus_tag LOCUS_12470 1043 1762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_12470 1807 3273 gene locus_tag LOCUS_12480 1807 3273 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_12480 4028 3312 gene locus_tag LOCUS_12490 4028 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5581 4028 gene locus_tag LOCUS_12500 5581 4028 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_12500 6696 5683 gene locus_tag LOCUS_12510 6696 5683 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_12510 6870 7154 gene locus_tag LOCUS_12520 6870 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7355 8437 gene locus_tag LOCUS_12530 7355 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 8401 9231 gene locus_tag LOCUS_12540 8401 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 9452 9538 gene locus_tag LOCUS_t00090 9452 9538 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence103 275 724 gene locus_tag LOCUS_12550 275 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 727 2091 gene locus_tag LOCUS_12560 727 2091 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_12560 2271 3140 gene locus_tag LOCUS_12570 2271 3140 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_12570 3143 4234 gene locus_tag LOCUS_12580 3143 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4234 4716 gene locus_tag LOCUS_12590 4234 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4919 6502 gene locus_tag LOCUS_12600 4919 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6499 7437 gene locus_tag LOCUS_12610 6499 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7862 8374 gene locus_tag LOCUS_12620 7862 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence104 1682 531 gene locus_tag LOCUS_12630 gene murF 1682 531 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595957.1 protein_id gnl|my_center|LOCUS_12630 3147 1690 gene locus_tag LOCUS_12640 gene cysS 3147 1690 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_12640 4563 3547 gene locus_tag LOCUS_12650 4563 3547 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_12650 6005 4569 gene locus_tag LOCUS_12660 gene gltX 6005 4569 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_12660 6633 6013 gene locus_tag LOCUS_12670 6633 6013 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_12670 7797 6766 gene locus_tag LOCUS_12680 gene queA 7797 6766 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_12680 8841 7822 gene locus_tag LOCUS_12690 gene ruvB 8841 7822 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_12690 <9490 8966 gene locus_tag LOCUS_12700 <9490 8966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086122.1:Holliday junction branch migration protein RuvA >Feature sequence105 266 1330 gene locus_tag LOCUS_12710 266 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1442 1514 gene locus_tag LOCUS_t00100 1442 1514 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1632 2288 gene locus_tag LOCUS_12720 1632 2288 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_12720 2300 2872 gene locus_tag LOCUS_12730 gene pth 2300 2872 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545410.1 protein_id gnl|my_center|LOCUS_12730 2891 4951 gene locus_tag LOCUS_12740 2891 4951 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_12740 5165 5641 gene locus_tag LOCUS_12750 5165 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 5645 5872 gene locus_tag LOCUS_12760 gene rpsR 5645 5872 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_12760 5893 6336 gene locus_tag LOCUS_12770 gene rplI 5893 6336 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_12770 6551 8998 gene locus_tag LOCUS_12780 gene priA 6551 8998 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence106 1764 1213 gene locus_tag LOCUS_12790 1764 1213 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932941.1 protein_id gnl|my_center|LOCUS_12790 2614 1799 gene locus_tag LOCUS_12800 2614 1799 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649894.1 protein_id gnl|my_center|LOCUS_12800 2796 3005 gene locus_tag LOCUS_12810 2796 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4631 3207 gene locus_tag LOCUS_12820 gene pruA 4631 3207 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_12820 4838 4686 gene locus_tag LOCUS_12830 4838 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5227 6498 gene locus_tag LOCUS_12840 5227 6498 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932902.1 protein_id gnl|my_center|LOCUS_12840 7423 6569 gene locus_tag LOCUS_12850 7423 6569 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965435.1 protein_id gnl|my_center|LOCUS_12850 7800 7510 gene locus_tag LOCUS_12860 7800 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 8297 9331 gene locus_tag LOCUS_12870 8297 9331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence107 <1 1029 gene locus_tag LOCUS_12880 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:type IX secretion system sortase PorU 1026 2039 gene locus_tag LOCUS_12890 gene porV 1026 2039 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_12890 2112 2795 gene locus_tag LOCUS_12900 2112 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2808 3302 gene locus_tag LOCUS_12910 2808 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3331 4473 gene locus_tag LOCUS_12920 3331 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 4688 5827 gene locus_tag LOCUS_12930 4688 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6015 7604 gene locus_tag LOCUS_12940 6015 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7849 8712 gene locus_tag LOCUS_12950 gene prfB 7849 8712 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence108 757 563 gene locus_tag LOCUS_12960 757 563 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_12960 1144 881 gene locus_tag LOCUS_12970 gene rpmA 1144 881 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_12970 1711 1145 gene locus_tag LOCUS_12980 1711 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2472 2083 gene locus_tag LOCUS_12990 2472 2083 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545317.1 protein_id gnl|my_center|LOCUS_12990 2665 4107 gene locus_tag LOCUS_13000 2665 4107 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202873.1 protein_id gnl|my_center|LOCUS_13000 5461 4205 gene locus_tag LOCUS_13010 5461 4205 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_13010 6847 5645 gene locus_tag LOCUS_13020 6847 5645 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_13020 8929 6911 gene locus_tag LOCUS_13030 8929 6911 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence109 2889 1519 gene locus_tag LOCUS_13040 2889 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4669 2996 gene locus_tag LOCUS_13050 4669 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 6998 4767 gene locus_tag LOCUS_13060 6998 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 8998 7016 gene locus_tag LOCUS_13070 8998 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence110 <1 734 gene locus_tag LOCUS_13080 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941827.1:tetratricopeptide repeat protein 743 967 gene locus_tag LOCUS_13090 743 967 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_13090 971 1330 gene locus_tag LOCUS_13100 971 1330 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010015189.1 protein_id gnl|my_center|LOCUS_13100 1494 2714 gene locus_tag LOCUS_13110 1494 2714 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_13110 3165 2788 gene locus_tag LOCUS_13120 3165 2788 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769565.1 protein_id gnl|my_center|LOCUS_13120 3282 4985 gene locus_tag LOCUS_13130 3282 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 5133 6395 gene locus_tag LOCUS_13140 5133 6395 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_13140 6418 7773 gene locus_tag LOCUS_13150 6418 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 8958 7816 gene locus_tag LOCUS_13160 8958 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence111 503 2311 gene locus_tag LOCUS_13170 gene mutL 503 2311 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_13170 2443 3366 gene locus_tag LOCUS_13180 gene miaA 2443 3366 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_13180 3586 3897 gene locus_tag LOCUS_13190 3586 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4483 3983 gene locus_tag LOCUS_13200 gene tpx 4483 3983 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_13200 6439 4565 gene locus_tag LOCUS_13210 6439 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8166 6772 gene locus_tag LOCUS_13220 8166 6772 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767086.1 protein_id gnl|my_center|LOCUS_13220 9128 8178 gene locus_tag LOCUS_13230 9128 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence112 4678 1340 gene locus_tag LOCUS_13240 4678 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7387 5177 gene locus_tag LOCUS_13250 7387 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8962 7637 gene locus_tag LOCUS_13260 8962 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence113 401 1141 gene locus_tag LOCUS_13270 401 1141 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_13270 1138 3369 gene locus_tag LOCUS_13280 1138 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3359 3820 gene locus_tag LOCUS_13290 3359 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3904 4230 gene locus_tag LOCUS_13300 gene trxA 3904 4230 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_13300 4310 4912 gene locus_tag LOCUS_13310 gene yihA 4310 4912 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965924.1 protein_id gnl|my_center|LOCUS_13310 5036 6709 gene locus_tag LOCUS_13320 5036 6709 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228762.1 protein_id gnl|my_center|LOCUS_13320 6706 7500 gene locus_tag LOCUS_13330 6706 7500 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_13330 7516 7743 gene locus_tag LOCUS_13340 7516 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7965 7756 gene locus_tag LOCUS_13350 7965 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 <8887 8336 gene locus_tag LOCUS_13360 <8887 8336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926895.1:DUF92 domain-containing protein >Feature sequence114 677 3448 gene locus_tag LOCUS_13370 677 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3533 4138 gene locus_tag LOCUS_13380 3533 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4147 4977 gene locus_tag LOCUS_13390 4147 4977 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 protein_id gnl|my_center|LOCUS_13390 5136 6587 gene locus_tag LOCUS_13400 gene glpK 5136 6587 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931879.1 protein_id gnl|my_center|LOCUS_13400 8310 6640 gene locus_tag LOCUS_13410 8310 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence115 1669 110 gene locus_tag LOCUS_13420 1669 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1964 1674 gene locus_tag LOCUS_13430 1964 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3681 1981 gene locus_tag LOCUS_13440 gene ggt 3681 1981 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_13440 4202 3678 gene locus_tag LOCUS_13450 4202 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 5025 4180 gene locus_tag LOCUS_13460 5025 4180 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 protein_id gnl|my_center|LOCUS_13460 6636 5029 gene locus_tag LOCUS_13470 gene recJ 6636 5029 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_13470 7912 7199 gene locus_tag LOCUS_13480 7912 7199 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_13480 8121 8047 gene locus_tag LOCUS_t00110 8121 8047 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence116 7 912 gene locus_tag LOCUS_13490 7 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 966 4772 gene locus_tag LOCUS_13500 966 4772 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_13500 6063 4804 gene locus_tag LOCUS_13510 6063 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6253 6693 gene locus_tag LOCUS_13520 6253 6693 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876802.1 protein_id gnl|my_center|LOCUS_13520 6696 7559 gene locus_tag LOCUS_13530 6696 7559 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079932.1 protein_id gnl|my_center|LOCUS_13530 7742 8080 gene locus_tag LOCUS_13540 7742 8080 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_13540 8081 8476 gene locus_tag LOCUS_13550 8081 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence117 <1 2812 gene locus_tag LOCUS_13560 <1 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256518.1:TAT-variant-translocated molybdopterin oxidoreductase 2850 4244 gene locus_tag LOCUS_13570 gene nrfD 2850 4244 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_13570 4257 4799 gene locus_tag LOCUS_13580 4257 4799 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_13580 4886 5398 gene locus_tag LOCUS_13590 4886 5398 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 protein_id gnl|my_center|LOCUS_13590 5447 6631 gene locus_tag LOCUS_13600 5447 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_13600 6855 6661 gene locus_tag LOCUS_13610 6855 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6874 7416 gene locus_tag LOCUS_13620 6874 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7875 8273 gene locus_tag LOCUS_13630 7875 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence118 <1 1326 gene locus_tag LOCUS_13640 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939096.1:L-aspartate oxidase 1431 4088 gene locus_tag LOCUS_13650 1431 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6368 4164 gene locus_tag LOCUS_13660 6368 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7217 6393 gene locus_tag LOCUS_13670 7217 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7237 7812 gene locus_tag LOCUS_13680 7237 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7999 7790 gene locus_tag LOCUS_13690 7999 7790 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202520.1 protein_id gnl|my_center|LOCUS_13690 <8718 8020 gene locus_tag LOCUS_13700 <8718 8020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121009277.1:sulfite exporter TauE/SafE family protein >Feature sequence119 4907 774 gene locus_tag LOCUS_13710 4907 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5538 4918 gene locus_tag LOCUS_13720 5538 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6646 5558 gene locus_tag LOCUS_13730 6646 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 7691 6678 gene locus_tag LOCUS_13740 7691 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 <8704 7921 gene locus_tag LOCUS_13750 <8704 7921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence120 4080 991 gene locus_tag LOCUS_13760 4080 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6072 4204 gene locus_tag LOCUS_13770 6072 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6894 6400 gene locus_tag LOCUS_13780 6894 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7215 8177 gene locus_tag LOCUS_13790 7215 8177 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence121 2258 177 gene locus_tag LOCUS_13800 gene fusA 2258 177 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_13800 2740 2270 gene locus_tag LOCUS_13810 gene rpsG 2740 2270 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_13810 3139 2765 gene locus_tag LOCUS_13820 gene rpsL 3139 2765 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_13820 7460 3198 gene locus_tag LOCUS_13830 gene rpoC 7460 3198 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_13830 <8632 7569 gene locus_tag LOCUS_13840 <8632 7569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927192.1:DNA-directed RNA polymerase subunit beta >Feature sequence122 955 308 gene locus_tag LOCUS_13850 955 308 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_13850 2693 1371 gene locus_tag LOCUS_13860 gene pfp 2693 1371 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546508.1 protein_id gnl|my_center|LOCUS_13860 3018 4712 gene locus_tag LOCUS_13870 3018 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6085 4709 gene locus_tag LOCUS_13880 6085 4709 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_13880 6777 6103 gene locus_tag LOCUS_13890 6777 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 7116 7868 gene locus_tag LOCUS_13900 7116 7868 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_13900 7901 8314 gene locus_tag LOCUS_13910 7901 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8440 8352 gene locus_tag LOCUS_t00120 8440 8352 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 1462 995 gene locus_tag LOCUS_13920 1462 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3286 1961 gene locus_tag LOCUS_13930 3286 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5371 3290 gene locus_tag LOCUS_13940 5371 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5557 5985 gene locus_tag LOCUS_13950 5557 5985 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_13950 6000 7265 gene locus_tag LOCUS_13960 6000 7265 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13960 7292 7456 gene locus_tag LOCUS_13970 7292 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 8129 7476 gene locus_tag LOCUS_13980 8129 7476 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence124 <1 564 gene locus_tag LOCUS_13990 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402820.1:YicC family protein 599 1156 gene locus_tag LOCUS_14000 gene gmk 599 1156 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931939.1 protein_id gnl|my_center|LOCUS_14000 1160 2203 gene locus_tag LOCUS_14010 1160 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2406 3176 gene locus_tag LOCUS_14020 2406 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3272 4666 gene locus_tag LOCUS_14030 gene dnaB 3272 4666 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_14030 4702 6909 gene locus_tag LOCUS_14040 4702 6909 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_14040 6989 7459 gene locus_tag LOCUS_14050 gene greA 6989 7459 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840123.1 protein_id gnl|my_center|LOCUS_14050 7611 8315 gene locus_tag LOCUS_14060 7611 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence125 112 804 gene locus_tag LOCUS_14070 112 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1900 809 gene locus_tag LOCUS_14080 1900 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 2790 1969 gene locus_tag LOCUS_14090 2790 1969 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_14090 3562 2804 gene locus_tag LOCUS_14100 3562 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3903 3640 gene locus_tag LOCUS_14110 3903 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4171 7320 gene locus_tag LOCUS_14120 4171 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7990 7469 gene locus_tag LOCUS_14130 7990 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence126 345 58 gene locus_tag LOCUS_14140 345 58 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365849.1 protein_id gnl|my_center|LOCUS_14140 662 393 gene locus_tag LOCUS_14150 662 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3048 664 gene locus_tag LOCUS_14160 gene pheT 3048 664 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_14160 4074 3067 gene locus_tag LOCUS_14170 gene pheS 4074 3067 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_14170 4683 4336 gene locus_tag LOCUS_14180 gene rplT 4683 4336 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405508.1 protein_id gnl|my_center|LOCUS_14180 5325 4921 gene locus_tag LOCUS_14190 gene infC 5325 4921 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 7413 5479 gene locus_tag LOCUS_14200 gene thrS 7413 5479 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_14200 7552 7478 gene locus_tag LOCUS_t00130 7552 7478 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7717 7633 gene locus_tag LOCUS_t00140 7717 7633 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8209 8116 gene locus_tag LOCUS_t00150 8209 8116 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 8437 8294 gene locus_tag LOCUS_14210 8437 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence127 551 4117 gene locus_tag LOCUS_14220 gene nifJ 551 4117 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_14220 4190 5182 gene locus_tag LOCUS_14230 4190 5182 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_14230 5312 6412 gene locus_tag LOCUS_14240 5312 6412 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_14240 6409 7188 gene locus_tag LOCUS_14250 6409 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7124 7699 gene locus_tag LOCUS_14260 7124 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7712 8014 gene locus_tag LOCUS_14270 7712 8014 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_14270 8177 8252 gene locus_tag LOCUS_t00160 8177 8252 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence128 545 153 gene locus_tag LOCUS_14280 545 153 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_14280 1705 545 gene locus_tag LOCUS_14290 1705 545 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_14290 2781 1735 gene locus_tag LOCUS_14300 2781 1735 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_14300 3381 5213 gene locus_tag LOCUS_14310 3381 5213 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_14310 5219 6247 gene locus_tag LOCUS_14320 5219 6247 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_14320 6401 7408 gene locus_tag LOCUS_14330 6401 7408 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_14330 7478 7549 gene locus_tag LOCUS_t00170 7478 7549 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7561 7635 gene locus_tag LOCUS_t00180 7561 7635 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7723 7796 gene locus_tag LOCUS_t00190 7723 7796 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8032 8190 gene locus_tag LOCUS_14340 8032 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence129 1290 508 gene locus_tag LOCUS_14350 1290 508 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_14350 2093 1293 gene locus_tag LOCUS_14360 2093 1293 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192063.1 