>Feature sequence01 211 1104 gene locus_tag LOCUS_00010 gene cheV 211 1104 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_00010 1161 1643 gene locus_tag LOCUS_00020 1161 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1685 4375 gene locus_tag LOCUS_00030 1685 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4372 4977 gene locus_tag LOCUS_00040 gene hisH 4372 4977 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_00040 4991 5746 gene locus_tag LOCUS_00050 gene hisF 4991 5746 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_00050 5758 6432 gene locus_tag LOCUS_00060 5758 6432 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_00060 6435 7679 gene locus_tag LOCUS_00070 gene lysA 6435 7679 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_00070 7829 7746 gene locus_tag LOCUS_t00010 7829 7746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7952 8281 gene locus_tag LOCUS_00080 7952 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8282 10927 gene locus_tag LOCUS_00090 gene polA 8282 10927 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_00090 10951 13068 gene locus_tag LOCUS_00100 10951 13068 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964331.1 protein_id gnl|my_center|LOCUS_00100 13065 13880 gene locus_tag LOCUS_00110 13065 13880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_00110 13921 14841 gene locus_tag LOCUS_00120 13921 14841 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_00120 14841 15779 gene locus_tag LOCUS_00130 14841 15779 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_00130 15792 17468 gene locus_tag LOCUS_00140 15792 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17471 18637 gene locus_tag LOCUS_00150 17471 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18638 21181 gene locus_tag LOCUS_00160 18638 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21183 22544 gene locus_tag LOCUS_00170 21183 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23740 22574 gene locus_tag LOCUS_00180 23740 22574 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_00180 23843 24844 gene locus_tag LOCUS_00190 gene pta 23843 24844 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_00190 24870 26063 gene locus_tag LOCUS_00200 gene ackA 24870 26063 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_00200 26186 27040 gene locus_tag LOCUS_00210 26186 27040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27119 31399 gene locus_tag LOCUS_00220 27119 31399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 31412 33241 gene locus_tag LOCUS_00230 31412 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 33294 33869 gene locus_tag LOCUS_00240 33294 33869 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_00240 33872 34051 gene locus_tag LOCUS_00250 gene rpmF 33872 34051 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_00250 34172 35185 gene locus_tag LOCUS_00260 gene plsX 34172 35185 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_00260 35200 35430 gene locus_tag LOCUS_00270 gene acpP 35200 35430 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_00270 35475 36152 gene locus_tag LOCUS_00280 gene rnc 35475 36152 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_00280 36162 39722 gene locus_tag LOCUS_00290 gene smc 36162 39722 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_00290 39722 40579 gene locus_tag LOCUS_00300 gene ftsY 39722 40579 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_00300 40601 41824 gene locus_tag LOCUS_00310 gene ilvA 40601 41824 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_00310 41824 42891 gene locus_tag LOCUS_00320 41824 42891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43015 43359 gene locus_tag LOCUS_00330 gene rplS 43015 43359 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_00330 43423 44007 gene locus_tag LOCUS_00340 43423 44007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 44015 44866 gene locus_tag LOCUS_00350 gene ylqF 44015 44866 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296988.1 protein_id gnl|my_center|LOCUS_00350 44872 45411 gene locus_tag LOCUS_00360 gene lepB 44872 45411 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_00360 45424 46182 gene locus_tag LOCUS_00370 45424 46182 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_00370 46182 47861 gene locus_tag LOCUS_00380 46182 47861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948001.1 protein_id gnl|my_center|LOCUS_00380 47861 48157 gene locus_tag LOCUS_00390 47861 48157 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392518.1 protein_id gnl|my_center|LOCUS_00390 48164 48517 gene locus_tag LOCUS_00400 48164 48517 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_00400 48611 49672 gene locus_tag LOCUS_00410 48611 49672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49739 50404 gene locus_tag LOCUS_00420 49739 50404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 50401 50880 gene locus_tag LOCUS_00430 gene rlmH 50401 50880 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_00430 50895 52199 gene locus_tag LOCUS_00440 50895 52199 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_00440 52199 53209 gene locus_tag LOCUS_00450 52199 53209 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_00450 53193 54386 gene locus_tag LOCUS_00460 53193 54386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54394 56010 gene locus_tag LOCUS_00470 gene spoVB 54394 56010 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 protein_id gnl|my_center|LOCUS_00470 56019 57614 gene locus_tag LOCUS_00480 56019 57614 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_00480 57625 58203 gene locus_tag LOCUS_00490 57625 58203 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583583.1 protein_id gnl|my_center|LOCUS_00490 58203 59450 gene locus_tag LOCUS_00500 58203 59450 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083010.1 protein_id gnl|my_center|LOCUS_00500 59531 60601 gene locus_tag LOCUS_00510 59531 60601 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468109.1 protein_id gnl|my_center|LOCUS_00510 60621 61652 gene locus_tag LOCUS_00520 60621 61652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61671 62804 gene locus_tag LOCUS_00530 gene tgt 61671 62804 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_00530 62876 63193 gene locus_tag LOCUS_00540 gene yajC 62876 63193 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_00540 63244 64326 gene locus_tag LOCUS_00550 gene leuB 63244 64326 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_00550 64330 65991 gene locus_tag LOCUS_00560 gene ilvD 64330 65991 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_00560 66014 67705 gene locus_tag LOCUS_00570 gene ilvB 66014 67705 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_00570 67708 69120 gene locus_tag LOCUS_00580 67708 69120 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_00580 69210 70289 gene locus_tag LOCUS_00590 gene serC 69210 70289 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_00590 70289 71452 gene locus_tag LOCUS_00600 70289 71452 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_00600 71823 71554 gene locus_tag LOCUS_00610 71823 71554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71929 74361 gene locus_tag LOCUS_00620 gene glgB 71929 74361 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_00620 74402 74474 gene locus_tag LOCUS_t00020 74402 74474 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 74578 75960 gene locus_tag LOCUS_00630 gene argH 74578 75960 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_00630 75972 77057 gene locus_tag LOCUS_00640 gene asd 75972 77057 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_00640 77082 78812 gene locus_tag LOCUS_00650 77082 78812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 78827 80191 gene locus_tag LOCUS_00660 78827 80191 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_00660 80209 82782 gene locus_tag LOCUS_00670 80209 82782 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_00670 82893 83585 gene locus_tag LOCUS_00680 82893 83585 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_00680 83606 84625 gene locus_tag LOCUS_00690 83606 84625 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_00690 84749 85288 gene locus_tag LOCUS_00700 84749 85288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85310 85720 gene locus_tag LOCUS_00710 85310 85720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 85797 86396 gene locus_tag LOCUS_00720 85797 86396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 86912 86439 gene locus_tag LOCUS_00730 86912 86439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87032 89467 gene locus_tag LOCUS_00740 87032 89467 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_00740 89527 91143 gene locus_tag LOCUS_00750 89527 91143 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_00750 91157 91642 gene locus_tag LOCUS_00760 gene ilvN 91157 91642 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_00760 91712 92209 gene locus_tag LOCUS_00770 gene ilvN 91712 92209 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_00770 92240 93262 gene locus_tag LOCUS_00780 gene ilvC 92240 93262 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_00780 93329 94591 gene locus_tag LOCUS_00790 gene leuC 93329 94591 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_00790 94602 95090 gene locus_tag LOCUS_00800 gene leuD 94602 95090 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_00800 95100 95708 gene locus_tag LOCUS_00810 95100 95708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 95689 97281 gene locus_tag LOCUS_00820 95689 97281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 98072 97278 gene locus_tag LOCUS_00830 98072 97278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 98146 98541 gene locus_tag LOCUS_00840 98146 98541 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_00840 98525 99049 gene locus_tag LOCUS_00850 98525 99049 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_00850 99046 99660 gene locus_tag LOCUS_00860 gene ruvA 99046 99660 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_00860 99675 100670 gene locus_tag LOCUS_00870 gene ruvB 99675 100670 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_00870 100719 101117 gene locus_tag LOCUS_00880 100719 101117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101151 102422 gene locus_tag LOCUS_00890 101151 102422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 102415 103245 gene locus_tag LOCUS_00900 102415 103245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 103245 104942 gene locus_tag LOCUS_00910 103245 104942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 104920 106374 gene locus_tag LOCUS_00920 104920 106374 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_00920 106444 107316 gene locus_tag LOCUS_00930 106444 107316 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_00930 107340 108842 gene locus_tag LOCUS_00940 107340 108842 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_00940 109933 108878 gene locus_tag LOCUS_00950 109933 108878 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963797.1 protein_id gnl|my_center|LOCUS_00950 110052 110381 gene locus_tag LOCUS_00960 110052 110381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 110381 111331 gene locus_tag LOCUS_00970 110381 111331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 111324 111710 gene locus_tag LOCUS_00980 111324 111710 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_00980 111722 112297 gene locus_tag LOCUS_00990 111722 112297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112543 112358 gene locus_tag LOCUS_01000 gene rpmB 112543 112358 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_01000 112713 113099 gene locus_tag LOCUS_01010 112713 113099 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 protein_id gnl|my_center|LOCUS_01010 113111 114781 gene locus_tag LOCUS_01020 113111 114781 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_01020 114795 116861 gene locus_tag LOCUS_01030 gene recG 114795 116861 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_01030 116934 117791 gene locus_tag LOCUS_01040 116934 117791 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166859.1 protein_id gnl|my_center|LOCUS_01040 117803 119725 gene locus_tag LOCUS_01050 gene gyrB 117803 119725 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_01050 119736 121991 gene locus_tag LOCUS_01060 gene gyrA 119736 121991 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_01060 121991 122536 gene locus_tag LOCUS_01070 gene rsmD 121991 122536 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_01070 122529 123023 gene locus_tag LOCUS_01080 gene coaD 122529 123023 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_01080 123025 123756 gene locus_tag LOCUS_01090 123025 123756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 123811 124938 gene locus_tag LOCUS_01100 123811 124938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 124922 125641 gene locus_tag LOCUS_01110 124922 125641 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965964.1 protein_id gnl|my_center|LOCUS_01110 125631 126308 gene locus_tag LOCUS_01120 125631 126308 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_01120 126301 126873 gene locus_tag LOCUS_01130 126301 126873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 126883 127818 gene locus_tag LOCUS_01140 126883 127818 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_01140 127820 128362 gene locus_tag LOCUS_01150 gene recU 127820 128362 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460152.1 protein_id gnl|my_center|LOCUS_01150 128440 130098 gene locus_tag LOCUS_01160 128440 130098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 130085 131377 gene locus_tag LOCUS_01170 gene hisD 130085 131377 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_01170 131390 131974 gene locus_tag LOCUS_01180 gene hisB 131390 131974 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_01180 131974 133266 gene locus_tag LOCUS_01190 131974 133266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 133273 135138 gene locus_tag LOCUS_01200 133273 135138 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_01200 135135 135830 gene locus_tag LOCUS_01210 135135 135830 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_01210 135832 136986 gene locus_tag LOCUS_01220 135832 136986 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_01220 137055 138239 gene locus_tag LOCUS_01230 137055 138239 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989701.1 protein_id gnl|my_center|LOCUS_01230 138305 139861 gene locus_tag LOCUS_01240 138305 139861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920612.1 protein_id gnl|my_center|LOCUS_01240 139854 140963 gene locus_tag LOCUS_01250 139854 140963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679664.1 protein_id gnl|my_center|LOCUS_01250 140966 141925 gene locus_tag LOCUS_01260 140966 141925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044979586.1 protein_id gnl|my_center|LOCUS_01260 142079 142384 gene locus_tag LOCUS_01270 gene rplU 142079 142384 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_01270 142394 142738 gene locus_tag LOCUS_01280 142394 142738 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_01280 142725 143009 gene locus_tag LOCUS_01290 gene rpmA 142725 143009 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_01290 143069 144364 gene locus_tag LOCUS_01300 gene obgE 143069 144364 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_01300 144379 144669 gene locus_tag LOCUS_01310 gene yhbY 144379 144669 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_01310 144696 145268 gene locus_tag LOCUS_01320 gene yqeK 144696 145268 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_01320 145268 145624 gene locus_tag LOCUS_01330 gene rsfS 145268 145624 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_01330 145624 146367 gene locus_tag LOCUS_01340 145624 146367 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_01340 146342 147394 gene locus_tag LOCUS_01350 146342 147394 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_01350 147407 148861 gene locus_tag LOCUS_01360 147407 148861 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_01360 149574 148957 gene locus_tag LOCUS_01370 gene lexA 149574 148957 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_01370 149747 150106 gene locus_tag LOCUS_01380 149747 150106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 150212 150778 gene locus_tag LOCUS_01390 150212 150778 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_01390 150818 151402 gene locus_tag LOCUS_01400 150818 151402 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_01400 151411 151731 gene locus_tag LOCUS_01410 151411 151731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 151735 152928 gene locus_tag LOCUS_01420 151735 152928 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_01420 152930 153871 gene locus_tag LOCUS_01430 152930 153871 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_01430 153896 154801 gene locus_tag LOCUS_01440 153896 154801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 154808 155686 gene locus_tag LOCUS_01450 154808 155686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965285.1 protein_id gnl|my_center|LOCUS_01450 155733 156716 gene locus_tag LOCUS_01460 155733 156716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 157557 157300 gene locus_tag LOCUS_01470 157557 157300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 158183 157557 gene locus_tag LOCUS_01480 158183 157557 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_01480 159129 158221 gene locus_tag LOCUS_01490 159129 158221 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_01490 159651 159130 gene locus_tag LOCUS_01500 gene lspA 159651 159130 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_01500 160228 159653 gene locus_tag LOCUS_01510 160228 159653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 160781 160311 gene locus_tag LOCUS_01520 160781 160311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 161481 160792 gene locus_tag LOCUS_01530 161481 160792 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_01530 162877 161474 gene locus_tag LOCUS_01540 162877 161474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 163365 162949 gene locus_tag LOCUS_01550 163365 162949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_01550 164409 163429 gene locus_tag LOCUS_01560 164409 163429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 164788 164393 gene locus_tag LOCUS_01570 164788 164393 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_01570 165943 164837 gene locus_tag LOCUS_01580 gene rodA 165943 164837 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_01580 168809 165945 gene locus_tag LOCUS_01590 168809 165945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 169320 168802 gene locus_tag LOCUS_01600 169320 168802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 170047 169322 gene locus_tag LOCUS_01610 gene mreC 170047 169322 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_01610 171215 170208 gene locus_tag LOCUS_01620 171215 170208 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557301.1 protein_id gnl|my_center|LOCUS_01620 172558 171275 gene locus_tag LOCUS_01630 172558 171275 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_01630 173483 172545 gene locus_tag LOCUS_01640 gene miaA 173483 172545 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_01640 175354 173483 gene locus_tag LOCUS_01650 gene mutL 175354 173483 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_01650 178018 175358 gene locus_tag LOCUS_01660 gene mutS 178018 175358 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_01660 179406 178003 gene locus_tag LOCUS_01670 gene miaB 179406 178003 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_01670 179922 179422 gene locus_tag LOCUS_01680 179922 179422 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_01680 181796 179937 gene locus_tag LOCUS_01690 gene glgX 181796 179937 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971803.1 protein_id gnl|my_center|LOCUS_01690 182838 181834 gene locus_tag LOCUS_01700 182838 181834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 183031 183369 gene locus_tag LOCUS_01710 183031 183369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 185172 183370 gene locus_tag LOCUS_01720 185172 183370 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_01720 186782 185328 gene locus_tag LOCUS_01730 gene gltX 186782 185328 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_01730 188501 186795 gene locus_tag LOCUS_01740 188501 186795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 188955 188521 gene locus_tag LOCUS_01750 gene dutA 188955 188521 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_01750 189463 188957 gene locus_tag LOCUS_01760 gene nrdG 189463 188957 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_01760 190783 189605 gene locus_tag LOCUS_01770 190783 189605 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_01770 193065 190888 gene locus_tag LOCUS_01780 gene nrdD 193065 190888 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_01780 194223 193231 gene locus_tag LOCUS_01790 194223 193231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 194359 194195 gene locus_tag LOCUS_01800 194359 194195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 195924 194419 gene locus_tag LOCUS_01810 195924 194419 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287495.1 protein_id gnl|my_center|LOCUS_01810 197195 195924 gene locus_tag LOCUS_01820 197195 195924 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_01820 197717 197205 gene locus_tag LOCUS_01830 197717 197205 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_01830 198547 197726 gene locus_tag LOCUS_01840 198547 197726 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_01840 199770 198550 gene locus_tag LOCUS_01850 gene tyrS 199770 198550 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_01850 200996 199788 gene locus_tag LOCUS_01860 200996 199788 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_01860 201795 200986 gene locus_tag LOCUS_01870 201795 200986 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_01870 202842 201805 gene locus_tag LOCUS_01880 202842 201805 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_01880 203521 202835 gene locus_tag LOCUS_01890 gene plsY 203521 202835 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258974.1 protein_id gnl|my_center|LOCUS_01890 204855 203521 gene locus_tag LOCUS_01900 gene der 204855 203521 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_01900 205002 206195 gene locus_tag LOCUS_01910 205002 206195 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_01910 208350 206302 gene locus_tag LOCUS_01920 208350 206302 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861512.1 protein_id gnl|my_center|LOCUS_01920 209051 208347 gene locus_tag LOCUS_01930 209051 208347 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_01930 210597 209212 gene locus_tag LOCUS_01940 gene gltA 210597 209212 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_01940 211491 210613 gene locus_tag LOCUS_01950 211491 210613 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_01950 213004 211520 gene locus_tag LOCUS_01960 213004 211520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 213838 213008 gene locus_tag LOCUS_01970 gene folD 213838 213008 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_01970 215520 213850 gene locus_tag LOCUS_01980 215520 213850 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809743.1 protein_id gnl|my_center|LOCUS_01980 218365 215534 gene locus_tag LOCUS_01990 218365 215534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 219704 218385 gene locus_tag LOCUS_02000 219704 218385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 220549 219821 gene locus_tag LOCUS_02010 220549 219821 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_02010 221769 220567 gene locus_tag LOCUS_02020 gene alr 221769 220567 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_02020 222380 221766 gene locus_tag LOCUS_02030 222380 221766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 223018 222386 gene locus_tag LOCUS_02040 223018 222386 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_02040 223198 225129 gene locus_tag LOCUS_02050 223198 225129 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_02050 226471 225155 gene locus_tag LOCUS_02060 226471 225155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 227695 226487 gene locus_tag LOCUS_02070 227695 226487 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_02070 228374 227697 gene locus_tag LOCUS_02080 228374 227697 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02080 229801 228374 gene locus_tag LOCUS_02090 229801 228374 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_02090 232681 229934 gene locus_tag LOCUS_02100 232681 229934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 238211 232719 gene locus_tag LOCUS_02110 238211 232719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 239161 238493 gene locus_tag LOCUS_02120 239161 238493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 240906 239161 gene locus_tag LOCUS_02130 240906 239161 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_02130 242096 240924 gene locus_tag LOCUS_02140 242096 240924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 244516 242099 gene locus_tag LOCUS_02150 gene leuS 244516 242099 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108730.1 protein_id gnl|my_center|LOCUS_02150 245328 244537 gene locus_tag LOCUS_02160 245328 244537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964973.1 protein_id gnl|my_center|LOCUS_02160 247586 245493 gene locus_tag LOCUS_02170 gene fusA 247586 245493 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_02170 248070 247732 gene locus_tag LOCUS_02180 248070 247732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 249825 248176 gene locus_tag LOCUS_02190 249825 248176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 250906 249842 gene locus_tag LOCUS_02200 gene queA 250906 249842 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_02200 252317 250908 gene locus_tag LOCUS_02210 252317 250908 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_02210 254677 252320 gene locus_tag LOCUS_02220 gene pheT 254677 252320 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_02220 255757 254693 gene locus_tag LOCUS_02230 gene pheS 255757 254693 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_02230 256426 255800 gene locus_tag LOCUS_02240 256426 255800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 256392 256631 gene locus_tag LOCUS_02250 256392 256631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 258571 256958 gene locus_tag LOCUS_02260 gene pckA 258571 256958 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_02260 260047 258671 gene locus_tag LOCUS_02270 260047 258671 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_02270 261413 260082 gene locus_tag LOCUS_02280 261413 260082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 262901 261417 gene locus_tag LOCUS_02290 gene thrC 262901 261417 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_02290 262997 263794 gene locus_tag LOCUS_02300 262997 263794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 264939 263779 gene locus_tag LOCUS_02310 264939 263779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 264988 266073 gene locus_tag LOCUS_02320 264988 266073 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966047.1 protein_id gnl|my_center|LOCUS_02320 266854 266063 gene locus_tag LOCUS_02330 266854 266063 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_02330 267442 266864 gene locus_tag LOCUS_02340 gene rsxA 267442 266864 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_02340 268151 267435 gene locus_tag LOCUS_02350 268151 267435 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_02350 268761 268141 gene locus_tag LOCUS_02360 268761 268141 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_02360 269708 268758 gene locus_tag LOCUS_02370 269708 268758 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_02370 271040 269724 gene locus_tag LOCUS_02380 gene rsxC 271040 269724 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_02380 271140 272243 gene locus_tag LOCUS_02390 271140 272243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 273066 272284 gene locus_tag LOCUS_02400 273066 272284 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_02400 274240 273098 gene locus_tag LOCUS_02410 gene rpsA 274240 273098 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986222.1 protein_id gnl|my_center|LOCUS_02410 275102 274221 gene locus_tag LOCUS_02420 275102 274221 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_02420 275749 275093 gene locus_tag LOCUS_02430 gene cmk 275749 275093 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723586.1 protein_id gnl|my_center|LOCUS_02430 276976 275762 gene locus_tag LOCUS_02440 276976 275762 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_02440 277910 276969 gene locus_tag LOCUS_02450 277910 276969 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_02450 278539 277994 gene locus_tag LOCUS_02460 278539 277994 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356883.1 protein_id gnl|my_center|LOCUS_02460 280129 278696 gene locus_tag LOCUS_02470 280129 278696 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_02470 281306 280155 gene locus_tag LOCUS_02480 281306 280155 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_02480 281726 281358 gene locus_tag LOCUS_02490 281726 281358 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_02490 282498 281755 gene locus_tag LOCUS_02500 282498 281755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 283943 282519 gene locus_tag LOCUS_02510 283943 282519 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_02510 284648 284076 gene locus_tag LOCUS_02520 gene scpB 284648 284076 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_02520 285438 284653 gene locus_tag LOCUS_02530 285438 284653 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_02530 286084 285440 gene locus_tag LOCUS_02540 gene deoC 286084 285440 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_02540 287055 286195 gene locus_tag LOCUS_02550 287055 286195 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_02550 287299 287123 gene locus_tag LOCUS_02560 gene rpsU 287299 287123 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_02560 288383 287442 gene locus_tag LOCUS_02570 288383 287442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 289745 288456 gene locus_tag LOCUS_02580 289745 288456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 292416 289765 gene locus_tag LOCUS_02590 gene alaS 292416 289765 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02590 293864 292458 gene locus_tag LOCUS_02600 293864 292458 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_02600 294523 293885 gene locus_tag LOCUS_02610 294523 293885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 295202 294555 gene locus_tag LOCUS_02620 295202 294555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 296111 295203 gene locus_tag LOCUS_02630 gene era 296111 295203 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_02630 299005 296105 gene locus_tag LOCUS_02640 299005 296105 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_02640 299448 299005 gene locus_tag LOCUS_02650 299448 299005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 300196 299441 gene locus_tag LOCUS_02660 300196 299441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 301112 300204 gene locus_tag LOCUS_02670 301112 300204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 302542 301112 gene locus_tag LOCUS_02680 302542 301112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 302775 307010 gene locus_tag LOCUS_02690 302775 307010 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_02690 308177 307053 gene locus_tag LOCUS_02700 308177 307053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 309413 308208 gene locus_tag LOCUS_02710 gene murD 309413 308208 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881357.1 protein_id gnl|my_center|LOCUS_02710 310714 309488 gene locus_tag LOCUS_02720 310714 309488 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_02720 311029 310733 gene locus_tag LOCUS_02730 311029 310733 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809935.1 protein_id gnl|my_center|LOCUS_02730 311488 311090 gene locus_tag LOCUS_02740 311488 311090 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_02740 313925 311490 gene locus_tag LOCUS_02750 313925 311490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 315560 314010 gene locus_tag LOCUS_02760 gene rny 315560 314010 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_02760 316314 315691 gene locus_tag LOCUS_02770 316314 315691 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 protein_id gnl|my_center|LOCUS_02770 317317 316286 gene locus_tag LOCUS_02780 gene recA 317317 316286 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_02780 319705 317654 gene locus_tag LOCUS_02790 319705 317654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 320263 319721 gene locus_tag LOCUS_02800 gene pgsA 320263 319721 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_02800 321582 320260 gene locus_tag LOCUS_02810 gene rimO 321582 320260 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_02810 321845 321597 gene locus_tag LOCUS_02820 gene rpoZ 321845 321597 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431167.1 protein_id gnl|my_center|LOCUS_02820 322489 321866 gene locus_tag LOCUS_02830 gene gmk 322489 321866 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_02830 323386 322508 gene locus_tag LOCUS_02840 323386 322508 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_02840 323646 325385 gene locus_tag LOCUS_02850 323646 325385 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_02850 326198 325410 gene locus_tag LOCUS_02860 326198 325410 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_02860 327843 326209 gene locus_tag LOCUS_02870 327843 326209 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048381.1 protein_id gnl|my_center|LOCUS_02870 328214 327861 gene locus_tag LOCUS_02880 328214 327861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 329186 328317 gene locus_tag LOCUS_02890 329186 328317 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_02890 329354 329932 gene locus_tag LOCUS_02900 gene folE 329354 329932 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_02900 331108 329960 gene locus_tag LOCUS_02910 331108 329960 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722868.1 protein_id gnl|my_center|LOCUS_02910 331984 331145 gene locus_tag LOCUS_02920 331984 331145 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_02920 332672 331986 gene locus_tag LOCUS_02930 332672 331986 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_02930 333712 332669 gene locus_tag LOCUS_02940 333712 332669 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_02940 334708 333809 gene locus_tag LOCUS_02950 334708 333809 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_02950 334929 335387 gene locus_tag LOCUS_02960 334929 335387 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_02960 335398 336135 gene locus_tag LOCUS_02970 335398 336135 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_02970 337679 336315 gene locus_tag LOCUS_02980 337679 336315 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815306.1 protein_id gnl|my_center|LOCUS_02980 337976 337704 gene locus_tag LOCUS_02990 337976 337704 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_02990 338394 338035 gene locus_tag LOCUS_03000 338394 338035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 341653 338435 gene locus_tag LOCUS_03010 341653 338435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 342501 341650 gene locus_tag LOCUS_03020 342501 341650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 343165 342590 gene locus_tag LOCUS_03030 343165 342590 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_03030 345823 343184 gene locus_tag LOCUS_03040 345823 343184 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456350.1 protein_id gnl|my_center|LOCUS_03040 346923 345823 gene locus_tag LOCUS_03050 346923 345823 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829843.1 protein_id gnl|my_center|LOCUS_03050 348672 346984 gene locus_tag LOCUS_03060 348672 346984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 349036 348746 gene locus_tag LOCUS_03070 349036 348746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_03070 349891 350067 gene locus_tag LOCUS_03080 349891 350067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 350534 350205 gene locus_tag LOCUS_03090 350534 350205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 350874 350662 gene locus_tag LOCUS_03100 350874 350662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 350955 352505 gene locus_tag LOCUS_03110 350955 352505 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_03110 353375 352578 gene locus_tag LOCUS_03120 gene dapF 353375 352578 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_03120 353912 353532 gene locus_tag LOCUS_03130 353912 353532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 355216 353930 gene locus_tag LOCUS_03140 355216 353930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 355908 355303 gene locus_tag LOCUS_03150 355908 355303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 356682 355987 gene locus_tag LOCUS_03160 356682 355987 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485010.1 protein_id gnl|my_center|LOCUS_03160 356867 356721 gene locus_tag LOCUS_03170 356867 356721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 357307 356915 gene locus_tag LOCUS_03180 357307 356915 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_03180 357507 358493 gene locus_tag LOCUS_03190 357507 358493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 358503 358796 gene locus_tag LOCUS_03200 358503 358796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 360203 358845 gene locus_tag LOCUS_03210 360203 358845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 362041 360332 gene locus_tag LOCUS_03220 362041 360332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 362815 362117 gene locus_tag LOCUS_03230 362815 362117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 363447 362812 gene locus_tag LOCUS_03240 363447 362812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989792.1 protein_id gnl|my_center|LOCUS_03240 364351 363605 gene locus_tag LOCUS_03250 364351 363605 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_03250 365406 364366 gene locus_tag LOCUS_03260 365406 364366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_03260 365831 365409 gene locus_tag LOCUS_03270 365831 365409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 366603 365986 gene locus_tag LOCUS_03280 366603 365986 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459001.1 protein_id gnl|my_center|LOCUS_03280 367175 366678 gene locus_tag LOCUS_03290 367175 366678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 367955 367197 gene locus_tag LOCUS_03300 367955 367197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 368647 368165 gene locus_tag LOCUS_03310 368647 368165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 369617 368691 gene locus_tag LOCUS_03320 369617 368691 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_03320 370435 369662 gene locus_tag LOCUS_03330 370435 369662 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_03330 371415 370507 gene locus_tag LOCUS_03340 371415 370507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 372081 371479 gene locus_tag LOCUS_03350 372081 371479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 375022 372203 gene locus_tag LOCUS_03360 375022 372203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 375736 375038 gene locus_tag LOCUS_03370 375736 375038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_03370 376173 375820 gene locus_tag LOCUS_03380 376173 375820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 378369 376270 gene locus_tag LOCUS_03390 378369 376270 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_03390 378684 378373 gene locus_tag LOCUS_03400 378684 378373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 379097 378702 gene locus_tag LOCUS_03410 379097 378702 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_03410 379273 379136 gene locus_tag LOCUS_03420 379273 379136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 381382 379385 gene locus_tag LOCUS_03430 gene feoB 381382 379385 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_03430 381758 381546 gene locus_tag LOCUS_03440 381758 381546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 