>Feature sequence0001 521 123 gene locus_tag LOCUS_00010 521 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2010 619 gene locus_tag LOCUS_00020 gene glnG 2010 619 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 protein_id gnl|my_center|LOCUS_00020 3089 2007 gene locus_tag LOCUS_00030 gene glnL 3089 2007 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_00030 3589 3224 gene locus_tag LOCUS_00040 3589 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4725 4015 gene locus_tag LOCUS_00050 4725 4015 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_00050 4753 4852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5387 4995 gene locus_tag LOCUS_00060 gene rplQ 5387 4995 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_00060 6442 5432 gene locus_tag LOCUS_00070 gene rpoA 6442 5432 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_00070 7041 6454 gene locus_tag LOCUS_00080 gene rpsD 7041 6454 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919224.1 protein_id gnl|my_center|LOCUS_00080 7468 7079 gene locus_tag LOCUS_00090 gene rpsK 7468 7079 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_00090 7860 7504 gene locus_tag LOCUS_00100 gene rpsM 7860 7504 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070630.1 protein_id gnl|my_center|LOCUS_00100 9496 8147 gene locus_tag LOCUS_00110 gene secY 9496 8147 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_00110 9939 9505 gene locus_tag LOCUS_00120 gene rplO 9939 9505 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417259.1 protein_id gnl|my_center|LOCUS_00120 10132 9941 gene locus_tag LOCUS_00130 gene rpmD 10132 9941 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_00130 10640 10137 gene locus_tag LOCUS_00140 gene rpsE 10640 10137 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141025.1 protein_id gnl|my_center|LOCUS_00140 11007 10651 gene locus_tag LOCUS_00150 gene rplR 11007 10651 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_00150 11556 11020 gene locus_tag LOCUS_00160 gene rplF 11556 11020 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_00160 11968 11573 gene locus_tag LOCUS_00170 gene rpsH 11968 11573 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_00170 12452 12147 gene locus_tag LOCUS_00180 gene rpsN 12452 12147 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014354.1 protein_id gnl|my_center|LOCUS_00180 13013 12477 gene locus_tag LOCUS_00190 gene rplE 13013 12477 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_00190 13347 13027 gene locus_tag LOCUS_00200 gene rplX 13347 13027 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_00200 13725 13357 gene locus_tag LOCUS_00210 gene rplN 13725 13357 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_00210 14040 13780 gene locus_tag LOCUS_00220 gene rpsQ 14040 13780 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461671.1 protein_id gnl|my_center|LOCUS_00220 14237 14043 gene locus_tag LOCUS_00230 gene rpmC 14237 14043 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307965.1 protein_id gnl|my_center|LOCUS_00230 14650 14237 gene locus_tag LOCUS_00240 gene rplP 14650 14237 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_00240 15342 14653 gene locus_tag LOCUS_00250 gene rpsC 15342 14653 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_00250 15687 15355 gene locus_tag LOCUS_00260 gene rplV 15687 15355 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_00260 15973 15698 gene locus_tag LOCUS_00270 gene rpsS 15973 15698 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_00270 16821 15994 gene locus_tag LOCUS_00280 gene rplB 16821 15994 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_00280 17162 16863 gene locus_tag LOCUS_00290 gene rplW 17162 16863 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555488.1 protein_id gnl|my_center|LOCUS_00290 17761 17159 gene locus_tag LOCUS_00300 gene rplD 17761 17159 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417226.1 protein_id gnl|my_center|LOCUS_00300 18415 17765 gene locus_tag LOCUS_00310 gene rplC 18415 17765 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 protein_id gnl|my_center|LOCUS_00310 18738 18427 gene locus_tag LOCUS_00320 gene rpsJ 18738 18427 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_00320 19934 18744 gene locus_tag LOCUS_00330 gene tuf 19934 18744 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_00330 22053 19963 gene locus_tag LOCUS_00340 gene fusA 22053 19963 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 protein_id gnl|my_center|LOCUS_00340 22581 22111 gene locus_tag LOCUS_00350 gene rpsG 22581 22111 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_00350 23005 22631 gene locus_tag LOCUS_00360 gene rpsL 23005 22631 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_00360 27496 23273 gene locus_tag LOCUS_00370 gene rpoC 27496 23273 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_00370 31686 27544 gene locus_tag LOCUS_00380 gene rpoB 31686 27544 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_00380 32217 31837 gene locus_tag LOCUS_00390 gene rplL 32217 31837 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_00390 32797 32270 gene locus_tag LOCUS_00400 gene rplJ 32797 32270 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_00400 33753 33058 gene locus_tag LOCUS_00410 gene rplA 33753 33058 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_00410 34186 33755 gene locus_tag LOCUS_00420 gene rplK 34186 33755 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690112.1 protein_id gnl|my_center|LOCUS_00420 34919 34386 gene locus_tag LOCUS_00430 gene nusG 34919 34386 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_00430 35299 34922 gene locus_tag LOCUS_00440 gene secE 35299 34922 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_00440 35435 35360 gene locus_tag LOCUS_t00010 35435 35360 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36716 35526 gene locus_tag LOCUS_00450 gene tuf 36716 35526 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946066.1 protein_id gnl|my_center|LOCUS_00450 36864 36789 gene locus_tag LOCUS_t00020 36864 36789 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36984 36911 gene locus_tag LOCUS_t00030 36984 36911 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37361 37277 gene locus_tag LOCUS_t00040 37361 37277 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 37537 39276 gene locus_tag LOCUS_00460 37537 39276 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074907579.1 protein_id gnl|my_center|LOCUS_00460 39273 40142 gene locus_tag LOCUS_00470 gene ispE 39273 40142 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_00470 40121 40195 gene locus_tag LOCUS_t00050 40121 40195 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 40252 41205 gene locus_tag LOCUS_00480 40252 41205 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_00480 41291 41947 gene locus_tag LOCUS_00490 41291 41947 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_00490 42016 42597 gene locus_tag LOCUS_00500 gene pth 42016 42597 