protein_id gnl|my_center|LOCUS_14360 4448 2286 gene locus_tag LOCUS_14370 4448 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5440 4763 gene locus_tag LOCUS_14380 5440 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_14380 5646 5437 gene locus_tag LOCUS_14390 5646 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6383 5760 gene locus_tag LOCUS_14400 6383 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7801 6410 gene locus_tag LOCUS_14410 7801 6410 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_14410 <8336 7801 gene locus_tag LOCUS_14420 <8336 7801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098784.1:heavy metal response regulator transcription factor >Feature sequence130 525 1070 gene locus_tag LOCUS_14430 525 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14430 1457 2695 gene locus_tag LOCUS_14440 1457 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2824 2654 gene locus_tag LOCUS_14450 2824 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2893 3657 gene locus_tag LOCUS_14460 gene agaR 2893 3657 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 protein_id gnl|my_center|LOCUS_14460 3673 4932 gene locus_tag LOCUS_14470 3673 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4958 5746 gene locus_tag LOCUS_14480 4958 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 5686 6324 gene locus_tag LOCUS_14490 5686 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 6646 7791 gene locus_tag LOCUS_14500 6646 7791 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence131 3491 1380 gene locus_tag LOCUS_14510 3491 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4069 3500 gene locus_tag LOCUS_14520 4069 3500 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14520 4794 4186 gene locus_tag LOCUS_14530 4794 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5960 4815 gene locus_tag LOCUS_14540 gene lapB 5960 4815 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 protein_id gnl|my_center|LOCUS_14540 6310 5978 gene locus_tag LOCUS_14550 6310 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 6966 6571 gene locus_tag LOCUS_14560 6966 6571 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_14560 7560 7009 gene locus_tag LOCUS_14570 7560 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 8306 7539 gene locus_tag LOCUS_14580 8306 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence132 482 171 gene locus_tag LOCUS_14590 482 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 784 1233 gene locus_tag LOCUS_14600 784 1233 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932791.1 protein_id gnl|my_center|LOCUS_14600 1672 4302 gene locus_tag LOCUS_14610 1672 4302 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_14610 4585 6150 gene locus_tag LOCUS_14620 gene rng 4585 6150 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_14620 6147 7682 gene locus_tag LOCUS_14630 6147 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence133 <1 519 gene locus_tag LOCUS_14640 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120272.1:serine acetyltransferase 596 1507 gene locus_tag LOCUS_14650 gene cysK 596 1507 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_14650 5974 1532 gene locus_tag LOCUS_14660 5974 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 7878 6163 gene locus_tag LOCUS_14670 7878 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence134 221 526 gene locus_tag LOCUS_14680 221 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 542 2326 gene locus_tag LOCUS_14690 542 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2319 2939 gene locus_tag LOCUS_14700 2319 2939 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081580.1 protein_id gnl|my_center|LOCUS_14700 2936 4576 gene locus_tag LOCUS_14710 2936 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4588 6018 gene locus_tag LOCUS_14720 4588 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6117 6311 gene locus_tag LOCUS_14730 6117 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6395 7426 gene locus_tag LOCUS_14740 6395 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 7589 7750 gene locus_tag LOCUS_14750 7589 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence135 2264 114 gene locus_tag LOCUS_14760 2264 114 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_14760 3662 2463 gene locus_tag LOCUS_14770 3662 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4841 3918 gene locus_tag LOCUS_14780 4841 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5548 4862 gene locus_tag LOCUS_14790 5548 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6679 5567 gene locus_tag LOCUS_14800 6679 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7643 6819 gene locus_tag LOCUS_14810 7643 6819 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence136 <1 2098 gene locus_tag LOCUS_14820 <1 2098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098744.1:outer membrane channel protein TolC 2287 3396 gene locus_tag LOCUS_14830 2287 3396 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_14830 3403 6582 gene locus_tag LOCUS_14840 3403 6582 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402871.1 protein_id gnl|my_center|LOCUS_14840 6583 7263 gene locus_tag LOCUS_14850 6583 7263 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence137 1017 2033 gene locus_tag LOCUS_14860 1017 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2159 2767 gene locus_tag LOCUS_14870 2159 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2980 3777 gene locus_tag LOCUS_14880 2980 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3780 4973 gene locus_tag LOCUS_14890 3780 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4995 6443 gene locus_tag LOCUS_14900 4995 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 6674 7474 gene locus_tag LOCUS_14910 6674 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence138 1661 1308 gene locus_tag LOCUS_14920 gene rsfS 1661 1308 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926804.1 protein_id gnl|my_center|LOCUS_14920 2330 1674 gene locus_tag LOCUS_14930 2330 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2956 2423 gene locus_tag LOCUS_14940 2956 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3893 3018 gene locus_tag LOCUS_14950 gene panC 3893 3018 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_14950 4695 3877 gene locus_tag LOCUS_14960 gene panB 4695 3877 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942349.1 protein_id gnl|my_center|LOCUS_14960 5221 4820 gene locus_tag LOCUS_14970 5221 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6566 5457 gene locus_tag LOCUS_14980 gene mnmA 6566 5457 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_14980 7018 6599 gene locus_tag LOCUS_14990 7018 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7178 7345 gene locus_tag LOCUS_15000 7178 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7284 7643 gene locus_tag LOCUS_15010 7284 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence139 <1 1490 gene locus_tag LOCUS_15020 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931835.1:DNA gyrase subunit A 1528 2151 gene locus_tag LOCUS_15030 1528 2151 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936275.1 protein_id gnl|my_center|LOCUS_15030 3318 2230 gene locus_tag LOCUS_15040 3318 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4372 3335 gene locus_tag LOCUS_15050 gene mtnA 4372 3335 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_15050 4472 5290 gene locus_tag LOCUS_15060 4472 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5541 5287 gene locus_tag LOCUS_15070 5541 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6100 5519 gene locus_tag LOCUS_15080 6100 5519 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_15080 7340 6189 gene locus_tag LOCUS_15090 7340 6189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence140 560 1840 gene locus_tag LOCUS_15100 gene yegQ 560 1840 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_15100 1908 2672 gene locus_tag LOCUS_15110 1908 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2862 3923 gene locus_tag LOCUS_15120 2862 3923 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920814.1 protein_id gnl|my_center|LOCUS_15120 3995 5386 gene locus_tag LOCUS_15130 gene rsmF 3995 5386 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705938.1 protein_id gnl|my_center|LOCUS_15130 7501 5414 gene locus_tag LOCUS_15140 7501 5414 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence141 <1 882 gene locus_tag LOCUS_15150 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867373.1:methylmalonyl Co-A mutase-associated GTPase MeaB 879 1283 gene locus_tag LOCUS_15160 gene mce 879 1283 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_15160 1333 1803 gene locus_tag LOCUS_15170 1333 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 3125 2199 gene locus_tag LOCUS_15180 3125 2199 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_15180 4556 3300 gene locus_tag LOCUS_15190 gene murA 4556 3300 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_15190 4739 4560 gene locus_tag LOCUS_15200 4739 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5605 4796 gene locus_tag LOCUS_15210 5605 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15210 6555 5620 gene locus_tag LOCUS_15220 6555 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 6699 7751 gene locus_tag LOCUS_15230 6699 7751 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence142 1047 2090 gene locus_tag LOCUS_15240 1047 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2112 4016 gene locus_tag LOCUS_15250 2112 4016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_15250 4203 5138 gene locus_tag LOCUS_15260 4203 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5388 6617 gene locus_tag LOCUS_15270 5388 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6799 7422 gene locus_tag LOCUS_15280 6799 7422 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660625.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence143 1503 139 gene locus_tag LOCUS_15290 gene hslU 1503 139 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_15290 2435 1884 gene locus_tag LOCUS_15300 gene hslV 2435 1884 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_15300 3924 2455 gene locus_tag LOCUS_15310 gene rpoN 3924 2455 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_15310 4898 4059 gene locus_tag LOCUS_15320 4898 4059 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_15320 5988 4903 gene locus_tag LOCUS_15330 gene hisC 5988 4903 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_15330 6212 6892 gene locus_tag LOCUS_15340 6212 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence144 1230 397 gene locus_tag LOCUS_15350 1230 397 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_15350 1871 1236 gene locus_tag LOCUS_15360 1871 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2564 1881 gene locus_tag LOCUS_15370 2564 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3255 2566 gene locus_tag LOCUS_15380 3255 2566 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_15380 3695 3381 gene locus_tag LOCUS_15390 3695 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3825 5681 gene locus_tag LOCUS_15400 gene dnaG 3825 5681 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990130.1 protein_id gnl|my_center|LOCUS_15400 7322 5673 gene locus_tag LOCUS_15410 7322 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence145 31 372 gene locus_tag LOCUS_15420 gene rplS 31 372 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181402.1 protein_id gnl|my_center|LOCUS_15420 848 417 gene locus_tag LOCUS_15430 848 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 921 2633 gene locus_tag LOCUS_15440 921 2633 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933669.1 protein_id gnl|my_center|LOCUS_15440 2636 3448 gene locus_tag LOCUS_15450 gene dapF 2636 3448 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_15450 3556 4497 gene locus_tag LOCUS_15460 3556 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4515 5594 gene locus_tag LOCUS_15470 4515 5594 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_15470 5674 5922 gene locus_tag LOCUS_15480 5674 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5998 6336 gene locus_tag LOCUS_15490 5998 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence146 1202 210 gene locus_tag LOCUS_15500 gene rhuM 1202 210 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_15500 2231 1575 gene locus_tag LOCUS_15510 2231 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3521 2235 gene locus_tag LOCUS_15520 3521 2235 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_15520 4441 4001 gene locus_tag LOCUS_15530 4441 4001 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_15530 5257 4505 gene locus_tag LOCUS_15540 5257 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 5870 5274 gene locus_tag LOCUS_15550 5870 5274 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_15550 6800 5967 gene locus_tag LOCUS_15560 gene amrB 6800 5967 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence147 <1 556 gene locus_tag LOCUS_15570 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009872209.1:serine protease HtrA 854 1306 gene locus_tag LOCUS_15580 854 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1310 2860 gene locus_tag LOCUS_15590 1310 2860 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_15590 2898 3251 gene locus_tag LOCUS_15600 2898 3251 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227761.1 protein_id gnl|my_center|LOCUS_15600 4135 3257 gene locus_tag LOCUS_15610 4135 3257 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 protein_id gnl|my_center|LOCUS_15610 4020 4229 gene locus_tag LOCUS_15620 4020 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence148 584 1507 gene locus_tag LOCUS_15630 584 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1535 3538 gene locus_tag LOCUS_15640 1535 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4532 3690 gene locus_tag LOCUS_15650 4532 3690 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_15650 4719 6089 gene locus_tag LOCUS_15660 4719 6089 CDS product methanol--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392723.1 protein_id gnl|my_center|LOCUS_15660 6170 6838 gene locus_tag LOCUS_15670 6170 6838 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence149 165 776 gene locus_tag LOCUS_15680 165 776 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_15680 803 1210 gene locus_tag LOCUS_15690 803 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1227 1646 gene locus_tag LOCUS_15700 1227 1646 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_15700 1648 2277 gene locus_tag LOCUS_15710 1648 2277 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_15710 2429 2611 gene locus_tag LOCUS_15720 2429 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2686 3492 gene locus_tag LOCUS_15730 2686 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15730 3787 6447 gene locus_tag LOCUS_15740 3787 6447 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_15740 6454 7440 gene locus_tag LOCUS_15750 6454 7440 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259483.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence150 1367 372 gene locus_tag LOCUS_15760 1367 372 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969437.1 protein_id gnl|my_center|LOCUS_15760 1885 1364 gene locus_tag LOCUS_15770 1885 1364 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969436.1 protein_id gnl|my_center|LOCUS_15770 2966 2034 gene locus_tag LOCUS_15780 2966 2034 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004582193.1 protein_id gnl|my_center|LOCUS_15780 4139 3156 gene locus_tag LOCUS_15790 4139 3156 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969434.1 protein_id gnl|my_center|LOCUS_15790 5385 4303 gene locus_tag LOCUS_15800 5385 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 5841 5476 gene locus_tag LOCUS_15810 5841 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 7091 6057 gene locus_tag LOCUS_15820 7091 6057 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence151 531 2489 gene locus_tag LOCUS_15830 531 2489 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250356.1 protein_id gnl|my_center|LOCUS_15830 3289 2633 gene locus_tag LOCUS_15840 3289 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3747 4829 gene locus_tag LOCUS_15850 3747 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4926 5513 gene locus_tag LOCUS_15860 gene fadR 4926 5513 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_15860 5697 6983 gene locus_tag LOCUS_15870 5697 6983 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence152 449 1246 gene locus_tag LOCUS_15880 gene rsmA 449 1246 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_15880 1243 2595 gene locus_tag LOCUS_15890 gene mgtE 1243 2595 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_15890 2682 3188 gene locus_tag LOCUS_15900 2682 3188 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_15900 3398 3994 gene locus_tag LOCUS_15910 3398 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4081 5109 gene locus_tag LOCUS_15920 4081 5109 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_15920 5168 6772 gene locus_tag LOCUS_15930 gene pckA 5168 6772 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_15930 <7450 6817 gene locus_tag LOCUS_15940 <7450 6817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071323.1:YgjV family protein >Feature sequence153 2273 471 gene locus_tag LOCUS_15950 2273 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4350 2524 gene locus_tag LOCUS_15960 gene glmS 4350 2524 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_15960 6039 4486 gene locus_tag LOCUS_15970 gene guaA 6039 4486 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_15970 6788 6003 gene locus_tag LOCUS_15980 gene surE 6788 6003 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_15980 <7376 6788 gene locus_tag LOCUS_15990 <7376 6788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403909.1:acetyl-CoA carboxylase, carboxyltransferase subunit beta >Feature sequence154 385 2229 gene locus_tag LOCUS_16000 385 2229 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120386.1 protein_id gnl|my_center|LOCUS_16000 2289 4376 gene locus_tag LOCUS_16010 2289 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4432 5961 gene locus_tag LOCUS_16020 4432 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5974 6531 gene locus_tag LOCUS_16030 5974 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6646 7122 gene locus_tag LOCUS_16040 6646 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence155 1079 462 gene locus_tag LOCUS_16050 gene nadD 1079 462 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583638.1 protein_id gnl|my_center|LOCUS_16050 1842 1060 gene locus_tag LOCUS_16060 1842 1060 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_16060 2570 1956 gene locus_tag LOCUS_16070 2570 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3620 2607 gene locus_tag LOCUS_16080 3620 2607 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_16080 4699 3623 gene locus_tag LOCUS_16090 4699 3623 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839036.1 protein_id gnl|my_center|LOCUS_16090 5742 4708 gene locus_tag LOCUS_16100 gene aroF 5742 4708 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_16100 6253 5837 gene locus_tag LOCUS_16110 gene ruvX 6253 5837 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_16110 6811 6500 gene locus_tag LOCUS_16120 6811 6500 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence156 1033 263 gene locus_tag LOCUS_16130 1033 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1489 1052 gene locus_tag LOCUS_16140 gene dtd 1489 1052 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_16140 4998 1492 gene locus_tag LOCUS_16150 gene dnaE 4998 1492 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_16150 5393 6637 gene locus_tag LOCUS_16160 5393 6637 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence157 889 641 gene locus_tag LOCUS_16170 889 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1474 1103 gene locus_tag LOCUS_16180 1474 1103 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582909.1 protein_id gnl|my_center|LOCUS_16180 2773 1748 gene locus_tag LOCUS_16190 2773 1748 CDS product putative manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_16190 3710 2775 gene locus_tag LOCUS_16200 3710 2775 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_16200 4381 3740 gene locus_tag LOCUS_16210 4381 3740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_16210 4773 4525 gene locus_tag LOCUS_16220 4773 4525 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_16220 5615 4869 gene locus_tag LOCUS_16230 5615 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6142 5618 gene locus_tag LOCUS_16240 6142 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6857 6366 gene locus_tag LOCUS_16250 gene tsaA 6857 6366 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence158 69 563 gene locus_tag LOCUS_16260 69 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1627 560 gene locus_tag LOCUS_16270 gene prfA 1627 560 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_16270 2657 1644 gene locus_tag LOCUS_16280 2657 1644 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_16280 2949 2749 gene locus_tag LOCUS_16290 gene rpmE 2949 2749 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_16290 4272 3022 gene locus_tag LOCUS_16300 gene rho 4272 3022 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_16300 5711 4434 gene locus_tag LOCUS_16310 5711 4434 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_16310 6256 5834 gene locus_tag LOCUS_16320 6256 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 7032 6256 gene locus_tag LOCUS_16330 7032 6256 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence159 2362 1109 gene locus_tag LOCUS_16340 2362 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4069 2525 gene locus_tag LOCUS_16350 4069 2525 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_16350 