381936 382313 gene locus_tag LOCUS_03450 381936 382313 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03450 383099 382452 gene locus_tag LOCUS_03460 383099 382452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 383596 383090 gene locus_tag LOCUS_03470 383596 383090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 384273 383716 gene locus_tag LOCUS_03480 384273 383716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 385355 384357 gene locus_tag LOCUS_03490 385355 384357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence02 1263 343 gene locus_tag LOCUS_03500 1263 343 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_03500 1337 2674 gene locus_tag LOCUS_03510 1337 2674 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_03510 3888 2902 gene locus_tag LOCUS_03520 3888 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4171 3881 gene locus_tag LOCUS_03530 4171 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 7058 4425 gene locus_tag LOCUS_03540 gene ppdK 7058 4425 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_03540 8265 7120 gene locus_tag LOCUS_03550 8265 7120 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762418.1 protein_id gnl|my_center|LOCUS_03550 10180 8486 gene locus_tag LOCUS_03560 10180 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 11814 10180 gene locus_tag LOCUS_03570 11814 10180 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_03570 13845 11944 gene locus_tag LOCUS_03580 13845 11944 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03580 14098 13880 gene locus_tag LOCUS_03590 14098 13880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03590 14285 14662 gene locus_tag LOCUS_03600 14285 14662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 14713 17184 gene locus_tag LOCUS_03610 14713 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 18409 17177 gene locus_tag LOCUS_03620 18409 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 19556 18402 gene locus_tag LOCUS_03630 19556 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 19989 19651 gene locus_tag LOCUS_03640 19989 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 21842 20100 gene locus_tag LOCUS_03650 gene dnaK 21842 20100 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_03650 22741 21911 gene locus_tag LOCUS_03660 22741 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 23179 22745 gene locus_tag LOCUS_03670 23179 22745 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_03670 23330 24589 gene locus_tag LOCUS_03680 23330 24589 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_03680 25894 24602 gene locus_tag LOCUS_03690 25894 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 26826 25900 gene locus_tag LOCUS_03700 26826 25900 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_03700 27772 26819 gene locus_tag LOCUS_03710 27772 26819 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_03710 28656 27862 gene locus_tag LOCUS_03720 28656 27862 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055304.1 protein_id gnl|my_center|LOCUS_03720 29382 28717 gene locus_tag LOCUS_03730 29382 28717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 30689 29364 gene locus_tag LOCUS_03740 30689 29364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 32367 30859 gene locus_tag LOCUS_03750 32367 30859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 33427 32489 gene locus_tag LOCUS_03760 gene cysK 33427 32489 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_03760 33683 33611 gene locus_tag LOCUS_t00030 33683 33611 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 34892 33771 gene locus_tag LOCUS_03770 34892 33771 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_03770 35460 34951 gene locus_tag LOCUS_03780 35460 34951 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_03780 36203 35460 gene locus_tag LOCUS_03790 36203 35460 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642482.1 protein_id gnl|my_center|LOCUS_03790 36936 36286 gene locus_tag LOCUS_03800 36936 36286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 41585 36957 gene locus_tag LOCUS_03810 gene polC 41585 36957 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_03810 42641 41589 gene locus_tag LOCUS_03820 gene ispG 42641 41589 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_03820 44005 42704 gene locus_tag LOCUS_03830 44005 42704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 44728 44024 gene locus_tag LOCUS_03840 44728 44024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 45979 44900 gene locus_tag LOCUS_03850 gene rseP 45979 44900 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_03850 47134 45995 gene locus_tag LOCUS_03860 47134 45995 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_03860 47998 47165 gene locus_tag LOCUS_03870 47998 47165 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_03870 48726 47998 gene locus_tag LOCUS_03880 48726 47998 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_03880 49370 48816 gene locus_tag LOCUS_03890 gene frr 49370 48816 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_03890 50079 49384 gene locus_tag LOCUS_03900 gene pyrH 50079 49384 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_03900 50919 50098 gene locus_tag LOCUS_03910 50919 50098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 51157 50987 gene locus_tag LOCUS_03920 51157 50987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 52086 51157 gene locus_tag LOCUS_03930 gene pyrF 52086 51157 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_03930 52957 52115 gene locus_tag LOCUS_03940 52957 52115 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948026.1 protein_id gnl|my_center|LOCUS_03940 55448 53037 gene locus_tag LOCUS_03950 55448 53037 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_03950 56779 55736 gene locus_tag LOCUS_03960 56779 55736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 58153 56780 gene locus_tag LOCUS_03970 58153 56780 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_03970 58245 59303 gene locus_tag LOCUS_03980 58245 59303 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_03980 60649 59300 gene locus_tag LOCUS_03990 60649 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 60999 60685 gene locus_tag LOCUS_04000 60999 60685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 61323 61024 gene locus_tag LOCUS_04010 61323 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 61677 61339 gene locus_tag LOCUS_04020 61677 61339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 61927 61616 gene locus_tag LOCUS_04030 61927 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 62225 61941 gene locus_tag LOCUS_04040 62225 61941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 62488 62252 gene locus_tag LOCUS_04050 62488 62252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 66004 62531 gene locus_tag LOCUS_04060 66004 62531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 66342 66043 gene locus_tag LOCUS_04070 66342 66043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 67804 66479 gene locus_tag LOCUS_04080 67804 66479 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_04080 69743 67806 gene locus_tag LOCUS_04090 69743 67806 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064637.1 protein_id gnl|my_center|LOCUS_04090 70717 69752 gene locus_tag LOCUS_04100 70717 69752 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_04100 71343 70744 gene locus_tag LOCUS_04110 71343 70744 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_04110 72186 71488 gene locus_tag LOCUS_04120 72186 71488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 72525 72440 gene locus_tag LOCUS_t00040 72525 72440 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72591 73154 gene locus_tag LOCUS_04130 72591 73154 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_04130 73169 73528 gene locus_tag LOCUS_04140 73169 73528 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_04140 74230 73646 gene locus_tag LOCUS_04150 74230 73646 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461089.1 protein_id gnl|my_center|LOCUS_04150 75460 74354 gene locus_tag LOCUS_04160 75460 74354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 76298 75462 gene locus_tag LOCUS_04170 76298 75462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 78600 76666 gene locus_tag LOCUS_04180 78600 76666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 79354 78611 gene locus_tag LOCUS_04190 79354 78611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 81155 79392 gene locus_tag LOCUS_04200 gene aspS 81155 79392 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_04200 82289 81201 gene locus_tag LOCUS_04210 82289 81201 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706047.1 protein_id gnl|my_center|LOCUS_04210 84522 82327 gene locus_tag LOCUS_04220 84522 82327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 85735 84662 gene locus_tag LOCUS_04230 gene prfA 85735 84662 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_04230 86592 85720 gene locus_tag LOCUS_04240 86592 85720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 87578 86592 gene locus_tag LOCUS_04250 87578 86592 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_04250 87841 87635 gene locus_tag LOCUS_04260 gene rpmE 87841 87635 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_04260 88660 88010 gene locus_tag LOCUS_04270 88660 88010 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460518.1 protein_id gnl|my_center|LOCUS_04270 90009 88699 gene locus_tag LOCUS_04280 gene thiC 90009 88699 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_04280 90967 90116 gene locus_tag LOCUS_04290 gene thiD 90967 90116 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_04290 91689 91015 gene locus_tag LOCUS_04300 91689 91015 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_04300 92333 91695 gene locus_tag LOCUS_04310 gene thiE 92333 91695 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436488.1 protein_id gnl|my_center|LOCUS_04310 93218 92397 gene locus_tag LOCUS_04320 gene thiM 93218 92397 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_04320 94199 93549 gene locus_tag LOCUS_04330 94199 93549 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_04330 94603 94205 gene locus_tag LOCUS_04340 94603 94205 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_04340 96045 94843 gene locus_tag LOCUS_04350 96045 94843 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_04350 96368 96153 gene locus_tag LOCUS_04360 96368 96153 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004613735.1 protein_id gnl|my_center|LOCUS_04360 97125 96361 gene locus_tag LOCUS_04370 97125 96361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 99433 97847 gene locus_tag LOCUS_04380 99433 97847 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016681.1 protein_id gnl|my_center|LOCUS_04380 101859 100021 gene locus_tag LOCUS_04390 101859 100021 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994298.1 protein_id gnl|my_center|LOCUS_04390 102773 101952 gene locus_tag LOCUS_04400 102773 101952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 104137 102926 gene locus_tag LOCUS_04410 gene nifS 104137 102926 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_04410 105146 104142 gene locus_tag LOCUS_04420 105146 104142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 110483 105213 gene locus_tag LOCUS_04430 110483 105213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 111840 110464 gene locus_tag LOCUS_04440 111840 110464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 113583 111841 gene locus_tag LOCUS_04450 113583 111841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 113826 113605 gene locus_tag LOCUS_04460 113826 113605 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_04460 115774 115016 gene locus_tag LOCUS_04470 115774 115016 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151916064.1 protein_id gnl|my_center|LOCUS_04470 116256 115810 gene locus_tag LOCUS_04480 116256 115810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 117420 116395 gene locus_tag LOCUS_04490 117420 116395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 119633 117609 gene locus_tag LOCUS_04500 119633 117609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073778.1 protein_id gnl|my_center|LOCUS_04500 122991 119647 gene locus_tag LOCUS_04510 122991 119647 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_04510 123542 123018 gene locus_tag LOCUS_04520 123542 123018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 123881 123543 gene locus_tag LOCUS_04530 123881 123543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 125027 123891 gene locus_tag LOCUS_04540 125027 123891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 126292 125072 gene locus_tag LOCUS_04550 126292 125072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 127812 126307 gene locus_tag LOCUS_04560 127812 126307 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_04560 128877 127816 gene locus_tag LOCUS_04570 128877 127816 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_04570 129552 129376 gene locus_tag LOCUS_04580 129552 129376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 130173 129565 gene locus_tag LOCUS_04590 130173 129565 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_04590 131027 130224 gene locus_tag LOCUS_04600 131027 130224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 131913 131020 gene locus_tag LOCUS_04610 131913 131020 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_04610 132688 131918 gene locus_tag LOCUS_04620 132688 131918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 133467 132688 gene locus_tag LOCUS_04630 133467 132688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 134218 133493 gene locus_tag LOCUS_04640 134218 133493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_04640 135713 134283 gene locus_tag LOCUS_04650 135713 134283 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_04650 137672 135747 gene locus_tag LOCUS_04660 137672 135747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 138892 137702 gene locus_tag LOCUS_04670 138892 137702 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_04670 139109 140638 gene locus_tag LOCUS_04680 139109 140638 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896230.1 protein_id gnl|my_center|LOCUS_04680 142726 140756 gene locus_tag LOCUS_04690 142726 140756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 143651 142788 gene locus_tag LOCUS_04700 143651 142788 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_04700 145296 143800 gene locus_tag LOCUS_04710 145296 143800 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_04710 146793 145312 gene locus_tag LOCUS_04720 gene rho 146793 145312 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_04720 148643 147066 gene locus_tag LOCUS_04730 148643 147066 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_04730 150310 148670 gene locus_tag LOCUS_04740 150310 148670 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_04740 152189 150459 gene locus_tag LOCUS_04750 152189 150459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 153585 152194 gene locus_tag LOCUS_04760 153585 152194 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_04760 154978 153572 gene locus_tag LOCUS_04770 154978 153572 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_04770 155762 155004 gene locus_tag LOCUS_04780 155762 155004 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_04780 156420 155770 gene locus_tag LOCUS_04790 156420 155770 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_04790 157272 156445 gene locus_tag LOCUS_04800 157272 156445 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_04800 158558 157356 gene locus_tag LOCUS_04810 158558 157356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 159391 158558 gene locus_tag LOCUS_04820 159391 158558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 160698 159394 gene locus_tag LOCUS_04830 160698 159394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 164279 160710 gene locus_tag LOCUS_04840 164279 160710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 166423 164366 gene locus_tag LOCUS_04850 gene htpG 166423 164366 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_04850 167488 166475 gene locus_tag LOCUS_04860 167488 166475 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_04860 168337 167639 gene locus_tag LOCUS_04870 168337 167639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 169153 168395 gene locus_tag LOCUS_04880 169153 168395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 172326 169336 gene locus_tag LOCUS_04890 172326 169336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 174271 173234 gene locus_tag LOCUS_04900 174271 173234 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_04900 175197 174379 gene locus_tag LOCUS_04910 175197 174379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 175945 175268 gene locus_tag LOCUS_04920 175945 175268 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_04920 177052 175955 gene locus_tag LOCUS_04930 gene mtnA 177052 175955 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_04930 178253 177120 gene locus_tag LOCUS_04940 178253 177120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 180629 178491 gene locus_tag LOCUS_04950 180629 178491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 181508 180639 gene locus_tag LOCUS_04960 181508 180639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 182222 182770 gene locus_tag LOCUS_04970 182222 182770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 182861 183097 gene locus_tag LOCUS_04980 182861 183097 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_04980 184469 183084 gene locus_tag LOCUS_04990 184469 183084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 185238 184447 gene locus_tag LOCUS_05000 185238 184447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 186302 185292 gene locus_tag LOCUS_05010 186302 185292 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_05010 187895 186489 gene locus_tag LOCUS_05020 187895 186489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 188361 188993 gene locus_tag LOCUS_05030 188361 188993 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_05030 190171 189122 gene locus_tag LOCUS_05040 190171 189122 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_05040 190964 190173 gene locus_tag LOCUS_05050 190964 190173 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_05050 192146 190977 gene locus_tag LOCUS_05060 192146 190977 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_05060 193135 192263 gene locus_tag LOCUS_05070 193135 192263 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_05070 194047 193217 gene locus_tag LOCUS_05080 194047 193217 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_05080 195313 194132 gene locus_tag LOCUS_05090 195313 194132 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_05090 195875 195441 gene locus_tag LOCUS_05100 195875 195441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 196629 195865 gene locus_tag LOCUS_05110 196629 195865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 197551 196703 gene locus_tag LOCUS_05120 197551 196703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 198185 197658 gene locus_tag LOCUS_05130 gene raiA 198185 197658 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_05130 199718 198279 gene locus_tag LOCUS_05140 199718 198279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 200802 199888 gene locus_tag LOCUS_05150 gene trxB 200802 199888 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_05150 201551 200802 gene locus_tag LOCUS_05160 201551 200802 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965914.1 protein_id gnl|my_center|LOCUS_05160 202410 201559 gene locus_tag LOCUS_05170 202410 201559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 203811 202423 gene locus_tag LOCUS_05180 203811 202423 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_05180 204960 203980 gene locus_tag LOCUS_05190 204960 203980 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_05190 205974 205741 gene locus_tag LOCUS_05200 205974 205741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 208304 205929 gene locus_tag LOCUS_05210 gene feoB 208304 205929 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_05210 209105 208452 gene locus_tag LOCUS_05220 209105 208452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 212345 209121 gene locus_tag LOCUS_05230 gene carB 212345 209121 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_05230 213482 212553 gene locus_tag LOCUS_05240 gene cysK 213482 212553 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582454.1 protein_id gnl|my_center|LOCUS_05240 214626 213511 gene locus_tag LOCUS_05250 214626 213511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 214908 214708 gene locus_tag LOCUS_05260 214908 214708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 214913 215758 gene locus_tag LOCUS_05270 214913 215758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 216728 215769 gene locus_tag LOCUS_05280 216728 215769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 217059 216889 gene locus_tag LOCUS_05290 217059 216889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 217493 217164 gene locus_tag LOCUS_05300 217493 217164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 218573 217671 gene locus_tag LOCUS_05310 218573 217671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 218956 219924 gene locus_tag LOCUS_05320 218956 219924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 220676 219993 gene locus_tag LOCUS_05330 220676 219993 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_05330 221526 220744 gene locus_tag LOCUS_05340 221526 220744 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_05340 222030 221614 gene locus_tag LOCUS_05350 222030 221614 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_05350 222925 222116 gene locus_tag LOCUS_05360 222925 222116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 223486 222935 gene locus_tag LOCUS_05370 223486 222935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 223706 225226 gene locus_tag LOCUS_05380 223706 225226 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_05380 225201 225968 gene locus_tag LOCUS_05390 225201 225968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 227008 225989 gene locus_tag LOCUS_05400 227008 225989 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_05400 228037 227111 gene locus_tag LOCUS_05410 228037 227111 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_05410 228699 228157 gene locus_tag LOCUS_05420 228699 228157 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304258.1 protein_id gnl|my_center|LOCUS_05420 230208 228799 gene locus_tag LOCUS_05430 230208 228799 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_05430 233089 231431 gene locus_tag LOCUS_05440 233089 231431 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_05440 234995 233235 gene locus_tag LOCUS_05450 234995 233235 CDS product KHG/KDPG aldolase/sugar kinase fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681035.1 protein_id gnl|my_center|LOCUS_05450 236508 235069 gene locus_tag LOCUS_05460 gene uxaC 236508 235069 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_05460 239358 236686 gene locus_tag LOCUS_05470 239358 236686 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_05470 239482 240816 gene locus_tag LOCUS_05480 239482 240816 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_05480 241232 240825 gene locus_tag LOCUS_05490 241232 240825 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_05490 241582 241235 gene locus_tag LOCUS_05500 241582 241235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 242605 241604 gene locus_tag LOCUS_05510 242605 241604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 243652 242678 gene locus_tag LOCUS_05520 243652 242678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 244768 243842 gene locus_tag LOCUS_05530 244768 243842 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence03 1688 357 gene locus_tag LOCUS_05540 1688 357 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_05540 2867 2121 gene locus_tag LOCUS_05550 gene tpiA 2867 2121 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_05550 4127 2895 gene locus_tag LOCUS_05560 4127 2895 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_05560 5005 4280 gene locus_tag LOCUS_05570 5005 4280 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949000.1 protein_id gnl|my_center|LOCUS_05570 5764 5054 gene locus_tag LOCUS_05580 5764 5054 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027947.1 protein_id gnl|my_center|LOCUS_05580 6618 5812 gene locus_tag LOCUS_05590 6618 5812 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027948.1 protein_id gnl|my_center|LOCUS_05590 7735 6734 gene locus_tag LOCUS_05600 gene gap 7735 6734 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_05600 8731 7913 gene locus_tag LOCUS_05610 8731 7913 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_05610 11128 8834 gene locus_tag LOCUS_05620 11128 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 11272 12021 gene locus_tag LOCUS_05630 11272 12021 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368777.1 protein_id gnl|my_center|LOCUS_05630 12018 12317 gene locus_tag LOCUS_05640 12018 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13035 12346 gene locus_tag LOCUS_05650 13035 12346 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_05650 14322 13051 gene locus_tag LOCUS_05660 gene hisS 14322 13051 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_05660 15281 14397 gene locus_tag LOCUS_05670 gene xerD 15281 14397 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_05670 16081 15539 gene locus_tag LOCUS_05680 16081 15539 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067042.1 protein_id gnl|my_center|LOCUS_05680 17376 16093 gene locus_tag LOCUS_05690 17376 16093 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_05690 18477 17530 gene locus_tag LOCUS_05700 18477 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 18547 19107 gene locus_tag LOCUS_05710 18547 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 20484 19171 gene locus_tag LOCUS_05720 20484 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 23522 20514 gene locus_tag LOCUS_05730 23522 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 24920 23562 gene locus_tag LOCUS_05740 24920 23562 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_05740 25018 24899 gene locus_tag LOCUS_05750 25018 24899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 25171 26163 gene locus_tag LOCUS_05760 25171 26163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_05760 26255 27433 gene locus_tag LOCUS_05770 26255 27433 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_05770 27715 27584 gene locus_tag LOCUS_05780 27715 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 28881 27712 gene locus_tag LOCUS_05790 28881 27712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 29447 29133 gene locus_tag LOCUS_05800 29447 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 30047 29448 gene locus_tag LOCUS_05810 30047 29448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 30291 30166 gene locus_tag LOCUS_05820 30291 30166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 30415 30284 gene locus_tag LOCUS_05830 30415 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 30895 30512 gene locus_tag LOCUS_05840 30895 30512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 32667 31153 gene locus_tag LOCUS_05850 32667 31153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398313.1 protein_id gnl|my_center|LOCUS_05850 33355 32648 gene locus_tag LOCUS_05860 33355 32648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 33620 33444 gene locus_tag LOCUS_05870 33620 33444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 36489 33706 gene locus_tag LOCUS_05880 36489 33706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 37197 36736 gene locus_tag LOCUS_05890 37197 36736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 37439 37251 gene locus_tag LOCUS_05900 37439 37251 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434206.1 protein_id gnl|my_center|LOCUS_05900 38232 37606 gene locus_tag LOCUS_05910 38232 37606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 38581 38411 gene locus_tag LOCUS_05920 38581 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 39746 38820 gene locus_tag LOCUS_05930 gene metA 39746 38820 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_05930 41718 39736 gene locus_tag LOCUS_05940 gene ligA 41718 39736 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_05940 42618 41899 gene locus_tag LOCUS_05950 gene rluF 42618 41899 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 protein_id gnl|my_center|LOCUS_05950 44049 42904 gene locus_tag LOCUS_05960 44049 42904 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_05960 45196 44234 gene locus_tag LOCUS_05970 45196 44234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 48181 45200 gene locus_tag LOCUS_05980 48181 45200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 49746 48223 gene locus_tag LOCUS_05990 49746 48223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 51253 49907 gene locus_tag LOCUS_06000 gene gdhA 51253 49907 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_06000 52752 51424 gene locus_tag LOCUS_06010 52752 51424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 52847 52774 gene locus_tag LOCUS_t00050 52847 52774 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53754 52924 gene locus_tag LOCUS_06020 53754 52924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 54489 53932 gene locus_tag LOCUS_06030 gene efp 54489 53932 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_06030 55091 54579 gene locus_tag LOCUS_06040 55091 54579 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_06040 55549 55166 gene locus_tag LOCUS_06050 55549 55166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 56386 55661 gene locus_tag LOCUS_06060 56386 55661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 57190 56387 gene locus_tag LOCUS_06070 57190 56387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_06070 57921 57193 gene locus_tag LOCUS_06080 57921 57193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_06080 58969 58022 gene locus_tag LOCUS_06090 58969 58022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_06090 60493 58973 gene locus_tag LOCUS_06100 60493 58973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_06100 61049 60600 gene locus_tag LOCUS_06110 gene nrdR 61049 60600 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_06110 61237 61046 gene locus_tag LOCUS_06120 61237 61046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 62499 61255 gene locus_tag LOCUS_06130 62499 61255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 63334 62594 gene locus_tag LOCUS_06140 63334 62594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 64485 63334 gene locus_tag LOCUS_06150 gene spoVE 64485 63334 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_06150 66789 64516 gene locus_tag LOCUS_06160 66789 64516 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_06160 67211 66798 gene locus_tag LOCUS_06170 67211 66798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 68173 67238 gene locus_tag LOCUS_06180 gene rsmH 68173 67238 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_06180 68609 68175 gene locus_tag LOCUS_06190 gene mraZ 68609 68175 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358778.1 protein_id gnl|my_center|LOCUS_06190 69656 68790 gene locus_tag LOCUS_06200 gene lgt 69656 68790 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_06200 70791 69691 gene locus_tag LOCUS_06210 gene ychF 70791 69691 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_06210 71060 71818 gene locus_tag LOCUS_06220 71060 71818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 73054 71879 gene locus_tag LOCUS_06230 73054 71879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_06230 73845 73051 gene locus_tag LOCUS_06240 73845 73051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 74502 73846 gene locus_tag LOCUS_06250 74502 73846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 74678 75910 gene locus_tag LOCUS_06260 gene nagA 74678 75910 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_06260 77599 75938 gene locus_tag LOCUS_06270 77599 75938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 79676 77604 gene locus_tag LOCUS_06280 79676 77604 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_06280 80373 79810 gene locus_tag LOCUS_06290 80373 79810 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_06290 81189 80386 gene locus_tag LOCUS_06300 81189 80386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 82152 81271 gene locus_tag LOCUS_06310 gene rsgA 82152 81271 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_06310 84335 82164 gene locus_tag LOCUS_06320 gene pknB 84335 82164 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_06320 85083 84349 gene locus_tag LOCUS_06330 85083 84349 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_06330 86147 85110 gene locus_tag LOCUS_06340 gene rlmN 86147 85110 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_06340 87376 86144 gene locus_tag LOCUS_06350 gene rsmB 87376 86144 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_06350 88321 87389 gene locus_tag LOCUS_06360 gene fmt 88321 87389 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_06360 88809 88321 gene locus_tag LOCUS_06370 gene def 88809 88321 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_06370 91045 88832 gene locus_tag LOCUS_06380 gene priA 91045 88832 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_06380 92523 91045 gene locus_tag LOCUS_06390 92523 91045 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_06390 93686 92742 gene locus_tag LOCUS_06400 gene pfkB 93686 92742 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_06400 95518 93746 gene locus_tag LOCUS_06410 gene recJ 95518 93746 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943623.1 protein_id gnl|my_center|LOCUS_06410 97860 95611 gene locus_tag LOCUS_06420 97860 95611 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_06420 99141 97951 gene locus_tag LOCUS_06430 99141 97951 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_06430 99810 99298 gene locus_tag LOCUS_06440 99810 99298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 100029 102359 gene locus_tag LOCUS_06450 100029 102359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 105242 102369 gene locus_tag LOCUS_06460 105242 102369 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_06460 107086 105371 gene locus_tag LOCUS_06470 107086 105371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 108038 107163 gene locus_tag LOCUS_06480 108038 107163 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_06480 108980 108048 gene locus_tag LOCUS_06490 108980 108048 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_06490 110586 108967 gene locus_tag LOCUS_06500 110586 108967 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_06500 111656 110583 gene locus_tag LOCUS_06510 gene uxuA 111656 110583 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_06510 111862 112764 gene locus_tag LOCUS_06520 111862 112764 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_06520 114268 112772 gene locus_tag LOCUS_06530 114268 112772 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_06530 114894 114265 gene locus_tag LOCUS_06540 114894 114265 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_06540 117209 114903 gene locus_tag LOCUS_06550 117209 114903 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_06550 118919 117291 gene locus_tag LOCUS_06560 gene groL 118919 117291 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_06560 119218 118934 gene locus_tag LOCUS_06570 gene groES 119218 118934 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965991.1 protein_id gnl|my_center|LOCUS_06570 119814 119320 gene locus_tag LOCUS_06580 gene ybeY 119814 119320 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_06580 120873 119815 gene locus_tag LOCUS_06590 120873 119815 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212366851.1 protein_id gnl|my_center|LOCUS_06590 122498 121014 gene locus_tag LOCUS_06600 122498 121014 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_06600 124021 122546 gene locus_tag LOCUS_06610 gene xylB 124021 122546 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_06610 125103 124207 gene locus_tag LOCUS_06620 125103 124207 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_06620 126057 125116 gene locus_tag LOCUS_06630 126057 125116 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_06630 127850 126135 gene locus_tag LOCUS_06640 127850 126135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_06640 129602 128013 gene locus_tag LOCUS_06650 129602 128013 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_06650 131226 129595 gene locus_tag LOCUS_06660 131226 129595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 131390 132325 gene locus_tag LOCUS_06670 131390 132325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 133887 132349 gene locus_tag LOCUS_06680 133887 132349 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_06680 135622 133901 gene locus_tag LOCUS_06690 135622 133901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 136790 135660 gene locus_tag LOCUS_06700 136790 135660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 138965 136818 gene locus_tag LOCUS_06710 138965 136818 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_06710 139673 139125 gene locus_tag LOCUS_06720 139673 139125 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_06720 140883 139807 gene locus_tag LOCUS_06730 gene tsf 140883 139807 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775698.1 protein_id gnl|my_center|LOCUS_06730 141696 140932 gene locus_tag LOCUS_06740 gene rpsB 141696 140932 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 protein_id gnl|my_center|LOCUS_06740 142178 141909 gene locus_tag LOCUS_06750 142178 141909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 142527 142252 gene locus_tag LOCUS_06760 142527 142252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 142623 142696 gene locus_tag LOCUS_t00060 142623 142696 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 144933 142744 gene locus_tag LOCUS_06770 144933 142744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 147117 144952 gene locus_tag LOCUS_06780 147117 144952 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_06780 147611 147129 gene locus_tag LOCUS_06790 147611 147129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 148494 147700 gene locus_tag LOCUS_06800 148494 147700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 149360 148500 gene locus_tag LOCUS_06810 149360 148500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 149671 149357 gene locus_tag LOCUS_06820 149671 149357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 151320 149719 gene locus_tag LOCUS_06830 151320 149719 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080991.1 protein_id gnl|my_center|LOCUS_06830 152081 151317 gene locus_tag LOCUS_06840 gene whiG 152081 151317 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_06840 152455 152105 gene locus_tag LOCUS_06850 152455 152105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 152940 152452 gene locus_tag LOCUS_06860 152940 152452 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_06860 153607 152972 gene locus_tag LOCUS_06870 153607 152972 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_06870 154099 153623 gene locus_tag LOCUS_06880 154099 153623 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_06880 156202 154118 gene locus_tag LOCUS_06890 156202 154118 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_06890 156791 156204 gene locus_tag LOCUS_06900 156791 156204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 157627 156899 gene locus_tag LOCUS_06910 157627 156899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 158530 157640 gene locus_tag LOCUS_06920 158530 157640 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986948.1 protein_id gnl|my_center|LOCUS_06920 159893 158544 gene locus_tag LOCUS_06930 gene flhF 159893 158544 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_06930 161931 159883 gene locus_tag LOCUS_06940 gene flhA 161931 159883 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_06940 163107 161992 gene locus_tag LOCUS_06950 gene flhB 163107 161992 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_06950 163886 163107 gene locus_tag LOCUS_06960 gene fliR 163886 163107 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_06960 164161 163892 gene locus_tag LOCUS_06970 gene fliQ 164161 163892 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_06970 164968 164177 gene locus_tag LOCUS_06980 gene fliP 164968 164177 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_06980 165275 165036 gene locus_tag LOCUS_06990 165275 165036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 165773 165411 gene locus_tag LOCUS_07000 165773 165411 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_07000 167041 165785 gene locus_tag LOCUS_07010 167041 165785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 168025 167045 gene locus_tag LOCUS_07020 gene fliM 168025 167045 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_07020 168581 168060 gene locus_tag LOCUS_07030 168581 168060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 169432 168596 gene locus_tag LOCUS_07040 gene motB 169432 168596 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 protein_id gnl|my_center|LOCUS_07040 170222 169425 gene locus_tag LOCUS_07050 170222 169425 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_07050 170428 170243 gene locus_tag LOCUS_07060 170428 170243 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 protein_id gnl|my_center|LOCUS_07060 171945 170560 gene locus_tag LOCUS_07070 gene flgE 171945 170560 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_07070 172422 172027 gene locus_tag LOCUS_07080 172422 172027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 173219 172437 gene locus_tag LOCUS_07090 173219 172437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 174664 173252 gene locus_tag LOCUS_07100 174664 173252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 175607 174729 gene locus_tag LOCUS_07110 175607 174729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 176055 175600 gene locus_tag LOCUS_07120 176055 175600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 177381 176074 gene locus_tag LOCUS_07130 gene fliI 177381 176074 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_07130 178392 177412 gene locus_tag LOCUS_07140 178392 177412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 179401 178385 gene locus_tag LOCUS_07150 gene fliG 179401 178385 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_07150 181006 179405 gene locus_tag LOCUS_07160 gene fliF 181006 179405 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_07160 181378 181064 gene locus_tag LOCUS_07170 181378 181064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 181873 181421 gene locus_tag LOCUS_07180 gene flgC 181873 181421 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_07180 182274 181885 gene locus_tag LOCUS_07190 gene flgB 182274 181885 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_07190 183414 182635 gene locus_tag LOCUS_07200 gene codY 183414 182635 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_07200 185523 183535 gene locus_tag LOCUS_07210 gene topA 185523 183535 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_07210 185895 185761 gene locus_tag LOCUS_07220 185895 185761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 186491 185898 gene locus_tag LOCUS_07230 186491 185898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 186690 186496 gene locus_tag LOCUS_07240 186690 186496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 187693 186761 gene locus_tag LOCUS_07250 187693 186761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_07250 193421 187806 gene locus_tag LOCUS_07260 193421 187806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 195999 193504 gene locus_tag LOCUS_07270 195999 193504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 196644 196021 gene locus_tag LOCUS_07280 196644 196021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 199080 196675 gene locus_tag LOCUS_07290 199080 196675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 200478 199096 gene locus_tag LOCUS_07300 200478 199096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 201348 200530 gene locus_tag LOCUS_07310 201348 200530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 203164 201350 gene locus_tag LOCUS_07320 203164 201350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 203839 203207 gene locus_tag LOCUS_07330 203839 203207 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_07330 204406 203984 gene locus_tag LOCUS_07340 204406 203984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 205696 204482 gene locus_tag LOCUS_07350 205696 204482 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_07350 207416 205722 gene locus_tag LOCUS_07360 207416 205722 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_07360 208663 207443 gene locus_tag LOCUS_07370 208663 207443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 209263 209042 gene locus_tag LOCUS_07380 209263 209042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 209334 210743 gene locus_tag LOCUS_07390 209334 210743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 210991 210824 gene locus_tag LOCUS_07400 210991 210824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence04 964 485 gene locus_tag LOCUS_07410 964 485 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_07410 1261 995 gene locus_tag LOCUS_07420 1261 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2266 1484 gene locus_tag LOCUS_07430 2266 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3297 2284 gene locus_tag LOCUS_07440 3297 2284 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_07440 4663 3416 gene locus_tag LOCUS_07450 4663 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5702 4707 gene locus_tag LOCUS_07460 5702 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6902 5703 gene locus_tag LOCUS_07470 6902 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 7995 6940 gene locus_tag LOCUS_07480 7995 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 8510 7995 gene locus_tag LOCUS_07490 8510 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 9556 8531 gene locus_tag LOCUS_07500 9556 8531 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_07500 10926 9556 gene locus_tag LOCUS_07510 10926 9556 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_07510 12101 10995 gene locus_tag LOCUS_07520 12101 10995 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_07520 12778 12152 gene locus_tag LOCUS_07530 12778 12152 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902061.1 protein_id gnl|my_center|LOCUS_07530 13792 12851 gene locus_tag LOCUS_07540 13792 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14307 14011 gene locus_tag LOCUS_07550 14307 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 14774 14304 gene locus_tag LOCUS_07560 14774 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 15108 14812 gene locus_tag LOCUS_07570 15108 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 16432 15686 gene locus_tag LOCUS_07580 16432 15686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 18134 16425 gene locus_tag LOCUS_07590 18134 16425 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_07590 19258 18233 gene locus_tag LOCUS_07600 19258 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 20076 19255 gene locus_tag LOCUS_07610 20076 19255 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_07610 21121 20159 gene locus_tag LOCUS_07620 21121 20159 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_07620 23024 21123 gene locus_tag LOCUS_07630 gene asnB 23024 21123 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_07630 24262 23147 gene locus_tag LOCUS_07640 24262 23147 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_07640 25661 24264 gene locus_tag LOCUS_07650 25661 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 27559 25664 gene locus_tag LOCUS_07660 gene asnB 27559 25664 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_07660 28519 27590 gene locus_tag LOCUS_07670 28519 27590 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_07670 29668 28583 gene locus_tag LOCUS_07680 29668 28583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 30863 29637 gene locus_tag LOCUS_07690 30863 29637 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_07690 31784 30885 gene locus_tag LOCUS_07700 31784 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 32632 31784 gene locus_tag LOCUS_07710 32632 31784 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_07710 33508 32747 gene locus_tag LOCUS_07720 33508 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 34325 33537 gene locus_tag LOCUS_07730 34325 33537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 35266 34322 gene locus_tag LOCUS_07740 35266 34322 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975600.1 protein_id gnl|my_center|LOCUS_07740 36250 35276 gene locus_tag LOCUS_07750 36250 35276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029668.1 protein_id gnl|my_center|LOCUS_07750 37664 36309 gene locus_tag LOCUS_07760 37664 36309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 38063 37704 gene locus_tag LOCUS_07770 38063 37704 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985167.1 protein_id gnl|my_center|LOCUS_07770 38749 38063 gene locus_tag LOCUS_07780 38749 38063 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_07780 40076 38757 gene locus_tag LOCUS_07790 40076 38757 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_07790 41021 40209 gene locus_tag LOCUS_07800 41021 40209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 41803 41018 gene locus_tag LOCUS_07810 41803 41018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 43789 41843 gene locus_tag LOCUS_07820 43789 41843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_07820 45677 43800 gene locus_tag LOCUS_07830 45677 43800 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_07830 48345 45664 gene locus_tag LOCUS_07840 48345 45664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 50007 48346 gene locus_tag LOCUS_07850 50007 48346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 50929 49988 gene locus_tag LOCUS_07860 50929 49988 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_07860 51410 50919 gene locus_tag LOCUS_07870 51410 50919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 53175 51391 gene locus_tag LOCUS_07880 53175 51391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 54295 53162 gene locus_tag LOCUS_07890 gene rffA 54295 53162 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612049.1 protein_id gnl|my_center|LOCUS_07890 55995 54313 gene locus_tag LOCUS_07900 55995 54313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 57839 56082 gene locus_tag LOCUS_07910 57839 56082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_07910 58902 57961 gene locus_tag LOCUS_07920 58902 57961 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_07920 60205 59123 gene locus_tag LOCUS_07930 60205 59123 CDS product glycosyltransferase family 52 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058925.1 protein_id gnl|my_center|LOCUS_07930 61289 60207 gene locus_tag LOCUS_07940 61289 60207 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_07940 62838 61309 gene locus_tag LOCUS_07950 62838 61309 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_07950 63638 62838 gene locus_tag LOCUS_07960 63638 62838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 63868 63641 gene locus_tag LOCUS_07970 63868 63641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 65257 63929 gene locus_tag LOCUS_07980 65257 63929 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_07980 66473 65280 gene locus_tag LOCUS_07990 gene pseC 66473 65280 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_07990 67734 66547 gene locus_tag LOCUS_08000 67734 66547 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_08000 69709 67907 gene locus_tag LOCUS_08010 69709 67907 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_08010 73386 69850 gene locus_tag LOCUS_08020 gene mfd 73386 69850 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_08020 75262 73526 gene locus_tag LOCUS_08030 gene glnS 75262 73526 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_08030 77190 75679 gene locus_tag LOCUS_08040 77190 75679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 78119 77616 gene locus_tag LOCUS_08050 78119 77616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 78749 78138 gene locus_tag LOCUS_08060 gene pth 78749 78138 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226727.1 protein_id gnl|my_center|LOCUS_08060 79061 78777 gene locus_tag LOCUS_08070 79061 78777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 80301 79183 gene locus_tag LOCUS_08080 gene glgD 80301 79183 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_08080 81572 80301 gene locus_tag LOCUS_08090 81572 80301 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_08090 83430 82246 gene locus_tag LOCUS_08100 83430 82246 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_08100 84417 83455 gene locus_tag LOCUS_08110 84417 83455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_08110 85486 84452 gene locus_tag LOCUS_08120 85486 84452 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_08120 87103 85724 gene locus_tag LOCUS_08130 gene murC 87103 85724 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_08130 88896 87202 gene locus_tag LOCUS_08140 88896 87202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 92236 88889 gene locus_tag LOCUS_08150 92236 88889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 93260 92307 gene locus_tag LOCUS_08160 93260 92307 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_08160 94332 93277 gene locus_tag LOCUS_08170 94332 93277 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_08170 95746 94406 gene locus_tag LOCUS_08180 95746 94406 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_08180 96485 95724 gene locus_tag LOCUS_08190 96485 95724 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_08190 98096 96573 gene locus_tag LOCUS_08200 98096 96573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 99250 98210 gene locus_tag LOCUS_08210 99250 98210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459067.1 protein_id gnl|my_center|LOCUS_08210 100859 99417 gene locus_tag LOCUS_08220 100859 99417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 101505 100786 gene locus_tag LOCUS_08230 101505 100786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 101848 101510 gene locus_tag LOCUS_08240 101848 101510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 102494 101850 gene locus_tag LOCUS_08250 102494 101850 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_08250 104155 102506 gene locus_tag LOCUS_08260 104155 102506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 104994 104473 gene locus_tag LOCUS_08270 104994 104473 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_08270 105036 105746 gene locus_tag LOCUS_08280 105036 105746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 108093 105694 gene locus_tag LOCUS_08290 108093 105694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 109169 108201 gene locus_tag LOCUS_08300 109169 108201 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_08300 109471 109217 gene locus_tag LOCUS_08310 109471 109217 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_08310 110251 109490 gene locus_tag LOCUS_08320 gene whiA 110251 109490 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_08320 111129 110254 gene locus_tag LOCUS_08330 gene rapZ 111129 110254 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_08330 112052 111132 gene locus_tag LOCUS_08340 gene murB 112052 111132 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_08340 113007 112066 gene locus_tag LOCUS_08350 113007 112066 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_08350 114012 113068 gene locus_tag LOCUS_08360 gene hprK 114012 113068 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_08360 114451 114095 gene locus_tag LOCUS_08370 114451 114095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 115467 116300 gene locus_tag LOCUS_08380 115467 116300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 116468 118276 gene locus_tag LOCUS_08390 gene uvrC 116468 118276 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_08390 120555 118318 gene locus_tag LOCUS_08400 gene ftsH 120555 118318 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_08400 122031 120559 gene locus_tag LOCUS_08410 122031 120559 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918342.1 protein_id gnl|my_center|LOCUS_08410 124532 122037 gene locus_tag LOCUS_08420 124532 122037 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_08420 127737 124546 gene locus_tag LOCUS_08430 gene ileS 127737 124546 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_08430 128890 127820 gene locus_tag LOCUS_08440 128890 127820 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_08440 129491 128913 gene locus_tag LOCUS_08450 129491 128913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 130450 129494 gene locus_tag LOCUS_08460 130450 129494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 132175 130583 gene locus_tag LOCUS_08470 132175 130583 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_08470 132405 132178 gene locus_tag LOCUS_08480 132405 132178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 133966 132464 gene locus_tag LOCUS_08490 133966 132464 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_08490 134702 133977 gene locus_tag LOCUS_08500 134702 133977 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_08500 136625 134736 gene locus_tag LOCUS_08510 136625 134736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 137184 136687 gene locus_tag LOCUS_08520 137184 136687 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_08520 138616 137186 gene locus_tag LOCUS_08530 138616 137186 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_08530 139357 138653 gene locus_tag LOCUS_08540 139357 138653 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_08540 141781 139370 gene locus_tag LOCUS_08550 141781 139370 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_08550 142476 141805 gene locus_tag LOCUS_08560 142476 141805 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_08560 142628 144106 gene locus_tag LOCUS_08570 142628 144106 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_08570 145088 144111 gene locus_tag LOCUS_08580 145088 144111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 146408 145092 gene locus_tag LOCUS_08590 146408 145092 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_08590 148764 146560 gene locus_tag LOCUS_08600 148764 146560 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_08600 148916 149533 gene locus_tag LOCUS_08610 148916 149533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 151812 149530 gene locus_tag LOCUS_08620 151812 149530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 152672 151815 gene locus_tag LOCUS_08630 gene rsmA 152672 151815 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_08630 153453 152659 gene locus_tag LOCUS_08640 153453 152659 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_08640 153651 153578 gene locus_tag LOCUS_t00070 153651 153578 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 155084 153777 gene locus_tag LOCUS_08650 gene hflX 155084 153777 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_08650 158325 155164 gene locus_tag LOCUS_08660 158325 155164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 159162 158380 gene locus_tag LOCUS_08670 159162 158380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 159220 159513 gene locus_tag LOCUS_08680 159220 159513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 159521 160006 gene locus_tag LOCUS_08690 gene lepB 159521 160006 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_08690 161790 160009 gene locus_tag LOCUS_08700 161790 160009 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_08700 162286 161819 gene locus_tag LOCUS_08710 162286 161819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_08710 163257 162346 gene locus_tag LOCUS_08720 163257 162346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674216.1 protein_id gnl|my_center|LOCUS_08720 164159 163257 gene locus_tag LOCUS_08730 164159 163257 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_08730 164715 164287 gene locus_tag LOCUS_08740 164715 164287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 165150 164716 gene locus_tag LOCUS_08750 165150 164716 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_08750 166536 165160 gene locus_tag LOCUS_08760 166536 165160 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_08760 167069 167644 gene locus_tag LOCUS_08770 167069 167644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 168847 167666 gene locus_tag LOCUS_08780 168847 167666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 169807 168929 gene locus_tag LOCUS_08790 169807 168929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 170686 169820 gene locus_tag LOCUS_08800 170686 169820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 171883 170741 gene locus_tag LOCUS_08810 171883 170741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 172646 171951 gene locus_tag LOCUS_08820 172646 171951 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_08820 173263 172646 gene locus_tag LOCUS_08830 173263 172646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 174177 173581 gene locus_tag LOCUS_08840 174177 173581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 174744 174253 gene locus_tag LOCUS_08850 174744 174253 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_08850 175252 174749 gene locus_tag LOCUS_08860 175252 174749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 177617 175653 gene locus_tag LOCUS_08870 177617 175653 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249589.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence05 4865 3306 gene locus_tag LOCUS_08880 gene gpmI 4865 3306 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_08880 6726 5032 gene locus_tag LOCUS_08890 6726 5032 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_08890 8634 6739 gene locus_tag LOCUS_08900 8634 6739 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416938.1 protein_id gnl|my_center|LOCUS_08900 9117 8635 gene locus_tag LOCUS_08910 gene nuoE 9117 8635 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582933.1 protein_id gnl|my_center|LOCUS_08910 11326 9131 gene locus_tag LOCUS_08920 11326 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 13587 11308 gene locus_tag LOCUS_08930 13587 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 14880 13657 gene locus_tag LOCUS_08940 14880 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 16141 14861 gene locus_tag LOCUS_08950 16141 14861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 17328 16138 gene locus_tag LOCUS_08960 17328 16138 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_08960 18343 17396 gene locus_tag LOCUS_08970 18343 17396 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_08970 18732 19391 gene locus_tag LOCUS_08980 18732 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 19392 20600 gene locus_tag LOCUS_08990 19392 20600 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_08990 20597 22765 gene locus_tag LOCUS_09000 20597 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 24637 22718 gene locus_tag LOCUS_09010 24637 22718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 25850 24651 gene locus_tag LOCUS_09020 25850 24651 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_09020 26546 25863 gene locus_tag LOCUS_09030 gene bioD 26546 25863 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_09030 27546 26587 gene locus_tag LOCUS_09040 gene bioB 27546 26587 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_09040 28345 27707 gene locus_tag LOCUS_09050 28345 27707 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963528.1 protein_id gnl|my_center|LOCUS_09050 33060 28351 gene locus_tag LOCUS_09060 33060 28351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 34046 33249 gene locus_tag LOCUS_09070 34046 33249 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_09070 34795 34244 gene locus_tag LOCUS_09080 34795 34244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 36964 34913 gene locus_tag LOCUS_09090 36964 34913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 37242 37000 gene locus_tag LOCUS_09100 37242 37000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 38090 37752 gene locus_tag LOCUS_09110 38090 37752 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_09110 38603 38280 gene locus_tag LOCUS_09120 38603 38280 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994766.1 protein_id gnl|my_center|LOCUS_09120 38908 38603 gene locus_tag LOCUS_09130 38908 38603 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991611.1 protein_id gnl|my_center|LOCUS_09130 40741 39209 gene locus_tag LOCUS_09140 gene guaA 40741 39209 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_09140 42173 40758 gene locus_tag LOCUS_09150 gene purB 42173 40758 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_09150 43491 42217 gene locus_tag LOCUS_09160 43491 42217 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464135.1 protein_id gnl|my_center|LOCUS_09160 44323 43610 gene locus_tag LOCUS_09170 44323 43610 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_09170 45558 44497 gene locus_tag LOCUS_09180 45558 44497 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_09180 45664 47013 gene locus_tag LOCUS_09190 45664 47013 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_09190 48799 47033 gene locus_tag LOCUS_09200 48799 47033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 49078 49974 gene locus_tag LOCUS_09210 49078 49974 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_09210 51074 49980 gene locus_tag LOCUS_09220 51074 49980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 53562 51142 gene locus_tag LOCUS_09230 53562 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 54519 53581 gene locus_tag LOCUS_09240 54519 53581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 55828 54530 gene locus_tag LOCUS_09250 55828 54530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 57575 55842 gene locus_tag LOCUS_09260 57575 55842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 protein_id gnl|my_center|LOCUS_09260 59338 57575 gene locus_tag LOCUS_09270 59338 57575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_09270 60528 59362 gene locus_tag LOCUS_09280 60528 59362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 63152 60567 gene locus_tag LOCUS_09290 63152 60567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 64461 63145 gene locus_tag LOCUS_09300 64461 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 65441 64461 gene locus_tag LOCUS_09310 65441 64461 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956968.1 protein_id gnl|my_center|LOCUS_09310 66973 65471 gene locus_tag LOCUS_09320 66973 65471 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890735.1 protein_id gnl|my_center|LOCUS_09320 67969 66989 gene locus_tag LOCUS_09330 67969 66989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 68243 68058 gene locus_tag LOCUS_09340 68243 68058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 69181 68357 gene locus_tag LOCUS_09350 69181 68357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 71136 69691 gene locus_tag LOCUS_09360 gene glgA 71136 69691 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_09360 72280 71243 gene locus_tag LOCUS_09370 72280 71243 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_09370 73959 72286 gene locus_tag LOCUS_09380 gene recN 73959 72286 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_09380 74500 74048 gene locus_tag LOCUS_09390 74500 74048 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_09390 75348 74503 gene locus_tag LOCUS_09400 75348 74503 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_09400 76204 75320 gene locus_tag LOCUS_09410 76204 75320 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_09410 78063 76207 gene locus_tag LOCUS_09420 gene dxs 78063 76207 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_09420 79054 78143 gene locus_tag LOCUS_09430 79054 78143 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09430 79250 79032 gene locus_tag LOCUS_09440 79250 79032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 80475 79258 gene locus_tag LOCUS_09450 gene xseA 80475 79258 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_09450 80882 80478 gene locus_tag LOCUS_09460 gene nusB 80882 80478 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_09460 81274 80891 gene locus_tag LOCUS_09470 81274 80891 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_09470 82587 81304 gene locus_tag LOCUS_09480 82587 81304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 84212 82620 gene locus_tag LOCUS_09490 84212 82620 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_09490 85418 84297 gene locus_tag LOCUS_09500 85418 84297 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_09500 87661 85577 gene locus_tag LOCUS_09510 gene pnp 87661 85577 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_09510 88149 87883 gene locus_tag LOCUS_09520 gene rpsO 88149 87883 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111957.1 protein_id gnl|my_center|LOCUS_09520 89056 88352 gene locus_tag LOCUS_09530 89056 88352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 90099 89158 gene locus_tag LOCUS_09540 gene ribF 90099 89158 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_09540 91082 90099 gene locus_tag LOCUS_09550 gene truB 91082 90099 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_09550 92036 91083 gene locus_tag LOCUS_09560 92036 91083 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_09560 92447 92043 gene locus_tag LOCUS_09570 gene rbfA 92447 92043 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_09570 95239 92546 gene locus_tag LOCUS_09580 gene infB 95239 92546 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_09580 95564 95226 gene locus_tag LOCUS_09590 95564 95226 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 protein_id gnl|my_center|LOCUS_09590 96726 95557 gene locus_tag LOCUS_09600 96726 95557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 97233 96748 gene locus_tag LOCUS_09610 97233 96748 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_09610 97704 97438 gene locus_tag LOCUS_09620 97704 97438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 98438 97770 gene locus_tag LOCUS_09630 98438 97770 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_09630 100613 98451 gene locus_tag LOCUS_09640 100613 98451 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913524.1 protein_id gnl|my_center|LOCUS_09640 101374 100610 gene locus_tag LOCUS_09650 101374 100610 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878012.1 protein_id gnl|my_center|LOCUS_09650 102928 101381 gene locus_tag LOCUS_09660 102928 101381 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_09660 104253 102952 gene locus_tag LOCUS_09670 104253 102952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_09670 104428 104285 gene locus_tag LOCUS_09680 104428 104285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 106094 104409 gene locus_tag LOCUS_09690 106094 104409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 106378 107415 gene locus_tag LOCUS_09700 106378 107415 CDS product DUF5050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966320.1 protein_id gnl|my_center|LOCUS_09700 107415 108347 gene locus_tag LOCUS_09710 gene ansB 107415 108347 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479812.1 protein_id gnl|my_center|LOCUS_09710 108648 108475 gene locus_tag LOCUS_09720 108648 108475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 109536 108718 gene locus_tag LOCUS_09730 gene folK 109536 108718 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_09730 110316 109552 gene locus_tag LOCUS_09740 gene folP 110316 109552 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_09740 111514 110336 gene locus_tag LOCUS_09750 111514 110336 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_09750 111999 111598 gene locus_tag LOCUS_09760 111999 111598 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813451.1 protein_id gnl|my_center|LOCUS_09760 112129 112668 gene locus_tag LOCUS_09770 112129 112668 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_09770 112748 113659 gene locus_tag LOCUS_09780 gene pyrB 112748 113659 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_09780 113748 114179 gene locus_tag LOCUS_09790 113748 114179 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_09790 115805 114261 gene locus_tag LOCUS_09800 115805 114261 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_09800 117309 115885 gene locus_tag LOCUS_09810 117309 115885 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_09810 117742 117386 gene locus_tag LOCUS_09820 gene rplT 117742 117386 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_09820 117972 117775 gene locus_tag LOCUS_09830 gene rpmI 117972 117775 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_09830 118583 118011 gene locus_tag LOCUS_09840 gene infC 118583 118011 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355797.1 protein_id gnl|my_center|LOCUS_09840 119380 118721 gene locus_tag LOCUS_09850 119380 118721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 121334 119367 gene locus_tag LOCUS_09860 gene thrS 121334 119367 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_09860 121865 121362 gene locus_tag LOCUS_09870 121865 121362 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_09870 121975 122244 gene locus_tag LOCUS_09880 121975 122244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 126154 122330 gene locus_tag LOCUS_09890 126154 122330 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_09890 126742 126161 gene locus_tag LOCUS_09900 126742 126161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 127215 126754 gene locus_tag LOCUS_09910 127215 126754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 128020 127304 gene locus_tag LOCUS_09920 128020 127304 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_09920 128132 128204 gene locus_tag LOCUS_t00080 128132 128204 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 129131 128346 gene locus_tag LOCUS_09930 129131 128346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 130328 129180 gene locus_tag LOCUS_09940 130328 129180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 131727 130363 gene locus_tag LOCUS_09950 gene radA 131727 130363 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_09950 132165 131755 gene locus_tag LOCUS_09960 132165 131755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 134634 132181 gene locus_tag LOCUS_09970 134634 132181 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_09970 135900 134641 gene locus_tag LOCUS_09980 135900 134641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 136208 135948 gene locus_tag LOCUS_09990 136208 135948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 137480 136209 gene locus_tag LOCUS_10000 gene purD 137480 136209 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_10000 138076 137477 gene locus_tag LOCUS_10010 gene purN 138076 137477 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_10010 139095 138070 gene locus_tag LOCUS_10020 gene purM 139095 138070 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_10020 139625 139119 gene locus_tag LOCUS_10030 gene purE 139625 139119 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_10030 141769 139760 gene locus_tag LOCUS_10040 141769 139760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 142086 141769 gene locus_tag LOCUS_10050 142086 141769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 142247 142095 gene locus_tag LOCUS_10060 142247 142095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 142947 142267 gene locus_tag LOCUS_10070 gene pyrE 142947 142267 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_10070 143528 143004 gene locus_tag LOCUS_10080 gene apt 143528 143004 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_10080 144247 143576 gene locus_tag LOCUS_10090 144247 143576 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_10090 145342 144248 gene locus_tag LOCUS_10100 145342 144248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 146556 145342 gene locus_tag LOCUS_10110 146556 145342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 147245 146556 gene locus_tag LOCUS_10120 147245 146556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 149556 147223 gene locus_tag LOCUS_10130 149556 147223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 150030 150680 gene locus_tag LOCUS_10140 150030 150680 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943184.1 protein_id gnl|my_center|LOCUS_10140 151153 150677 gene locus_tag LOCUS_10150 151153 150677 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_10150 151656 151225 gene locus_tag LOCUS_10160 gene dtd 151656 151225 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_10160 152843 151653 gene locus_tag LOCUS_10170 152843 151653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 152969 153373 gene locus_tag LOCUS_10180 152969 153373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence06 257 1108 gene locus_tag LOCUS_10190 257 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1136 1885 gene locus_tag LOCUS_10200 1136 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1996 2664 gene locus_tag LOCUS_10210 1996 2664 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_10210 2761 3300 gene locus_tag LOCUS_10220 2761 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3521 3994 gene locus_tag LOCUS_10230 3521 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3927 4154 gene locus_tag LOCUS_10240 3927 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4156 5013 gene locus_tag LOCUS_10250 4156 5013 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_10250 5016 5540 gene locus_tag LOCUS_10260 5016 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5716 6273 gene locus_tag LOCUS_10270 5716 6273 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_10270 6275 6736 gene locus_tag LOCUS_10280 6275 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6733 7440 gene locus_tag LOCUS_10290 6733 7440 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_10290 8027 7488 gene locus_tag LOCUS_10300 8027 7488 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948594.1 protein_id gnl|my_center|LOCUS_10300 8189 9184 gene locus_tag LOCUS_10310 8189 9184 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_10310 9231 11276 gene locus_tag LOCUS_10320 9231 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 12021 11242 gene locus_tag LOCUS_10330 12021 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 12374 13345 gene locus_tag LOCUS_10340 12374 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 13447 14496 gene locus_tag LOCUS_10350 13447 14496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14591 15580 gene locus_tag LOCUS_10360 14591 15580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15647 16495 gene locus_tag LOCUS_10370 15647 16495 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_10370 16734 18155 gene locus_tag LOCUS_10380 gene purF 16734 18155 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_10380 18177 19295 gene locus_tag LOCUS_10390 18177 19295 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_10390 19288 22482 gene locus_tag LOCUS_10400 gene carB 19288 22482 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 protein_id gnl|my_center|LOCUS_10400 23611 25707 gene locus_tag LOCUS_10410 23611 25707 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_10410 25833 27602 gene locus_tag LOCUS_10420 25833 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 27752 29347 gene locus_tag LOCUS_10430 27752 29347 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_10430 29418 33959 gene locus_tag LOCUS_10440 gene gltB 29418 33959 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_10440 33962 35470 gene locus_tag LOCUS_10450 33962 35470 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_10450 35496 36806 gene locus_tag LOCUS_10460 gene glnA 35496 36806 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392811.1 protein_id gnl|my_center|LOCUS_10460 36822 37358 gene locus_tag LOCUS_10470 36822 37358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 37435 38649 gene locus_tag LOCUS_10480 37435 38649 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_10480 38872 39744 gene locus_tag LOCUS_10490 38872 39744 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_10490 39766 41130 gene locus_tag LOCUS_10500 39766 41130 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_10500 41160 42290 gene locus_tag LOCUS_10510 gene mnmA 41160 42290 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_10510 42287 44644 gene locus_tag LOCUS_10520 42287 44644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 44740 45882 gene locus_tag LOCUS_10530 gene pheA 