4970 4062 gene locus_tag LOCUS_16360 4970 4062 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_16360 5378 6727 gene locus_tag LOCUS_16370 5378 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence160 <1 717 gene locus_tag LOCUS_16380 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257672.1:glycosyltransferase family 4 protein 880 1305 gene locus_tag LOCUS_16390 880 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16390 1309 1725 gene locus_tag LOCUS_16400 1309 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 1728 2294 gene locus_tag LOCUS_16410 gene folE 1728 2294 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_16410 2483 2935 gene locus_tag LOCUS_16420 2483 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3063 3467 gene locus_tag LOCUS_16430 3063 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3648 4955 gene locus_tag LOCUS_16440 3648 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5064 5465 gene locus_tag LOCUS_16450 gene cdd 5064 5465 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_16450 5465 6094 gene locus_tag LOCUS_16460 gene udk 5465 6094 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768807.1 protein_id gnl|my_center|LOCUS_16460 6126 6716 gene locus_tag LOCUS_16470 6126 6716 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence161 1875 772 gene locus_tag LOCUS_16480 1875 772 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_16480 2659 1880 gene locus_tag LOCUS_16490 2659 1880 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 3502 5826 gene locus_tag LOCUS_16500 3502 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6560 6030 gene locus_tag LOCUS_16510 6560 6030 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 6911 6714 gene locus_tag LOCUS_16520 6911 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence162 481 1827 gene locus_tag LOCUS_16530 481 1827 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838467.1 protein_id gnl|my_center|LOCUS_16530 1882 3342 gene locus_tag LOCUS_16540 1882 3342 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921831.1 protein_id gnl|my_center|LOCUS_16540 3615 3361 gene locus_tag LOCUS_16550 3615 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 4138 4365 gene locus_tag LOCUS_16560 4138 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4401 5531 gene locus_tag LOCUS_16570 4401 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence163 766 449 gene locus_tag LOCUS_16580 766 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1990 944 gene locus_tag LOCUS_16590 1990 944 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_16590 4171 2072 gene locus_tag LOCUS_16600 4171 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4821 4351 gene locus_tag LOCUS_16610 gene tadA 4821 4351 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_16610 5025 5861 gene locus_tag LOCUS_16620 5025 5861 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_16620 <7103 5883 gene locus_tag LOCUS_16630 <7103 5883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence164 582 3935 gene locus_tag LOCUS_16640 582 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence165 1221 3110 gene locus_tag LOCUS_16650 1221 3110 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_16650 6515 3255 gene locus_tag LOCUS_16660 6515 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence166 1424 375 gene locus_tag LOCUS_16670 1424 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4007 1605 gene locus_tag LOCUS_16680 4007 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16680 6152 4017 gene locus_tag LOCUS_16690 6152 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16690 <6966 6276 gene locus_tag LOCUS_16700 <6966 6276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444445.1:S9 family peptidase >Feature sequence167 89 1294 gene locus_tag LOCUS_16710 89 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1305 3176 gene locus_tag LOCUS_16720 1305 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3297 4355 gene locus_tag LOCUS_16730 3297 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4369 4860 gene locus_tag LOCUS_16740 4369 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 4873 6294 gene locus_tag LOCUS_16750 4873 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 <6963 6382 gene locus_tag LOCUS_16760 <6963 6382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence168 <1 505 gene locus_tag LOCUS_16770 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877664.1:heavy metal translocating P-type ATPase 591 770 gene locus_tag LOCUS_16780 591 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 913 3144 gene locus_tag LOCUS_16790 gene ccsA 913 3144 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_16790 3253 4176 gene locus_tag LOCUS_16800 3253 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4186 5490 gene locus_tag LOCUS_16810 4186 5490 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503612.1 protein_id gnl|my_center|LOCUS_16810 6731 5589 gene locus_tag LOCUS_16820 6731 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence169 172 459 gene locus_tag LOCUS_16830 172 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 653 1567 gene locus_tag LOCUS_16840 653 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1872 4064 gene locus_tag LOCUS_16850 1872 4064 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_16850 5021 4275 gene locus_tag LOCUS_16860 5021 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6739 5054 gene locus_tag LOCUS_16870 gene ggt 6739 5054 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133817160.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence170 1027 641 gene locus_tag LOCUS_16880 1027 641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_16880 2741 1344 gene locus_tag LOCUS_16890 2741 1344 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_16890 4171 2762 gene locus_tag LOCUS_16900 4171 2762 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545017.1 protein_id gnl|my_center|LOCUS_16900 5613 4171 gene locus_tag LOCUS_16910 5613 4171 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277839.1 protein_id gnl|my_center|LOCUS_16910 <6861 5951 gene locus_tag LOCUS_16920 <6861 5951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460649.1:radical SAM protein >Feature sequence171 1743 931 gene locus_tag LOCUS_16930 gene lgt 1743 931 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_16930 1936 2445 gene locus_tag LOCUS_16940 1936 2445 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_16940 3460 2504 gene locus_tag LOCUS_16950 3460 2504 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_16950 4442 3450 gene locus_tag LOCUS_16960 gene hflK 4442 3450 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_16960 5237 4725 gene locus_tag LOCUS_16970 5237 4725 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_16970 5355 6404 gene locus_tag LOCUS_16980 5355 6404 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083947.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence172 646 80 gene locus_tag LOCUS_16990 646 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 895 3366 gene locus_tag LOCUS_17000 895 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 4045 3422 gene locus_tag LOCUS_17010 4045 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 4734 4084 gene locus_tag LOCUS_17020 4734 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 5026 5835 gene locus_tag LOCUS_17030 gene nagB 5026 5835 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_17030 6801 5965 gene locus_tag LOCUS_17040 6801 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence173 1232 429 gene locus_tag LOCUS_17050 1232 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2669 1251 gene locus_tag LOCUS_17060 2669 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 3483 2779 gene locus_tag LOCUS_17070 3483 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5752 3542 gene locus_tag LOCUS_17080 5752 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6593 5772 gene locus_tag LOCUS_17090 6593 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence174 <1 2416 gene locus_tag LOCUS_17100 <1 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein 2528 3829 gene locus_tag LOCUS_17110 2528 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4269 4502 gene locus_tag LOCUS_17120 4269 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5448 5801 gene locus_tag LOCUS_17130 5448 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence175 176 1501 gene locus_tag LOCUS_17140 176 1501 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_17140 1571 2197 gene locus_tag LOCUS_17150 1571 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2197 2658 gene locus_tag LOCUS_17160 2197 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 6495 2671 gene locus_tag LOCUS_17170 6495 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence176 3276 2605 gene locus_tag LOCUS_17180 3276 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3304 3480 gene locus_tag LOCUS_17190 3304 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4481 3540 gene locus_tag LOCUS_17200 4481 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <6767 4567 gene locus_tag LOCUS_17210 <6767 4567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839758.1:basic secretory protein-like protein >Feature sequence177 2497 1214 gene locus_tag LOCUS_17220 2497 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4042 2612 gene locus_tag LOCUS_17230 4042 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 6222 4081 gene locus_tag LOCUS_17240 6222 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence178 599 36 gene locus_tag LOCUS_17250 gene efp 599 36 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_17250 1494 589 gene locus_tag LOCUS_17260 1494 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2428 1481 gene locus_tag LOCUS_17270 2428 1481 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_17270 3420 2431 gene locus_tag LOCUS_17280 gene ansA 3420 2431 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_17280 6409 3725 gene locus_tag LOCUS_17290 gene ppdK 6409 3725 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence179 826 1146 gene locus_tag LOCUS_17300 826 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1156 3276 gene locus_tag LOCUS_17310 1156 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3389 3922 gene locus_tag LOCUS_17320 3389 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5118 4036 gene locus_tag LOCUS_17330 gene serC 5118 4036 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931650.1 protein_id gnl|my_center|LOCUS_17330 5591 6058 gene locus_tag LOCUS_17340 5591 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence180 427 1209 gene locus_tag LOCUS_17350 427 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1251 1895 gene locus_tag LOCUS_17360 1251 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2738 1908 gene locus_tag LOCUS_17370 2738 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3710 2958 gene locus_tag LOCUS_17380 gene kdsB 3710 2958 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_17380 3841 3768 gene locus_tag LOCUS_t00200 3841 3768 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4278 3958 gene locus_tag LOCUS_17390 4278 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4720 5772 gene locus_tag LOCUS_17400 4720 5772 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_17400 5909 6430 gene locus_tag LOCUS_17410 5909 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence181 98 1030 gene locus_tag LOCUS_17420 98 1030 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_17420 1130 1723 gene locus_tag LOCUS_17430 1130 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1731 1913 gene locus_tag LOCUS_17440 1731 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2027 5185 gene locus_tag LOCUS_17450 2027 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence182 77 1738 gene locus_tag LOCUS_17460 77 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1741 3117 gene locus_tag LOCUS_17470 1741 3117 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_17470 3360 3728 gene locus_tag LOCUS_17480 3360 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3852 5264 gene locus_tag LOCUS_17490 3852 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5246 5503 gene locus_tag LOCUS_17500 5246 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5493 6326 gene locus_tag LOCUS_17510 5493 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence183 56 1180 gene locus_tag LOCUS_17520 gene ald 56 1180 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937875.1 protein_id gnl|my_center|LOCUS_17520 1184 1972 gene locus_tag LOCUS_17530 1184 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1993 2337 gene locus_tag LOCUS_17540 1993 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2334 3173 gene locus_tag LOCUS_17550 2334 3173 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_17550 4694 3291 gene locus_tag LOCUS_17560 gene dnaA 4694 3291 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_17560 5368 6144 gene locus_tag LOCUS_17570 5368 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence184 970 167 gene locus_tag LOCUS_17580 970 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1818 988 gene locus_tag LOCUS_17590 1818 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2732 1791 gene locus_tag LOCUS_17600 2732 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4352 2742 gene locus_tag LOCUS_17610 4352 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 <6477 4543 gene locus_tag LOCUS_17620 <6477 4543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108723.1:DNA polymerase I >Feature sequence185 308 568 gene locus_tag LOCUS_17630 308 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 584 1303 gene locus_tag LOCUS_17640 584 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17640 1564 2592 gene locus_tag LOCUS_17650 1564 2592 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_17650 2668 3420 gene locus_tag LOCUS_17660 2668 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 3643 5463 gene locus_tag LOCUS_17670 3643 5463 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_17670 5554 6306 gene locus_tag LOCUS_17680 5554 6306 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence186 1261 767 gene locus_tag LOCUS_17690 1261 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1958 1248 gene locus_tag LOCUS_17700 1958 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2396 2016 gene locus_tag LOCUS_17710 2396 2016 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_17710 3082 3519 gene locus_tag LOCUS_17720 3082 3519 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_17720 3618 3905 gene locus_tag LOCUS_17730 gene groES 3618 3905 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817319.1 protein_id gnl|my_center|LOCUS_17730 3921 5546 gene locus_tag LOCUS_17740 gene groL 3921 5546 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_17740 6094 5714 gene locus_tag LOCUS_17750 6094 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence187 171 2939 gene locus_tag LOCUS_17760 171 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3385 2942 gene locus_tag LOCUS_17770 3385 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3629 5137 gene locus_tag LOCUS_17780 3629 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5139 6263 gene locus_tag LOCUS_17790 gene bshA 5139 6263 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence188 785 327 gene locus_tag LOCUS_17800 785 327 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_17800 1525 827 gene locus_tag LOCUS_17810 1525 827 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258526.1 protein_id gnl|my_center|LOCUS_17810 3284 1923 gene locus_tag LOCUS_17820 3284 1923 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_17820 4402 3281 gene locus_tag LOCUS_17830 4402 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5529 4399 gene locus_tag LOCUS_17840 5529 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5786 6007 gene locus_tag LOCUS_17850 5786 6007 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence189 315 2303 gene locus_tag LOCUS_17860 315 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2324 2995 gene locus_tag LOCUS_17870 2324 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3799 3068 gene locus_tag LOCUS_17880 3799 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3981 4898 gene locus_tag LOCUS_17890 3981 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 4802 5029 gene locus_tag LOCUS_17900 4802 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17900 >Feature sequence190 2080 1112 gene locus_tag LOCUS_17910 2080 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17910 3022 2309 gene locus_tag LOCUS_17920 3022 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17920 3328 3041 gene locus_tag LOCUS_17930 3328 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4446 3325 gene locus_tag LOCUS_17940 gene recF 4446 3325 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_17940 5565 4450 gene locus_tag LOCUS_17950 gene dnaN 5565 4450 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence191 <1 767 gene locus_tag LOCUS_17960 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969438.1:VWA domain-containing protein 764 1459 gene locus_tag LOCUS_17970 764 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1461 2804 gene locus_tag LOCUS_17980 1461 2804 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969439.1 protein_id gnl|my_center|LOCUS_17980 3481 2918 gene locus_tag LOCUS_17990 3481 2918 CDS product phosphatidylethanolamine N-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509340.1 protein_id gnl|my_center|LOCUS_17990 4066 5232 gene locus_tag LOCUS_18000 4066 5232 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_18000 <6399 5354 gene locus_tag LOCUS_18010 <6399 5354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141702.1:S9 family peptidase >Feature sequence192 1658 252 gene locus_tag LOCUS_18020 1658 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2575 1658 gene locus_tag LOCUS_18030 2575 1658 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_18030 3267 2575 gene locus_tag LOCUS_18040 gene csm3 3267 2575 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_18040 3689 3267 gene locus_tag LOCUS_18050 gene csm2 3689 3267 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_18050 5995 3686 gene locus_tag LOCUS_18060 gene cas10 5995 3686 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_18060 6337 6095 gene locus_tag LOCUS_18070 6337 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence193 214 1326 gene locus_tag LOCUS_18080 214 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2121 1333 gene locus_tag LOCUS_18090 2121 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_18090 2327 2785 gene locus_tag LOCUS_18100 2327 2785 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741976.1 protein_id gnl|my_center|LOCUS_18100 2918 3853 gene locus_tag LOCUS_18110 2918 3853 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_18110 4138 5511 gene locus_tag LOCUS_18120 4138 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence194 3749 339 gene locus_tag LOCUS_18130 3749 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18130 5190 6227 gene locus_tag LOCUS_18140 5190 6227 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence195 605 159 gene locus_tag LOCUS_18150 605 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2164 605 gene locus_tag LOCUS_18160 2164 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3663 2170 gene locus_tag LOCUS_18170 3663 2170 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880089.1 protein_id gnl|my_center|LOCUS_18170 4661 3690 gene locus_tag LOCUS_18180 4661 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5801 4716 gene locus_tag LOCUS_18190 5801 4716 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence196 2073 955 gene locus_tag LOCUS_18200 gene cfa 2073 955 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_18200 2712 2086 gene locus_tag LOCUS_18210 2712 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2920 3087 gene locus_tag LOCUS_18220 2920 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4061 3429 gene locus_tag LOCUS_18230 4061 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 4286 6049 gene locus_tag LOCUS_18240 4286 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence197 164 475 gene locus_tag LOCUS_18250 164 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 868 632 gene locus_tag LOCUS_18260 868 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1728 898 gene locus_tag LOCUS_18270 1728 898 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_18270 3453 2023 gene locus_tag LOCUS_18280 gene proS 3453 2023 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_18280 3735 3661 gene locus_tag LOCUS_t00210 3735 3661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4479 3814 gene locus_tag LOCUS_18290 4479 3814 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_18290 <6279 4492 gene locus_tag LOCUS_18300 <6279 4492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173427597.1:TrkH family potassium uptake protein >Feature sequence198 941 183 gene locus_tag LOCUS_18310 941 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1189 3594 gene locus_tag LOCUS_18320 1189 3594 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_18320 3864 5246 gene locus_tag LOCUS_18330 3864 5246 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_18330 5396 6250 gene locus_tag LOCUS_18340 5396 6250 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence199 388 1752 gene locus_tag LOCUS_18350 388 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 2163 2504 gene locus_tag LOCUS_18360 2163 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_18360 2797 3558 gene locus_tag LOCUS_18370 gene xth 2797 3558 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_18370 3739 4404 gene locus_tag LOCUS_18380 3739 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 5385 4411 gene locus_tag LOCUS_18390 5385 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 5792 5415 