44740 45882 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_10530 45948 47624 gene locus_tag LOCUS_10540 45948 47624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 47663 48367 gene locus_tag LOCUS_10550 47663 48367 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_10550 48395 49591 gene locus_tag LOCUS_10560 48395 49591 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_10560 49600 49842 gene locus_tag LOCUS_10570 49600 49842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 49894 50625 gene locus_tag LOCUS_10580 49894 50625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 50630 51583 gene locus_tag LOCUS_10590 50630 51583 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_10590 51670 52785 gene locus_tag LOCUS_10600 gene glf 51670 52785 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_10600 52817 53119 gene locus_tag LOCUS_10610 52817 53119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 53308 53844 gene locus_tag LOCUS_10620 53308 53844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 53848 54042 gene locus_tag LOCUS_10630 53848 54042 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262994.1 protein_id gnl|my_center|LOCUS_10630 54192 54716 gene locus_tag LOCUS_10640 54192 54716 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_10640 54747 55292 gene locus_tag LOCUS_10650 54747 55292 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_10650 55413 56519 gene locus_tag LOCUS_10660 55413 56519 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_10660 56704 57936 gene locus_tag LOCUS_10670 56704 57936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 58304 59989 gene locus_tag LOCUS_10680 58304 59989 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_10680 59989 61944 gene locus_tag LOCUS_10690 59989 61944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 63518 62091 gene locus_tag LOCUS_10700 63518 62091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 64352 63528 gene locus_tag LOCUS_10710 64352 63528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 64527 65846 gene locus_tag LOCUS_10720 64527 65846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 65833 67347 gene locus_tag LOCUS_10730 65833 67347 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_10730 67387 68877 gene locus_tag LOCUS_10740 67387 68877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 68926 69984 gene locus_tag LOCUS_10750 68926 69984 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966323.1 protein_id gnl|my_center|LOCUS_10750 70395 71204 gene locus_tag LOCUS_10760 70395 71204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 71259 72311 gene locus_tag LOCUS_10770 71259 72311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 72314 73114 gene locus_tag LOCUS_10780 72314 73114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 73116 74534 gene locus_tag LOCUS_10790 73116 74534 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_10790 74543 75700 gene locus_tag LOCUS_10800 74543 75700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083206.1 protein_id gnl|my_center|LOCUS_10800 75700 76077 gene locus_tag LOCUS_10810 75700 76077 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_10810 76077 76421 gene locus_tag LOCUS_10820 76077 76421 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089868.1 protein_id gnl|my_center|LOCUS_10820 76466 78937 gene locus_tag LOCUS_10830 76466 78937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 78950 80035 gene locus_tag LOCUS_10840 gene rfbB 78950 80035 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_10840 80099 80968 gene locus_tag LOCUS_10850 gene rfbA 80099 80968 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_10850 80968 81531 gene locus_tag LOCUS_10860 gene rfbC 80968 81531 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_10860 81548 82573 gene locus_tag LOCUS_10870 81548 82573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289081.1 protein_id gnl|my_center|LOCUS_10870 82576 83901 gene locus_tag LOCUS_10880 82576 83901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_10880 83901 85991 gene locus_tag LOCUS_10890 83901 85991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 86105 88231 gene locus_tag LOCUS_10900 86105 88231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 88275 90254 gene locus_tag LOCUS_10910 88275 90254 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_10910 90296 92017 gene locus_tag LOCUS_10920 90296 92017 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_10920 92071 93390 gene locus_tag LOCUS_10930 92071 93390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 93383 94345 gene locus_tag LOCUS_10940 93383 94345 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_10940 94386 95795 gene locus_tag LOCUS_10950 94386 95795 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_10950 95975 97435 gene locus_tag LOCUS_10960 95975 97435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 98527 99456 gene locus_tag LOCUS_10970 gene rfbN 98527 99456 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_10970 99570 100934 gene locus_tag LOCUS_10980 99570 100934 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290101.1 protein_id gnl|my_center|LOCUS_10980 101123 101398 gene locus_tag LOCUS_10990 101123 101398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 101406 101924 gene locus_tag LOCUS_11000 101406 101924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 101956 103602 gene locus_tag LOCUS_11010 101956 103602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 103678 105573 gene locus_tag LOCUS_11020 103678 105573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 105653 107275 gene locus_tag LOCUS_11030 105653 107275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 107331 107786 gene locus_tag LOCUS_11040 107331 107786 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674247.1 protein_id gnl|my_center|LOCUS_11040 107788 108006 gene locus_tag LOCUS_11050 gene csrA 107788 108006 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327053.1 protein_id gnl|my_center|LOCUS_11050 108435 108100 gene locus_tag LOCUS_11060 108435 108100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 109764 108451 gene locus_tag LOCUS_11070 109764 108451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 110041 111396 gene locus_tag LOCUS_11080 gene glmM 110041 111396 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_11080 111407 112081 gene locus_tag LOCUS_11090 111407 112081 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11090 112203 112352 gene locus_tag LOCUS_11100 gene rpmG 112203 112352 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_11100 112382 112576 gene locus_tag LOCUS_11110 112382 112576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 112618 113136 gene locus_tag LOCUS_11120 gene nusG 112618 113136 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966426.1 protein_id gnl|my_center|LOCUS_11120 113263 113688 gene locus_tag LOCUS_11130 gene rplK 113263 113688 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_11130 113703 114392 gene locus_tag LOCUS_11140 gene rplA 113703 114392 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_11140 114479 115846 gene locus_tag LOCUS_11150 114479 115846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 116102 116731 gene locus_tag LOCUS_11160 116102 116731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 116801 117181 gene locus_tag LOCUS_11170 gene rplL 116801 117181 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_11170 117583 121335 gene locus_tag LOCUS_11180 gene rpoB 117583 121335 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_11180 121349 125026 gene locus_tag LOCUS_11190 gene rpoC 121349 125026 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_11190 125180 125479 gene locus_tag LOCUS_11200 125180 125479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 125481 126848 gene locus_tag LOCUS_11210 gene ffh 125481 126848 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_11210 126910 127155 gene locus_tag LOCUS_11220 gene rpsP 126910 127155 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_11220 127177 127404 gene locus_tag LOCUS_11230 127177 127404 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_11230 127453 127959 gene locus_tag LOCUS_11240 gene rimM 127453 127959 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_11240 127963 128745 gene locus_tag LOCUS_11250 gene trmD 127963 128745 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_11250 128903 129322 gene locus_tag LOCUS_11260 gene rpsL 128903 129322 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_11260 129499 129969 gene locus_tag LOCUS_11270 gene rpsG 129499 129969 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_11270 130052 132217 gene locus_tag LOCUS_11280 gene fusA 130052 132217 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_11280 132319 133506 gene locus_tag LOCUS_11290 gene tuf 132319 133506 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_11290 133840 134193 gene locus_tag LOCUS_11300 133840 134193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 134439 134942 gene locus_tag LOCUS_11310 134439 134942 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_11310 134957 136735 gene locus_tag LOCUS_11320 134957 136735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 137536 137012 gene locus_tag LOCUS_11330 137536 137012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 137737 137952 gene locus_tag LOCUS_11340 137737 137952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 137939 139027 gene locus_tag LOCUS_11350 137939 139027 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_11350 139136 139813 gene locus_tag LOCUS_11360 139136 139813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 139728 141092 gene locus_tag LOCUS_11370 139728 141092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 141252 142181 gene locus_tag LOCUS_11380 141252 142181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 142183 142584 gene locus_tag LOCUS_11390 142183 142584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 142984 144198 gene locus_tag LOCUS_11400 142984 144198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 144413 144883 gene locus_tag LOCUS_11410 144413 144883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 145008 145238 gene locus_tag LOCUS_11420 145008 145238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 145290 145664 gene locus_tag LOCUS_11430 145290 145664 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence07 379 113 gene locus_tag LOCUS_11440 379 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 789 391 gene locus_tag LOCUS_11450 789 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2022 814 gene locus_tag LOCUS_11460 2022 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3065 2028 gene locus_tag LOCUS_11470 3065 2028 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_11470 3683 3087 gene locus_tag LOCUS_11480 gene recR 3683 3087 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_11480 4024 3683 gene locus_tag LOCUS_11490 4024 3683 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_11490 5667 4039 gene locus_tag LOCUS_11500 gene dnaX 5667 4039 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_11500 6742 5669 gene locus_tag LOCUS_11510 6742 5669 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_11510 7780 6746 gene locus_tag LOCUS_11520 gene pseG 7780 6746 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_11520 8481 7777 gene locus_tag LOCUS_11530 gene pseF 8481 7777 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097862.1 protein_id gnl|my_center|LOCUS_11530 11218 8495 gene locus_tag LOCUS_11540 11218 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 11758 11249 gene locus_tag LOCUS_11550 gene tadA 11758 11249 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_11550 12447 11758 gene locus_tag LOCUS_11560 12447 11758 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_11560 13536 12451 gene locus_tag LOCUS_11570 13536 12451 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393831.1 protein_id gnl|my_center|LOCUS_11570 14710 13601 gene locus_tag LOCUS_11580 gene ugpC 14710 13601 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_11580 16384 14831 gene locus_tag LOCUS_11590 16384 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 17133 16390 gene locus_tag LOCUS_11600 17133 16390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 17605 17144 gene locus_tag LOCUS_11610 17605 17144 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627840.1 protein_id gnl|my_center|LOCUS_11610 18137 17688 gene locus_tag LOCUS_11620 18137 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 19063 18134 gene locus_tag LOCUS_11630 19063 18134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_11630 21031 19076 gene locus_tag LOCUS_11640 gene metG 21031 19076 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_11640 22034 21021 gene locus_tag LOCUS_11650 22034 21021 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_11650 23142 22042 gene locus_tag LOCUS_11660 23142 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 24548 23268 gene locus_tag LOCUS_11670 24548 23268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 25395 24559 gene locus_tag LOCUS_11680 25395 24559 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257991.1 protein_id gnl|my_center|LOCUS_11680 26521 25397 gene locus_tag LOCUS_11690 26521 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 27300 26518 gene locus_tag LOCUS_11700 27300 26518 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_11700 28472 27330 gene locus_tag LOCUS_11710 28472 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 29900 28515 gene locus_tag LOCUS_11720 29900 28515 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575762.1 protein_id gnl|my_center|LOCUS_11720 30668 29913 gene locus_tag LOCUS_11730 30668 29913 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242619.1 protein_id gnl|my_center|LOCUS_11730 31598 30669 gene locus_tag LOCUS_11740 31598 30669 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_11740 32430 31627 gene locus_tag LOCUS_11750 32430 31627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 33793 32423 gene locus_tag LOCUS_11760 33793 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 36093 33805 gene locus_tag LOCUS_11770 36093 33805 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_11770 37047 36106 gene locus_tag LOCUS_11780 37047 36106 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_11780 38589 37069 gene locus_tag LOCUS_11790 38589 37069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879752.1 protein_id gnl|my_center|LOCUS_11790 39803 38733 gene locus_tag LOCUS_11800 gene gmd 39803 38733 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_11800 40666 39821 gene locus_tag LOCUS_11810 gene rfbD 40666 39821 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_11810 40908 42065 gene locus_tag LOCUS_11820 40908 42065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 42402 42139 gene locus_tag LOCUS_11830 42402 42139 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956441.1 protein_id gnl|my_center|LOCUS_11830 43746 42475 gene locus_tag LOCUS_11840 43746 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 44617 43736 gene locus_tag LOCUS_11850 gene cdaA 44617 43736 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_11850 45575 44631 gene locus_tag LOCUS_11860 45575 44631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 45972 45586 gene locus_tag LOCUS_11870 45972 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 46395 45988 gene locus_tag LOCUS_11880 46395 45988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 47074 46412 gene locus_tag LOCUS_11890 47074 46412 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_11890 49346 47103 gene locus_tag LOCUS_11900 49346 47103 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_11900 49721 49365 gene locus_tag LOCUS_11910 49721 49365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 50555 49737 gene locus_tag LOCUS_11920 gene flgG 50555 49737 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937819.1 protein_id gnl|my_center|LOCUS_11920 51358 50579 gene locus_tag LOCUS_11930 51358 50579 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860711.1 protein_id gnl|my_center|LOCUS_11930 52369 51371 gene locus_tag LOCUS_11940 52369 51371 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_11940 55339 52475 gene locus_tag LOCUS_11950 gene uvrA 55339 52475 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_11950 57311 55332 gene locus_tag LOCUS_11960 gene uvrB 57311 55332 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984194.1 protein_id gnl|my_center|LOCUS_11960 57434 58252 gene locus_tag LOCUS_11970 57434 58252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 58237 58926 gene locus_tag LOCUS_11980 58237 58926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 59055 60596 gene locus_tag LOCUS_11990 59055 60596 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_11990 60661 61161 gene locus_tag LOCUS_12000 60661 61161 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289112.1 protein_id gnl|my_center|LOCUS_12000 61226 61921 gene locus_tag LOCUS_12010 61226 61921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 63642 62137 gene locus_tag LOCUS_12020 63642 62137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 64072 63827 gene locus_tag LOCUS_12030 64072 63827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 66002 64272 gene locus_tag LOCUS_12040 gene atzF 66002 64272 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_12040 66669 66022 gene locus_tag LOCUS_12050 66669 66022 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_12050 67406 66687 gene locus_tag LOCUS_12060 67406 66687 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_12060 68018 67446 gene locus_tag LOCUS_12070 68018 67446 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_12070 68611 68033 gene locus_tag LOCUS_12080 68611 68033 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_12080 69991 68639 gene locus_tag LOCUS_12090 69991 68639 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_12090 71144 70020 gene locus_tag LOCUS_12100 71144 70020 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_12100 71991 71203 gene locus_tag LOCUS_12110 71991 71203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 72848 71994 gene locus_tag LOCUS_12120 72848 71994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_12120 73961 72861 gene locus_tag LOCUS_12130 gene potA 73961 72861 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948297.1 protein_id gnl|my_center|LOCUS_12130 74944 74108 gene locus_tag LOCUS_12140 74944 74108 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_12140 75498 74968 gene locus_tag LOCUS_12150 75498 74968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 76511 75531 gene locus_tag LOCUS_12160 76511 75531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 77771 76527 gene locus_tag LOCUS_12170 77771 76527 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_12170 79005 77785 gene locus_tag LOCUS_12180 79005 77785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 79913 79014 gene locus_tag LOCUS_12190 gene ftsX 79913 79014 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_12190 80646 79903 gene locus_tag LOCUS_12200 gene ftsE 80646 79903 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_12200 81807 80719 gene locus_tag LOCUS_12210 81807 80719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 82025 82213 gene locus_tag LOCUS_12220 82025 82213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 82894 82262 gene locus_tag LOCUS_12230 82894 82262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 83592 82891 gene locus_tag LOCUS_12240 83592 82891 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_12240 84019 84771 gene locus_tag LOCUS_12250 84019 84771 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_12250 86329 84797 gene locus_tag LOCUS_12260 86329 84797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 86818 86336 gene locus_tag LOCUS_12270 gene ylaC 86818 86336 CDS product RNA polymerase sigma factor YlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245485.1 protein_id gnl|my_center|LOCUS_12270 87028 86834 gene locus_tag LOCUS_12280 87028 86834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 88048 87131 gene locus_tag LOCUS_12290 88048 87131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 88971 88057 gene locus_tag LOCUS_12300 88971 88057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 89734 88991 gene locus_tag LOCUS_12310 89734 88991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 90159 89773 gene locus_tag LOCUS_12320 90159 89773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 91218 90208 gene locus_tag LOCUS_12330 91218 90208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 92432 91365 gene locus_tag LOCUS_12340 92432 91365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 93095 92799 gene locus_tag LOCUS_12350 93095 92799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 93370 93107 gene locus_tag LOCUS_12360 93370 93107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 94068 93493 gene locus_tag LOCUS_12370 94068 93493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 95387 94071 gene locus_tag LOCUS_12380 95387 94071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_12380 95604 95532 gene locus_tag LOCUS_t00090 95604 95532 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 96945 95773 gene locus_tag LOCUS_12390 96945 95773 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_12390 97424 96942 gene locus_tag LOCUS_12400 97424 96942 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_12400 97983 97396 gene locus_tag LOCUS_12410 97983 97396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 99589 98018 gene locus_tag LOCUS_12420 99589 98018 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_12420 99786 100418 gene locus_tag LOCUS_12430 99786 100418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 100992 100360 gene locus_tag LOCUS_12440 gene nth 100992 100360 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_12440 102134 100983 gene locus_tag LOCUS_12450 gene dnaJ 102134 100983 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_12450 104017 102137 gene locus_tag LOCUS_12460 gene dnaK 104017 102137 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_12460 104645 104055 gene locus_tag LOCUS_12470 104645 104055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 105689 104661 gene locus_tag LOCUS_12480 gene hrcA 105689 104661 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_12480 106437 105922 gene locus_tag LOCUS_12490 106437 105922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 107269 106607 gene locus_tag LOCUS_12500 107269 106607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 108531 107341 gene locus_tag LOCUS_12510 108531 107341 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052235.1 protein_id gnl|my_center|LOCUS_12510 109208 108534 gene locus_tag LOCUS_12520 109208 108534 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814547.1 protein_id gnl|my_center|LOCUS_12520 111343 109232 gene locus_tag LOCUS_12530 111343 109232 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_12530 112616 111360 gene locus_tag LOCUS_12540 112616 111360 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_12540 113260 112613 gene locus_tag LOCUS_12550 113260 112613 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989211.1 protein_id gnl|my_center|LOCUS_12550 113775 113257 gene locus_tag LOCUS_12560 113775 113257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 114107 113778 gene locus_tag LOCUS_12570 114107 113778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 115785 114109 gene locus_tag LOCUS_12580 115785 114109 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_12580 116054 115800 gene locus_tag LOCUS_12590 116054 115800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 116491 116066 gene locus_tag LOCUS_12600 gene ruvX 116491 116066 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_12600 116767 116498 gene locus_tag LOCUS_12610 116767 116498 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_12610 118157 116811 gene locus_tag LOCUS_12620 gene mtaB 118157 116811 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_12620 118257 118487 gene locus_tag LOCUS_12630 118257 118487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 119743 118556 gene locus_tag LOCUS_12640 gene thiI 119743 118556 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_12640 120949 119753 gene locus_tag LOCUS_12650 120949 119753 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_12650 121702 120950 gene locus_tag LOCUS_12660 121702 120950 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_12660 122658 121702 gene locus_tag LOCUS_12670 gene prmA 122658 121702 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_12670 122802 123281 gene locus_tag LOCUS_12680 122802 123281 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_12680 124047 123268 gene locus_tag LOCUS_12690 124047 123268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 124252 125193 gene locus_tag LOCUS_12700 124252 125193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 125207 126253 gene locus_tag LOCUS_12710 125207 126253 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_12710 126260 126595 gene locus_tag LOCUS_12720 126260 126595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 126599 127093 gene locus_tag LOCUS_12730 126599 127093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 127086 127529 gene locus_tag LOCUS_12740 127086 127529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 127501 127890 gene locus_tag LOCUS_12750 127501 127890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 128738 127905 gene locus_tag LOCUS_12760 128738 127905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 130489 128972 gene locus_tag LOCUS_12770 130489 128972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 133613 130506 gene locus_tag LOCUS_12780 133613 130506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 134407 133835 gene locus_tag LOCUS_12790 134407 133835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 135397 134561 gene locus_tag LOCUS_12800 gene rsmI 135397 134561 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_12800 136112 135357 gene locus_tag LOCUS_12810 136112 135357 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_12810 137020 136112 gene locus_tag LOCUS_12820 137020 136112 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_12820 138046 137054 gene locus_tag LOCUS_12830 138046 137054 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_12830 138505 138065 gene locus_tag LOCUS_12840 138505 138065 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_12840 139094 138507 gene locus_tag LOCUS_12850 139094 138507 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_12850 139375 139094 gene locus_tag LOCUS_12860 139375 139094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 140614 139688 gene locus_tag LOCUS_12870 140614 139688 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_12870 141792 140935 gene locus_tag LOCUS_12880 141792 140935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 142810 141815 gene locus_tag LOCUS_12890 142810 141815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 143240 142830 gene locus_tag LOCUS_12900 143240 142830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 143406 143333 gene locus_tag LOCUS_t00100 143406 143333 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence08 1376 138 gene locus_tag LOCUS_12910 1376 138 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_12910 2379 1441 gene locus_tag LOCUS_12920 2379 1441 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_12920 3203 2379 gene locus_tag LOCUS_12930 3203 2379 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_12930 4150 3551 gene locus_tag LOCUS_12940 4150 3551 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_12940 5234 4227 gene locus_tag LOCUS_12950 5234 4227 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107230.1 protein_id gnl|my_center|LOCUS_12950 5781 5587 gene locus_tag LOCUS_12960 5781 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6871 5996 gene locus_tag LOCUS_12970 6871 5996 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015669.1 protein_id gnl|my_center|LOCUS_12970 8237 6861 gene locus_tag LOCUS_12980 8237 6861 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_12980 8598 8855 gene locus_tag LOCUS_12990 8598 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 8874 9101 gene locus_tag LOCUS_13000 8874 9101 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_13000 9657 9403 gene locus_tag LOCUS_13010 9657 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9979 9731 gene locus_tag LOCUS_13020 9979 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 11938 10337 gene locus_tag LOCUS_13030 11938 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 13148 12039 gene locus_tag LOCUS_13040 13148 12039 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390245.1 protein_id gnl|my_center|LOCUS_13040 14245 13190 gene locus_tag LOCUS_13050 14245 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 15899 14418 gene locus_tag LOCUS_13060 15899 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 17082 15976 gene locus_tag LOCUS_13070 17082 15976 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390245.1 protein_id gnl|my_center|LOCUS_13070 18179 17124 gene locus_tag LOCUS_13080 18179 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 20003 18378 gene locus_tag LOCUS_13090 20003 18378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_13090 21063 20083 gene locus_tag LOCUS_13100 21063 20083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 22794 21223 gene locus_tag LOCUS_13110 22794 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 23728 22808 gene locus_tag LOCUS_13120 23728 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_13120 24901 23807 gene locus_tag LOCUS_13130 24901 23807 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_13130 25627 24902 gene locus_tag LOCUS_13140 25627 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 26570 25617 gene locus_tag LOCUS_13150 26570 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 27760 26636 gene locus_tag LOCUS_13160 27760 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 29109 27778 gene locus_tag LOCUS_13170 29109 27778 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_13170 30241 29147 gene locus_tag LOCUS_13180 30241 29147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 32041 30320 gene locus_tag LOCUS_13190 32041 30320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 32735 32019 gene locus_tag LOCUS_13200 32735 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 33856 32735 gene locus_tag LOCUS_13210 gene aepY 33856 32735 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679014.1 protein_id gnl|my_center|LOCUS_13210 35229 33934 gene locus_tag LOCUS_13220 gene aepX 35229 33934 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202933.1 protein_id gnl|my_center|LOCUS_13220 36445 35321 gene locus_tag LOCUS_13230 36445 35321 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202611.1 protein_id gnl|my_center|LOCUS_13230 38338 36449 gene locus_tag LOCUS_13240 38338 36449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 38641 38360 gene locus_tag LOCUS_13250 38641 38360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 40920 38767 gene locus_tag LOCUS_13260 40920 38767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 41445 41032 gene locus_tag LOCUS_13270 41445 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 42295 43065 gene locus_tag LOCUS_13280 42295 43065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 43093 43497 gene locus_tag LOCUS_13290 43093 43497 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965490.1 protein_id gnl|my_center|LOCUS_13290 44774 43494 gene locus_tag LOCUS_13300 44774 43494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 45000 45914 gene locus_tag LOCUS_13310 45000 45914 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_13310 47009 45903 gene locus_tag LOCUS_13320 47009 45903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 48413 47010 gene locus_tag LOCUS_13330 48413 47010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 50465 49083 gene locus_tag LOCUS_13340 50465 49083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 51071 50613 gene locus_tag LOCUS_13350 51071 50613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 51885 51145 gene locus_tag LOCUS_13360 51885 51145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 52087 52887 gene locus_tag LOCUS_13370 52087 52887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_13370 54368 52920 gene locus_tag LOCUS_13380 54368 52920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 55730 54378 gene locus_tag LOCUS_13390 55730 54378 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_13390 56554 55874 gene locus_tag LOCUS_13400 56554 55874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 57795 56923 gene locus_tag LOCUS_13410 57795 56923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 59222 57795 gene locus_tag LOCUS_13420 59222 57795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 60908 59250 gene locus_tag LOCUS_13430 60908 59250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 62261 60912 gene locus_tag LOCUS_13440 gene rfbH 62261 60912 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_13440 63298 62285 gene locus_tag LOCUS_13450 gene rfbG 63298 62285 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_13450 64574 63411 gene locus_tag LOCUS_13460 64574 63411 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775569.1 protein_id gnl|my_center|LOCUS_13460 65912 65226 gene locus_tag LOCUS_13470 65912 65226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 67359 65905 gene locus_tag LOCUS_13480 67359 65905 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_13480 68465 67473 gene locus_tag LOCUS_13490 68465 67473 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861092.1 protein_id gnl|my_center|LOCUS_13490 69076 68615 gene locus_tag LOCUS_13500 69076 68615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 69380 69087 gene locus_tag LOCUS_13510 69380 69087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 70476 69355 gene locus_tag LOCUS_13520 70476 69355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 70886 70599 gene locus_tag LOCUS_13530 70886 70599 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_13530 71278 70889 gene locus_tag LOCUS_13540 71278 70889 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_13540 73413 71644 gene locus_tag LOCUS_13550 73413 71644 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_13550 74293 73772 gene locus_tag LOCUS_13560 74293 73772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 75070 74888 gene locus_tag LOCUS_13570 75070 74888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 75340 75194 gene locus_tag LOCUS_13580 75340 75194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 76533 75388 gene locus_tag LOCUS_13590 76533 75388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 76721 76503 gene locus_tag LOCUS_13600 76721 76503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 76932 76759 gene locus_tag LOCUS_13610 76932 76759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 77963 76950 gene locus_tag LOCUS_13620 77963 76950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 78198 78031 gene locus_tag LOCUS_13630 78198 78031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 78574 78443 gene locus_tag LOCUS_13640 78574 78443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 80187 79132 gene locus_tag LOCUS_13650 80187 79132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 81330 80338 gene locus_tag LOCUS_13660 81330 80338 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_13660 82303 81365 gene locus_tag LOCUS_13670 82303 81365 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_13670 83215 82340 gene locus_tag LOCUS_13680 83215 82340 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_13680 84373 83252 gene locus_tag LOCUS_13690 84373 83252 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065256.1 protein_id gnl|my_center|LOCUS_13690 85067 84414 gene locus_tag LOCUS_13700 85067 84414 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837716.1 protein_id gnl|my_center|LOCUS_13700 86589 85072 gene locus_tag LOCUS_13710 86589 85072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 88413 86605 gene locus_tag LOCUS_13720 gene ilvB 88413 86605 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182646.1 protein_id gnl|my_center|LOCUS_13720 90427 88499 gene locus_tag LOCUS_13730 90427 88499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 91263 90460 gene locus_tag LOCUS_13740 gene rfbF 91263 90460 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_13740 93220 91274 gene locus_tag LOCUS_13750 93220 91274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 94120 93236 gene locus_tag LOCUS_13760 94120 93236 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_13760 95238 94141 gene locus_tag LOCUS_13770 95238 94141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 95339 95698 gene locus_tag LOCUS_13780 95339 95698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 96620 95670 gene locus_tag LOCUS_13790 96620 95670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 97572 96622 gene locus_tag LOCUS_13800 97572 96622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 100229 97578 gene locus_tag LOCUS_13810 100229 97578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 102725 101214 gene locus_tag LOCUS_13820 102725 101214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 104145 103162 gene locus_tag LOCUS_13830 104145 103162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 104719 104135 gene locus_tag LOCUS_13840 104719 104135 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_13840 106325 104712 gene locus_tag LOCUS_13850 106325 104712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 107044 106325 gene locus_tag LOCUS_13860 107044 106325 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965878.1 protein_id gnl|my_center|LOCUS_13860 108057 107818 gene locus_tag LOCUS_13870 108057 107818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 109097 108180 gene locus_tag LOCUS_13880 109097 108180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 109495 110769 gene locus_tag LOCUS_13890 109495 110769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 110988 110797 gene locus_tag LOCUS_13900 110988 110797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 112741 111524 gene locus_tag LOCUS_13910 112741 111524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 114170 112722 gene locus_tag LOCUS_13920 114170 112722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 115624 114167 gene locus_tag LOCUS_13930 115624 114167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 117220 115826 gene locus_tag LOCUS_13940 gene ltrA 117220 115826 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence09 2091 55 gene locus_tag LOCUS_13950 gene glgB 2091 55 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257047.1 protein_id gnl|my_center|LOCUS_13950 4912 2111 gene locus_tag LOCUS_13960 4912 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 6554 5058 gene locus_tag LOCUS_13970 gene glpK 6554 5058 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_13970 6602 7483 gene locus_tag LOCUS_13980 6602 7483 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079106.1 protein_id gnl|my_center|LOCUS_13980 8354 7485 gene locus_tag LOCUS_13990 8354 7485 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_13990 9104 8412 gene locus_tag LOCUS_14000 gene rpe 9104 8412 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986839.1 protein_id gnl|my_center|LOCUS_14000 10047 9106 gene locus_tag LOCUS_14010 10047 9106 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_14010 10891 10049 gene locus_tag LOCUS_14020 10891 10049 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_14020 11709 11029 gene locus_tag LOCUS_14030 11709 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12850 11714 gene locus_tag LOCUS_14040 12850 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14722 12902 gene locus_tag LOCUS_14050 14722 12902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_14050 16360 14723 gene locus_tag LOCUS_14060 16360 14723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_14060 17381 16452 gene locus_tag LOCUS_14070 17381 16452 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_14070 18102 17383 gene locus_tag LOCUS_14080 18102 17383 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_14080 19361 18183 gene locus_tag LOCUS_14090 19361 18183 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_14090 20094 19375 gene locus_tag LOCUS_14100 20094 