gene locus_tag LOCUS_18400 5792 5415 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_18400 6036 5773 gene locus_tag LOCUS_18410 6036 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence200 <1 1042 gene locus_tag LOCUS_18420 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940637.1:ATP-binding protein 1060 1425 gene locus_tag LOCUS_18430 1060 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1427 2068 gene locus_tag LOCUS_18440 1427 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2312 2749 gene locus_tag LOCUS_18450 2312 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2806 3291 gene locus_tag LOCUS_18460 2806 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3333 4043 gene locus_tag LOCUS_18470 3333 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4064 4576 gene locus_tag LOCUS_18480 4064 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 4628 5212 gene locus_tag LOCUS_18490 4628 5212 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_18490 5581 6075 gene locus_tag LOCUS_18500 5581 6075 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence201 590 1042 gene locus_tag LOCUS_18510 590 1042 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 protein_id gnl|my_center|LOCUS_18510 1059 1442 gene locus_tag LOCUS_18520 1059 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1456 1941 gene locus_tag LOCUS_18530 1456 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1938 2942 gene locus_tag LOCUS_18540 1938 2942 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946540.1 protein_id gnl|my_center|LOCUS_18540 3142 3483 gene locus_tag LOCUS_18550 3142 3483 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_18550 3470 4366 gene locus_tag LOCUS_18560 3470 4366 CDS product initiation factor 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257268.1 protein_id gnl|my_center|LOCUS_18560 4369 4563 gene locus_tag LOCUS_18570 4369 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4573 5004 gene locus_tag LOCUS_18580 4573 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5050 5883 gene locus_tag LOCUS_18590 5050 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence202 327 401 gene locus_tag LOCUS_t00220 327 401 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 441 623 gene locus_tag LOCUS_18600 gene secE 441 623 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931843.1 protein_id gnl|my_center|LOCUS_18600 650 1195 gene locus_tag LOCUS_18610 gene nusG 650 1195 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404507.1 protein_id gnl|my_center|LOCUS_18610 1223 1648 gene locus_tag LOCUS_18620 gene rplK 1223 1648 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_18620 1674 2372 gene locus_tag LOCUS_18630 gene rplA 1674 2372 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_18630 2388 2903 gene locus_tag LOCUS_18640 gene rplJ 2388 2903 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_18640 2946 3332 gene locus_tag LOCUS_18650 gene rplL 2946 3332 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence203 2554 59 gene locus_tag LOCUS_18660 2554 59 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_18660 3489 2554 gene locus_tag LOCUS_18670 3489 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5442 3613 gene locus_tag LOCUS_18680 5442 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6093 5569 gene locus_tag LOCUS_18690 6093 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence204 1211 942 gene locus_tag LOCUS_18700 1211 942 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_18700 1468 1208 gene locus_tag LOCUS_18710 1468 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 5111 1566 gene locus_tag LOCUS_18720 5111 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_18720 6012 5104 gene locus_tag LOCUS_18730 6012 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence205 509 1438 gene locus_tag LOCUS_18740 509 1438 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_18740 1582 2928 gene locus_tag LOCUS_18750 1582 2928 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_18750 3614 3216 gene locus_tag LOCUS_18760 3614 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4918 3710 gene locus_tag LOCUS_18770 4918 3710 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_18770 5767 4946 gene locus_tag LOCUS_18780 5767 4946 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence206 1259 747 gene locus_tag LOCUS_18790 1259 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1507 1256 gene locus_tag LOCUS_18800 1507 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2093 1533 gene locus_tag LOCUS_18810 2093 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4679 2406 gene locus_tag LOCUS_18820 4679 2406 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_18820 5076 4696 gene locus_tag LOCUS_18830 5076 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence207 1049 885 gene locus_tag LOCUS_18840 1049 885 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_18840 1513 1112 gene locus_tag LOCUS_18850 1513 1112 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_18850 2483 1515 gene locus_tag LOCUS_18860 2483 1515 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_18860 3217 2492 gene locus_tag LOCUS_18870 3217 2492 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_18870 4112 3219 gene locus_tag LOCUS_18880 gene rfbD 4112 3219 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_18880 5026 4109 gene locus_tag LOCUS_18890 5026 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 5524 5039 gene locus_tag LOCUS_18900 5524 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence208 485 240 gene locus_tag LOCUS_18910 485 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2412 619 gene locus_tag LOCUS_18920 gene pepF 2412 619 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_18920 2496 3443 gene locus_tag LOCUS_18930 gene queG 2496 3443 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_18930 3534 3908 gene locus_tag LOCUS_18940 3534 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3905 4285 gene locus_tag LOCUS_18950 3905 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 5199 4300 gene locus_tag LOCUS_18960 5199 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence209 <1 1191 gene locus_tag LOCUS_18970 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880529.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 1235 3112 gene locus_tag LOCUS_18980 gene mnmG 1235 3112 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_18980 3090 3770 gene locus_tag LOCUS_18990 3090 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 3763 4710 gene locus_tag LOCUS_19000 gene murQ 3763 4710 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477926.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence210 4917 1294 gene locus_tag LOCUS_19010 4917 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 <5919 4940 gene locus_tag LOCUS_19020 <5919 4940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989805.1:DNA helicase PcrA >Feature sequence211 <1 804 gene locus_tag LOCUS_19030 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869183.1:dihydropyrimidinase 953 1702 gene locus_tag LOCUS_19040 gene btsR 953 1702 CDS product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097930.1 protein_id gnl|my_center|LOCUS_19040 1988 2647 gene locus_tag LOCUS_19050 1988 2647 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230527.1 protein_id gnl|my_center|LOCUS_19050 2773 2985 gene locus_tag LOCUS_19060 2773 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3243 3992 gene locus_tag LOCUS_19070 3243 3992 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109111.1 protein_id gnl|my_center|LOCUS_19070 3994 5064 gene locus_tag LOCUS_19080 3994 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5122 5817 gene locus_tag LOCUS_19090 5122 5817 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence212 <1 1008 gene locus_tag LOCUS_19100 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:S8 family serine peptidase 1107 1661 gene locus_tag LOCUS_19110 1107 1661 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_19110 1702 2133 gene locus_tag LOCUS_19120 1702 2133 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_19120 5558 2304 gene locus_tag LOCUS_19130 5558 2304 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence213 508 1536 gene locus_tag LOCUS_19140 508 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1598 2602 gene locus_tag LOCUS_19150 1598 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2800 3738 gene locus_tag LOCUS_19160 2800 3738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_19160 3740 4522 gene locus_tag LOCUS_19170 3740 4522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence214 <1 1192 gene locus_tag LOCUS_19180 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 1277 1960 gene locus_tag LOCUS_19190 1277 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2140 2991 gene locus_tag LOCUS_19200 2140 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence215 <1 504 gene locus_tag LOCUS_19210 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496475.1:phosphatase PAP2 family protein 597 2060 gene locus_tag LOCUS_19220 597 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 4066 2693 gene locus_tag LOCUS_19230 gene glnA 4066 2693 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_19230 4411 4578 gene locus_tag LOCUS_19240 4411 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 5044 4622 gene locus_tag LOCUS_19250 5044 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5824 5147 gene locus_tag LOCUS_19260 gene cmk 5824 5147 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence216 40 564 gene locus_tag LOCUS_19270 40 564 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_19270 609 1979 gene locus_tag LOCUS_19280 609 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2319 3035 gene locus_tag LOCUS_19290 2319 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3136 3957 gene locus_tag LOCUS_19300 3136 3957 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_19300 4137 4937 gene locus_tag LOCUS_19310 4137 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4964 5812 gene locus_tag LOCUS_19320 4964 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence217 2476 5151 gene locus_tag LOCUS_19330 2476 5151 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927267.1 protein_id gnl|my_center|LOCUS_19330 <5817 5141 gene locus_tag LOCUS_19340 <5817 5141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404847.1:A/G-specific adenine glycosylase >Feature sequence218 1278 2732 gene locus_tag LOCUS_19350 gene gltX 1278 2732 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_19350 2729 4171 gene locus_tag LOCUS_19360 2729 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4197 5564 gene locus_tag LOCUS_19370 gene atoC 4197 5564 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence219 1929 808 gene locus_tag LOCUS_19380 gene murG 1929 808 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_19380 3100 1931 gene locus_tag LOCUS_19390 gene ftsW 3100 1931 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_19390 4446 3100 gene locus_tag LOCUS_19400 gene murD 4446 3100 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_19400 5546 4443 gene locus_tag LOCUS_19410 gene mraY 5546 4443 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence220 845 2131 gene locus_tag LOCUS_19420 845 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2292 5639 gene locus_tag LOCUS_19430 2292 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence221 247 1947 gene locus_tag LOCUS_19440 247 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2277 2543 gene locus_tag LOCUS_19450 2277 2543 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_19450 2540 2857 gene locus_tag LOCUS_19460 2540 2857 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_19460 3082 3582 gene locus_tag LOCUS_19470 3082 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4745 3771 gene locus_tag LOCUS_19480 4745 3771 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_19480 5322 4738 gene locus_tag LOCUS_19490 5322 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5726 5325 gene locus_tag LOCUS_19500 5726 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence222 25 873 gene locus_tag LOCUS_19510 25 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 892 1572 gene locus_tag LOCUS_19520 892 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1579 4005 gene locus_tag LOCUS_19530 1579 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4002 4385 gene locus_tag LOCUS_19540 4002 4385 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence223 157 1389 gene locus_tag LOCUS_19550 157 1389 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_19550 1628 2302 gene locus_tag LOCUS_19560 1628 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3771 2299 gene locus_tag LOCUS_19570 3771 2299 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878569.1 protein_id gnl|my_center|LOCUS_19570 4778 4077 gene locus_tag LOCUS_19580 4778 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence224 530 1009 gene locus_tag LOCUS_19590 530 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1477 1013 gene locus_tag LOCUS_19600 1477 1013 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300417.1 protein_id gnl|my_center|LOCUS_19600 3125 1773 gene locus_tag LOCUS_19610 3125 1773 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_19610 3611 3216 gene locus_tag LOCUS_19620 3611 3216 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_19620 3841 3611 gene locus_tag LOCUS_19630 3841 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 4840 3995 gene locus_tag LOCUS_19640 4840 3995 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_19640 5678 4845 gene locus_tag LOCUS_19650 5678 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence225 1088 273 gene locus_tag LOCUS_19660 1088 273 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_19660 2473 1160 gene locus_tag LOCUS_19670 2473 1160 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_19670 4459 3137 gene locus_tag LOCUS_19680 4459 3137 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_19680 4657 5226 gene locus_tag LOCUS_19690 gene sigW 4657 5226 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence226 <1 1975 gene locus_tag LOCUS_19700 <1 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein 2300 3277 gene locus_tag LOCUS_19710 2300 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3404 4651 gene locus_tag LOCUS_19720 3404 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4641 5513 gene locus_tag LOCUS_19730 4641 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence227 1585 2688 gene locus_tag LOCUS_19740 1585 2688 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703897.1 protein_id gnl|my_center|LOCUS_19740 2758 3093 gene locus_tag LOCUS_19750 2758 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3135 3626 gene locus_tag LOCUS_19760 3135 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3862 5334 gene locus_tag LOCUS_19770 3862 5334 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797436.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence228 2450 309 gene locus_tag LOCUS_19780 2450 309 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_19780 3738 2566 gene locus_tag LOCUS_19790 3738 2566 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_19790 3913 4440 gene locus_tag LOCUS_19800 3913 4440 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_19800 4449 5489 gene locus_tag LOCUS_19810 4449 5489 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence229 <1 1005 gene locus_tag LOCUS_19820 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545770.1:3-deoxy-7-phosphoheptulonate synthase 2860 1055 gene locus_tag LOCUS_19830 2860 1055 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931897.1 protein_id gnl|my_center|LOCUS_19830 3085 3966 gene locus_tag LOCUS_19840 3085 3966 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_19840 3971 5131 gene locus_tag LOCUS_19850 3971 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence230 1109 720 gene locus_tag LOCUS_19860 1109 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 1554 1099 gene locus_tag LOCUS_19870 1554 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2866 1562 gene locus_tag LOCUS_19880 2866 1562 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_19880 3636 2863 gene locus_tag LOCUS_19890 3636 2863 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_19890 4349 3633 gene locus_tag LOCUS_19900 4349 3633 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_19900 5555 4494 gene locus_tag LOCUS_19910 5555 4494 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence231 3219 3028 gene locus_tag LOCUS_19920 3219 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 <5611 3182 gene locus_tag LOCUS_19930 <5611 3182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128975410.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence232 2078 1314 gene locus_tag LOCUS_19940 2078 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3166 2279 gene locus_tag LOCUS_19950 3166 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 3404 4846 gene locus_tag LOCUS_19960 3404 4846 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_19960 5305 4874 gene locus_tag LOCUS_19970 5305 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence233 <1 2056 gene locus_tag LOCUS_19980 <1 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_098074422.1:glucosamine-6-phosphate deaminase 2095 2514 gene locus_tag LOCUS_19990 2095 2514 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_19990 2763 2518 gene locus_tag LOCUS_20000 2763 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 <5588 2980 gene locus_tag LOCUS_20010 <5588 2980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201996.1:xanthan lyase >Feature sequence234 837 76 gene locus_tag LOCUS_20020 837 76 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_20020 1718 834 gene locus_tag LOCUS_20030 1718 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2785 1718 gene locus_tag LOCUS_20040 gene hisC 2785 1718 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879516.1 protein_id gnl|my_center|LOCUS_20040 4270 2894 gene locus_tag LOCUS_20050 4270 2894 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_20050 <5583 4277 gene locus_tag LOCUS_20060 <5583 4277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232504.1:sporulation two-component system sensor histidine kinase KinE >Feature sequence235 <1 824 gene locus_tag LOCUS_20070 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291480.1:ATP-binding protein 937 2835 gene locus_tag LOCUS_20080 gene pepF 937 2835 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_20080 3351 3761 gene locus_tag LOCUS_20090 3351 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence236 <1 1095 gene locus_tag LOCUS_20100 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942885.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) 1214 3319 gene locus_tag LOCUS_20110 1214 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 3585 3376 gene locus_tag LOCUS_20120 3585 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3536 5032 gene locus_tag LOCUS_20130 3536 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence237 603 761 gene locus_tag LOCUS_20140 603 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 758 877 gene locus_tag LOCUS_20150 758 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2034 1111 gene locus_tag LOCUS_20160 2034 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4597 2267 gene locus_tag LOCUS_20170 4597 2267 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence238 2805 307 gene locus_tag LOCUS_20180 2805 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3152 2874 gene locus_tag LOCUS_20190 3152 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4793 3168 gene locus_tag LOCUS_20200 4793 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence239 1802 1218 gene locus_tag LOCUS_20210 1802 1218 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_20210 2170 4701 gene locus_tag LOCUS_20220 2170 4701 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_20220 4727 5362 gene locus_tag LOCUS_20230 4727 5362 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723061.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence240 1241 2044 gene locus_tag LOCUS_20240 1241 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20240 2069 3499 gene locus_tag LOCUS_20250 2069 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20250 3684 4700 gene locus_tag LOCUS_20260 3684 4700 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_20260 5273 4689 gene locus_tag LOCUS_20270 5273 4689 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971421.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence241 <1 1352 gene locus_tag LOCUS_20280 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763503.1:oligopeptide transporter, OPT family 1618 2712 gene locus_tag LOCUS_20290 1618 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2714 3967 gene locus_tag LOCUS_20300 2714 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 4831 4022 gene locus_tag LOCUS_20310 4831 4022 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence242 2257 1034 gene locus_tag LOCUS_20320 2257 1034 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987001.1 protein_id gnl|my_center|LOCUS_20320 3021 2254 gene locus_tag LOCUS_20330 3021 2254 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_20330 3634 3014 gene locus_tag LOCUS_20340 gene hisH 3634 3014 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_20340 4728 3679 gene locus_tag LOCUS_20350 gene wecB 4728 3679 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_20350 5267 4725 gene locus_tag LOCUS_20360 5267 4725 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence243 <1 756 gene locus_tag LOCUS_20370 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019538492.1:methionyl-tRNA formyltransferase 962 1153 gene locus_tag LOCUS_20380 962 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1251 2261 gene locus_tag LOCUS_20390 1251 2261 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_20390 2378 2584 gene locus_tag LOCUS_20400 2378 2584 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527838.1 protein_id gnl|my_center|LOCUS_20400 2630 2878 gene locus_tag LOCUS_20410 2630 2878 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_20410 3048 4640 gene locus_tag LOCUS_20420 gene rny 3048 4640 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829512.1 protein_id gnl|my_center|LOCUS_20420 4784 5107 gene locus_tag LOCUS_20430 gene erpA 4784 5107 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649956.