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 20706 20143 gene locus_tag LOCUS_14110 20706 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 21815 20706 gene locus_tag LOCUS_14120 21815 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 23202 21817 gene locus_tag LOCUS_14130 23202 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 23897 23235 gene locus_tag LOCUS_14140 23897 23235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 26016 23908 gene locus_tag LOCUS_14150 gene malZ 26016 23908 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482420.1 protein_id gnl|my_center|LOCUS_14150 28091 26268 gene locus_tag LOCUS_14160 gene ftsH 28091 26268 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_14160 28629 28102 gene locus_tag LOCUS_14170 gene hpt 28629 28102 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_14170 29974 28613 gene locus_tag LOCUS_14180 gene tilS 29974 28613 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_14180 30263 29955 gene locus_tag LOCUS_14190 30263 29955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 30669 30430 gene locus_tag LOCUS_14200 30669 30430 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_14200 31046 30774 gene locus_tag LOCUS_14210 31046 30774 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_14210 32613 31210 gene locus_tag LOCUS_14220 32613 31210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 33944 32610 gene locus_tag LOCUS_14230 33944 32610 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14230 36157 33941 gene locus_tag LOCUS_14240 36157 33941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 36963 36190 gene locus_tag LOCUS_14250 36963 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 38430 36994 gene locus_tag LOCUS_14260 gene proS 38430 36994 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_14260 40035 38521 gene locus_tag LOCUS_14270 40035 38521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 40720 39998 gene locus_tag LOCUS_14280 40720 39998 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_14280 41424 40723 gene locus_tag LOCUS_14290 41424 40723 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_14290 43052 41460 gene locus_tag LOCUS_14300 43052 41460 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_14300 43297 43611 gene locus_tag LOCUS_14310 43297 43611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 44376 43687 gene locus_tag LOCUS_14320 44376 43687 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_14320 45529 44369 gene locus_tag LOCUS_14330 45529 44369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 46794 45607 gene locus_tag LOCUS_14340 46794 45607 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_14340 46921 48126 gene locus_tag LOCUS_14350 46921 48126 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_14350 49450 48095 gene locus_tag LOCUS_14360 49450 48095 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_14360 49505 49963 gene locus_tag LOCUS_14370 49505 49963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 51246 49960 gene locus_tag LOCUS_14380 51246 49960 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_14380 52514 51264 gene locus_tag LOCUS_14390 52514 51264 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_14390 53068 52598 gene locus_tag LOCUS_14400 53068 52598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 53970 53083 gene locus_tag LOCUS_14410 53970 53083 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_14410 55301 53997 gene locus_tag LOCUS_14420 55301 53997 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_14420 56281 55292 gene locus_tag LOCUS_14430 56281 55292 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_14430 56734 56285 gene locus_tag LOCUS_14440 56734 56285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 58722 56854 gene locus_tag LOCUS_14450 gene glmS 58722 56854 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_14450 60100 58754 gene locus_tag LOCUS_14460 60100 58754 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_14460 60665 61423 gene locus_tag LOCUS_14470 60665 61423 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_14470 62519 61431 gene locus_tag LOCUS_14480 62519 61431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 63949 62525 gene locus_tag LOCUS_14490 63949 62525 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_14490 65110 64040 gene locus_tag LOCUS_14500 65110 64040 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_14500 65216 65144 gene locus_tag LOCUS_t00110 65216 65144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66091 65207 gene locus_tag LOCUS_14510 66091 65207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 67390 66101 gene locus_tag LOCUS_14520 gene serS 67390 66101 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_14520 68449 67394 gene locus_tag LOCUS_14530 68449 67394 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948166.1 protein_id gnl|my_center|LOCUS_14530 68963 68436 gene locus_tag LOCUS_14540 68963 68436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 69886 68972 gene locus_tag LOCUS_14550 69886 68972 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_14550 70752 69994 gene locus_tag LOCUS_14560 70752 69994 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_14560 71472 70840 gene locus_tag LOCUS_14570 71472 70840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 72592 71948 gene locus_tag LOCUS_14580 gene liaR 72592 71948 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_14580 73622 72609 gene locus_tag LOCUS_14590 73622 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 74404 73676 gene locus_tag LOCUS_14600 gene rsmG 74404 73676 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 protein_id gnl|my_center|LOCUS_14600 76325 74406 gene locus_tag LOCUS_14610 gene mnmG 76325 74406 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_14610 77749 76370 gene locus_tag LOCUS_14620 gene mnmE 77749 76370 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_14620 78375 77752 gene locus_tag LOCUS_14630 78375 77752 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_14630 79700 78387 gene locus_tag LOCUS_14640 79700 78387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 79949 79740 gene locus_tag LOCUS_14650 gene yidD 79949 79740 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_14650 80314 79961 gene locus_tag LOCUS_14660 gene rnpA 80314 79961 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_14660 80470 80336 gene locus_tag LOCUS_14670 gene rpmH 80470 80336 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_14670 80944 82308 gene locus_tag LOCUS_14680 gene dnaA 80944 82308 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_14680 82515 83624 gene locus_tag LOCUS_14690 gene dnaN 82515 83624 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_14690 83634 83849 gene locus_tag LOCUS_14700 83634 83849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 83839 84924 gene locus_tag LOCUS_14710 gene recF 83839 84924 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_14710 84912 86903 gene locus_tag LOCUS_14720 gene gyrB 84912 86903 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_14720 86950 89451 gene locus_tag LOCUS_14730 gene gyrA 86950 89451 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_14730 89509 89805 gene locus_tag LOCUS_14740 89509 89805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 89827 91008 gene locus_tag LOCUS_14750 89827 91008 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_14750 91038 93338 gene locus_tag LOCUS_14760 gene yicI 91038 93338 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 protein_id gnl|my_center|LOCUS_14760 93437 95464 gene locus_tag LOCUS_14770 93437 95464 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_14770 95467 96432 gene locus_tag LOCUS_14780 95467 96432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 96435 97151 gene locus_tag LOCUS_14790 96435 97151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_14790 97135 97980 gene locus_tag LOCUS_14800 97135 97980 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_14800 98248 98490 gene locus_tag LOCUS_14810 98248 98490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 98456 98863 gene locus_tag LOCUS_14820 98456 98863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 98898 99440 gene locus_tag LOCUS_14830 98898 99440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 99579 101219 gene locus_tag LOCUS_14840 99579 101219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 101238 102089 gene locus_tag LOCUS_14850 101238 102089 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence10 223 1260 gene locus_tag LOCUS_14860 223 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1263 2438 gene locus_tag LOCUS_14870 1263 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2690 3526 gene locus_tag LOCUS_14880 2690 3526 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_14880 3803 4639 gene locus_tag LOCUS_14890 3803 4639 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_14890 4706 5677 gene locus_tag LOCUS_14900 4706 5677 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_14900 6874 5717 gene locus_tag LOCUS_14910 6874 5717 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704233.1 protein_id gnl|my_center|LOCUS_14910 8421 6886 gene locus_tag LOCUS_14920 8421 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 8522 9562 gene locus_tag LOCUS_14930 8522 9562 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_14930 9570 10703 gene locus_tag LOCUS_14940 gene neuC 9570 10703 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_14940 10718 11413 gene locus_tag LOCUS_14950 10718 11413 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_14950 12459 11410 gene locus_tag LOCUS_14960 12459 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 13753 12584 gene locus_tag LOCUS_14970 13753 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 14150 13815 gene locus_tag LOCUS_14980 14150 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 14655 14533 gene locus_tag LOCUS_14990 14655 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 14949 16085 gene locus_tag LOCUS_15000 14949 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 16128 17081 gene locus_tag LOCUS_15010 16128 17081 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032826364.1 protein_id gnl|my_center|LOCUS_15010 17166 18308 gene locus_tag LOCUS_15020 17166 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 18644 18474 gene locus_tag LOCUS_15030 18644 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 19555 18677 gene locus_tag LOCUS_15040 19555 18677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 20043 20468 gene locus_tag LOCUS_15050 20043 20468 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679681.1 protein_id gnl|my_center|LOCUS_15050 20487 21443 gene locus_tag LOCUS_15060 20487 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 21567 23003 gene locus_tag LOCUS_15070 21567 23003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250416.1 protein_id gnl|my_center|LOCUS_15070 23003 24151 gene locus_tag LOCUS_15080 23003 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 24328 25008 gene locus_tag LOCUS_15090 24328 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 24992 25549 gene locus_tag LOCUS_15100 24992 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 25627 27987 gene locus_tag LOCUS_15110 25627 27987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 28089 29798 gene locus_tag LOCUS_15120 28089 29798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 29883 30002 gene locus_tag LOCUS_15130 29883 30002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 30677 30096 gene locus_tag LOCUS_15140 30677 30096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 30896 30970 gene locus_tag LOCUS_t00120 30896 30970 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31411 32448 gene locus_tag LOCUS_15150 31411 32448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 31461 31554 gene locus_tag LOCUS_t00130 31461 31554 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 32460 33755 gene locus_tag LOCUS_15160 32460 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 33736 35028 gene locus_tag LOCUS_15170 33736 35028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 35046 36383 gene locus_tag LOCUS_15180 35046 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 36392 37675 gene locus_tag LOCUS_15190 36392 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 37689 38693 gene locus_tag LOCUS_15200 37689 38693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 38708 39409 gene locus_tag LOCUS_15210 38708 39409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 39421 40539 gene locus_tag LOCUS_15220 39421 40539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 40581 40844 gene locus_tag LOCUS_15230 40581 40844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 40906 41403 gene locus_tag LOCUS_15240 40906 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 41723 44260 gene locus_tag LOCUS_15250 41723 44260 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_15250 44275 45504 gene locus_tag LOCUS_15260 44275 45504 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_15260 45602 46573 gene locus_tag LOCUS_15270 45602 46573 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_15270 46762 46547 gene locus_tag LOCUS_15280 46762 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 46870 48090 gene locus_tag LOCUS_15290 46870 48090 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_15290 48200 49720 gene locus_tag LOCUS_15300 48200 49720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 49717 50688 gene locus_tag LOCUS_15310 49717 50688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 51687 50725 gene locus_tag LOCUS_15320 51687 50725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 53779 51953 gene locus_tag LOCUS_15330 53779 51953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 54004 56934 gene locus_tag LOCUS_15340 54004 56934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 57384 56911 gene locus_tag LOCUS_15350 57384 56911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 58548 57457 gene locus_tag LOCUS_15360 gene trpS 58548 57457 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_15360 59654 58761 gene locus_tag LOCUS_15370 59654 58761 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_15370 59927 60259 gene locus_tag LOCUS_15380 59927 60259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 60377 61840 gene locus_tag LOCUS_15390 60377 61840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 61992 62807 gene locus_tag LOCUS_15400 gene proB 61992 62807 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_15400 62938 64185 gene locus_tag LOCUS_15410 62938 64185 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462038.1 protein_id gnl|my_center|LOCUS_15410 64282 65265 gene locus_tag LOCUS_15420 gene holA 64282 65265 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_15420 65343 66857 gene locus_tag LOCUS_15430 gene malQ 65343 66857 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028588.1 protein_id gnl|my_center|LOCUS_15430 66900 68123 gene locus_tag LOCUS_15440 gene sstT 66900 68123 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_15440 68290 68673 gene locus_tag LOCUS_15450 68290 68673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 68770 69225 gene locus_tag LOCUS_15460 68770 69225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 69336 70247 gene locus_tag LOCUS_15470 69336 70247 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_15470 71312 70338 gene locus_tag LOCUS_15480 71312 70338 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229243.1 protein_id gnl|my_center|LOCUS_15480 71490 72728 gene locus_tag LOCUS_15490 71490 72728 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_15490 73631 74548 gene locus_tag LOCUS_15500 gene ptb 73631 74548 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_15500 74568 75635 gene locus_tag LOCUS_15510 gene buk 74568 75635 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_15510 76174 75764 gene locus_tag LOCUS_15520 gene mscL 76174 75764 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_15520 77016 76300 gene locus_tag LOCUS_15530 77016 76300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 78398 77013 gene locus_tag LOCUS_15540 78398 77013 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_15540 78686 81250 gene locus_tag LOCUS_15550 gene secA 78686 81250 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_15550 81254 82369 gene locus_tag LOCUS_15560 gene prfB 81254 82369 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_15560 83125 82781 gene locus_tag LOCUS_15570 83125 82781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 83675 84811 gene locus_tag LOCUS_15580 83675 84811 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_15580 84993 85604 gene locus_tag LOCUS_15590 84993 85604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 85630 86451 gene locus_tag LOCUS_15600 85630 86451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 86600 88705 gene locus_tag LOCUS_15610 86600 88705 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_15610 88775 89257 gene locus_tag LOCUS_15620 88775 89257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 89247 89699 gene locus_tag LOCUS_15630 gene tsaE 89247 89699 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_15630 89677 90420 gene locus_tag LOCUS_15640 gene tsaB 89677 90420 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_15640 90386 90853 gene locus_tag LOCUS_15650 gene rimI 90386 90853 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_15650 90951 91850 gene locus_tag LOCUS_15660 90951 91850 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_15660 91834 92430 gene locus_tag LOCUS_15670 91834 92430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 92414 93436 gene locus_tag LOCUS_15680 gene tsaD 92414 93436 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_15680 93441 94160 gene locus_tag LOCUS_15690 gene ispD 93441 94160 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_15690 94147 95514 gene locus_tag LOCUS_15700 94147 95514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 97092 95794 gene locus_tag LOCUS_15710 97092 95794 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922710.1 protein_id gnl|my_center|LOCUS_15710 97259 97918 gene locus_tag LOCUS_15720 97259 97918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 98283 98861 gene locus_tag LOCUS_15730 98283 98861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 98836 99048 gene locus_tag LOCUS_15740 98836 99048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 99282 99367 gene locus_tag LOCUS_t00140 99282 99367 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence11 684 511 gene locus_tag LOCUS_15750 684 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1027 647 gene locus_tag LOCUS_15760 1027 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1554 1303 gene locus_tag LOCUS_15770 1554 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2265 1648 gene locus_tag LOCUS_15780 2265 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2898 2518 gene locus_tag LOCUS_15790 2898 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4182 3001 gene locus_tag LOCUS_15800 4182 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 5067 4219 gene locus_tag LOCUS_15810 5067 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6815 5064 gene locus_tag LOCUS_15820 6815 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 9392 6825 gene locus_tag LOCUS_15830 9392 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 16101 9442 gene locus_tag LOCUS_15840 16101 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 16469 16089 gene locus_tag LOCUS_15850 16469 16089 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939431.1 protein_id gnl|my_center|LOCUS_15850 16995 16471 gene locus_tag LOCUS_15860 16995 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 17770 16997 gene locus_tag LOCUS_15870 17770 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 22889 17820 gene locus_tag LOCUS_15880 22889 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 23282 22899 gene locus_tag LOCUS_15890 23282 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 23761 23336 gene locus_tag LOCUS_15900 23761 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 25677 23851 gene locus_tag LOCUS_15910 25677 23851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 26209 25766 gene locus_tag LOCUS_15920 26209 25766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 27837 26206 gene locus_tag LOCUS_15930 27837 26206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 28215 27850 gene locus_tag LOCUS_15940 28215 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 28925 28218 gene locus_tag LOCUS_15950 28925 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 29160 28942 gene locus_tag LOCUS_15960 29160 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 30361 29207 gene locus_tag LOCUS_15970 30361 29207 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705696.1 protein_id gnl|my_center|LOCUS_15970 31165 30383 gene locus_tag LOCUS_15980 31165 30383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 32213 31647 gene locus_tag LOCUS_15990 32213 31647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 33824 32217 gene locus_tag LOCUS_16000 33824 32217 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566295.1 protein_id gnl|my_center|LOCUS_16000 35118 33826 gene locus_tag LOCUS_16010 35118 33826 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211787.1 protein_id gnl|my_center|LOCUS_16010 35563 35111 gene locus_tag LOCUS_16020 35563 35111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 35641 35949 gene locus_tag LOCUS_16030 35641 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 35949 36542 gene locus_tag LOCUS_16040 35949 36542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 36926 36615 gene locus_tag LOCUS_16050 36926 36615 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047617.1 protein_id gnl|my_center|LOCUS_16050 37395 37042 gene locus_tag LOCUS_16060 37395 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 37789 37406 gene locus_tag LOCUS_16070 37789 37406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 38148 37780 gene locus_tag LOCUS_16080 38148 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 38374 38030 gene locus_tag LOCUS_16090 38374 38030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 38796 38374 gene locus_tag LOCUS_16100 38796 38374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 39242 39787 gene locus_tag LOCUS_16110 39242 39787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 40707 40892 gene locus_tag LOCUS_16120 40707 40892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 40986 41174 gene locus_tag LOCUS_16130 40986 41174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 41171 41458 gene locus_tag LOCUS_16140 41171 41458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 41451 41585 gene locus_tag LOCUS_16150 41451 41585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 41587 41850 gene locus_tag LOCUS_16160 41587 41850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 41851 42174 gene locus_tag LOCUS_16170 41851 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 42185 42382 gene locus_tag LOCUS_16180 42185 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 42426 42788 gene locus_tag LOCUS_16190 42426 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 42799 43023 gene locus_tag LOCUS_16200 42799 43023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 43090 43341 gene locus_tag LOCUS_16210 43090 43341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 43353 44885 gene locus_tag LOCUS_16220 43353 44885 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679741.1 protein_id gnl|my_center|LOCUS_16220 44943 45461 gene locus_tag LOCUS_16230 44943 45461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 45461 45694 gene locus_tag LOCUS_16240 45461 45694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 45768 47240 gene locus_tag LOCUS_16250 45768 47240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 47233 47511 gene locus_tag LOCUS_16260 47233 47511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 47508 48014 gene locus_tag LOCUS_16270 47508 48014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 48007 48237 gene locus_tag LOCUS_16280 48007 48237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 48242 49432 gene locus_tag LOCUS_16290 48242 49432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 50197 50478 gene locus_tag LOCUS_16300 50197 50478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 50478 50774 gene locus_tag LOCUS_16310 50478 50774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 50771 51109 gene locus_tag LOCUS_16320 50771 51109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 51110 51469 gene locus_tag LOCUS_16330 51110 51469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 51556 52221 gene locus_tag LOCUS_16340 51556 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 52230 52415 gene locus_tag LOCUS_16350 52230 52415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 52832 53035 gene locus_tag LOCUS_16360 52832 53035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 53035 53268 gene locus_tag LOCUS_16370 53035 53268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 53255 53413 gene locus_tag LOCUS_16380 53255 53413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 53417 53695 gene locus_tag LOCUS_16390 53417 53695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 53670 53870 gene locus_tag LOCUS_16400 53670 53870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 53884 54258 gene locus_tag LOCUS_16410 53884 54258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 54270 54575 gene locus_tag LOCUS_16420 54270 54575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 54579 54794 gene locus_tag LOCUS_16430 54579 54794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 54798 55130 gene locus_tag LOCUS_16440 54798 55130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 55144 55809 gene locus_tag LOCUS_16450 55144 55809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 55846 56109 gene locus_tag LOCUS_16460 55846 56109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 56120 56320 gene locus_tag LOCUS_16470 56120 56320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 56331 56477 gene locus_tag LOCUS_16480 56331 56477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 56487 56702 gene locus_tag LOCUS_16490 56487 56702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 56720 57961 gene locus_tag LOCUS_16500 gene tnpB 56720 57961 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_16500 57936 58097 gene locus_tag LOCUS_16510 57936 58097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 58111 58584 gene locus_tag LOCUS_16520 58111 58584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 58595 59476 gene locus_tag LOCUS_16530 58595 59476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 59589 59735 gene locus_tag LOCUS_16540 59589 59735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 59802 60239 gene locus_tag LOCUS_16550 59802 60239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 60239 60682 gene locus_tag LOCUS_16560 60239 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 60805 61107 gene locus_tag LOCUS_16570 60805 61107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 61119 61787 gene locus_tag LOCUS_16580 61119 61787 CDS product DUF1071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905689.1 protein_id gnl|my_center|LOCUS_16580 61892 62251 gene locus_tag LOCUS_16590 61892 62251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 62251 62730 gene locus_tag LOCUS_16600 62251 62730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 62717 62971 gene locus_tag LOCUS_16610 62717 62971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 62968 63177 gene locus_tag LOCUS_16620 62968 63177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 63178 63501 gene locus_tag LOCUS_16630 63178 63501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 63504 63716 gene locus_tag LOCUS_16640 63504 63716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 64285 63797 gene locus_tag LOCUS_16650 64285 63797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 64444 64650 gene locus_tag LOCUS_16660 64444 64650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 64651 64914 gene locus_tag LOCUS_16670 64651 64914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 64911 68138 gene locus_tag LOCUS_16680 64911 68138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 68658 68086 gene locus_tag LOCUS_16690 68658 68086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 68875 68645 gene locus_tag LOCUS_16700 68875 68645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 70980 69028 gene locus_tag LOCUS_16710 70980 69028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 71227 70991 gene locus_tag LOCUS_16720 71227 70991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 71913 71242 gene locus_tag LOCUS_16730 71913 71242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 73218 71959 gene locus_tag LOCUS_16740 gene tnpB 73218 71959 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_16740 73818 73336 gene locus_tag LOCUS_16750 73818 73336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 74234 73890 gene locus_tag LOCUS_16760 74234 73890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 74629 74231 gene locus_tag LOCUS_16770 74629 74231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 75618 74629 gene locus_tag LOCUS_16780 75618 74629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 76188 75823 gene locus_tag LOCUS_16790 76188 75823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 76318 76178 gene locus_tag LOCUS_16800 76318 76178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 76647 76318 gene locus_tag LOCUS_16810 76647 76318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 77324 76647 gene locus_tag LOCUS_16820 77324 76647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 77706 77287 gene locus_tag LOCUS_16830 77706 77287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 78216 77770 gene locus_tag LOCUS_16840 78216 77770 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657080.1 protein_id gnl|my_center|LOCUS_16840 78494 78216 gene locus_tag LOCUS_16850 78494 78216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 78722 79315 gene locus_tag LOCUS_16860 78722 79315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 79324 79614 gene locus_tag LOCUS_16870 79324 79614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 80103 79618 gene locus_tag LOCUS_16880 80103 79618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 80297 80707 gene locus_tag LOCUS_16890 80297 80707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 80700 81005 gene locus_tag LOCUS_16900 80700 81005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 81751 82218 gene locus_tag LOCUS_16910 81751 82218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 82465 82175 gene locus_tag LOCUS_16920 82465 82175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 82729 83730 gene locus_tag LOCUS_16930 82729 83730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 83727 84362 gene locus_tag LOCUS_16940 83727 84362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 84365 85657 gene locus_tag LOCUS_16950 gene dnaB 84365 85657 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669313.1 protein_id gnl|my_center|LOCUS_16950 85694 86134 gene locus_tag LOCUS_16960 85694 86134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 86215 86469 gene locus_tag LOCUS_16970 86215 86469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 86484 86732 gene locus_tag LOCUS_16980 86484 86732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 86719 86961 gene locus_tag LOCUS_16990 86719 86961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 86951 87121 gene locus_tag LOCUS_17000 86951 87121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 87124 87327 gene locus_tag LOCUS_17010 87124 87327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 87432 87695 gene locus_tag LOCUS_17020 87432 87695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 87703 88047 gene locus_tag LOCUS_17030 87703 88047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 88172 88822 gene locus_tag LOCUS_17040 88172 88822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 88819 89196 gene locus_tag LOCUS_17050 88819 89196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 89199 89720 gene locus_tag LOCUS_17060 89199 89720 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_17060 89720 90217 gene locus_tag LOCUS_17070 89720 90217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 90221 90490 gene locus_tag LOCUS_17080 90221 90490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 90490 90639 gene locus_tag LOCUS_17090 90490 90639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 90639 91382 gene locus_tag LOCUS_17100 90639 91382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 91385 91675 gene locus_tag LOCUS_17110 91385 91675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 91686 91964 gene locus_tag LOCUS_17120 91686 91964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 91976 92419 gene locus_tag LOCUS_17130 91976 92419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 92467 92670 gene locus_tag LOCUS_17140 92467 92670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 92769 92936 gene locus_tag LOCUS_17150 92769 92936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 93211 94302 gene locus_tag LOCUS_17160 93211 94302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 94344 94520 gene locus_tag LOCUS_17170 94344 94520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 94552 94806 gene locus_tag LOCUS_17180 94552 94806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 94760 95176 gene locus_tag LOCUS_17190 94760 95176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 95176 95652 gene locus_tag LOCUS_17200 95176 95652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 95875 95642 gene locus_tag LOCUS_17210 95875 95642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 96219 95878 gene locus_tag LOCUS_17220 96219 95878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 96415 96113 gene locus_tag LOCUS_17230 96415 96113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 96675 96412 gene locus_tag LOCUS_17240 96675 96412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 97212 96769 gene locus_tag LOCUS_17250 97212 96769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 97856 97203 gene locus_tag LOCUS_17260 97856 97203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 98377 97910 gene locus_tag LOCUS_17270 98377 97910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 98625 98380 gene locus_tag LOCUS_17280 98625 98380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 98960 98625 gene locus_tag LOCUS_17290 98960 98625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence12 459 235 gene locus_tag LOCUS_17300 459 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 879 517 gene locus_tag LOCUS_17310 879 517 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_17310 1511 951 gene locus_tag LOCUS_17320 1511 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2042 1602 gene locus_tag LOCUS_17330 2042 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350140.1 protein_id gnl|my_center|LOCUS_17330 2188 3129 gene locus_tag LOCUS_17340 2188 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3246 4247 gene locus_tag LOCUS_17350 3246 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 5617 4253 gene locus_tag LOCUS_17360 5617 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 6248 5628 gene locus_tag LOCUS_17370 6248 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 8627 6375 gene locus_tag LOCUS_17380 8627 6375 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679111.1 protein_id gnl|my_center|LOCUS_17380 10165 8756 gene locus_tag LOCUS_17390 gene melB 10165 8756 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032709637.1 protein_id gnl|my_center|LOCUS_17390 12586 10184 gene locus_tag LOCUS_17400 12586 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 13156 12599 gene locus_tag LOCUS_17410 13156 12599 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986315.1 protein_id gnl|my_center|LOCUS_17410 13971 13306 gene locus_tag LOCUS_17420 13971 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 14806 13913 gene locus_tag LOCUS_17430 14806 13913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 15816 15505 gene locus_tag LOCUS_17440 15816 15505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 16730 15819 gene locus_tag LOCUS_17450 16730 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 17753 16881 gene locus_tag LOCUS_17460 17753 16881 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836405.1 protein_id gnl|my_center|LOCUS_17460 17999 17808 gene locus_tag LOCUS_17470 17999 17808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 18587 18018 gene locus_tag LOCUS_17480 18587 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 19237 18617 gene locus_tag LOCUS_17490 19237 18617 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_17490 21375 19234 gene locus_tag LOCUS_17500 21375 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 21848 21630 gene locus_tag LOCUS_17510 21848 21630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 22083 22562 gene locus_tag LOCUS_17520 22083 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 22894 22670 gene locus_tag LOCUS_17530 22894 22670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 24148 23567 gene locus_tag LOCUS_17540 24148 23567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 24475 24239 gene locus_tag LOCUS_17550 24475 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 25901 24615 gene locus_tag LOCUS_17560 25901 24615 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870846.1 protein_id gnl|my_center|LOCUS_17560 26376 26227 gene locus_tag LOCUS_17570 26376 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 26887 26582 gene locus_tag LOCUS_17580 26887 26582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 27689 27051 gene locus_tag LOCUS_17590 27689 27051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 28472 27795 gene locus_tag LOCUS_17600 28472 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 28776 28558 gene locus_tag LOCUS_17610 28776 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 30066 29464 gene locus_tag LOCUS_17620 30066 29464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 30659 30123 gene locus_tag LOCUS_17630 30659 30123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 31219 30947 gene locus_tag LOCUS_17640 31219 30947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 31951 31346 gene locus_tag LOCUS_17650 31951 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 32597 31956 gene locus_tag LOCUS_17660 32597 31956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 34865 32598 gene locus_tag LOCUS_17670 34865 32598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 36291 34867 gene locus_tag LOCUS_17680 36291 34867 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263383.1 protein_id gnl|my_center|LOCUS_17680 37948 36437 gene locus_tag LOCUS_17690 37948 36437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 43912 38168 gene locus_tag LOCUS_17700 43912 38168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 44594 44157 gene locus_tag LOCUS_17710 44594 44157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 44856 44662 gene locus_tag LOCUS_17720 44856 44662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 45662 44901 gene locus_tag LOCUS_17730 45662 44901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 46597 45665 gene locus_tag LOCUS_17740 46597 45665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 47835 46672 gene locus_tag LOCUS_17750 47835 46672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 48365 47838 gene locus_tag LOCUS_17760 48365 47838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 48779 48402 gene locus_tag LOCUS_17770 48779 48402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 50220 48772 gene locus_tag LOCUS_17780 50220 48772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 52148 50535 gene locus_tag LOCUS_17790 52148 50535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 52843 52415 gene locus_tag LOCUS_17800 52843 52415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 54008 52854 gene locus_tag LOCUS_17810 54008 52854 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 protein_id gnl|my_center|LOCUS_17810 55008 53995 gene locus_tag LOCUS_17820 gene dcm 55008 53995 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_17820 55194 55009 gene locus_tag LOCUS_17830 55194 55009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 55527 55249 gene locus_tag LOCUS_17840 55527 55249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 56008 55520 gene locus_tag LOCUS_17850 56008 55520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 58810 56399 gene locus_tag LOCUS_17860 58810 56399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 59517 58906 gene locus_tag LOCUS_17870 59517 58906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 60011 59517 gene locus_tag LOCUS_17880 60011 59517 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_17880 60826 60023 gene locus_tag LOCUS_17890 60826 60023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 62492 61050 gene locus_tag LOCUS_17900 62492 61050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114264.1 protein_id gnl|my_center|LOCUS_17900 63396 62716 gene locus_tag LOCUS_17910 63396 62716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 63763 63440 gene locus_tag LOCUS_17920 63763 63440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 65046 63775 gene locus_tag LOCUS_17930 65046 63775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 65960 65052 gene locus_tag LOCUS_17940 65960 65052 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562946.1 protein_id gnl|my_center|LOCUS_17940 66735 65953 gene locus_tag LOCUS_17950 66735 65953 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_17950 66925 66749 gene locus_tag LOCUS_17960 66925 66749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 68841 67603 gene locus_tag LOCUS_17970 68841 67603 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610375.1 protein_id gnl|my_center|LOCUS_17970 69054 68875 gene locus_tag LOCUS_17980 69054 68875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 69398 69138 gene locus_tag LOCUS_17990 69398 69138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 69959 69402 gene locus_tag LOCUS_18000 69959 69402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 70472 70284 gene locus_tag LOCUS_18010 70472 70284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 70710 70519 gene locus_tag LOCUS_18020 70710 70519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 71776 70811 gene locus_tag LOCUS_18030 71776 70811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 73948 71792 gene locus_tag LOCUS_18040 73948 71792 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_18040 76086 73987 gene locus_tag LOCUS_18050 76086 73987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 78618 76135 gene locus_tag LOCUS_18060 78618 76135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 78945 78730 gene locus_tag LOCUS_18070 78945 78730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 79869 79039 gene locus_tag LOCUS_18080 79869 79039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 80785 79958 gene locus_tag LOCUS_18090 80785 79958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 83417 80856 gene locus_tag LOCUS_18100 83417 80856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 85573 83420 gene locus_tag LOCUS_18110 85573 83420 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476506.1 protein_id gnl|my_center|LOCUS_18110 86725 85595 gene locus_tag LOCUS_18120 86725 85595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 88087 87131 gene locus_tag LOCUS_18130 88087 87131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 90032 88434 gene locus_tag LOCUS_18140 90032 88434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 90348 90022 gene locus_tag LOCUS_18150 90348 90022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence13 2056 293 gene locus_tag LOCUS_18160 2056 293 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_18160 2547 2053 gene locus_tag LOCUS_18170 2547 2053 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368727.1 protein_id gnl|my_center|LOCUS_18170 2904 2581 gene locus_tag LOCUS_18180 2904 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 3224 2913 gene locus_tag LOCUS_18190 3224 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4206 3259 gene locus_tag LOCUS_18200 4206 3259 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_18200 4482 4213 gene locus_tag LOCUS_18210 4482 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 5871 4795 gene locus_tag LOCUS_18220 5871 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6516 6253 gene locus_tag LOCUS_18230 6516 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7481 6522 gene locus_tag LOCUS_18240 7481 6522 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_18240 7891 7520 gene locus_tag LOCUS_18250 7891 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8822 7893 gene locus_tag LOCUS_18260 8822 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9610 8822 gene locus_tag LOCUS_18270 9610 8822 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_18270 10095 9610 gene locus_tag LOCUS_18280 10095 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12032 10410 gene locus_tag LOCUS_18290 gene lysS 12032 10410 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_18290 12534 12049 gene locus_tag LOCUS_18300 gene greA 12534 12049 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_18300 14480 12675 gene locus_tag LOCUS_18310 14480 12675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_18310 16329 14470 gene locus_tag LOCUS_18320 16329 14470 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_18320 17298 16333 gene locus_tag LOCUS_18330 gene dusB 17298 16333 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_18330 18049 17276 gene locus_tag LOCUS_18340 18049 17276 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_18340 18463 18116 gene locus_tag LOCUS_18350 18463 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 19532 18543 gene locus_tag LOCUS_18360 gene argF 19532 18543 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_18360 20789 19611 gene locus_tag LOCUS_18370 20789 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 21722 20928 gene locus_tag LOCUS_18380 gene proC 21722 20928 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_18380 22607 21783 gene locus_tag LOCUS_18390 22607 21783 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_18390 23581 22607 gene locus_tag LOCUS_18400 gene pfkA 23581 22607 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_18400 27244 23756 gene locus_tag LOCUS_18410 27244 23756 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_18410 28526 27345 gene locus_tag LOCUS_18420 gene metK 28526 27345 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_18420 28942 30018 gene locus_tag LOCUS_18430 28942 30018 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_18430 31389 30097 gene locus_tag LOCUS_18440 31389 30097 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_18440 33022 31568 gene locus_tag LOCUS_18450 33022 31568 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813688.1 protein_id gnl|my_center|LOCUS_18450 33719 33159 gene locus_tag LOCUS_18460 33719 33159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 34298 33990 gene locus_tag LOCUS_18470 34298 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 34961 34314 gene locus_tag LOCUS_18480 34961 34314 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_18480 35142 35954 gene locus_tag LOCUS_18490 35142 35954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 36151 35873 gene locus_tag LOCUS_18500 36151 35873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 36154 37371 gene locus_tag LOCUS_18510 36154 37371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 38482 37472 gene locus_tag LOCUS_18520 gene galE 38482 37472 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_18520 39718 38495 gene locus_tag LOCUS_18530 39718 38495 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_18530 40736 39738 gene locus_tag LOCUS_18540 gene pseB 40736 39738 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_18540 42066 40816 gene locus_tag LOCUS_18550 42066 40816 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_18550 42931 42134 gene locus_tag LOCUS_18560 42931 42134 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_18560 43794 42928 gene locus_tag LOCUS_18570 gene metF 43794 42928 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_18570 44621 43806 gene locus_tag LOCUS_18580 44621 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 44923 44642 gene locus_tag LOCUS_18590 44923 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 45762 44959 gene locus_tag LOCUS_18600 45762 44959 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_18600 46822 45776 gene locus_tag LOCUS_18610 gene pseI 46822 45776 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_18610 47821 46823 gene locus_tag LOCUS_18620 47821 46823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_18620 48921 47821 gene locus_tag LOCUS_18630 48921 47821 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307647.1 protein_id gnl|my_center|LOCUS_18630 50452 48908 gene locus_tag LOCUS_18640 50452 48908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_18640 51763 50540 gene locus_tag LOCUS_18650 51763 50540 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_18650 52481 51897 gene locus_tag LOCUS_18660 52481 51897 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_18660 54106 52496 gene locus_tag LOCUS_18670 54106 52496 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098956.1 protein_id gnl|my_center|LOCUS_18670 56683 54122 gene locus_tag LOCUS_18680 56683 54122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 57116 56715 gene locus_tag LOCUS_18690 57116 56715 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_18690 58527 57127 gene locus_tag LOCUS_18700 gene atpD 58527 57127 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_18700 59413 58544 gene locus_tag LOCUS_18710 gene atpG 59413 58544 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_18710 60962 59457 gene locus_tag LOCUS_18720 gene atpA 60962 59457 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_18720 61534 60989 gene locus_tag LOCUS_18730 61534 60989 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 protein_id gnl|my_center|LOCUS_18730 62043 61522 gene locus_tag LOCUS_18740 62043 61522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 62344 62090 gene locus_tag LOCUS_18750 gene atpE 62344 62090 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_18750 63122 62397 gene locus_tag LOCUS_18760 63122 62397 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_18760 63603 63142 gene locus_tag LOCUS_18770 63603 63142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 63880 63581 gene locus_tag LOCUS_18780 63880 63581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 64033 64506 gene locus_tag LOCUS_18790 64033 64506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 66163 64586 gene locus_tag LOCUS_18800 66163 64586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 67502 66309 gene locus_tag LOCUS_18810 67502 66309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 67969 67544 gene locus_tag LOCUS_18820 gene rpiB 67969 67544 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_18820 69015 67966 gene locus_tag LOCUS_18830 69015 67966 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_18830 70719 69016 gene locus_tag LOCUS_18840 70719 69016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 71334 72134 gene locus_tag LOCUS_18850 71334 72134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 72195 72971 gene locus_tag LOCUS_18860 gene pflA 72195 72971 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721912.1 protein_id gnl|my_center|LOCUS_18860 72958 73158 gene locus_tag LOCUS_18870 72958 73158 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_18870 73506 73261 gene locus_tag LOCUS_18880 73506 73261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 73725 73519 gene locus_tag LOCUS_18890 73725 73519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 75791 73752 gene locus_tag LOCUS_18900 gene pflB 75791 73752 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_18900 76046 76216 gene locus_tag LOCUS_18910 76046 76216 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_18910 77620 76274 gene locus_tag LOCUS_18920 gene dnaB 77620 76274 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_18920 78069 77620 gene locus_tag LOCUS_18930 gene rplI 78069 77620 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_18930 80126 78066 gene locus_tag LOCUS_18940 80126 78066 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_18940 80500 80237 gene locus_tag LOCUS_18950 gene rpsR 80500 80237 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_18950 80980 80531 gene locus_tag LOCUS_18960 gene ssb 80980 80531 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_18960 81304 81014 gene locus_tag LOCUS_18970 gene rpsF 81304 81014 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_18970 82198 81467 gene locus_tag LOCUS_18980 82198 81467 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082209.1 protein_id gnl|my_center|LOCUS_18980 82325 83041 gene locus_tag LOCUS_18990 82325 83041 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_18990 84783 83161 gene locus_tag LOCUS_19000 84783 83161 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_19000 85794 84865 gene locus_tag LOCUS_19010 85794 84865 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_19010 86716 85811 gene locus_tag LOCUS_19020 86716 85811 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_19020 87478 86876 gene locus_tag LOCUS_19030 gene coaE 87478 86876 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_19030 87710 87639 gene locus_tag LOCUS_t00150 87710 87639 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 87805 87732 gene locus_tag LOCUS_t00160 87805 87732 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 377 180 gene locus_tag LOCUS_19040 377 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 846 520 gene locus_tag LOCUS_19050 846 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1594 1073 gene locus_tag LOCUS_19060 1594 1073 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941194.1 protein_id gnl|my_center|LOCUS_19060 2715 1741 gene locus_tag LOCUS_19070 2715 1741 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_19070 5941 2948 gene locus_tag LOCUS_19080 5941 2948 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_19080 11018 5994 gene locus_tag LOCUS_19090 11018 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 14773 11033 gene locus_tag LOCUS_19100 14773 11033 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871043.1 protein_id gnl|my_center|LOCUS_19100 15059 14874 gene locus_tag LOCUS_19110 15059 14874 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905249.1 protein_id gnl|my_center|LOCUS_19110 16695 15328 gene locus_tag LOCUS_19120 gene rlmD 16695 15328 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_19120 17643 16699 gene locus_tag LOCUS_19130 17643 16699 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_19130 19079 17685 gene locus_tag LOCUS_19140 19079 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 19347 19093 gene locus_tag LOCUS_19150 19347 19093 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_19150 20519 19467 gene locus_tag LOCUS_19160 gene yjfF 20519 19467 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_19160 21589 20519 gene locus_tag LOCUS_19170 21589 20519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803760.1 protein_id gnl|my_center|LOCUS_19170 23087 21576 gene locus_tag LOCUS_19180 23087 21576 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_19180 24170 23169 gene locus_tag LOCUS_19190 24170 23169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_19190 24572 25615 gene locus_tag LOCUS_19200 24572 25615 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964649.1 protein_id gnl|my_center|LOCUS_19200 27111 25555 gene locus_tag LOCUS_19210 27111 25555 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_19210 28154 27123 gene locus_tag LOCUS_19220 28154 27123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_19220 29625 28144 gene locus_tag LOCUS_19230 29625 28144 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_19230 29704 30633 gene locus_tag LOCUS_19240 29704 30633 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_19240 31505 30642 gene locus_tag LOCUS_19250 31505 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 32179 31505 gene locus_tag LOCUS_19260 32179 31505 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_19260 32868 32176 gene locus_tag LOCUS_19270 32868 32176 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_19270 34382 32853 gene locus_tag LOCUS_19280 34382 32853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 36954 34366 gene locus_tag LOCUS_19290 36954 34366 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387314.1 protein_id gnl|my_center|LOCUS_19290 37388 36954 gene locus_tag LOCUS_19300 gene aroQ 37388 36954 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_19300 38655 37369 gene locus_tag LOCUS_19310 38655 37369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 39727 38645 gene locus_tag LOCUS_19320 gene aroC 39727 38645 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_19320 40998 39745 gene locus_tag LOCUS_19330 gene aroA 40998 39745 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_19330 42043 40988 gene locus_tag LOCUS_19340 gene aroB 42043 40988 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893310.1 protein_id gnl|my_center|LOCUS_19340 43093 42065 gene locus_tag LOCUS_19350 43093 42065 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_19350 43963 43109 gene locus_tag LOCUS_19360 43963 43109 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_19360 45829 44120 gene locus_tag LOCUS_19370 45829 44120 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_19370 46732 45971 gene locus_tag LOCUS_19380 46732 45971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 47276 46719 gene locus_tag LOCUS_19390 47276 46719 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391659.1 protein_id gnl|my_center|LOCUS_19390 47980 47339 gene locus_tag LOCUS_19400 gene trmB 47980 47339 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_19400 48071 49471 gene locus_tag LOCUS_19410 48071 49471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 49517 49592 gene locus_tag LOCUS_t00170 49517 49592 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49729 50295 gene locus_tag LOCUS_19420 49729 50295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 51068 50400 gene locus_tag LOCUS_19430 51068 50400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 51291 52370 gene locus_tag LOCUS_19440 51291 52370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 53271 52459 gene locus_tag LOCUS_19450 53271 52459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 53814 53338 gene locus_tag LOCUS_19460 gene ybaK 53814 53338 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_19460 54531 53881 gene locus_tag LOCUS_19470 54531 53881 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582836.1 protein_id gnl|my_center|LOCUS_19470 55452 54538 gene locus_tag LOCUS_19480 55452 54538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 55744 55475 gene locus_tag LOCUS_19490 55744 55475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 56651 55764 gene locus_tag LOCUS_19500 56651 55764 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_19500 57180 56737 gene locus_tag LOCUS_19510 57180 56737 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_19510 58156 57188 gene locus_tag LOCUS_19520 58156 57188 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192131.1 protein_id gnl|my_center|LOCUS_19520 59190 58156 gene locus_tag LOCUS_19530 59190 58156 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_19530 60969 59200 gene locus_tag LOCUS_19540 60969 59200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 61419 60991 gene locus_tag LOCUS_19550 gene fabZ 61419 60991 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_19550 62685 61450 gene locus_tag LOCUS_19560 gene fabF 62685 61450 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_19560 63437 62682 gene locus_tag LOCUS_19570 gene fabG 63437 62682 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_19570 64378 63461 gene locus_tag LOCUS_19580 gene fabD 64378 63461 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_19580 65303 64371 gene locus_tag LOCUS_19590 gene fabK 65303 64371 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_19590 65627 65403 gene locus_tag LOCUS_19600 gene acpP 65627 65403 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 protein_id gnl|my_center|LOCUS_19600 65936 66523 gene locus_tag LOCUS_19610 65936 66523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 67396 66533 gene locus_tag LOCUS_19620 67396 66533 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_19620 67518 68639 gene locus_tag LOCUS_19630 67518 68639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 68654 69931 gene locus_tag LOCUS_19640 gene galK 68654 69931 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_19640 69995 70945 gene locus_tag LOCUS_19650 69995 70945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 70967 71737 gene locus_tag LOCUS_19660 70967 71737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 71808 72029 gene locus_tag LOCUS_19670 71808 72029 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775256.1 protein_id gnl|my_center|LOCUS_19670 72030 72293 gene locus_tag LOCUS_19680 72030 72293 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389879.1 protein_id gnl|my_center|LOCUS_19680 72386 72742 gene locus_tag LOCUS_19690 72386 72742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 74188 73217 gene locus_tag LOCUS_19700 74188 73217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 74401 74213 gene locus_tag LOCUS_19710 74401 74213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 74545 75222 gene locus_tag LOCUS_19720 74545 75222 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence15 177 1829 gene locus_tag LOCUS_19730 177 1829 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_19730 2296 2505 gene locus_tag LOCUS_19740 2296 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2681 3121 gene locus_tag LOCUS_19750 2681 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3631 4068 gene locus_tag LOCUS_19760 3631 4068 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_19760 4251 5453 gene locus_tag LOCUS_19770 4251 5453 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_19770 5544 6746 gene locus_tag LOCUS_19780 5544 6746 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_19780 6887 8206 gene locus_tag LOCUS_19790 6887 8206 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_19790 8688 8245 gene locus_tag LOCUS_19800 8688 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8907 9518 gene locus_tag LOCUS_19810 8907 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 9637 11271 gene locus_tag LOCUS_19820 9637 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 11274 12215 gene locus_tag LOCUS_19830 11274 12215 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_19830 12269 14122 gene locus_tag LOCUS_19840 12269 14122 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_19840 14148 17429 gene locus_tag LOCUS_19850 14148 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 17472 18596 gene locus_tag LOCUS_19860 gene glf 17472 18596 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_19860 18593 20605 gene locus_tag LOCUS_19870 18593 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 20831 20950 gene locus_tag LOCUS_19880 20831 20950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 21157 22251 gene locus_tag LOCUS_19890 21157 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 22252 22980 gene locus_tag LOCUS_19900 22252 22980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 23043 24575 gene locus_tag LOCUS_19910 23043 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 24579 25706 gene locus_tag LOCUS_19920 24579 25706 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568758.1 protein_id gnl|my_center|LOCUS_19920 26700 25660 gene locus_tag LOCUS_19930 26700 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 27026 27700 gene locus_tag LOCUS_19940 27026 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 27890 27690 gene locus_tag LOCUS_19950 27890 27690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 28263 27949 gene locus_tag LOCUS_19960 28263 27949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 28394 28654 gene locus_tag LOCUS_19970 28394 28654 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_19970 28644 29282 gene locus_tag LOCUS_19980 28644 29282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 30248 29361 gene locus_tag LOCUS_19990 30248 29361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 30847 30311 gene locus_tag LOCUS_20000 gene cyaB 30847 30311 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869738.1 protein_id gnl|my_center|LOCUS_20000 31362 31643 gene locus_tag LOCUS_20010 31362 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 31980 32486 gene locus_tag LOCUS_20020 31980 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 32629 34083 gene locus_tag LOCUS_20030 gene guaB 32629 34083 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_20030 34104 36782 gene locus_tag LOCUS_20040 34104 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 36835 37701 gene locus_tag LOCUS_20050 36835 37701 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948004.1 protein_id gnl|my_center|LOCUS_20050 37701 38630 gene locus_tag LOCUS_20060 37701 38630 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_20060 39087 38725 gene locus_tag LOCUS_20070 39087 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 39274 39876 gene locus_tag LOCUS_20080 39274 39876 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460086.1 protein_id gnl|my_center|LOCUS_20080 40029 40766 gene locus_tag LOCUS_20090 40029 40766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 40759 42123 gene locus_tag LOCUS_20100 40759 42123 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_20100 42195 43250 gene locus_tag LOCUS_20110 42195 43250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 43256 44335 gene locus_tag LOCUS_20120 43256 44335 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_20120 44348 44581 gene locus_tag LOCUS_20130 44348 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 44635 45009 gene locus_tag LOCUS_20140 44635 45009 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_20140 45025 46833 gene locus_tag LOCUS_20150 45025 46833 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_20150 46834 50244 gene locus_tag LOCUS_20160 gene addB 46834 50244 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_20160 50260 53805 gene locus_tag LOCUS_20170 gene addA 50260 53805 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_20170 53861 54103 gene locus_tag LOCUS_20180 53861 54103 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_20180 54325 55653 gene locus_tag LOCUS_20190 54325 55653 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_20190 55655 56794 gene locus_tag LOCUS_20200 55655 56794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 56813 58366 gene locus_tag LOCUS_20210 gene malQ 56813 58366 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_20210 58404 60017 gene locus_tag LOCUS_20220 gene ptsP 58404 60017 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048342.1 protein_id gnl|my_center|LOCUS_20220 60109 60579 gene locus_tag LOCUS_20230 60109 60579 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_20230 60664 62211 gene locus_tag LOCUS_20240 60664 62211 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_20240 62273 62566 gene locus_tag LOCUS_20250 gene gatC 62273 62566 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_20250 62587 64065 gene locus_tag LOCUS_20260 gene gatA 62587 64065 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027919.1 protein_id gnl|my_center|LOCUS_20260 64067 65497 gene locus_tag LOCUS_20270 gene gatB 64067 65497 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_20270 65533 67221 gene locus_tag LOCUS_20280 65533 67221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 67218 67781 gene locus_tag LOCUS_20290 gene ispF 67218 67781 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947931.1 protein_id gnl|my_center|LOCUS_20290 67872 69284 gene locus_tag LOCUS_20300 67872 69284 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_20300 69269 69694 gene locus_tag LOCUS_20310 69269 69694 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_20310 69705 70439 gene locus_tag LOCUS_20320 gene rlmB 69705 70439 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_20320 70442 72253 gene locus_tag LOCUS_20330 70442 72253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 72253 72828 gene locus_tag LOCUS_20340 gene sigH 72253 72828 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence16 383 2641 gene locus_tag LOCUS_20350 383 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 4622 2760 gene locus_tag LOCUS_20360 4622 2760 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_20360 5346 6431 gene locus_tag LOCUS_20370 5346 6431 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_20370 6479 8380 gene locus_tag LOCUS_20380 6479 8380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 8551 8471 gene locus_tag LOCUS_t00180 8551 8471 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10566 9196 gene locus_tag LOCUS_20390 10566 9196 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_20390 10984 12336 gene locus_tag LOCUS_20400 10984 12336 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_20400 12390 13205 gene locus_tag LOCUS_20410 12390 13205 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109300.1 protein_id gnl|my_center|LOCUS_20410 13892 13311 gene locus_tag LOCUS_20420 13892 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 14352 15167 gene locus_tag LOCUS_20430 gene trpC 14352 15167 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966437.1 protein_id gnl|my_center|LOCUS_20430 15183 15881 gene locus_tag LOCUS_20440 15183 15881 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603742.1 protein_id gnl|my_center|LOCUS_20440 15883 17070 gene locus_tag LOCUS_20450 gene trpB 15883 17070 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 protein_id gnl|my_center|LOCUS_20450 17121 17915 gene locus_tag LOCUS_20460 gene trpA 17121 17915 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_20460 17989 19011 gene locus_tag LOCUS_20470 gene trpD 17989 19011 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_20470 19126 20595 gene locus_tag LOCUS_20480 gene trpE 19126 20595 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_20480 20616 21182 gene locus_tag LOCUS_20490 20616 21182 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636333.1 protein_id gnl|my_center|LOCUS_20490 21285 22133 gene locus_tag LOCUS_20500 21285 22133 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130548.1 protein_id gnl|my_center|LOCUS_20500 23069 22119 gene locus_tag LOCUS_20510 23069 22119 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_20510 23440 24255 gene locus_tag LOCUS_20520 23440 24255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 24342 27200 gene locus_tag LOCUS_20530 24342 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 27230 27991 gene locus_tag LOCUS_20540 27230 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 27994 28980 gene locus_tag LOCUS_20550 27994 28980 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_20550 29093 29980 gene locus_tag LOCUS_20560 29093 29980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 29995 30351 gene locus_tag LOCUS_20570 29995 30351 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_20570 30419 32731 gene locus_tag LOCUS_20580 gene glgP 30419 32731 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_20580 32805 33878 gene locus_tag LOCUS_20590 32805 33878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 33888 34649 gene locus_tag LOCUS_20600 33888 34649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 34760 37048 gene locus_tag LOCUS_20610 34760 37048 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964979.1 protein_id gnl|my_center|LOCUS_20610 37383 38693 gene locus_tag LOCUS_20620 37383 38693 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_20620 39874 38702 gene locus_tag LOCUS_20630 39874 38702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 40173 41855 gene locus_tag LOCUS_20640 40173 41855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834781.1 protein_id gnl|my_center|LOCUS_20640 41855 43750 gene locus_tag LOCUS_20650 41855 43750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_20650 43886 45472 gene locus_tag LOCUS_20660 43886 45472 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015553.1 protein_id gnl|my_center|LOCUS_20660 45472 46179 gene locus_tag LOCUS_20670 45472 46179 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_20670 46176 47465 gene locus_tag LOCUS_20680 46176 47465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_20680 47720 50302 gene locus_tag LOCUS_20690 gene clpB 47720 50302 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_20690 50361 50543 gene locus_tag LOCUS_20700 50361 50543 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_20700 50645 51961 gene locus_tag LOCUS_20710 50645 51961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 51977 53836 gene locus_tag LOCUS_20720 51977 53836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 54388 53873 gene locus_tag LOCUS_20730 54388 53873 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_20730 55457 54414 gene locus_tag LOCUS_20740 55457 54414 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004575007.1 protein_id gnl|my_center|LOCUS_20740 56700 55546 gene locus_tag LOCUS_20750 56700 55546 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_20750 57427 56690 gene locus_tag LOCUS_20760 57427 56690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 57576 57836 gene locus_tag LOCUS_20770 57576 57836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 58074 59021 gene locus_tag LOCUS_20780 gene argC 58074 59021 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_20780 59021 59476 gene locus_tag LOCUS_20790 59021 59476 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851934.1 protein_id gnl|my_center|LOCUS_20790 59526 60749 gene locus_tag LOCUS_20800 gene argJ 59526 60749 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_20800 60807 61703 gene locus_tag LOCUS_20810 gene argB 60807 61703 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864194.1 protein_id gnl|my_center|LOCUS_20810 61700 62887 gene locus_tag LOCUS_20820 61700 62887 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864195.1 protein_id gnl|my_center|LOCUS_20820 62898 64412 gene locus_tag LOCUS_20830 62898 64412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 64519 65478 gene locus_tag LOCUS_20840 64519 65478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 65494 66183 gene locus_tag LOCUS_20850 gene yycF 65494 66183 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894937.1 protein_id gnl|my_center|LOCUS_20850 66254 67564 gene locus_tag LOCUS_20860 66254 67564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 67702 68529 gene locus_tag LOCUS_20870 67702 68529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 68724 69371 gene locus_tag LOCUS_20880 68724 69371 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_20880 69400 69831 gene locus_tag LOCUS_20890 gene ohrR 69400 69831 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_20890 69972 72437 gene locus_tag LOCUS_20900 69972 72437 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939903.