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence244 <1 918 gene locus_tag LOCUS_20440 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933195.1:sigma-54-dependent Fis family transcriptional regulator 2218 944 gene locus_tag LOCUS_20450 gene hemL 2218 944 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_20450 3232 2246 gene locus_tag LOCUS_20460 gene hemB 3232 2246 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_20460 4649 3282 gene locus_tag LOCUS_20470 gene hemG 4649 3282 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_20470 <5479 4659 gene locus_tag LOCUS_20480 <5479 4659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546394.1:ferrochelatase >Feature sequence245 4259 1779 gene locus_tag LOCUS_20490 4259 1779 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_20490 4985 4356 gene locus_tag LOCUS_20500 4985 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence246 1502 2407 gene locus_tag LOCUS_20510 1502 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2487 3767 gene locus_tag LOCUS_20520 2487 3767 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_20520 3941 4852 gene locus_tag LOCUS_20530 3941 4852 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_20530 4858 5325 gene locus_tag LOCUS_20540 4858 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence247 1578 715 gene locus_tag LOCUS_20550 1578 715 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_20550 3547 1826 gene locus_tag LOCUS_20560 3547 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4452 3544 gene locus_tag LOCUS_20570 4452 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 5318 4458 gene locus_tag LOCUS_20580 5318 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence248 832 179 gene locus_tag LOCUS_20590 832 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 3413 1170 gene locus_tag LOCUS_20600 3413 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4653 3580 gene locus_tag LOCUS_20610 4653 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5314 4667 gene locus_tag LOCUS_20620 5314 4667 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678714.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence249 <1 558 gene locus_tag LOCUS_20630 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404816.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase 572 1243 gene locus_tag LOCUS_20640 572 1243 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_20640 1240 2571 gene locus_tag LOCUS_20650 1240 2571 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_20650 3513 2608 gene locus_tag LOCUS_20660 3513 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4362 5012 gene locus_tag LOCUS_20670 gene tmk 4362 5012 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence250 2128 3897 gene locus_tag LOCUS_20680 2128 3897 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025016.1 protein_id gnl|my_center|LOCUS_20680 3970 4323 gene locus_tag LOCUS_20690 3970 4323 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence251 765 1190 gene locus_tag LOCUS_20700 765 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1322 2269 gene locus_tag LOCUS_20710 1322 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2671 3882 gene locus_tag LOCUS_20720 2671 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4098 4385 gene locus_tag LOCUS_20730 4098 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4699 5124 gene locus_tag LOCUS_20740 4699 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence252 3389 2109 gene locus_tag LOCUS_20750 3389 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3863 3414 gene locus_tag LOCUS_20760 3863 3414 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_20760 <5346 3965 gene locus_tag LOCUS_20770 <5346 3965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000493034.1:amino acid permease >Feature sequence253 452 889 gene locus_tag LOCUS_20780 gene rplM 452 889 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_20780 903 1292 gene locus_tag LOCUS_20790 gene rpsI 903 1292 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_20790 1464 2297 gene locus_tag LOCUS_20800 gene rpsB 1464 2297 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_20800 2299 2895 gene locus_tag LOCUS_20810 gene tsf 2299 2895 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_20810 2899 3621 gene locus_tag LOCUS_20820 gene pyrH 2899 3621 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_20820 3624 4184 gene locus_tag LOCUS_20830 gene frr 3624 4184 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence254 579 1718 gene locus_tag LOCUS_20840 579 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1807 2091 gene locus_tag LOCUS_20850 1807 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2095 2961 gene locus_tag LOCUS_20860 2095 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2961 4721 gene locus_tag LOCUS_20870 2961 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 5165 4752 gene locus_tag LOCUS_20880 5165 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence255 345 2675 gene locus_tag LOCUS_20890 345 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3047 2685 gene locus_tag LOCUS_20900 3047 2685 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272792.1 protein_id gnl|my_center|LOCUS_20900 3240 4748 gene locus_tag LOCUS_20910 3240 4748 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence256 <1 1588 gene locus_tag LOCUS_20920 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258140.1:TIGR03986 family CRISPR-associated RAMP protein 1628 2167 gene locus_tag LOCUS_20930 1628 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2361 2600 gene locus_tag LOCUS_20940 2361 2600 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546514.1 protein_id gnl|my_center|LOCUS_20940 2841 3095 gene locus_tag LOCUS_20950 2841 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3140 5026 gene locus_tag LOCUS_20960 3140 5026 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence257 1455 1216 gene locus_tag LOCUS_20970 gene tatA 1455 1216 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_20970 1741 1478 gene locus_tag LOCUS_20980 1741 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2495 1773 gene locus_tag LOCUS_20990 gene pssA 2495 1773 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_20990 3142 2492 gene locus_tag LOCUS_21000 3142 2492 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_21000 3864 3154 gene locus_tag LOCUS_21010 3864 3154 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817239.1 protein_id gnl|my_center|LOCUS_21010 5161 3923 gene locus_tag LOCUS_21020 5161 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence258 <1 941 gene locus_tag LOCUS_21030 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263255.1:BamA/TamA family outer membrane protein 1032 1700 gene locus_tag LOCUS_21040 1032 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 1989 2618 gene locus_tag LOCUS_21050 1989 2618 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784472.1 protein_id gnl|my_center|LOCUS_21050 2686 3318 gene locus_tag LOCUS_21060 2686 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 3431 4093 gene locus_tag LOCUS_21070 3431 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4096 5055 gene locus_tag LOCUS_21080 4096 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence259 434 4321 gene locus_tag LOCUS_21090 434 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence260 1498 662 gene locus_tag LOCUS_21100 1498 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2773 1610 gene locus_tag LOCUS_21110 gene acdA 2773 1610 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_21110 3476 2925 gene locus_tag LOCUS_21120 3476 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4245 3847 gene locus_tag LOCUS_21130 4245 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 4460 4242 gene locus_tag LOCUS_21140 4460 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4686 4477 gene locus_tag LOCUS_21150 4686 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence261 519 49 gene locus_tag LOCUS_21160 gene bcp 519 49 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_21160 3384 610 gene locus_tag LOCUS_21170 3384 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 5170 3623 gene locus_tag LOCUS_21180 5170 3623 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence262 867 430 gene locus_tag LOCUS_21190 gene rimI 867 430 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880336.1 protein_id gnl|my_center|LOCUS_21190 1550 864 gene locus_tag LOCUS_21200 gene tsaB 1550 864 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_21200 1978 1547 gene locus_tag LOCUS_21210 gene tsaE 1978 1547 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_21210 3648 2089 gene locus_tag LOCUS_21220 3648 2089 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_21220 4975 3923 gene locus_tag LOCUS_21230 4975 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence263 629 2353 gene locus_tag LOCUS_21240 629 2353 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584157.1 protein_id gnl|my_center|LOCUS_21240 2355 3614 gene locus_tag LOCUS_21250 2355 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4677 3700 gene locus_tag LOCUS_21260 4677 3700 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_21260 5017 4691 gene locus_tag LOCUS_21270 5017 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence264 <1 2061 gene locus_tag LOCUS_21280 <1 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546592.1:molybdopterin-dependent oxidoreductase 2061 2597 gene locus_tag LOCUS_21290 2061 2597 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_21290 2627 3592 gene locus_tag LOCUS_21300 gene nrfD 2627 3592 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_21300 3635 4138 gene locus_tag LOCUS_21310 3635 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4173 4763 gene locus_tag LOCUS_21320 4173 4763 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086307.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence265 3628 707 gene locus_tag LOCUS_21330 3628 707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_21330 3804 5057 gene locus_tag LOCUS_21340 3804 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 >Feature sequence266 3371 2385 gene locus_tag LOCUS_21350 3371 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_21350 4068 3361 gene locus_tag LOCUS_21360 4068 3361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_21360 <5119 4119 gene locus_tag LOCUS_21370 <5119 4119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941915.1:FtsX-like permease family protein >Feature sequence267 578 2014 gene locus_tag LOCUS_21380 578 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2255 3463 gene locus_tag LOCUS_21390 2255 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3467 4324 gene locus_tag LOCUS_21400 3467 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 >Feature sequence268 1957 398 gene locus_tag LOCUS_21410 1957 398 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_21410 3141 1975 gene locus_tag LOCUS_21420 3141 1975 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_21420 3747 4703 gene locus_tag LOCUS_21430 3747 4703 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence269 515 4555 gene locus_tag LOCUS_21440 515 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence270 3510 2158 gene locus_tag LOCUS_21450 3510 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 <5084 3712 gene locus_tag LOCUS_21460 <5084 3712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein >Feature sequence271 <1 1902 gene locus_tag LOCUS_21470 <1 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020404386.1:glycosyltransferase 2156 1899 gene locus_tag LOCUS_21480 2156 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2430 3713 gene locus_tag LOCUS_21490 gene serS 2430 3713 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 protein_id gnl|my_center|LOCUS_21490 3725 4435 gene locus_tag LOCUS_21500 3725 4435 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence272 1209 10 gene locus_tag LOCUS_21510 gene xseA 1209 10 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_21510 1804 1388 gene locus_tag LOCUS_21520 1804 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4056 2197 gene locus_tag LOCUS_21530 4056 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 4554 4084 gene locus_tag LOCUS_21540 gene rfaE2 4554 4084 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence273 4499 1245 gene locus_tag LOCUS_21550 4499 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence274 1292 222 gene locus_tag LOCUS_21560 1292 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2005 1289 gene locus_tag LOCUS_21570 2005 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 3429 2305 gene locus_tag LOCUS_21580 3429 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 3548 3871 gene locus_tag LOCUS_21590 3548 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 4924 3899 gene locus_tag LOCUS_21600 4924 3899 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence275 166 921 gene locus_tag LOCUS_21610 166 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2061 1012 gene locus_tag LOCUS_21620 2061 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 3816 2083 gene locus_tag LOCUS_21630 3816 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4947 3862 gene locus_tag LOCUS_21640 gene der 4947 3862 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933444.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence276 13 2514 gene locus_tag LOCUS_21650 13 2514 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838538.1 protein_id gnl|my_center|LOCUS_21650 2514 3803 gene locus_tag LOCUS_21660 2514 3803 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21660 3800 4435 gene locus_tag LOCUS_21670 3800 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence277 2166 1795 gene locus_tag LOCUS_21680 2166 1795 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880271.1 protein_id gnl|my_center|LOCUS_21680 3633 2464 gene locus_tag LOCUS_21690 3633 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 4041 4679 gene locus_tag LOCUS_21700 4041 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21700 >Feature sequence278 426 1517 gene locus_tag LOCUS_21710 426 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3004 1652 gene locus_tag LOCUS_21720 3004 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 4015 3050 gene locus_tag LOCUS_21730 4015 3050 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_21730 4875 4222 gene locus_tag LOCUS_21740 4875 4222 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence279 577 1524 gene locus_tag LOCUS_21750 577 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 1584 2444 gene locus_tag LOCUS_21760 1584 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2458 4692 gene locus_tag LOCUS_21770 2458 4692 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence280 <1 2787 gene locus_tag LOCUS_21780 <1 2787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808106.1:ATP-binding protein >Feature sequence281 1827 2117 gene locus_tag LOCUS_21790 1827 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2276 2737 gene locus_tag LOCUS_21800 2276 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2689 2829 gene locus_tag LOCUS_21810 2689 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2875 3432 gene locus_tag LOCUS_21820 2875 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21820 3535 3966 gene locus_tag LOCUS_21830 3535 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21830 4194 4427 gene locus_tag LOCUS_21840 4194 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence282 1274 402 gene locus_tag LOCUS_21850 1274 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2687 1284 gene locus_tag LOCUS_21860 2687 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21860 3367 2582 gene locus_tag LOCUS_21870 3367 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 >Feature sequence283 1296 49 gene locus_tag LOCUS_21880 gene clpX 1296 49 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_21880 1917 1300 gene locus_tag LOCUS_21890 gene clpP 1917 1300 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_21890 3217 1958 gene locus_tag LOCUS_21900 gene tig 3217 1958 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_21900 3717 4607 gene locus_tag LOCUS_21910 3717 4607 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence284 842 201 gene locus_tag LOCUS_21920 842 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2439 1111 gene locus_tag LOCUS_21930 2439 1111 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_21930 4317 2470 gene locus_tag LOCUS_21940 4317 2470 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963797.1 protein_id gnl|my_center|LOCUS_21940 <4821 4310 gene locus_tag LOCUS_21950 <4821 4310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228644.1:lysophospholipid acyltransferase family protein >Feature sequence285 1811 417 gene locus_tag LOCUS_21960 1811 417 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_21960 3442 2045 gene locus_tag LOCUS_21970 gene selA 3442 2045 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_21970 4763 3477 gene locus_tag LOCUS_21980 4763 3477 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence286 532 161 gene locus_tag LOCUS_21990 532 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1411 644 gene locus_tag LOCUS_22000 1411 644 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_22000 3220 1769 gene locus_tag LOCUS_22010 3220 1769 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_22010 3783 3229 gene locus_tag LOCUS_22020 3783 3229 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_22020 4339 3860 gene locus_tag LOCUS_22030 4339 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 4810 4439 gene locus_tag LOCUS_22040 4810 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence287 1379 246 gene locus_tag LOCUS_22050 gene tgt 1379 246 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_22050 2905 1595 gene locus_tag LOCUS_22060 2905 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4390 2936 gene locus_tag LOCUS_22070 4390 2936 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221819.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence288 1952 282 gene locus_tag LOCUS_22080 1952 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 <4763 2026 gene locus_tag LOCUS_22090 <4763 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002457083.1:DNA helicase PcrA >Feature sequence289 >Feature sequence290 353 691 gene locus_tag LOCUS_22100 353 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 877 3528 gene locus_tag LOCUS_22110 877 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4395 3532 gene locus_tag LOCUS_22120 4395 3532 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence291 627 2963 gene locus_tag LOCUS_22130 627 2963 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_22130 4307 3225 gene locus_tag LOCUS_22140 4307 3225 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence292 3315 775 gene locus_tag LOCUS_22150 3315 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4273 3398 gene locus_tag LOCUS_22160 4273 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence293 1141 2211 gene locus_tag LOCUS_22170 1141 2211 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_22170 2339 3667 gene locus_tag LOCUS_22180 2339 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence294 265 1983 gene locus_tag LOCUS_22190 265 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2781 2017 gene locus_tag LOCUS_22200 gene lptB 2781 2017 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_22200 3853 2768 gene locus_tag LOCUS_22210 3853 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 4414 3869 gene locus_tag LOCUS_22220 4414 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence295 560 1480 gene locus_tag LOCUS_22230 gene thyX 560 1480 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_22230 2354 1497 gene locus_tag LOCUS_22240 2354 1497 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467602.1 protein_id gnl|my_center|LOCUS_22240 2486 3898 gene locus_tag LOCUS_22250 gene pyk 2486 3898 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence296 2928 877 gene locus_tag LOCUS_22260 gene metG 2928 877 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404304.1 protein_id gnl|my_center|LOCUS_22260 3130 3603 gene locus_tag LOCUS_22270 3130 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 >Feature sequence297 1 2040 gene locus_tag LOCUS_22280 1 2040 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_22280 3252 2143 gene locus_tag LOCUS_22290 3252 2143 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_22290 4122 3322 gene locus_tag LOCUS_22300 4122 3322 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_22300 4427 4152 gene locus_tag LOCUS_22310 4427 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence298 1359 238 gene locus_tag LOCUS_22320 1359 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3236 1440 gene locus_tag LOCUS_22330 3236 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 3942 3349 gene locus_tag LOCUS_22340 3942 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 <4528 3939 gene locus_tag LOCUS_22350 <4528 3939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869660.1:cyclodeaminase/cyclohydrolase family protein >Feature sequence299 472 1455 gene locus_tag LOCUS_22360 gene trpD 472 1455 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_22360 1513 1824 gene locus_tag LOCUS_22370 1513 1824 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942472.1 protein_id gnl|my_center|LOCUS_22370 1811 2233 gene locus_tag LOCUS_22380 1811 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2434 2871 gene locus_tag LOCUS_22390 2434 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 >Feature sequence300 420 1670 gene locus_tag LOCUS_22400 420 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1660 1887 gene locus_tag LOCUS_22410 1660 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2035 2433 gene locus_tag LOCUS_22420 2035 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2714 3556 gene locus_tag LOCUS_22430 2714 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 3525 3731 gene locus_tag LOCUS_22440 3525 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22440 >Feature sequence301 489 115 gene locus_tag LOCUS_22450 489 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 784 512 gene locus_tag LOCUS_22460 784 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1220 831 gene locus_tag LOCUS_22470 1220 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1603 1400 gene locus_tag LOCUS_22480 1603 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2691 2275 gene locus_tag LOCUS_22490 2691 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3778 3281 gene locus_tag LOCUS_22500 3778 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence302 213 1061 gene locus_tag LOCUS_22510 213 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1179 2168 gene locus_tag LOCUS_22520 gene mgrA 1179 2168 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_22520 2749 2222 gene locus_tag LOCUS_22530 2749 2222 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_22530 2972 3424 gene locus_tag LOCUS_22540 2972 3424 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence303 966 259 gene locus_tag LOCUS_22550 966 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 1346 924 gene locus_tag LOCUS_22560 1346 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22560 1997 1533 gene locus_tag LOCUS_22570 1997 1533 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_22570 3565 2021 gene locus_tag LOCUS_22580 3565 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 <4495 3831 gene locus_tag LOCUS_22590 <4495 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003532039.1:xanthine dehydrogenase family protein subunit M >Feature sequence304 393 800 gene locus_tag LOCUS_22600 393 800 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_22600 941 3550 gene locus_tag LOCUS_22610 941 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence305 <1 1110 gene locus_tag LOCUS_22620 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein 1363 1785 gene locus_tag LOCUS_22630 1363 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1896 3044 gene locus_tag LOCUS_22640 1896 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3052 3678 gene locus_tag LOCUS_22650 3052 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22650 3772 4398 gene locus_tag LOCUS_22660 3772 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22660 >Feature sequence306 1601 222 gene locus_tag LOCUS_22670 1601 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3125 1692 gene locus_tag LOCUS_22680 3125 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 3675 3379 gene locus_tag LOCUS_22690 3675 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 <4427 3747 gene locus_tag LOCUS_22700 <4427 3747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730657.1:VOC family protein >Feature sequence307 942 1763 gene locus_tag LOCUS_22710 942 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1778 2509 gene locus_tag LOCUS_22720 1778 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence308 <1 648 gene locus_tag LOCUS_22730 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001141968.1:histone deacetylase 630 1397 gene locus_tag LOCUS_22740 630 1397 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_22740 1684 2820 gene locus_tag LOCUS_22750 1684 2820 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_22750 2842 3429 gene locus_tag LOCUS_22760 2842 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 3426 4322 gene locus_tag LOCUS_22770 gene era 3426 4322 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence309 427 1566 gene locus_tag LOCUS_22780 427 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence310 95 1207 gene locus_tag LOCUS_22790 95 1207 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941973.1 protein_id gnl|my_center|LOCUS_22790 1212 2561 gene locus_tag LOCUS_22800 1212 2561 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_22800 2981 3325 gene locus_tag LOCUS_22810 2981 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence311 1154 333 gene locus_tag LOCUS_22820 1154 333 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_22820 1466 2671 gene locus_tag LOCUS_22830 1466 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2687 3037 gene locus_tag LOCUS_22840 2687 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3957 3172 gene locus_tag LOCUS_22850 3957 3172 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence312 1924 1247 gene locus_tag LOCUS_22860 1924 1247 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_22860 2491 1991 gene locus_tag LOCUS_22870 2491 1991 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217339.1 protein_id gnl|my_center|LOCUS_22870 3216 2512 gene locus_tag LOCUS_22880 3216 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 4318 3257 gene locus_tag LOCUS_22890 4318 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence313 1799 78 gene locus_tag LOCUS_22900 1799 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 2970 1894 gene locus_tag LOCUS_22910 2970 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 <4293 2977 gene locus_tag LOCUS_22920 <4293 2977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX >Feature sequence314 445 1308 gene locus_tag LOCUS_22930 445 1308 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_22930 1459 2415 gene locus_tag LOCUS_22940 gene nadE 1459 2415 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 protein_id gnl|my_center|LOCUS_22940 2560 3525 gene locus_tag LOCUS_22950 2560 3525 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261051.1 protein_id gnl|my_center|LOCUS_22950 3723 3598 gene locus_tag LOCUS_22960 3723 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 >Feature sequence315 491 105 gene locus_tag LOCUS_22970 491 105 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_22970 1393 3078 gene locus_tag LOCUS_22980 1393 3078 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence316 1633 845 gene locus_tag LOCUS_22990 1633 845 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_22990 2410 1640 gene locus_tag LOCUS_23000 2410 1640 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964340.1 protein_id gnl|my_center|LOCUS_23000 2640 2416 gene locus_tag LOCUS_23010 2640 2416 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_23010 4052 2637 gene locus_tag LOCUS_23020 4052 2637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502472.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence317 246 1706 gene locus_tag LOCUS_23030 246 1706 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_23030 1703 2110 gene locus_tag LOCUS_23040 1703 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2320 2574 gene locus_tag LOCUS_23050 2320 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2577 3404 gene locus_tag LOCUS_23060 gene eutJ 2577 3404 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929729.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence318 857 1435 gene locus_tag LOCUS_23070 857 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2499 1495 gene locus_tag LOCUS_23080 2499 1495 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_23080 <4185 2575 gene locus_tag LOCUS_23090 <4185 2575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence319 2813 3820 gene locus_tag LOCUS_23100 gene rfbB 2813 3820 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence320 137 880 gene locus_tag LOCUS_23110 137 880 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_23110 946 3357 gene locus_tag LOCUS_23120 946 3357 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence321 <1 745 gene locus_tag LOCUS_23130 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948252.1:SDR family oxidoreductase 823 1374 gene locus_tag LOCUS_23140 823 1374 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_23140 1917 1510 gene locus_tag LOCUS_23150 1917 1510 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_23150 2689 1982 gene locus_tag LOCUS_23160 2689 1982 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_23160 3603 2737 gene locus_tag LOCUS_23170 3603 2737 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence322 <1 826 gene locus_tag LOCUS_23180 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 937 2211 gene locus_tag LOCUS_23190 937 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2224 3630 gene locus_tag LOCUS_23200 2224 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence323 2097 3347 gene locus_tag LOCUS_23210 2097 3347 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391959.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence324 159 234 gene locus_tag LOCUS_t00230 159 234 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 241 317 gene locus_tag LOCUS_t00240 241 317 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 326 400 gene locus_tag LOCUS_t00250 326 400 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 425 498 gene locus_tag LOCUS_t00260 425 498 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 872 2683 gene locus_tag LOCUS_23220 gene typA 872 2683 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_23220 2709 3581 gene locus_tag LOCUS_23230 2709 3581 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234354.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence325 748 185 gene locus_tag LOCUS_23240 748 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 926 735 gene locus_tag LOCUS_23250 926 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1799 1434 gene locus_tag LOCUS_23260 1799 1434 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546106.1 protein_id gnl|my_center|LOCUS_23260 2028 1765 gene locus_tag LOCUS_23270 2028 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546126.1 protein_id gnl|my_center|LOCUS_23270 3642 2533 gene locus_tag LOCUS_23280 gene wecB 3642 2533 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence326 1 270 gene locus_tag LOCUS_23290 1 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 517 3480 gene locus_tag LOCUS_23300 517 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 3494 3862 gene locus_tag LOCUS_23310 3494 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence327 268 1392 gene locus_tag LOCUS_23320 268 1392 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23320 1905 1408 gene locus_tag LOCUS_23330 1905 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3926 1917 gene locus_tag LOCUS_23340 3926 1917 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence328 160 765 gene locus_tag LOCUS_23350 160 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 788 1180 gene locus_tag LOCUS_23360 788 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1199 1786 gene locus_tag LOCUS_23370 1199 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1788 2099 gene locus_tag LOCUS_23380 1788 2099 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_23380 2166 3695 gene locus_tag LOCUS_23390 2166 3695 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence329 <1 706 gene locus_tag LOCUS_23400 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein 833 1294 gene locus_tag LOCUS_23410 833 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 3971 1398 gene locus_tag LOCUS_23420 3971 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence330 2546 783 gene locus_tag LOCUS_23430 2546 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158861.1 protein_id gnl|my_center|LOCUS_23430 2783 3010 gene locus_tag LOCUS_23440 2783 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3131 3979 gene locus_tag LOCUS_23450 3131 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence331 <1 1250 gene locus_tag LOCUS_23460 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein 1711 1247 gene locus_tag LOCUS_23470 gene rnhA 1711 1247 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_23470 2975 1869 gene locus_tag LOCUS_23480 2975 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_23480 4012 3329 gene locus_tag LOCUS_23490 4012 3329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_23490 >Feature sequence332 191 1120 gene locus_tag LOCUS_23500 191 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1127 3877 gene locus_tag LOCUS_23510 1127 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence333 <1 879 gene locus_tag LOCUS_23520 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256516.1:redox-regulated ATPase YchF 1265 1414 gene locus_tag LOCUS_23530 1265 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1559 2962 gene locus_tag LOCUS_23540 1559 2962 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081454.1 protein_id gnl|my_center|LOCUS_23540 3065 3307 gene locus_tag LOCUS_23550 3065 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 <4017 3472 gene locus_tag LOCUS_23560 <4017 3472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459972.1:NTP transferase domain-containing protein >Feature sequence334 1009 320 gene locus_tag LOCUS_23570 1009 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1677 1108 gene locus_tag LOCUS_23580 1677 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2858 1680 gene locus_tag LOCUS_23590 2858 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3523 2855 gene locus_tag LOCUS_23600 3523 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 3917 4003 gene locus_tag LOCUS_t00270 3917 4003 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence335 1990 335 gene locus_tag LOCUS_23610 1990 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3302 2061 gene locus_tag LOCUS_23620 3302 2061 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence336 162 854 gene locus_tag LOCUS_23630 162 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1950 859 gene locus_tag LOCUS_23640 1950 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2840 2019 gene locus_tag LOCUS_23650 2840 2019 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927196.1 protein_id gnl|my_center|LOCUS_23650 3953 2853 gene locus_tag LOCUS_23660 3953 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence337 397 855 gene locus_tag LOCUS_23670 397 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2376 988 gene locus_tag LOCUS_23680 2376 988 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence338 <1 1956 gene locus_tag LOCUS_23690 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583909.1:endopeptidase La 2878 1985 gene locus_tag LOCUS_23700 2878 1985 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_23700 3653 2952 gene locus_tag LOCUS_23710 3653 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence339 384 3062 gene locus_tag LOCUS_23720 384 3062 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence340 <1 789 gene locus_tag LOCUS_23730 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000167663.1:SDR family oxidoreductase 801 3845 gene locus_tag LOCUS_23740 801 3845 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence341 1750 1031 gene locus_tag LOCUS_23750 1750 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2052 3737 gene locus_tag LOCUS_23760 2052 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence342 <1 1983 gene locus_tag LOCUS_23770 <1 1983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479507.1:fatty acid oxidation complex subunit alpha FadJ 2022 3758 gene locus_tag LOCUS_23780 2022 3758 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839145.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence343 <3925 2498 gene locus_tag LOCUS_23790 <3925 2498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681041.1:FlgD immunoglobulin-like domain containing protein >Feature sequence344 1290 811 gene locus_tag LOCUS_23800 1290 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2091 1354 gene locus_tag LOCUS_23810 2091 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3202 2759 gene locus_tag LOCUS_23820 3202 2759 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence345 925 299 gene locus_tag LOCUS_23830 gene pyrE 925 299 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_23830 2211 925 gene locus_tag LOCUS_23840 2211 925 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 protein_id gnl|my_center|LOCUS_23840 2876 2208 gene locus_tag LOCUS_23850 2876 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 <3918 3289 gene locus_tag LOCUS_23860 <3918 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886866.1:amidophosphoribosyltransferase >Feature sequence346 955 743 gene locus_tag LOCUS_23870 955 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1994 1068 gene locus_tag LOCUS_23880 1994 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence347 <1 555 gene locus_tag LOCUS_23890 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898511.1:Mut7-C RNAse domain-containing protein 793 1371 gene locus_tag LOCUS_23900 793 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1449 2930 gene locus_tag LOCUS_23910 1449 2930 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_23910 3484 3041 gene locus_tag LOCUS_23920 3484 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence348 903 1466 gene locus_tag LOCUS_23930 903 1466 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_23930 1579 3171 gene locus_tag LOCUS_23940 gene cimA 1579 3171 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932299.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence349 406 1419 gene locus_tag LOCUS_23950 406 1419 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878840.1 protein_id gnl|my_center|LOCUS_23950 2583 1429 gene locus_tag LOCUS_23960 2583 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3354 2599 gene locus_tag LOCUS_23970 3354 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 <3889 3354 gene locus_tag LOCUS_23980 <3889 3354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003432452.1:stage II sporulation protein D >Feature sequence350 119 613 gene locus_tag LOCUS_23990 119 613 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_23990 606 2936 gene locus_tag LOCUS_24000 606 2936 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063035.1 protein_id gnl|my_center|LOCUS_24000 <3877 2998 gene locus_tag LOCUS_24010 <3877 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081192.1:lipopolysaccharide biosynthesis protein >Feature sequence351 929 2641 gene locus_tag LOCUS_24020 929 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24020 >Feature sequence352 465 1793 gene locus_tag LOCUS_24030 gene gcvPA 465 1793 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_24030 1956 2960 gene locus_tag LOCUS_24040 1956 2960 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence353 1341 817 gene locus_tag LOCUS_24050 1341 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2027 1368 gene locus_tag LOCUS_24060 2027 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 <3855 2039 gene locus_tag LOCUS_24070 <3855 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878757.1:FAD-dependent oxidoreductase >Feature sequence354 1610 441 gene locus_tag LOCUS_24080 1610 441 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963747.1 protein_id gnl|my_center|LOCUS_24080 2653 1631 gene locus_tag LOCUS_24090 2653 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3263 2712 gene locus_tag LOCUS_24100 3263 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24100 3565 3260 gene locus_tag LOCUS_24110 3565 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence355 619 338 gene locus_tag LOCUS_24120 619 338 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020158.1 protein_id gnl|my_center|LOCUS_24120 1599 616 gene locus_tag LOCUS_24130 gene wbpB 1599 616 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_24130 1951 3120 gene locus_tag LOCUS_24140 gene sat 1951 3120 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_24140 3197 3550 gene locus_tag LOCUS_24150 3197 3550 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence356 1185 7 gene locus_tag LOCUS_24160 1185 7 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_24160 2373 1357 gene locus_tag LOCUS_24170 2373 1357 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_24170 3696 2374 gene locus_tag LOCUS_24180 3696 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence357 <1 558 gene locus_tag LOCUS_24190 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 630 2207 gene locus_tag LOCUS_24200 630 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2554 3555 gene locus_tag LOCUS_24210 gene argF 2554 3555 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261198.1 protein_id gnl|my_center|LOCUS_24210 3755 3678 gene locus_tag LOCUS_r00010 3755 3678 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 65 percent of the 5S ribosomal RNA >Feature sequence358 957 1286 gene locus_tag LOCUS_24220 957 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1320 1556 gene locus_tag LOCUS_24230 1320 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 2081 1833 gene locus_tag LOCUS_24240 2081 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2739 2083 gene locus_tag LOCUS_24250 2739 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24250 3355 2771 gene locus_tag LOCUS_24260 3355 2771 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence359 <1 667 gene locus_tag LOCUS_24270 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976109.1:carbamoyltransferase 654 1082 gene locus_tag LOCUS_24280 654 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1167 1331 gene locus_tag LOCUS_24290 1167 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1511 3274 gene locus_tag LOCUS_24300 1511 3274 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence360 933 2054 gene locus_tag LOCUS_24310 933 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2059 2616 gene locus_tag LOCUS_24320 gene rsmD 2059 2616 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_24320 2609 3094 gene locus_tag LOCUS_24330 gene coaD 2609 3094 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932645.