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence17 1392 1973 gene locus_tag LOCUS_20910 1392 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2128 12708 gene locus_tag LOCUS_20920 2128 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 14055 12763 gene locus_tag LOCUS_20930 14055 12763 CDS product PcfJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793658.1 protein_id gnl|my_center|LOCUS_20930 14541 14107 gene locus_tag LOCUS_20940 14541 14107 CDS product PcfK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793657.1 protein_id gnl|my_center|LOCUS_20940 14909 14598 gene locus_tag LOCUS_20950 14909 14598 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_20950 15544 16308 gene locus_tag LOCUS_20960 15544 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 16310 16783 gene locus_tag LOCUS_20970 16310 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 16794 17612 gene locus_tag LOCUS_20980 16794 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 17706 18005 gene locus_tag LOCUS_20990 17706 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 18114 18323 gene locus_tag LOCUS_21000 18114 18323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 18320 20815 gene locus_tag LOCUS_21010 18320 20815 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_21010 20953 21444 gene locus_tag LOCUS_21020 20953 21444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 21448 22590 gene locus_tag LOCUS_21030 21448 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 22590 23219 gene locus_tag LOCUS_21040 gene traK 22590 23219 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308760.1 protein_id gnl|my_center|LOCUS_21040 23222 23872 gene locus_tag LOCUS_21050 23222 23872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 23875 24216 gene locus_tag LOCUS_21060 23875 24216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 24200 25297 gene locus_tag LOCUS_21070 24200 25297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 25402 26406 gene locus_tag LOCUS_21080 gene traN 25402 26406 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842179.1 protein_id gnl|my_center|LOCUS_21080 26412 27251 gene locus_tag LOCUS_21090 26412 27251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 27338 27787 gene locus_tag LOCUS_21100 27338 27787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 27781 28695 gene locus_tag LOCUS_21110 27781 28695 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_21110 29228 30631 gene locus_tag LOCUS_21120 29228 30631 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_21120 30756 33368 gene locus_tag LOCUS_21130 30756 33368 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107114.1 protein_id gnl|my_center|LOCUS_21130 33376 34152 gene locus_tag LOCUS_21140 33376 34152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 34791 34444 gene locus_tag LOCUS_21150 34791 34444 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_21150 35086 35217 gene locus_tag LOCUS_21160 35086 35217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 35293 35883 gene locus_tag LOCUS_21170 35293 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 36701 35925 gene locus_tag LOCUS_21180 36701 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 37268 36774 gene locus_tag LOCUS_21190 37268 36774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 37663 37800 gene locus_tag LOCUS_21200 37663 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 38048 37872 gene locus_tag LOCUS_21210 38048 37872 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_21210 38387 38139 gene locus_tag LOCUS_21220 38387 38139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 38913 38467 gene locus_tag LOCUS_21230 38913 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 39506 39252 gene locus_tag LOCUS_21240 39506 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 40651 40217 gene locus_tag LOCUS_21250 40651 40217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 41133 40867 gene locus_tag LOCUS_21260 41133 40867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 41564 41184 gene locus_tag LOCUS_21270 41564 41184 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_21270 43007 42489 gene locus_tag LOCUS_21280 43007 42489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 43836 43324 gene locus_tag LOCUS_21290 43836 43324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 44530 44267 gene locus_tag LOCUS_21300 44530 44267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 45672 44608 gene locus_tag LOCUS_21310 45672 44608 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109637.1 protein_id gnl|my_center|LOCUS_21310 46737 46498 gene locus_tag LOCUS_21320 46737 46498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 47108 46836 gene locus_tag LOCUS_21330 47108 46836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 47696 47385 gene locus_tag LOCUS_21340 47696 47385 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_21340 48777 48610 gene locus_tag LOCUS_21350 48777 48610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 49379 48999 gene locus_tag LOCUS_21360 49379 48999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 49784 49395 gene locus_tag LOCUS_21370 49784 49395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 50303 50067 gene locus_tag LOCUS_21380 50303 50067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 50840 50325 gene locus_tag LOCUS_21390 50840 50325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 52821 51307 gene locus_tag LOCUS_21400 52821 51307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 56124 52831 gene locus_tag LOCUS_21410 56124 52831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 56795 56121 gene locus_tag LOCUS_21420 56795 56121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 58873 56816 gene locus_tag LOCUS_21430 58873 56816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 59181 58966 gene locus_tag LOCUS_21440 59181 58966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 60784 59312 gene locus_tag LOCUS_21450 60784 59312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 61070 61288 gene locus_tag LOCUS_21460 61070 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 61400 61591 gene locus_tag LOCUS_21470 61400 61591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 65245 62162 gene locus_tag LOCUS_21480 65245 62162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 65813 65415 gene locus_tag LOCUS_21490 65813 65415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 66313 66432 gene locus_tag LOCUS_21500 66313 66432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence18 <1 1933 gene locus_tag LOCUS_21510 <1 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775603.1:tetracycline resistance ribosomal protection protein Tet(O) 2646 3158 gene locus_tag LOCUS_21520 2646 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3253 3678 gene locus_tag LOCUS_21530 3253 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3762 3932 gene locus_tag LOCUS_21540 3762 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4391 5353 gene locus_tag LOCUS_21550 4391 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6779 5907 gene locus_tag LOCUS_21560 6779 5907 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642437.1 protein_id gnl|my_center|LOCUS_21560 6911 7090 gene locus_tag LOCUS_21570 6911 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7002 8120 gene locus_tag LOCUS_21580 7002 8120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_21580 8224 9009 gene locus_tag LOCUS_21590 8224 9009 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089550.1 protein_id gnl|my_center|LOCUS_21590 9028 9654 gene locus_tag LOCUS_21600 9028 9654 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_21600 9673 10545 gene locus_tag LOCUS_21610 9673 10545 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941427.1 protein_id gnl|my_center|LOCUS_21610 10571 11569 gene locus_tag LOCUS_21620 10571 11569 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_21620 11600 12385 gene locus_tag LOCUS_21630 11600 12385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488339.1 protein_id gnl|my_center|LOCUS_21630 12395 13111 gene locus_tag LOCUS_21640 12395 13111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_21640 13182 14348 gene locus_tag LOCUS_21650 13182 14348 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_21650 14366 15652 gene locus_tag LOCUS_21660 14366 15652 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_21660 15688 16680 gene locus_tag LOCUS_21670 15688 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 16737 17114 gene locus_tag LOCUS_21680 16737 17114 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_21680 17221 17526 gene locus_tag LOCUS_21690 17221 17526 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_21690 17565 18701 gene locus_tag LOCUS_21700 17565 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 18714 19208 gene locus_tag LOCUS_21710 18714 19208 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249075.1 protein_id gnl|my_center|LOCUS_21710 19221 19505 gene locus_tag LOCUS_21720 19221 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 19520 20704 gene locus_tag LOCUS_21730 19520 20704 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215235.1 protein_id gnl|my_center|LOCUS_21730 20806 21729 gene locus_tag LOCUS_21740 20806 21729 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_21740 22097 22228 gene locus_tag LOCUS_21750 22097 22228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 22463 23062 gene locus_tag LOCUS_21760 22463 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 23334 24182 gene locus_tag LOCUS_21770 23334 24182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 25097 24168 gene locus_tag LOCUS_21780 25097 24168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 25290 25442 gene locus_tag LOCUS_21790 25290 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 25624 26712 gene locus_tag LOCUS_21800 25624 26712 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016459.1 protein_id gnl|my_center|LOCUS_21800 26754 28043 gene locus_tag LOCUS_21810 26754 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 28057 29472 gene locus_tag LOCUS_21820 28057 29472 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_21820 29493 31343 gene locus_tag LOCUS_21830 29493 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 31378 33165 gene locus_tag LOCUS_21840 31378 33165 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_21840 33190 34215 gene locus_tag LOCUS_21850 33190 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 34434 35336 gene locus_tag LOCUS_21860 34434 35336 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_21860 35519 36727 gene locus_tag LOCUS_21870 35519 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 36765 37193 gene locus_tag LOCUS_21880 36765 37193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 37634 37230 gene locus_tag LOCUS_21890 37634 37230 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_21890 37824 39002 gene locus_tag LOCUS_21900 gene nifS 37824 39002 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_21900 39081 39533 gene locus_tag LOCUS_21910 gene nifU 39081 39533 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_21910 39944 40783 gene locus_tag LOCUS_21920 39944 40783 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_21920 40940 42007 gene locus_tag LOCUS_21930 40940 42007 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571207.1 protein_id gnl|my_center|LOCUS_21930 42011 42670 gene locus_tag LOCUS_21940 42011 42670 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_21940 42782 43351 gene locus_tag LOCUS_21950 42782 43351 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_21950 44131 45243 gene locus_tag LOCUS_21960 44131 45243 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_21960 45298 46575 gene locus_tag LOCUS_21970 45298 46575 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_21970 46649 48343 gene locus_tag LOCUS_21980 46649 48343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 49506 48346 gene locus_tag LOCUS_21990 49506 48346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 50352 49531 gene locus_tag LOCUS_22000 50352 49531 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_22000 51566 50445 gene locus_tag LOCUS_22010 51566 50445 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_22010 51787 52446 gene locus_tag LOCUS_22020 51787 52446 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460781.1 protein_id gnl|my_center|LOCUS_22020 52491 53270 gene locus_tag LOCUS_22030 52491 53270 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460780.1 protein_id gnl|my_center|LOCUS_22030 53327 54349 gene locus_tag LOCUS_22040 53327 54349 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_22040 54647 54940 gene locus_tag LOCUS_22050 54647 54940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 55090 56145 gene locus_tag LOCUS_22060 55090 56145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 56258 57469 gene locus_tag LOCUS_22070 56258 57469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 57492 59099 gene locus_tag LOCUS_22080 57492 59099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 59915 59100 gene locus_tag LOCUS_22090 59915 59100 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_22090 59977 60966 gene locus_tag LOCUS_22100 59977 60966 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_22100 60950 61984 gene locus_tag LOCUS_22110 60950 61984 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_22110 61981 63021 gene locus_tag LOCUS_22120 61981 63021 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_22120 63143 63604 gene locus_tag LOCUS_22130 63143 63604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 63614 65116 gene locus_tag LOCUS_22140 gene fliD 63614 65116 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860688.1 protein_id gnl|my_center|LOCUS_22140 65129 65515 gene locus_tag LOCUS_22150 gene fliS 65129 65515 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_22150 65512 65988 gene locus_tag LOCUS_22160 65512 65988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence19 127 2868 gene locus_tag LOCUS_22170 127 2868 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808183.1 protein_id gnl|my_center|LOCUS_22170 3520 2858 gene locus_tag LOCUS_22180 3520 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 4171 3533 gene locus_tag LOCUS_22190 4171 3533 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_22190 4272 5621 gene locus_tag LOCUS_22200 gene mgtE 4272 5621 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_22200 5631 6905 gene locus_tag LOCUS_22210 5631 6905 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_22210 6915 7061 gene locus_tag LOCUS_22220 6915 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 7068 8483 gene locus_tag LOCUS_22230 7068 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 8485 8988 gene locus_tag LOCUS_22240 gene greA 8485 8988 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_22240 9048 10022 gene locus_tag LOCUS_22250 9048 10022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_22250 10072 11382 gene locus_tag LOCUS_22260 10072 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 11444 11704 gene locus_tag LOCUS_22270 11444 11704 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_22270 11795 13081 gene locus_tag LOCUS_22280 gene tig 11795 13081 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_22280 13083 13676 gene locus_tag LOCUS_22290 gene clpP 13083 13676 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_22290 13677 14927 gene locus_tag LOCUS_22300 gene clpX 13677 14927 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_22300 14937 15560 gene locus_tag LOCUS_22310 gene yihA 14937 15560 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_22310 15654 15917 gene locus_tag LOCUS_22320 15654 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 15972 18659 gene locus_tag LOCUS_22330 15972 18659 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_22330 18695 19579 gene locus_tag LOCUS_22340 gene dapA 18695 19579 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_22340 19579 20334 gene locus_tag LOCUS_22350 gene dapB 19579 20334 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_22350 20408 22363 gene locus_tag LOCUS_22360 20408 22363 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_22360 22365 23138 gene locus_tag LOCUS_22370 22365 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 23454 23254 gene locus_tag LOCUS_22380 gene cspA 23454 23254 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809131.1 protein_id gnl|my_center|LOCUS_22380 23637 24359 gene locus_tag LOCUS_22390 23637 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 24761 24471 gene locus_tag LOCUS_22400 24761 24471 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_22400 25017 26228 gene locus_tag LOCUS_22410 25017 26228 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_22410 26300 27013 gene locus_tag LOCUS_22420 26300 27013 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949129.1 protein_id gnl|my_center|LOCUS_22420 28755 27118 gene locus_tag LOCUS_22430 28755 27118 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_22430 28908 30245 gene locus_tag LOCUS_22440 28908 30245 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_22440 30370 31479 gene locus_tag LOCUS_22450 30370 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384883.1 protein_id gnl|my_center|LOCUS_22450 31555 32307 gene locus_tag LOCUS_22460 31555 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 32357 34639 gene locus_tag LOCUS_22470 gene pcrA 32357 34639 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_22470 34723 35103 gene locus_tag LOCUS_22480 34723 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 35154 36650 gene locus_tag LOCUS_22490 gene rlmD 35154 36650 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_22490 36730 38181 gene locus_tag LOCUS_22500 36730 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 38194 38466 gene locus_tag LOCUS_22510 38194 38466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 38488 39741 gene locus_tag LOCUS_22520 38488 39741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 39774 40112 gene locus_tag LOCUS_22530 39774 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 40115 40582 gene locus_tag LOCUS_22540 40115 40582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_22540 40968 42239 gene locus_tag LOCUS_22550 40968 42239 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_22550 42382 42726 gene locus_tag LOCUS_22560 42382 42726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127478.1 protein_id gnl|my_center|LOCUS_22560 42803 44149 gene locus_tag LOCUS_22570 42803 44149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 44219 45328 gene locus_tag LOCUS_22580 44219 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 45534 45920 gene locus_tag LOCUS_22590 45534 45920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 45920 46453 gene locus_tag LOCUS_22600 45920 46453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 46785 47447 gene locus_tag LOCUS_22610 46785 47447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 47447 47908 gene locus_tag LOCUS_22620 47447 47908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 47905 48321 gene locus_tag LOCUS_22630 47905 48321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 48407 49375 gene locus_tag LOCUS_22640 48407 49375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 49663 50073 gene locus_tag LOCUS_22650 49663 50073 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_22650 50083 50304 gene locus_tag LOCUS_22660 50083 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence20 2102 132 gene locus_tag LOCUS_22670 2102 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3097 2258 gene locus_tag LOCUS_22680 3097 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 5134 3437 gene locus_tag LOCUS_22690 5134 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 6820 5174 gene locus_tag LOCUS_22700 6820 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 7583 6960 gene locus_tag LOCUS_22710 7583 6960 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965899.1 protein_id gnl|my_center|LOCUS_22710 9364 7754 gene locus_tag LOCUS_22720 9364 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 10070 9354 gene locus_tag LOCUS_22730 10070 9354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_22730 10411 10070 gene locus_tag LOCUS_22740 10411 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 10793 10425 gene locus_tag LOCUS_22750 10793 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 11800 10817 gene locus_tag LOCUS_22760 gene dprA 11800 10817 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_22760 13305 11770 gene locus_tag LOCUS_22770 13305 11770 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_22770 14730 13669 gene locus_tag LOCUS_22780 14730 13669 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_22780 15752 14736 gene locus_tag LOCUS_22790 15752 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 17070 15835 gene locus_tag LOCUS_22800 gene hemW 17070 15835 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_22800 18874 17060 gene locus_tag LOCUS_22810 gene lepA 18874 17060 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_22810 19218 18955 gene locus_tag LOCUS_22820 gene rpsT 19218 18955 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_22820 19994 19395 gene locus_tag LOCUS_22830 19994 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 22206 20542 gene locus_tag LOCUS_22840 22206 20542 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_22840 22998 22225 gene locus_tag LOCUS_22850 22998 22225 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047989.1 protein_id gnl|my_center|LOCUS_22850 24377 22998 gene locus_tag LOCUS_22860 gene rpoD 24377 22998 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_22860 26156 24378 gene locus_tag LOCUS_22870 gene dnaG 26156 24378 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_22870 27246 26242 gene locus_tag LOCUS_22880 27246 26242 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_22880 28503 27370 gene locus_tag LOCUS_22890 28503 27370 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016934.1 protein_id gnl|my_center|LOCUS_22890 29578 28523 gene locus_tag LOCUS_22900 29578 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 29741 29656 gene locus_tag LOCUS_t00190 29741 29656 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30001 30924 gene locus_tag LOCUS_22910 30001 30924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 31028 31846 gene locus_tag LOCUS_22920 31028 31846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 31925 32674 gene locus_tag LOCUS_22930 31925 32674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 32721 33821 gene locus_tag LOCUS_22940 32721 33821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_22940 33890 34714 gene locus_tag LOCUS_22950 33890 34714 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_22950 34728 35603 gene locus_tag LOCUS_22960 34728 35603 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_22960 35603 37189 gene locus_tag LOCUS_22970 35603 37189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_22970 37323 38054 gene locus_tag LOCUS_22980 37323 38054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 39137 38181 gene locus_tag LOCUS_22990 39137 38181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 40257 39178 gene locus_tag LOCUS_23000 40257 39178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 41146 40307 gene locus_tag LOCUS_23010 41146 40307 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_23010 42554 41283 gene locus_tag LOCUS_23020 42554 41283 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106084.1 protein_id gnl|my_center|LOCUS_23020 44732 42693 gene locus_tag LOCUS_23030 44732 42693 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_23030 45413 44862 gene locus_tag LOCUS_23040 45413 44862 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_23040 46642 45425 gene locus_tag LOCUS_23050 46642 45425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 47997 46642 gene locus_tag LOCUS_23060 47997 46642 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence21 567 1307 gene locus_tag LOCUS_23070 567 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1738 2454 gene locus_tag LOCUS_23080 1738 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2489 2920 gene locus_tag LOCUS_23090 2489 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 3925 5289 gene locus_tag LOCUS_23100 3925 5289 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_23100 5336 5746 gene locus_tag LOCUS_23110 5336 5746 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_23110 6006 6704 gene locus_tag LOCUS_23120 6006 6704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 protein_id gnl|my_center|LOCUS_23120 6719 8971 gene locus_tag LOCUS_23130 6719 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 9000 10925 gene locus_tag LOCUS_23140 9000 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11325 12347 gene locus_tag LOCUS_23150 gene trpD 11325 12347 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_23150 12366 13733 gene locus_tag LOCUS_23160 12366 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 13751 14656 gene locus_tag LOCUS_23170 13751 14656 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_23170 14671 17787 gene locus_tag LOCUS_23180 gene lacZ 14671 17787 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177898.1 protein_id gnl|my_center|LOCUS_23180 18149 19627 gene locus_tag LOCUS_23190 18149 19627 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_23190 19643 20539 gene locus_tag LOCUS_23200 gene speE 19643 20539 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_23200 20576 21835 gene locus_tag LOCUS_23210 20576 21835 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_23210 21865 23022 gene locus_tag LOCUS_23220 gene nspC 21865 23022 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_23220 23041 24204 gene locus_tag LOCUS_23230 gene aguA 23041 24204 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_23230 24256 25125 gene locus_tag LOCUS_23240 gene aguB 24256 25125 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_23240 25259 26437 gene locus_tag LOCUS_23250 25259 26437 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_23250 26548 27741 gene locus_tag LOCUS_23260 26548 27741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 27731 28390 gene locus_tag LOCUS_23270 27731 28390 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102032.1 protein_id gnl|my_center|LOCUS_23270 28436 30445 gene locus_tag LOCUS_23280 28436 30445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 30524 31717 gene locus_tag LOCUS_23290 30524 31717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 31987 33498 gene locus_tag LOCUS_23300 31987 33498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 33838 33503 gene locus_tag LOCUS_23310 33838 33503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 33928 35274 gene locus_tag LOCUS_23320 33928 35274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 35330 36817 gene locus_tag LOCUS_23330 35330 36817 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_23330 36827 37402 gene locus_tag LOCUS_23340 36827 37402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 37519 37881 gene locus_tag LOCUS_23350 37519 37881 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_23350 37865 38647 gene locus_tag LOCUS_23360 37865 38647 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_23360 38647 39273 gene locus_tag LOCUS_23370 38647 39273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 39263 39772 gene locus_tag LOCUS_23380 39263 39772 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_23380 39721 39906 gene locus_tag LOCUS_23390 39721 39906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 40065 41618 gene locus_tag LOCUS_23400 40065 41618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence22 353 733 gene locus_tag LOCUS_23410 353 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 765 2156 gene locus_tag LOCUS_23420 765 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2146 3387 gene locus_tag LOCUS_23430 2146 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3461 4765 gene locus_tag LOCUS_23440 3461 4765 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_23440 4790 5263 gene locus_tag LOCUS_23450 4790 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5824 5405 gene locus_tag LOCUS_23460 5824 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6025 7107 gene locus_tag LOCUS_23470 6025 7107 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_23470 7136 7309 gene locus_tag LOCUS_23480 7136 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 7338 8348 gene locus_tag LOCUS_23490 7338 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8420 9010 gene locus_tag LOCUS_23500 8420 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 9028 10326 gene locus_tag LOCUS_23510 9028 10326 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896806.1 protein_id gnl|my_center|LOCUS_23510 10551 11102 gene locus_tag LOCUS_23520 10551 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 11181 12536 gene locus_tag LOCUS_23530 11181 12536 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_23530 12612 13517 gene locus_tag LOCUS_23540 12612 13517 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_23540 13519 14403 gene locus_tag LOCUS_23550 13519 14403 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 protein_id gnl|my_center|LOCUS_23550 14574 16361 gene locus_tag LOCUS_23560 14574 16361 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_23560 16354 17097 gene locus_tag LOCUS_23570 16354 17097 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_23570 17112 18464 gene locus_tag LOCUS_23580 17112 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 18451 19404 gene locus_tag LOCUS_23590 18451 19404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 19488 20189 gene locus_tag LOCUS_23600 19488 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 20220 21593 gene locus_tag LOCUS_23610 20220 21593 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_23610 21596 22051 gene locus_tag LOCUS_23620 21596 22051 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_23620 22084 23250 gene locus_tag LOCUS_23630 22084 23250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 23271 24881 gene locus_tag LOCUS_23640 23271 24881 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_23640 24893 25570 gene locus_tag LOCUS_23650 24893 25570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 25610 26104 gene locus_tag LOCUS_23660 gene folA 25610 26104 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459612.1 protein_id gnl|my_center|LOCUS_23660 26235 27266 gene locus_tag LOCUS_23670 26235 27266 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_23670 27346 29103 gene locus_tag LOCUS_23680 gene iorA 27346 29103 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_23680 29117 29686 gene locus_tag LOCUS_23690 29117 29686 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430806.1 protein_id gnl|my_center|LOCUS_23690 29837 30403 gene locus_tag LOCUS_23700 29837 30403 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_23700 30441 32204 gene locus_tag LOCUS_23710 gene argS 30441 32204 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_23710 32364 33167 gene locus_tag LOCUS_23720 32364 33167 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_23720 33297 33758 gene locus_tag LOCUS_23730 33297 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 33774 34745 gene locus_tag LOCUS_23740 33774 34745 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_23740 34879 35370 gene locus_tag LOCUS_23750 34879 35370 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_23750 35373 38132 gene locus_tag LOCUS_23760 35373 38132 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_23760 38203 38276 gene locus_tag LOCUS_t00200 38203 38276 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 78 446 gene locus_tag LOCUS_23770 gene rplR 78 446 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583361.1 protein_id gnl|my_center|LOCUS_23770 462 971 gene locus_tag LOCUS_23780 gene rpsE 462 971 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_23780 985 1170 gene locus_tag LOCUS_23790 gene rpmD 985 1170 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 protein_id gnl|my_center|LOCUS_23790 1182 1622 gene locus_tag LOCUS_23800 gene rplO 1182 1622 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_23800 1624 2961 gene locus_tag LOCUS_23810 gene secY 1624 2961 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869909.1 protein_id gnl|my_center|LOCUS_23810 3046 3687 gene locus_tag LOCUS_23820 3046 3687 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_23820 3697 4455 gene locus_tag LOCUS_23830 gene map 3697 4455 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_23830 4474 4692 gene locus_tag LOCUS_23840 gene infA 4474 4692 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_23840 5034 5402 gene locus_tag LOCUS_23850 gene rpsM 5034 5402 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_23850 5459 5863 gene locus_tag LOCUS_23860 gene rpsK 5459 5863 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_23860 5942 6535 gene locus_tag LOCUS_23870 gene rpsD 5942 6535 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_23870 6561 7520 gene locus_tag LOCUS_23880 6561 7520 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_23880 7662 8198 gene locus_tag LOCUS_23890 gene rplQ 7662 8198 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_23890 8513 8349 gene locus_tag LOCUS_23900 8513 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 9448 11220 gene locus_tag LOCUS_23910 9448 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 11277 14072 gene locus_tag LOCUS_23920 11277 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 14254 16263 gene locus_tag LOCUS_23930 14254 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 16280 17128 gene locus_tag LOCUS_23940 16280 17128 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_23940 17113 17964 gene locus_tag LOCUS_23950 17113 17964 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_23950 18020 18832 gene locus_tag LOCUS_23960 18020 18832 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_23960 19657 18854 gene locus_tag LOCUS_23970 gene truA 19657 18854 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_23970 19974 20402 gene locus_tag LOCUS_23980 gene rplM 19974 20402 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_23980 20418 20816 gene locus_tag LOCUS_23990 gene rpsI 20418 20816 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_23990 21061 21216 gene locus_tag LOCUS_24000 21061 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 21341 21811 gene locus_tag LOCUS_24010 21341 21811 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_24010 21822 22352 gene locus_tag LOCUS_24020 21822 22352 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_24020 22396 22833 gene locus_tag LOCUS_24030 22396 22833 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_24030 22873 23448 gene locus_tag LOCUS_24040 22873 23448 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247747.1 protein_id gnl|my_center|LOCUS_24040 23485 24282 gene locus_tag LOCUS_24050 23485 24282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 24311 24766 gene locus_tag LOCUS_24060 24311 24766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459496.1 protein_id gnl|my_center|LOCUS_24060 24935 25783 gene locus_tag LOCUS_24070 24935 25783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621679.1 protein_id gnl|my_center|LOCUS_24070 25784 26470 gene locus_tag LOCUS_24080 25784 26470 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919280.1 protein_id gnl|my_center|LOCUS_24080 26471 26911 gene locus_tag LOCUS_24090 26471 26911 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437661.1 protein_id gnl|my_center|LOCUS_24090 26911 27393 gene locus_tag LOCUS_24100 26911 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 28018 28782 gene locus_tag LOCUS_24110 28018 28782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657419.1 protein_id gnl|my_center|LOCUS_24110 28787 29857 gene locus_tag LOCUS_24120 28787 29857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 29861 31015 gene locus_tag LOCUS_24130 29861 31015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963496.1 protein_id gnl|my_center|LOCUS_24130 31046 32206 gene locus_tag LOCUS_24140 31046 32206 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397664.1 protein_id gnl|my_center|LOCUS_24140 32193 32831 gene locus_tag LOCUS_24150 32193 32831 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694102.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence24 920 2644 gene locus_tag LOCUS_24160 920 2644 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_24160 2997 2689 gene locus_tag LOCUS_24170 2997 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3191 4843 gene locus_tag LOCUS_24180 3191 4843 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_24180 4863 5684 gene locus_tag LOCUS_24190 4863 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 5713 7422 gene locus_tag LOCUS_24200 5713 7422 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_24200 7511 7993 gene locus_tag LOCUS_24210 7511 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 8244 10121 gene locus_tag LOCUS_24220 8244 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 10132 10263 gene locus_tag LOCUS_24230 10132 10263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 10420 12534 gene locus_tag LOCUS_24240 10420 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 12655 13656 gene locus_tag LOCUS_24250 12655 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 13688 15754 gene locus_tag LOCUS_24260 13688 15754 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_24260 16023 16739 gene locus_tag LOCUS_24270 16023 16739 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948727.1 protein_id gnl|my_center|LOCUS_24270 16750 18069 gene locus_tag LOCUS_24280 16750 18069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 18253 20421 gene locus_tag LOCUS_24290 18253 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 20491 22605 gene locus_tag LOCUS_24300 20491 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 22687 23343 gene locus_tag LOCUS_24310 22687 23343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 23336 24304 gene locus_tag LOCUS_24320 23336 24304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 24474 26156 gene locus_tag LOCUS_24330 24474 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 26219 27334 gene locus_tag LOCUS_24340 26219 27334 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_24340 27478 28911 gene locus_tag LOCUS_24350 27478 28911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 29285 29491 gene locus_tag LOCUS_24360 29285 29491 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966013.1 protein_id gnl|my_center|LOCUS_24360 29601 32237 gene locus_tag LOCUS_24370 29601 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 32570 32307 gene locus_tag LOCUS_24380 32570 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 >Feature sequence25 204 1640 gene locus_tag LOCUS_24390 204 1640 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_24390 1773 2354 gene locus_tag LOCUS_24400 1773 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_24400 3026 3679 gene locus_tag LOCUS_24410 gene upp 3026 3679 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515974.1 protein_id gnl|my_center|LOCUS_24410 3890 6685 gene locus_tag LOCUS_24420 3890 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 6688 7248 gene locus_tag LOCUS_24430 6688 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 7251 7673 gene locus_tag LOCUS_24440 7251 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 7674 8021 gene locus_tag LOCUS_24450 7674 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 8018 8362 gene locus_tag LOCUS_24460 8018 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 8362 9282 gene locus_tag LOCUS_24470 8362 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 9348 9719 gene locus_tag LOCUS_24480 9348 9719 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_24480 9720 11291 gene locus_tag LOCUS_24490 9720 11291 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_24490 11291 12751 gene locus_tag LOCUS_24500 11291 12751 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_24500 12745 14289 gene locus_tag LOCUS_24510 12745 14289 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545971.1 protein_id gnl|my_center|LOCUS_24510 14440 16296 gene locus_tag LOCUS_24520 14440 16296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 16612 17055 gene locus_tag LOCUS_24530 16612 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 18070 18549 gene locus_tag LOCUS_24540 18070 18549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 18962 18552 gene locus_tag LOCUS_24550 18962 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 19863 19105 gene locus_tag LOCUS_24560 19863 19105 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_24560 20962 20003 gene locus_tag LOCUS_24570 gene ispE 20962 20003 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_24570 21316 21921 gene locus_tag LOCUS_24580 21316 21921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 22899 24038 gene locus_tag LOCUS_24590 22899 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 24028 25284 gene locus_tag LOCUS_24600 24028 25284 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947929.1 protein_id gnl|my_center|LOCUS_24600 25386 26816 gene locus_tag LOCUS_24610 25386 26816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 26825 28663 gene locus_tag LOCUS_24620 26825 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 28664 31165 gene locus_tag LOCUS_24630 28664 31165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 31691 31203 gene locus_tag LOCUS_24640 31691 31203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence26 63 785 gene locus_tag LOCUS_24650 63 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 788 1246 gene locus_tag LOCUS_24660 788 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1576 2394 gene locus_tag LOCUS_24670 1576 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 2509 3726 gene locus_tag LOCUS_24680 2509 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3848 4018 gene locus_tag LOCUS_24690 3848 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4553 4068 gene locus_tag LOCUS_24700 4553 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 5154 4546 gene locus_tag LOCUS_24710 5154 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 5842 5141 gene locus_tag LOCUS_24720 5842 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 7507 6419 gene locus_tag LOCUS_24730 7507 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 8616 8287 gene locus_tag LOCUS_24740 8616 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 9392 10462 gene locus_tag LOCUS_24750 9392 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 10630 11049 gene locus_tag LOCUS_24760 10630 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 11071 11313 gene locus_tag LOCUS_24770 11071 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_24770 11946 11434 gene locus_tag LOCUS_24780 11946 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 12770 12606 gene locus_tag LOCUS_24790 12770 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 12961 15618 gene locus_tag LOCUS_24800 12961 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 18528 16705 gene locus_tag LOCUS_24810 18528 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 19112 18525 gene locus_tag LOCUS_24820 19112 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 20652 19099 gene locus_tag LOCUS_24830 20652 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 21217 21843 gene locus_tag LOCUS_24840 21217 21843 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_24840 21882 22142 gene locus_tag LOCUS_24850 21882 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 23674 22553 gene locus_tag LOCUS_24860 23674 22553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 23981 23658 gene locus_tag LOCUS_24870 23981 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 25033 24527 gene locus_tag LOCUS_24880 25033 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 25676 25035 gene locus_tag LOCUS_24890 25676 25035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 26540 25980 gene locus_tag LOCUS_24900 26540 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 <27385 26530 gene locus_tag LOCUS_24910 <27385 26530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957128.1:RHS repeat-associated core domain-containing protein >Feature sequence27 1059 283 gene locus_tag LOCUS_24920 1059 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2470 1100 gene locus_tag LOCUS_24930 2470 1100 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_24930 3707 2733 gene locus_tag LOCUS_24940 3707 2733 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_24940 4563 3895 gene locus_tag LOCUS_24950 4563 3895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_24950 5889 4720 gene locus_tag LOCUS_24960 gene gguB 5889 4720 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_24960 7064 5904 gene locus_tag LOCUS_24970 gene gguB 7064 5904 CDS product sugar ABC transporter permease GguB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311699.1 protein_id gnl|my_center|LOCUS_24970 8604 7066 gene locus_tag LOCUS_24980 gene gguA 8604 7066 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533633.1 protein_id gnl|my_center|LOCUS_24980 9833 8694 gene locus_tag LOCUS_24990 gene chvE 9833 8694 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_24990 11105 10056 gene locus_tag LOCUS_25000 gene xylF 11105 10056 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_25000 12703 11108 gene locus_tag LOCUS_25010 12703 11108 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_25010 14186 12696 gene locus_tag LOCUS_25020 14186 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 15234 14179 gene locus_tag LOCUS_25030 15234 14179 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082691.1 protein_id gnl|my_center|LOCUS_25030 15816 15247 gene locus_tag LOCUS_25040 15816 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 16221 15882 gene locus_tag LOCUS_tm00010 16221 15882 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 16713 16246 gene locus_tag LOCUS_25050 gene smpB 16713 16246 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_25050 18665 16716 gene locus_tag LOCUS_25060 gene rnr 18665 16716 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_25060 18969 18727 gene locus_tag LOCUS_25070 gene secG 18969 18727 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556760.1 protein_id gnl|my_center|LOCUS_25070 20371 19034 gene locus_tag LOCUS_25080 20371 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 20436 22241 gene locus_tag LOCUS_25090 20436 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 23550 22348 gene locus_tag LOCUS_25100 23550 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 24193 23543 gene locus_tag LOCUS_25110 24193 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence28 9478 8234 gene locus_tag LOCUS_25120 9478 8234 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_25120 14765 9819 gene locus_tag LOCUS_25130 14765 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 17238 14854 gene locus_tag LOCUS_25140 17238 14854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 19946 17313 gene locus_tag LOCUS_25150 19946 17313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 21975 19933 gene locus_tag LOCUS_25160 21975 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 23227 22070 gene locus_tag LOCUS_25170 23227 22070 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777415.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence29 261 599 gene locus_tag LOCUS_25180 261 599 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_25180 574 1155 gene locus_tag LOCUS_25190 574 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1224 2174 gene locus_tag LOCUS_25200 1224 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3224 2187 gene locus_tag LOCUS_25210 3224 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 4715 3285 gene locus_tag LOCUS_25220 4715 3285 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272612.1 protein_id gnl|my_center|LOCUS_25220 6265 4814 gene locus_tag LOCUS_25230 6265 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 6993 6265 gene locus_tag LOCUS_25240 gene cobJ 6993 6265 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903755.1 protein_id gnl|my_center|LOCUS_25240 8029 7022 gene locus_tag LOCUS_25250 gene cbiG 8029 7022 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_25250 8805 8026 gene locus_tag LOCUS_25260 gene cobM 8805 8026 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_25260 9919 8798 gene locus_tag LOCUS_25270 gene cbiD 9919 8798 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_25270 11645 9912 gene locus_tag LOCUS_25280 11645 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 12645 11656 gene locus_tag LOCUS_25290 gene cbiB 12645 11656 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_25290 13222 12620 gene locus_tag LOCUS_25300 gene cobC 13222 12620 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 protein_id gnl|my_center|LOCUS_25300 14018 13224 gene locus_tag LOCUS_25310 gene cobS 14018 13224 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989692.1 protein_id gnl|my_center|LOCUS_25310 14541 14005 gene locus_tag LOCUS_25320 gene cobU 14541 14005 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948598.1 protein_id gnl|my_center|LOCUS_25320 15614 14541 gene locus_tag LOCUS_25330 gene cobT 15614 14541 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_25330 17974 15614 gene locus_tag LOCUS_25340 17974 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 18909 17983 gene locus_tag LOCUS_25350 18909 17983 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_25350 20960 18984 gene locus_tag LOCUS_25360 20960 18984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 22240 20963 gene locus_tag LOCUS_25370 22240 20963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 22502 22353 gene locus_tag LOCUS_25380 22502 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 22683 22612 gene locus_tag LOCUS_t00210 22683 22612 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence30 31 618 gene locus_tag LOCUS_25390 31 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 751 1281 gene locus_tag LOCUS_25400 751 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 1303 1578 gene locus_tag LOCUS_25410 1303 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1579 3333 gene locus_tag LOCUS_25420 1579 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3361 4473 gene locus_tag LOCUS_25430 3361 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4673 6499 gene locus_tag LOCUS_25440 4673 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 6535 7221 gene locus_tag LOCUS_25450 6535 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 7250 8641 gene locus_tag LOCUS_25460 7250 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 8744 10117 gene locus_tag LOCUS_25470 8744 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 10120 13056 gene locus_tag LOCUS_25480 10120 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 13088 13678 gene locus_tag LOCUS_25490 13088 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 13678 13971 gene locus_tag LOCUS_25500 13678 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 13976 15310 gene locus_tag LOCUS_25510 13976 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 15322 15510 gene locus_tag LOCUS_25520 15322 15510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 15530 15703 gene locus_tag LOCUS_25530 15530 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 15779 16120 gene locus_tag LOCUS_25540 15779 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 16117 17058 gene locus_tag LOCUS_25550 16117 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 17071 17310 gene locus_tag LOCUS_25560 17071 17310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 17347 17598 gene locus_tag LOCUS_25570 17347 17598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 17626 18027 gene locus_tag LOCUS_25580 17626 18027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 18030 18257 gene locus_tag LOCUS_25590 18030 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 18205 18447 gene locus_tag LOCUS_25600 18205 18447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 18447 18707 gene locus_tag LOCUS_25610 18447 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 18730 18897 gene locus_tag LOCUS_25620 18730 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 19358 19164 gene locus_tag LOCUS_25630 19358 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 19497 19360 gene locus_tag LOCUS_25640 19497 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 19725 19543 gene locus_tag LOCUS_25650 19725 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 19879 20181 gene locus_tag LOCUS_25660 19879 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 20367 20221 gene locus_tag LOCUS_25670 20367 20221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 21548 20505 gene locus_tag LOCUS_25680 21548 20505 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_25680 22064 21723 gene locus_tag LOCUS_25690 22064 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 22253 22426 gene locus_tag LOCUS_25700 22253 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence31 499 981 gene locus_tag LOCUS_25710 499 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1491 3224 gene locus_tag LOCUS_25720 1491 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3389 4780 gene locus_tag LOCUS_25730 3389 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 4805 6331 gene locus_tag LOCUS_25740 4805 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 6398 7090 gene locus_tag LOCUS_25750 gene regX 6398 7090 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_25750 7083 8306 gene locus_tag LOCUS_25760 7083 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 8448 10808 gene locus_tag LOCUS_25770 8448 10808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983425.1 protein_id gnl|my_center|LOCUS_25770 10859 11623 gene locus_tag LOCUS_25780 10859 11623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_25780 11800 12111 gene locus_tag LOCUS_25790 11800 12111 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_25790 12111 14726 gene locus_tag LOCUS_25800 12111 14726 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_25800 14772 16367 gene locus_tag LOCUS_25810 14772 16367 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_25810 16432 18183 gene locus_tag LOCUS_25820 gene aspS 16432 18183 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_25820 18245 19606 gene locus_tag LOCUS_25830 gene trkA 18245 19606 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_25830 19599 21035 gene locus_tag LOCUS_25840 19599 21035 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_25840 21100 21501 gene locus_tag LOCUS_25850 21100 21501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 21665 21738 gene locus_tag LOCUS_t00220 21665 21738 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 889 707 gene locus_tag LOCUS_25860 889 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1655 1461 gene locus_tag LOCUS_25870 1655 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1801 1971 gene locus_tag LOCUS_25880 1801 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2558 2166 gene locus_tag LOCUS_25890 2558 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3214 2564 gene locus_tag LOCUS_25900 3214 2564 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_25900 3709 10635 gene locus_tag LOCUS_25910 3709 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 10813 16053 gene locus_tag LOCUS_25920 10813 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 16072 16761 gene locus_tag LOCUS_25930 16072 16761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 16761 18572 gene locus_tag LOCUS_25940 16761 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence33 157 2859 gene locus_tag LOCUS_25950 157 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2878 3993 gene locus_tag LOCUS_25960 2878 3993 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080946.1 protein_id gnl|my_center|LOCUS_25960 4019 4492 gene locus_tag LOCUS_25970 4019 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 4796 5821 gene locus_tag LOCUS_25980 4796 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 5814 6971 gene locus_tag LOCUS_25990 5814 6971 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_25990 6949 7698 gene locus_tag LOCUS_26000 6949 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 7707 8921 gene locus_tag LOCUS_26010 7707 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8955 9113 gene locus_tag LOCUS_26020 8955 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 9125 10450 gene locus_tag LOCUS_26030 9125 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 10450 11205 gene locus_tag LOCUS_26040 10450 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 11174 11614 gene locus_tag LOCUS_26050 11174 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 11604 11861 gene locus_tag LOCUS_26060 11604 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 11858 12958 gene locus_tag LOCUS_26070 11858 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 13038 14048 gene locus_tag LOCUS_26080 13038 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 14060 14470 gene locus_tag LOCUS_26090 14060 14470 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_26090 14470 15312 gene locus_tag LOCUS_26100 14470 15312 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_26100 15314 15862 gene locus_tag LOCUS_26110 15314 15862 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_26110 15831 17162 gene locus_tag LOCUS_26120 15831 17162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 17155 18162 gene locus_tag LOCUS_26130 17155 18162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence34 699 151 gene locus_tag LOCUS_26140 699 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1463 960 gene locus_tag LOCUS_26150 1463 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2400 1474 gene locus_tag LOCUS_26160 2400 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2933 2400 gene locus_tag LOCUS_26170 2933 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 4138 2930 gene locus_tag LOCUS_26180 4138 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 5600 4140 gene locus_tag LOCUS_26190 5600 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 7477 6041 gene locus_tag LOCUS_26200 7477 6041 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_26200 8372 7971 gene locus_tag LOCUS_26210 8372 7971 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_26210 8852 9142 gene locus_tag LOCUS_26220 8852 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 9275 10501 gene locus_tag LOCUS_26230 9275 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 10502 11329 gene locus_tag LOCUS_26240 10502 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 11716 12138 gene locus_tag LOCUS_26250 11716 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 13083 12355 gene locus_tag LOCUS_26260 13083 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 13213 13518 gene locus_tag LOCUS_26270 13213 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26270 13653 14360 gene locus_tag LOCUS_26280 13653 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26280 14617 14408 gene locus_tag LOCUS_26290 14617 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 15303 14617 gene locus_tag LOCUS_26300 15303 14617 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_26300 15967 15680 gene locus_tag LOCUS_26310 15967 15680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 16722 16039 gene locus_tag LOCUS_26320 16722 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 17607 16744 gene locus_tag LOCUS_26330 17607 16744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence35 385 1440 gene locus_tag LOCUS_26340 385 1440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_26340 3033 1516 gene locus_tag LOCUS_26350 3033 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3935 3138 gene locus_tag LOCUS_26360 3935 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4211 3990 gene locus_tag LOCUS_26370 4211 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 4497 4198 gene locus_tag LOCUS_26380 4497 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4934 5128 gene locus_tag LOCUS_26390 4934 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 5138 6757 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaagaaccatatgaacttacaaggctctcaaac 7477 6806 gene locus_tag LOCUS_26400 7477 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 7779 7474 gene locus_tag LOCUS_26410 gene cas2 7779 7474 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_26410 8656 7784 gene locus_tag LOCUS_26420 gene cas1 8656 7784 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_26420 12786 8653 gene locus_tag LOCUS_26430 gene cas9 12786 8653 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_26430 15025 13763 gene locus_tag LOCUS_26440 15025 13763 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_26440 15345 15025 gene locus_tag LOCUS_26450 15345 15025 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_26450 15860 15465 gene locus_tag LOCUS_26460 15860 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 16600 15974 gene locus_tag LOCUS_26470 16600 15974 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_26470 16940 16764 gene locus_tag LOCUS_26480 16940 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 17054 16970 gene locus_tag LOCUS_t00230 17054 16970 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17170 17096 gene locus_tag LOCUS_t00240 17170 17096 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17264 17190 gene locus_tag LOCUS_t00250 17264 17190 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence36 748 77 gene locus_tag LOCUS_26490 748 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1318 755 gene locus_tag LOCUS_26500 1318 755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_26500 2853 1528 gene locus_tag LOCUS_26510 2853 1528 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024933635.1 protein_id gnl|my_center|LOCUS_26510 3617 2871 gene locus_tag LOCUS_26520 3617 2871 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454491.1 protein_id gnl|my_center|LOCUS_26520 6065 3687 gene locus_tag LOCUS_26530 6065 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 6911 6078 gene locus_tag LOCUS_26540 6911 6078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721684.1 protein_id gnl|my_center|LOCUS_26540 8318 6936 gene locus_tag LOCUS_26550 8318 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 10159 9407 gene locus_tag LOCUS_26560 10159 9407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 11168 10191 gene locus_tag LOCUS_26570 11168 10191 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836485.1 protein_id gnl|my_center|LOCUS_26570 12096 11254 gene locus_tag LOCUS_26580 12096 11254 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_26580 12459 12172 gene locus_tag LOCUS_26590 12459 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 13548 12559 gene locus_tag LOCUS_26600 13548 12559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836485.1 protein_id gnl|my_center|LOCUS_26600 15198 13603 gene locus_tag LOCUS_26610 15198 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 15813 15217 gene locus_tag LOCUS_26620 15813 15217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <16688 15994 gene locus_tag LOCUS_26630 <16688 15994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965767.1:alpha/beta hydrolase >Feature sequence37 308 520 gene locus_tag LOCUS_26640 308 520 CDS product Maff2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610321.1 protein_id gnl|my_center|LOCUS_26640 576 770 gene locus_tag LOCUS_26650 576 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 803 1669 gene locus_tag LOCUS_26660 803 1669 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002610323.1 protein_id gnl|my_center|LOCUS_26660 1685 2080 gene locus_tag LOCUS_26670 1685 2080 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861115.1 protein_id gnl|my_center|LOCUS_26670 2037 4493 gene locus_tag LOCUS_26680 2037 4493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_26680 4501 6234 gene locus_tag LOCUS_26690 4501 6234 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861112.1 protein_id gnl|my_center|LOCUS_26690 6244 6579 gene locus_tag LOCUS_26700 6244 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 6566 7369 gene locus_tag LOCUS_26710 6566 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 7460 7600 gene locus_tag LOCUS_26720 7460 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 7600 8880 gene locus_tag LOCUS_26730 7600 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 8947 11034 gene locus_tag LOCUS_26740 8947 11034 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861108.1 protein_id gnl|my_center|LOCUS_26740 11037 11237 gene locus_tag LOCUS_26750 11037 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 11234 11563 gene locus_tag LOCUS_26760 gene mobC 11234 11563 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_26760 11582 12997 gene locus_tag LOCUS_26770 11582 12997 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368703.1 protein_id gnl|my_center|LOCUS_26770 13607 14050 gene locus_tag LOCUS_26780 13607 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 14242 14706 gene locus_tag LOCUS_26790 14242 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 14844 15062 gene locus_tag LOCUS_26800 14844 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 15469 15792 gene locus_tag LOCUS_26810 15469 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 15912 16277 gene locus_tag LOCUS_26820 15912 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 >Feature sequence38 75 1 gene locus_tag LOCUS_t00260 75 1 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 184 109 gene locus_tag LOCUS_t00270 184 109 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 349 275 gene locus_tag LOCUS_t00280 349 275 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 944 453 gene locus_tag LOCUS_26830 944 453 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_26830 1598 975 gene locus_tag LOCUS_26840 1598 975 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_26840 2715 1660 gene locus_tag LOCUS_26850 2715 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 3871 2708 gene locus_tag LOCUS_26860 3871 2708 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_26860 5620 3959 gene locus_tag LOCUS_26870 gene cls 5620 3959 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775565.1 protein_id gnl|my_center|LOCUS_26870 7332 5671 gene locus_tag LOCUS_26880 7332 5671 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_26880 8287 7409 gene locus_tag LOCUS_26890 gene hslO 8287 7409 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_26890 9062 8310 gene locus_tag LOCUS_26900 9062 8310 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 protein_id gnl|my_center|LOCUS_26900 9585 9091 gene locus_tag LOCUS_26910 9585 9091 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_26910 10654 9578 gene locus_tag LOCUS_26920 gene hisC 10654 9578 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_26920 11734 10730 gene locus_tag LOCUS_26930 11734 10730 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_26930 12542 11805 gene locus_tag LOCUS_26940 12542 11805 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_26940 13230 12529 gene locus_tag LOCUS_26950 13230 12529 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_26950 13992 13243 gene locus_tag LOCUS_26960 13992 13243 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_26960 15384 14245 gene locus_tag LOCUS_26970 15384 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence39 140 937 gene locus_tag LOCUS_26980 140 937 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_26980 1915 938 gene locus_tag LOCUS_26990 1915 938 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_26990 3015 1915 gene locus_tag LOCUS_27000 gene glf 3015 1915 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_27000 3544 3029 gene locus_tag LOCUS_27010 3544 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4469 6391 gene locus_tag LOCUS_27020 4469 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 7075 6407 gene locus_tag LOCUS_27030 7075 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 8924 7821 gene locus_tag LOCUS_27040 8924 7821 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_27040 9555 8905 gene locus_tag LOCUS_27050 9555 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 10709 9573 gene locus_tag LOCUS_27060 10709 9573 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167408.1 protein_id gnl|my_center|LOCUS_27060 11437 10721 gene locus_tag LOCUS_27070 11437 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 13031 11550 gene locus_tag LOCUS_27080 13031 11550 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_27080 14398 13301 gene locus_tag LOCUS_27090 14398 13301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 <15652 14391 gene locus_tag LOCUS_27100 <15652 14391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202576.1:AAA family ATPase >Feature sequence40 536 1102 gene locus_tag LOCUS_27110 536 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 1164 2096 gene locus_tag LOCUS_27120 1164 2096 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_27120 2378 3574 gene locus_tag LOCUS_27130 2378 3574 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_27130 4193 5872 gene locus_tag LOCUS_27140 4193 5872 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_27140 5988 6257 gene locus_tag LOCUS_27150 5988 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6233 6634 gene locus_tag LOCUS_27160 6233 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 6986 7600 gene locus_tag LOCUS_27170 6986 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 7597 7767 gene locus_tag LOCUS_27180 7597 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 8153 8605 gene locus_tag LOCUS_27190 8153 8605 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361333.1 protein_id gnl|my_center|LOCUS_27190 9230 9406 gene locus_tag LOCUS_27200 9230 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence41 982 581 gene locus_tag LOCUS_27210 gene rpsH 982 581 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_27210 1185 1000 gene locus_tag LOCUS_27220 1185 1000 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_27220 1738 1199 gene locus_tag LOCUS_27230 gene rplE 1738 1199 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_27230 2074 1763 gene locus_tag LOCUS_27240 gene rplX 2074 1763 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_27240 2456 2088 gene locus_tag LOCUS_27250 gene rplN 2456 2088 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 protein_id gnl|my_center|LOCUS_27250 2732 2475 gene locus_tag LOCUS_27260 gene rpsQ 2732 2475 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_27260 2978 2778 gene locus_tag LOCUS_27270 gene rpmC 2978 2778 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_27270 3405 2971 gene locus_tag LOCUS_27280 gene rplP 3405 2971 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_27280 4079 3405 gene locus_tag LOCUS_27290 gene rpsC 4079 3405 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_27290 4498 4094 gene locus_tag LOCUS_27300 4498 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 4796 4515 gene locus_tag LOCUS_27310 gene rpsS 4796 4515 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638064.1 protein_id gnl|my_center|LOCUS_27310 5657 4815 gene locus_tag LOCUS_27320 gene rplB 5657 4815 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129965.1 protein_id gnl|my_center|LOCUS_27320 6012 5713 gene locus_tag LOCUS_27330 gene rplW 6012 5713 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_27330 6632 6012 gene locus_tag LOCUS_27340 gene rplD 6632 6012 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_27340 7334 6657 gene locus_tag LOCUS_27350 gene rplC 7334 6657 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_27350 7745 7428 gene locus_tag LOCUS_27360 gene rpsJ 7745 7428 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_27360 8575 8186 gene locus_tag LOCUS_27370 8575 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 9583 8786 gene locus_tag LOCUS_27380 9583 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence42 6207 163 gene locus_tag LOCUS_27390 6207 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7086 6340 gene locus_tag LOCUS_27400 7086 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 7721 7098 gene locus_tag LOCUS_27410 7721 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <9764 8661 gene locus_tag LOCUS_27420 <9764 8661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964397.1:lamin tail domain-containing protein >Feature sequence43 157 1455 gene locus_tag LOCUS_27430 157 1455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_27430 1747 2679 gene locus_tag LOCUS_27440 1747 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2838 6641 gene locus_tag LOCUS_27450 2838 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 6666 7223 gene locus_tag LOCUS_27460 6666 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 7237 8205 gene locus_tag LOCUS_27470 gene cas1c 7237 8205 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_27470 8206 8481 gene locus_tag LOCUS_27480 8206 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence44 143 406 gene locus_tag LOCUS_27490 143 406 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_27490 399 545 gene locus_tag LOCUS_27500 399 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 546 701 gene locus_tag LOCUS_27510 546 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 870 1316 gene locus_tag LOCUS_27520 870 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1537 3387 gene locus_tag LOCUS_27530 1537 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3414 4376 gene locus_tag LOCUS_27540 3414 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676624.1 protein_id gnl|my_center|LOCUS_27540 4373 5257 gene locus_tag LOCUS_27550 4373 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 5605 6501 gene locus_tag LOCUS_27560 5605 6501 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_27560 6769 7500 gene locus_tag LOCUS_27570 6769 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 7559 7795 gene locus_tag LOCUS_27580 7559 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence45 <1 822 gene locus_tag LOCUS_27590 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267967.1:phage tail tape measure protein 826 1182 gene locus_tag LOCUS_27600 826 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1175 1651 gene locus_tag LOCUS_27610 1175 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1711 2100 gene locus_tag LOCUS_27620 1711 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2042 7153 gene locus_tag LOCUS_27630 2042 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 7166 7519 gene locus_tag LOCUS_27640 7166 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 7512 7688 gene locus_tag LOCUS_27650 7512 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence46 1074 2555 gene locus_tag LOCUS_27660 1074 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2578 3504 gene locus_tag LOCUS_27670 2578 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3545 4510 gene locus_tag LOCUS_27680 3545 4510 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389891.1 protein_id gnl|my_center|LOCUS_27680 5242 4577 gene locus_tag LOCUS_27690 5242 4577 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_27690 5388 7229 gene locus_tag LOCUS_27700 gene typA 5388 7229 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence47 <1 807 gene locus_tag LOCUS_27710 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109529.1:BspA family leucine-rich repeat surface protein 809 1087 gene locus_tag LOCUS_27720 809 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1713 2813 gene locus_tag LOCUS_27730 1713 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 2816 3013 gene locus_tag LOCUS_27740 2816 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 3128 3622 gene locus_tag LOCUS_27750 3128 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 4898 3762 gene locus_tag LOCUS_27760 4898 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 5398 5093 gene locus_tag LOCUS_27770 5398 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence48 1098 112 gene locus_tag LOCUS_27780 1098 112 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 protein_id gnl|my_center|LOCUS_27780 1865 1320 gene locus_tag LOCUS_27790 1865 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3632 1962 gene locus_tag LOCUS_27800 3632 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4457 3675 gene locus_tag LOCUS_27810 4457 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5253 4465 gene locus_tag LOCUS_27820 5253 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 6163 5237 gene locus_tag LOCUS_27830 6163 5237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964179.1 protein_id gnl|my_center|LOCUS_27830 >Feature sequence49 574 2190 gene locus_tag LOCUS_27840 gene tet(35) 574 2190 CDS product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 protein_id gnl|my_center|LOCUS_27840 3331 2309 gene locus_tag LOCUS_27850 3331 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 3611 3384 gene locus_tag LOCUS_27860 3611 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 4318 4166 gene locus_tag LOCUS_27870 4318 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4689 4354 gene locus_tag LOCUS_27880 4689 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 4876 4694 gene locus_tag LOCUS_27890 4876 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 5884 5039 gene locus_tag LOCUS_27900 5884 5039 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_27900 6119 5877 gene locus_tag LOCUS_27910 6119 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence50 1331 183 gene locus_tag LOCUS_27920 1331 183 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_27920 1564 1337 gene locus_tag LOCUS_27930 1564 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2157 1810 gene locus_tag LOCUS_27940 2157 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2522 2145 gene locus_tag LOCUS_27950 2522 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 4081 3476 gene locus_tag LOCUS_27960 4081 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 4671 4081 gene locus_tag LOCUS_27970 4671 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 5503 4769 gene locus_tag LOCUS_27980 5503 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence51 924 112 gene locus_tag LOCUS_27990 gene ydcF 924 112 CDS product DUF218 domain-containing protein YdcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027967.1 protein_id gnl|my_center|LOCUS_27990 1640 993 gene locus_tag LOCUS_28000 1640 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2269 1739 gene locus_tag LOCUS_28010 2269 1739 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_28010 2805 2311 gene locus_tag LOCUS_28020 2805 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 3967 2849 gene locus_tag LOCUS_28030 3967 2849 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263500.1 protein_id gnl|my_center|LOCUS_28030 4209 4021 gene locus_tag LOCUS_28040 4209 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 5614 4355 gene locus_tag LOCUS_28050 5614 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence52 3175 2162 gene locus_tag LOCUS_28060 3175 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 4029 3172 gene locus_tag LOCUS_28070 4029 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence53 2120 51 gene locus_tag LOCUS_28080 2120 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3761 2121 gene locus_tag LOCUS_28090 3761 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 >Feature sequence54 >Feature sequence55 127 1536 gene locus_tag LOCUS_28100 127 1536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_28100 1552 2115 gene locus_tag LOCUS_28110 1552 2115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence56 402 88 gene locus_tag LOCUS_28120 402 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 667 1338 gene locus_tag LOCUS_28130 667 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1331 2335 gene locus_tag LOCUS_28140 1331 2335 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_28140 2631 3350 gene locus_tag LOCUS_28150 2631 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence57 544 116 gene locus_tag LOCUS_28160 544 116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_28160 1230 637 gene locus_tag LOCUS_28170 1230 637 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_28170 1485 1348 gene locus_tag LOCUS_28180 1485 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 1774 1643 gene locus_tag LOCUS_28190 1774 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 2681 1848 gene locus_tag LOCUS_28200 2681 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence58 1060 3312 gene locus_tag LOCUS_28210 gene glgP 1060 3312 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence59 1507 197 gene locus_tag LOCUS_28220 1507 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 2559 1966 gene locus_tag LOCUS_28230 2559 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2744 2568 gene locus_tag LOCUS_28240 2744 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence60 127 1080 gene locus_tag LOCUS_28250 gene rhuM 127 1080 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_28250 1509 1943 gene locus_tag LOCUS_28260 1509 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1990 2688 gene locus_tag LOCUS_28270 1990 2688 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence61 80 931 gene locus_tag LOCUS_28280 80 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 1106 1480 gene locus_tag LOCUS_28290 1106 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1504 1782 gene locus_tag LOCUS_28300 1504 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1858 2244 gene locus_tag LOCUS_28310 1858 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence62 1872 1498 gene locus_tag LOCUS_28320 1872 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence63 1612 53 gene locus_tag LOCUS_28330 1612 53 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_28330 2060 1704 gene locus_tag LOCUS_28340 gene tnpB 2060 1704 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287659.1 protein_id gnl|my_center|LOCUS_28340 2428 2054 gene locus_tag LOCUS_28350 2428 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence64 12 2334 gene locus_tag LOCUS_r00010 12 2334 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 71 percent of the 23S ribosomal RNA >Feature sequence65 1499 162 gene locus_tag LOCUS_28360 1499 162 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence66 485 54 gene locus_tag LOCUS_28370 485 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1488 514 gene locus_tag LOCUS_28380 1488 514 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 protein_id gnl|my_center|LOCUS_28380 2074 1541 gene locus_tag LOCUS_28390 2074 1541 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861314.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence67 771 1 gene locus_tag LOCUS_28400 771 1 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010257677.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence68 512 294 gene locus_tag LOCUS_28410 512 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 590 1159 gene locus_tag LOCUS_28420 590 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1090 1977 gene locus_tag LOCUS_28430 1090 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28430 >Feature sequence69 1407 943 gene locus_tag LOCUS_28440 1407 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1788 1408 gene locus_tag LOCUS_28450 1788 1408 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287552.1 protein_id gnl|my_center|LOCUS_28450 >Feature sequence70 1690 254 gene locus_tag LOCUS_28460 1690 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence71 96 320 gene locus_tag LOCUS_28470 96 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 336 473 gene locus_tag LOCUS_28480 336 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 463 921 gene locus_tag LOCUS_28490 463 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence72 1629 784 gene locus_tag LOCUS_28500 1629 784 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396365.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence73 >Feature sequence74 594 1517 gene locus_tag LOCUS_28510 gene cas1 594 1517 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence75 >Feature sequence76 106 1602 gene locus_tag LOCUS_28520 106 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence77 115 912 gene locus_tag LOCUS_28530 115 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 986 1360 gene locus_tag LOCUS_28540 986 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence78 103 1470 gene locus_tag LOCUS_28550 103 1470 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272192.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence79 >Feature sequence80 <1378 44 gene locus_tag LOCUS_28560 <1378 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223849864.1:ISL3 family transposase >Feature sequence81 1238 351 gene locus_tag LOCUS_28570 1238 351 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence82 1312 785 gene locus_tag LOCUS_28580 1312 785 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208113920.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence83 908 210 gene locus_tag LOCUS_28590 908 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence84 78 413 gene locus_tag LOCUS_28600 78 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 410 1264 gene locus_tag LOCUS_28610 410 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 >Feature sequence85 >Feature sequence86 838 149 gene locus_tag LOCUS_28620 838 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence87 21 521 gene locus_tag LOCUS_28630 21 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence88 113 1183 gene locus_tag LOCUS_28640 gene malR 113 1183 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence89 >Feature sequence90 48 419 gene locus_tag LOCUS_28650 48 419 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763908.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence91 >Feature sequence92 518 90 gene locus_tag LOCUS_28660 518 90 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438911.1 protein_id gnl|my_center|LOCUS_28660 1126 560 gene locus_tag LOCUS_28670 1126 560 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence93 >Feature sequence94 118 11 gene locus_tag LOCUS_r00020 118 11 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence95 >Feature sequence96