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence361 2247 1123 gene locus_tag LOCUS_24340 2247 1123 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_24340 3564 2671 gene locus_tag LOCUS_24350 3564 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence362 114 1838 gene locus_tag LOCUS_24360 gene polX 114 1838 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_24360 1936 2994 gene locus_tag LOCUS_24370 gene plsX 1936 2994 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869848.1 protein_id gnl|my_center|LOCUS_24370 <3715 3006 gene locus_tag LOCUS_24380 <3715 3006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583308.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence363 869 318 gene locus_tag LOCUS_24390 869 318 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933185.1 protein_id gnl|my_center|LOCUS_24390 1728 1132 gene locus_tag LOCUS_24400 1728 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2256 1741 gene locus_tag LOCUS_24410 2256 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 3695 2409 gene locus_tag LOCUS_24420 3695 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence364 2238 1471 gene locus_tag LOCUS_24430 2238 1471 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_24430 3025 2303 gene locus_tag LOCUS_24440 3025 2303 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942270.1 protein_id gnl|my_center|LOCUS_24440 3377 3290 gene locus_tag LOCUS_t00280 3377 3290 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence365 332 805 gene locus_tag LOCUS_24450 332 805 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_24450 <3661 1204 gene locus_tag LOCUS_24460 <3661 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109196.1:insulinase family protein >Feature sequence366 >Feature sequence367 280 663 gene locus_tag LOCUS_24470 280 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1828 743 gene locus_tag LOCUS_24480 1828 743 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_24480 2157 1837 gene locus_tag LOCUS_24490 2157 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2774 2151 gene locus_tag LOCUS_24500 2774 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3653 2811 gene locus_tag LOCUS_24510 3653 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence368 <1 2203 gene locus_tag LOCUS_24520 <1 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403652.1:chromosome segregation protein SMC 2220 3620 gene locus_tag LOCUS_24530 2220 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence369 181 1791 gene locus_tag LOCUS_24540 181 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1772 2905 gene locus_tag LOCUS_24550 1772 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence370 <1 625 gene locus_tag LOCUS_24560 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704642.1:bifunctional riboflavin kinase/FAD synthetase 642 911 gene locus_tag LOCUS_24570 gene rpsO 642 911 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_24570 928 3045 gene locus_tag LOCUS_24580 gene pnp 928 3045 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence371 66 140 gene locus_tag LOCUS_t00290 66 140 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 290 976 gene locus_tag LOCUS_24590 290 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 997 2190 gene locus_tag LOCUS_24600 997 2190 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_24600 2206 3156 gene locus_tag LOCUS_24610 2206 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence372 911 297 gene locus_tag LOCUS_24620 gene lpoB 911 297 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_24620 1189 1524 gene locus_tag LOCUS_24630 1189 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072044.1 protein_id gnl|my_center|LOCUS_24630 2594 1521 gene locus_tag LOCUS_24640 2594 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 3203 2604 gene locus_tag LOCUS_24650 3203 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence373 <1 1627 gene locus_tag LOCUS_24660 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023262.1:DUF3160 domain-containing protein 3153 1630 gene locus_tag LOCUS_24670 gene hutH 3153 1630 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence374 361 1398 gene locus_tag LOCUS_24680 361 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1411 2886 gene locus_tag LOCUS_24690 1411 2886 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974395.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence375 843 94 gene locus_tag LOCUS_24700 843 94 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_24700 913 2973 gene locus_tag LOCUS_24710 913 2973 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence376 2420 966 gene locus_tag LOCUS_24720 2420 966 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence377 2 307 gene locus_tag LOCUS_24730 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 869 507 gene locus_tag LOCUS_24740 869 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1058 3085 gene locus_tag LOCUS_24750 gene alaS 1058 3085 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24750 >Feature sequence378 <1 2322 gene locus_tag LOCUS_24760 <1 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB 2394 2798 gene locus_tag LOCUS_24770 2394 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence379 2534 1221 gene locus_tag LOCUS_24780 2534 1221 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence380 2024 1332 gene locus_tag LOCUS_24790 2024 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_24790 2352 2561 gene locus_tag LOCUS_24800 2352 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence381 <1 1965 gene locus_tag LOCUS_24810 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203230.1:alpha-amylase family glycosyl hydrolase >Feature sequence382 7 1440 gene locus_tag LOCUS_24820 7 1440 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_24820 2310 1564 gene locus_tag LOCUS_24830 2310 1564 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890736.1 protein_id gnl|my_center|LOCUS_24830 2417 3235 gene locus_tag LOCUS_24840 2417 3235 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence383 <1 675 gene locus_tag LOCUS_24850 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942670.1:chorismate synthase 746 919 gene locus_tag LOCUS_24860 746 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2777 972 gene locus_tag LOCUS_24870 2777 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence384 1813 767 gene locus_tag LOCUS_24880 1813 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 2585 1845 gene locus_tag LOCUS_24890 2585 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 <3515 2599 gene locus_tag LOCUS_24900 <3515 2599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933777.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence385 405 1196 gene locus_tag LOCUS_24910 405 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1204 2598 gene locus_tag LOCUS_24920 1204 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2665 3210 gene locus_tag LOCUS_24930 2665 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence386 414 662 gene locus_tag LOCUS_24940 414 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 689 1873 gene locus_tag LOCUS_24950 689 1873 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257960.1 protein_id gnl|my_center|LOCUS_24950 2202 1885 gene locus_tag LOCUS_24960 2202 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24960 2786 2337 gene locus_tag LOCUS_24970 2786 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24970 >Feature sequence387 494 577 gene locus_tag LOCUS_t00300 494 577 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 738 3029 gene locus_tag LOCUS_24980 738 3029 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence388 966 1526 gene locus_tag LOCUS_24990 966 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403180.1 protein_id gnl|my_center|LOCUS_24990 1562 2131 gene locus_tag LOCUS_25000 gene sigZ 1562 2131 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398507.1 protein_id gnl|my_center|LOCUS_25000 2198 2854 gene locus_tag LOCUS_25010 2198 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence389 2233 1751 gene locus_tag LOCUS_25020 2233 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2400 2275 gene locus_tag LOCUS_25030 2400 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence390 1 927 gene locus_tag LOCUS_25040 gene rsmH 1 927 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_25040 924 1310 gene locus_tag LOCUS_25050 924 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1310 3382 gene locus_tag LOCUS_25060 1310 3382 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence391 176 388 gene locus_tag LOCUS_25070 176 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 761 414 gene locus_tag LOCUS_25080 761 414 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227874.1 protein_id gnl|my_center|LOCUS_25080 2346 751 gene locus_tag LOCUS_25090 gene ptsP 2346 751 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_25090 2529 2371 gene locus_tag LOCUS_25100 2529 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2907 2638 gene locus_tag LOCUS_25110 gene groES 2907 2638 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_25110 3172 2918 gene locus_tag LOCUS_25120 3172 2918 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence392 844 1461 gene locus_tag LOCUS_25130 844 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 1463 2662 gene locus_tag LOCUS_25140 1463 2662 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence393 >Feature sequence394 214 1698 gene locus_tag LOCUS_25150 214 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1891 2916 gene locus_tag LOCUS_25160 1891 2916 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence395 1180 545 gene locus_tag LOCUS_25170 1180 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_25170 3133 1349 gene locus_tag LOCUS_25180 3133 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence396 <1 783 gene locus_tag LOCUS_25190 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405269.1:DNA polymerase III subunit gamma/tau 843 1223 gene locus_tag LOCUS_25200 843 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1238 1576 gene locus_tag LOCUS_25210 1238 1576 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 protein_id gnl|my_center|LOCUS_25210 1578 2180 gene locus_tag LOCUS_25220 gene recR 1578 2180 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_25220 3086 2175 gene locus_tag LOCUS_25230 3086 2175 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257278.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence397 134 1405 gene locus_tag LOCUS_25240 134 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210193.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence398 301 720 gene locus_tag LOCUS_25250 301 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 734 1078 gene locus_tag LOCUS_25260 734 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 2155 1130 gene locus_tag LOCUS_25270 2155 1130 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_25270 2418 3041 gene locus_tag LOCUS_25280 2418 3041 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530159.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence399 2663 984 gene locus_tag LOCUS_25290 2663 984 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_25290 3109 2975 gene locus_tag LOCUS_25300 3109 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence400 1230 496 gene locus_tag LOCUS_25310 1230 496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_25310 2467 1223 gene locus_tag LOCUS_25320 2467 1223 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_25320 3387 2464 gene locus_tag LOCUS_25330 3387 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence401 <1 644 gene locus_tag LOCUS_25340 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582685.1:class I SAM-dependent methyltransferase 649 1047 gene locus_tag LOCUS_25350 649 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1053 2384 gene locus_tag LOCUS_25360 1053 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence402 86 1396 gene locus_tag LOCUS_25370 86 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1415 1882 gene locus_tag LOCUS_25380 1415 1882 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838770.1 protein_id gnl|my_center|LOCUS_25380 1901 3355 gene locus_tag LOCUS_25390 1901 3355 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence403 43 1626 gene locus_tag LOCUS_25400 43 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence404 <1 1410 gene locus_tag LOCUS_25410 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257959.1:ABC transporter ATP-binding protein <3342 1446 gene locus_tag LOCUS_25420 <3342 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence405 2360 573 gene locus_tag LOCUS_25430 2360 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2546 3034 gene locus_tag LOCUS_25440 2546 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 >Feature sequence406 473 1198 gene locus_tag LOCUS_25450 gene scpB 473 1198 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_25450 1204 1926 gene locus_tag LOCUS_25460 1204 1926 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986387.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence407 1333 92 gene locus_tag LOCUS_25470 1333 92 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence408 468 1778 gene locus_tag LOCUS_25480 468 1778 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152045320.1 protein_id gnl|my_center|LOCUS_25480 1850 2059 gene locus_tag LOCUS_25490 1850 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2059 2889 gene locus_tag LOCUS_25500 2059 2889 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence409 2639 1770 gene locus_tag LOCUS_25510 2639 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence410 394 1143 gene locus_tag LOCUS_25520 394 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence411 <1 837 gene locus_tag LOCUS_25530 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798976.1:electron transfer flavoprotein subunit alpha/FixB family protein 1376 3097 gene locus_tag LOCUS_25540 1376 3097 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence412 752 468 gene locus_tag LOCUS_25550 752 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 961 1527 gene locus_tag LOCUS_25560 961 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence413 961 1542 gene locus_tag LOCUS_25570 961 1542 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228583.1 protein_id gnl|my_center|LOCUS_25570 1542 2030 gene locus_tag LOCUS_25580 1542 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2020 2769 gene locus_tag LOCUS_25590 2020 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence414 <1 1311 gene locus_tag LOCUS_25600 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927193.1:PBP1A family penicillin-binding protein 2592 1408 gene locus_tag LOCUS_25610 2592 1408 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence415 1004 504 gene locus_tag LOCUS_25620 1004 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 <3183 1075 gene locus_tag LOCUS_25630 <3183 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor >Feature sequence416 2688 184 gene locus_tag LOCUS_25640 2688 184 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence417 1144 2394 gene locus_tag LOCUS_25650 gene pepT 1144 2394 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_25650 2508 2864 gene locus_tag LOCUS_25660 2508 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence418 <1 630 gene locus_tag LOCUS_25670 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530257.1:malate dehydrogenase 910 1587 gene locus_tag LOCUS_25680 910 1587 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_25680 1594 2283 gene locus_tag LOCUS_25690 1594 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence419 488 1120 gene locus_tag LOCUS_25700 488 1120 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881413.1 protein_id gnl|my_center|LOCUS_25700 1146 1868 gene locus_tag LOCUS_25710 1146 1868 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence420 125 1930 gene locus_tag LOCUS_25720 gene lepA 125 1930 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_25720 2110 2826 gene locus_tag LOCUS_25730 gene lepB 2110 2826 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence421 <1 512 gene locus_tag LOCUS_25740 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957975.1:glycosyltransferase family 2 protein 509 1147 gene locus_tag LOCUS_25750 509 1147 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_25750 1132 2046 gene locus_tag LOCUS_25760 1132 2046 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_25760 2142 2067 gene locus_tag LOCUS_t00310 2142 2067 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 731 570 gene locus_tag LOCUS_25770 731 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 2444 1425 gene locus_tag LOCUS_25780 2444 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence423 >Feature sequence424 2088 1591 gene locus_tag LOCUS_25790 2088 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 >Feature sequence425 2324 1053 gene locus_tag LOCUS_25800 gene mtaB 2324 1053 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence426 1734 1297 gene locus_tag LOCUS_25810 gene aroQ 1734 1297 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 protein_id gnl|my_center|LOCUS_25810 2581 1751 gene locus_tag LOCUS_25820 2581 1751 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence427 2489 1908 gene locus_tag LOCUS_25830 2489 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25830 >Feature sequence428 1 1050 gene locus_tag LOCUS_25840 1 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1314 1129 gene locus_tag LOCUS_25850 1314 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 2619 1834 gene locus_tag LOCUS_25860 2619 1834 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence429 504 1886 gene locus_tag LOCUS_25870 gene gatD 504 1886 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_25870 2635 1985 gene locus_tag LOCUS_25880 gene nth 2635 1985 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence430 <1 1992 gene locus_tag LOCUS_25890 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence431 <1 2157 gene locus_tag LOCUS_25900 <1 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence432 154 708 gene locus_tag LOCUS_25910 154 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1172 1408 gene locus_tag LOCUS_25920 1172 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 1405 2652 gene locus_tag LOCUS_25930 1405 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence433 1939 641 gene locus_tag LOCUS_25940 1939 641 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence434 85 462 gene locus_tag LOCUS_25950 85 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25950 913 1383 gene locus_tag LOCUS_25960 913 1383 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence435 235 1533 gene locus_tag LOCUS_25970 235 1533 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_25970 2562 1543 gene locus_tag LOCUS_25980 2562 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence436 2780 1779 gene locus_tag LOCUS_25990 2780 1779 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence437 318 1874 gene locus_tag LOCUS_26000 gene rny 318 1874 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_26000 1908 2822 gene locus_tag LOCUS_26010 1908 2822 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922486.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence438 <1 555 gene locus_tag LOCUS_26020 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788554.1:trypsin-like peptidase domain-containing protein 891 2837 gene locus_tag LOCUS_26030 gene dnaK 891 2837 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence439 1 846 gene locus_tag LOCUS_26040 1 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 858 1835 gene locus_tag LOCUS_26050 858 1835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144142.1 protein_id gnl|my_center|LOCUS_26050 1839 2603 gene locus_tag LOCUS_26060 1839 2603 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence440 275 730 gene locus_tag LOCUS_26070 275 730 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_26070 2166 928 gene locus_tag LOCUS_26080 2166 928 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_26080 2506 2330 gene locus_tag LOCUS_26090 2506 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence441 <1 553 gene locus_tag LOCUS_26100 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000272429.1:stage 0 sporulation family protein 603 1802 gene locus_tag LOCUS_26110 gene lhgO 603 1802 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_26110 2466 1846 gene locus_tag LOCUS_26120 2466 1846 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence442 2526 940 gene locus_tag LOCUS_26130 2526 940 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117744.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence443 170 1642 gene locus_tag LOCUS_26140 170 1642 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_26140 1646 1786 gene locus_tag LOCUS_26150 1646 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1951 2277 gene locus_tag LOCUS_26160 1951 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2261 2479 gene locus_tag LOCUS_26170 2261 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence444 172 645 gene locus_tag LOCUS_26180 172 645 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_26180 782 1630 gene locus_tag LOCUS_26190 782 1630 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_26190 1646 1939 gene locus_tag LOCUS_26200 1646 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence445 77 1099 gene locus_tag LOCUS_26210 77 1099 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_26210 1195 2190 gene locus_tag LOCUS_26220 1195 2190 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence446 1534 452 gene locus_tag LOCUS_26230 1534 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 >Feature sequence447 1517 870 gene locus_tag LOCUS_26240 gene eda 1517 870 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_26240 <2811 1589 gene locus_tag LOCUS_26250 <2811 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence448 1525 377 gene locus_tag LOCUS_26260 gene nifS 1525 377 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence449 1078 644 gene locus_tag LOCUS_26270 1078 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1842 1228 gene locus_tag LOCUS_26280 gene lexA 1842 1228 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence450 <1 870 gene locus_tag LOCUS_26290 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:GAF domain-containing protein 899 1564 gene locus_tag LOCUS_26300 899 1564 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792797.1 protein_id gnl|my_center|LOCUS_26300 2083 2526 gene locus_tag LOCUS_26310 2083 2526 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence451 773 1963 gene locus_tag LOCUS_26320 773 1963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_26320 2540 1968 gene locus_tag LOCUS_26330 2540 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence452 <1 858 gene locus_tag LOCUS_26340 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:SpoIIE family protein phosphatase <2780 908 gene locus_tag LOCUS_26350 <2780 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence453 2130 301 gene locus_tag LOCUS_26360 2130 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 <2775 2099 gene locus_tag LOCUS_26370 <2775 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392119.1:radical SAM family heme chaperone HemW >Feature sequence454 1847 1167 gene locus_tag LOCUS_26380 1847 1167 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_26380 2161 2652 gene locus_tag LOCUS_26390 2161 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence455 <1 566 gene locus_tag LOCUS_26400 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146584900.1:N-acetylmuramoyl-L-alanine amidase 1706 618 gene locus_tag LOCUS_26410 1706 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2491 1709 gene locus_tag LOCUS_26420 2491 1709 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence456 44 412 gene locus_tag LOCUS_26430 gene folB 44 412 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_26430 409 894 gene locus_tag LOCUS_26440 gene folK 409 894 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_26440 894 1541 gene locus_tag LOCUS_26450 894 1541 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_26450 1545 1730 gene locus_tag LOCUS_26460 1545 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence457 590 1192 gene locus_tag LOCUS_26470 590 1192 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764520.1 protein_id gnl|my_center|LOCUS_26470 1258 2316 gene locus_tag LOCUS_26480 1258 2316 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence458 650 2140 gene locus_tag LOCUS_26490 650 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence459 1187 111 gene locus_tag LOCUS_26500 gene gcvT 1187 111 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_26500 1809 1189 gene locus_tag LOCUS_26510 gene plsY 1809 1189 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_26510 <2749 2182 gene locus_tag LOCUS_26520 <2749 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787649.1:ectonucleotide pyrophosphatase/phosphodiesterase >Feature sequence460 904 389 gene locus_tag LOCUS_26530 904 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2169 904 gene locus_tag LOCUS_26540 2169 904 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285230.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence461 <1 1317 gene locus_tag LOCUS_26550 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118691.1:DUF1926 domain-containing protein >Feature sequence462 >Feature sequence463 <1 2457 gene locus_tag LOCUS_26560 <1 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit >Feature sequence464 699 1379 gene locus_tag LOCUS_26570 699 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2440 1490 gene locus_tag LOCUS_26580 gene metF 2440 1490 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence465 2210 813 gene locus_tag LOCUS_26590 2210 813 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_26590 2656 2210 gene locus_tag LOCUS_26600 2656 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence466 >Feature sequence467 >Feature sequence468 530 871 gene locus_tag LOCUS_26610 530 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 868 1356 gene locus_tag LOCUS_26620 868 1356 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_26620 1413 1497 gene locus_tag LOCUS_t00320 1413 1497 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1731 2297 gene locus_tag LOCUS_26630 1731 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence469 846 322 gene locus_tag LOCUS_26640 846 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1922 891 gene locus_tag LOCUS_26650 1922 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence470 <1 1218 gene locus_tag LOCUS_26660 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator 1360 2112 gene locus_tag LOCUS_26670 1360 2112 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_26670 2122 2616 gene locus_tag LOCUS_26680 gene ruvC 2122 2616 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence471 640 149 gene locus_tag LOCUS_26690 640 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1790 783 gene locus_tag LOCUS_26700 1790 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2432 1812 gene locus_tag LOCUS_26710 gene lexA 2432 1812 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence472 104 478 gene locus_tag LOCUS_26720 104 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 672 1682 gene locus_tag LOCUS_26730 672 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence473 38 1441 gene locus_tag LOCUS_26740 38 1441 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258138.1 protein_id gnl|my_center|LOCUS_26740 1434 2012 gene locus_tag LOCUS_26750 1434 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence474 <1 1089 gene locus_tag LOCUS_26760 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087902.1:glycosyltransferase family 4 protein 1441 2379 gene locus_tag LOCUS_26770 1441 2379 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence475 1250 309 gene locus_tag LOCUS_26780 1250 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2188 1361 gene locus_tag LOCUS_26790 2188 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence476 >Feature sequence477 1125 61 gene locus_tag LOCUS_26800 1125 61 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence478 >Feature sequence479 2174 1560 gene locus_tag LOCUS_26810 2174 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26810 >Feature sequence480 >Feature sequence481 1158 229 gene locus_tag LOCUS_26820 1158 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 1331 1212 gene locus_tag LOCUS_26830 1331 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence482 619 203 gene locus_tag LOCUS_26840 619 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 <2495 594 gene locus_tag LOCUS_26850 <2495 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404269.1:HDIG domain-containing protein >Feature sequence483 2024 978 gene locus_tag LOCUS_26860 2024 978 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence484 423 178 gene locus_tag LOCUS_26870 423 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 910 599 gene locus_tag LOCUS_26880 910 599 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_26880 1211 933 gene locus_tag LOCUS_26890 1211 933 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_26890 >Feature sequence485 >Feature sequence486 1010 267 gene locus_tag LOCUS_26900 1010 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence487 <1 917 gene locus_tag LOCUS_26910 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258140.1:TIGR03986 family CRISPR-associated RAMP protein 929 1768 gene locus_tag LOCUS_26920 929 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1786 2025 gene locus_tag LOCUS_26930 1786 2025 CDS product CRISPR-associated protein Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546514.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence488 1164 154 gene locus_tag LOCUS_26940 1164 154 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_26940 2163 1240 gene locus_tag LOCUS_26950 2163 1240 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence489 >Feature sequence490 >Feature sequence491 >Feature sequence492 348 671 gene locus_tag LOCUS_26960 348 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 746 1663 gene locus_tag LOCUS_26970 746 1663 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence493 <1 1044 gene locus_tag LOCUS_26980 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582948.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) 1475 1669 gene locus_tag LOCUS_26990 1475 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1711 1917 gene locus_tag LOCUS_27000 1711 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 >Feature sequence494 509 1438 gene locus_tag LOCUS_27010 509 1438 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence495 >Feature sequence496 1106 462 gene locus_tag LOCUS_27020 1106 462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_27020 <2306 1258 gene locus_tag LOCUS_27030 <2306 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109153.1:two-component regulator propeller domain-containing protein >Feature sequence497 >Feature sequence498 >Feature sequence499 >Feature sequence500 902 198 gene locus_tag LOCUS_27040 gene radC 902 198 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 protein_id gnl|my_center|LOCUS_27040 1642 932 gene locus_tag LOCUS_27050 1642 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2197 1790 gene locus_tag LOCUS_27060 2197 1790 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence501 894 151 gene locus_tag LOCUS_27070 gene istB 894 151 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_27070 <2249 931 gene locus_tag LOCUS_27080 <2249 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:IS21-like element ISPsy14 family transposase >Feature sequence502 >Feature sequence503 >Feature sequence504 618 1130 gene locus_tag LOCUS_27090 618 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 1140 1262 gene locus_tag LOCUS_27100 1140 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 1277 2098 gene locus_tag LOCUS_27110 1277 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence505 >Feature sequence506 217 1053 gene locus_tag LOCUS_27120 217 1053 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence507 599 294 gene locus_tag LOCUS_27130 599 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1781 801 gene locus_tag LOCUS_27140 gene cas1 1781 801 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_27140 >Feature sequence508 2196 124 gene locus_tag LOCUS_27150 gene leuS 2196 124 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence509 217 1362 gene locus_tag LOCUS_27160 217 1362 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_27160 1473 1838 gene locus_tag LOCUS_27170 1473 1838 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence510 1644 1093 gene locus_tag LOCUS_27180 1644 1093 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_27180 1999 2074 gene locus_tag LOCUS_t00330 1999 2074 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence511 2174 726 gene locus_tag LOCUS_27190 2174 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence512 486 671 gene locus_tag LOCUS_27200 486 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 690 1928 gene locus_tag LOCUS_27210 690 1928 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680921.1 protein_id gnl|my_center|LOCUS_27210 1978 2050 gene locus_tag LOCUS_t00340 1978 2050 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence513 >Feature sequence514 1267 173 gene locus_tag LOCUS_27220 1267 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence515 2 436 gene locus_tag LOCUS_27230 2 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 455 1606 gene locus_tag LOCUS_27240 gene acdA 455 1606 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence516 >Feature sequence517 291 2033 gene locus_tag LOCUS_27250 291 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27250 >Feature sequence518 78 857 gene locus_tag LOCUS_27260 78 857 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_27260 1367 1993 gene locus_tag LOCUS_27270 1367 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27270 >Feature sequence519 70 810 gene locus_tag LOCUS_27280 70 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 910 1389 gene locus_tag LOCUS_27290 910 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1460 1900 gene locus_tag LOCUS_27300 1460 1900 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence520 42 917 gene locus_tag LOCUS_27310 42 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 958 1155 gene locus_tag LOCUS_27320 gene rpsU 958 1155 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546110.1 protein_id gnl|my_center|LOCUS_27320 1184 1645 gene locus_tag LOCUS_27330 1184 1645 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_27330 >Feature sequence521 <2068 37 gene locus_tag LOCUS_27340 <2068 37 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018662405.1:helicase-exonuclease AddAB subunit AddA >Feature sequence522 1307 417 gene locus_tag LOCUS_27350 1307 417 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_27350 1565 1308 gene locus_tag LOCUS_27360 1565 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence523 334 1944 gene locus_tag LOCUS_27370 334 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence524 1232 93 gene locus_tag LOCUS_27380 1232 93 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_27380 1725 1315 gene locus_tag LOCUS_27390 1725 1315 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214837.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence525 98 457 gene locus_tag LOCUS_27400 98 457 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942234.1 protein_id gnl|my_center|LOCUS_27400 438 1148 gene locus_tag LOCUS_27410 gene truB 438 1148 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931935.1 protein_id gnl|my_center|LOCUS_27410 >Feature sequence526 >Feature sequence527 1501 194 gene locus_tag LOCUS_27420 1501 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1775 1503 gene locus_tag LOCUS_27430 1775 1503 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence528 <1 1396 gene locus_tag LOCUS_27440 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109382.1:type I pullulanase 1947 1405 gene locus_tag LOCUS_27450 gene msrA 1947 1405 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence529 255 977 gene locus_tag LOCUS_27460 gene mtgA 255 977 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939571.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence530 33 686 gene locus_tag LOCUS_27470 33 686 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_27470 702 1274 gene locus_tag LOCUS_27480 702 1274 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733163.1 protein_id gnl|my_center|LOCUS_27480 1480 1728 gene locus_tag LOCUS_27490 1480 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence531 65 559 gene locus_tag LOCUS_27500 65 559 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_27500 649 1152 gene locus_tag LOCUS_27510 649 1152 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence532 >Feature sequence533 1222 953 gene locus_tag LOCUS_27520 gene hupB 1222 953 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208639.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence534 >Feature sequence535 1929 652 gene locus_tag LOCUS_27530 1929 652 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence536 354 1358 gene locus_tag LOCUS_27540 354 1358 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence537 309 566 gene locus_tag LOCUS_27550 309 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27550 563 682 gene locus_tag LOCUS_27560 563 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 679 1563 gene locus_tag LOCUS_27570 679 1563 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence538 19 1134 gene locus_tag LOCUS_27580 19 1134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence539 689 1831 gene locus_tag LOCUS_27590 689 1831 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence540 560 408 gene locus_tag LOCUS_27600 560 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1519 557 gene locus_tag LOCUS_27610 1519 557 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence541 107 934 gene locus_tag LOCUS_27620 gene aroE 107 934 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_27620 <1895 1013 gene locus_tag LOCUS_27630 <1895 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943070.1:ATP-binding protein >Feature sequence542 1634 879 gene locus_tag LOCUS_27640 gene cobB 1634 879 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868319.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence543 >Feature sequence544 >Feature sequence545 <1854 746 gene locus_tag LOCUS_27650 <1854 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_089761628.1:TlpA disulfide reductase family protein >Feature sequence546 >Feature sequence547 609 1577 gene locus_tag LOCUS_27660 609 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence548 363 956 gene locus_tag LOCUS_27670 363 956 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949065.1 protein_id gnl|my_center|LOCUS_27670 >Feature sequence549 149 1621 gene locus_tag LOCUS_27680 149 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence550 >Feature sequence551 1534 671 gene locus_tag LOCUS_27690 1534 671 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence552 390 1634 gene locus_tag LOCUS_27700 390 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence553 <1 915 gene locus_tag LOCUS_27710 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001136708.1:SpoIIE family protein phosphatase >Feature sequence554 <1 582 gene locus_tag LOCUS_27720 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002220007.1:sigma-70 family RNA polymerase sigma factor 582 875 gene locus_tag LOCUS_27730 582 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 1068 1586 gene locus_tag LOCUS_27740 1068 1586 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence555 <1 1293 gene locus_tag LOCUS_27750 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108087.1:ATP-binding protein >Feature sequence556 >Feature sequence557 388 1167 gene locus_tag LOCUS_27760 388 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27760 >Feature sequence558 957 430 gene locus_tag LOCUS_27770 957 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence559 662 1468 gene locus_tag LOCUS_27780 662 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence560 25 258 gene locus_tag LOCUS_27790 25 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence561 <1 649 gene locus_tag LOCUS_27800 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765411.1:aspartate ammonia-lyase <1723 659 gene locus_tag LOCUS_27810 <1723 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942299.1:response regulator >Feature sequence562 1338 547 gene locus_tag LOCUS_27820 1338 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence563 <1697 92 gene locus_tag LOCUS_27830 <1697 92 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943038.1:PocR ligand-binding domain-containing protein >Feature sequence564 677 1072 gene locus_tag LOCUS_27840 677 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence565 707 1378 gene locus_tag LOCUS_27850 707 1378 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence566 547 32 gene locus_tag LOCUS_27860 547 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 <1666 569 gene locus_tag LOCUS_27870 <1666 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107468.1:peptide MFS transporter >Feature sequence567 486 283 gene locus_tag LOCUS_27880 486 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27880 >Feature sequence568 346 1035 gene locus_tag LOCUS_27890 346 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27890 1036 1479 gene locus_tag LOCUS_27900 1036 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27900 >Feature sequence569 1 414 gene locus_tag LOCUS_27910 1 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence570 418 1131 gene locus_tag LOCUS_27920 418 1131 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927160.1 protein_id gnl|my_center|LOCUS_27920 1265 1396 gene locus_tag LOCUS_27930 1265 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence571 282 1307 gene locus_tag LOCUS_27940 282 1307 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942886.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence572 >Feature sequence573 >Feature sequence574 <1 1085 gene locus_tag LOCUS_27950 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494280.1:DNA helicase RecQ >Feature sequence575 908 441 gene locus_tag LOCUS_27960 908 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1434 910 gene locus_tag LOCUS_27970 1434 910 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence576 571 849 gene locus_tag LOCUS_27980 571 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence577 <1 862 gene locus_tag LOCUS_27990 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946763.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence578 >Feature sequence579 >Feature sequence580 1575 1114 gene locus_tag LOCUS_28000 1575 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence581 >Feature sequence582 1019 486 gene locus_tag LOCUS_28010 1019 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence583 <1 1492 gene locus_tag LOCUS_28020 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171507.1:class I adenylate-forming enzyme family protein >Feature sequence584 638 1216 gene locus_tag LOCUS_28030 638 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence585 755 671 gene locus_tag LOCUS_t00350 755 671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence586 >Feature sequence587 621 1418 gene locus_tag LOCUS_28040 621 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040