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_00500 45516 42715 gene locus_tag LOCUS_00510 45516 42715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 47845 45686 gene locus_tag LOCUS_00520 47845 45686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 48897 47950 gene locus_tag LOCUS_00530 48897 47950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence0002 243 377 gene locus_tag LOCUS_00540 243 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 595 374 gene locus_tag LOCUS_00550 595 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 2370 781 gene locus_tag LOCUS_00560 2370 781 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267012.1 protein_id gnl|my_center|LOCUS_00560 3156 3944 gene locus_tag LOCUS_00570 3156 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 3922 5085 gene locus_tag LOCUS_00580 3922 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 5082 6095 gene locus_tag LOCUS_00590 5082 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6095 6703 gene locus_tag LOCUS_00600 6095 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 6707 7435 gene locus_tag LOCUS_00610 gene icmJ 6707 7435 CDS product type IVB secretion system protein IcmJDotN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214708.1 protein_id gnl|my_center|LOCUS_00610 7425 8798 gene locus_tag LOCUS_00620 7425 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 8891 9868 gene locus_tag LOCUS_00630 8891 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9865 10293 gene locus_tag LOCUS_00640 9865 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 10535 11002 gene locus_tag LOCUS_00650 10535 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 11002 11802 gene locus_tag LOCUS_00660 11002 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 11760 12908 gene locus_tag LOCUS_00670 gene dotB 11760 12908 CDS product Dot/Icm type IV secretion system ATPase DotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769572.1 protein_id gnl|my_center|LOCUS_00670 12905 13195 gene locus_tag LOCUS_00680 12905 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 13192 14025 gene locus_tag LOCUS_00690 13192 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 14028 15539 gene locus_tag LOCUS_00700 14028 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15542 16918 gene locus_tag LOCUS_00710 15542 16918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 16935 17411 gene locus_tag LOCUS_00720 16935 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 17426 19108 gene locus_tag LOCUS_00730 17426 19108 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_00730 19108 20169 gene locus_tag LOCUS_00740 19108 20169 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187516.1 protein_id gnl|my_center|LOCUS_00740 20169 20693 gene locus_tag LOCUS_00750 20169 20693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 20748 21308 gene locus_tag LOCUS_00760 20748 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 21331 22272 gene locus_tag LOCUS_00770 21331 22272 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425013.1 protein_id gnl|my_center|LOCUS_00770 22377 22865 gene locus_tag LOCUS_00780 22377 22865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 22878 23405 gene locus_tag LOCUS_00790 22878 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 23408 24952 gene locus_tag LOCUS_00800 23408 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 25083 25598 gene locus_tag LOCUS_00810 25083 25598 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267029.1 protein_id gnl|my_center|LOCUS_00810 25605 26270 gene locus_tag LOCUS_00820 25605 26270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 26281 29292 gene locus_tag LOCUS_00830 26281 29292 CDS product type IVa secretion system protein IcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958330.1 protein_id gnl|my_center|LOCUS_00830 30544 29234 gene locus_tag LOCUS_00840 30544 29234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 30854 31018 gene locus_tag LOCUS_00850 30854 31018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00850 31484 31146 gene locus_tag LOCUS_00860 31484 31146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 31658 32047 gene locus_tag LOCUS_00870 31658 32047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 32062 32577 gene locus_tag LOCUS_00880 32062 32577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 32577 33365 gene locus_tag LOCUS_00890 32577 33365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 33366 33809 gene locus_tag LOCUS_00900 33366 33809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 33825 36863 gene locus_tag LOCUS_00910 33825 36863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 36934 37428 gene locus_tag LOCUS_00920 36934 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence0003 1259 363 gene locus_tag LOCUS_00930 1259 363 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_00930 1769 1356 gene locus_tag LOCUS_00940 1769 1356 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_00940 1990 1766 gene locus_tag LOCUS_00950 1990 1766 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_00950 4135 2138 gene locus_tag LOCUS_00960 gene aprA 4135 2138 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_00960 4665 4192 gene locus_tag LOCUS_00970 gene aprB 4665 4192 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_00970 5008 5661 gene locus_tag LOCUS_00980 5008 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5658 6044 gene locus_tag LOCUS_00990 5658 6044 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269203.1 protein_id gnl|my_center|LOCUS_00990 6041 7381 gene locus_tag LOCUS_01000 gene zraR 6041 7381 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148553.1 protein_id gnl|my_center|LOCUS_01000 7631 8173 gene locus_tag LOCUS_01010 7631 8173 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 protein_id gnl|my_center|LOCUS_01010 8769 8227 gene locus_tag LOCUS_01020 8769 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 8977 8792 gene locus_tag LOCUS_01030 8977 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9658 8999 gene locus_tag LOCUS_01040 9658 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01040 9947 10429 gene locus_tag LOCUS_01050 9947 10429 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419131.1 protein_id gnl|my_center|LOCUS_01050 10429 10860 gene locus_tag LOCUS_01060 10429 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 11437 10880 gene locus_tag LOCUS_01070 11437 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 13068 11617 gene locus_tag LOCUS_01080 13068 11617 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_01080 14462 13089 gene locus_tag LOCUS_01090 gene trkA 14462 13089 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_01090 15826 14459 gene locus_tag LOCUS_01100 15826 14459 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_01100 18003 15823 gene locus_tag LOCUS_01110 18003 15823 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_01110 18533 17985 gene locus_tag LOCUS_01120 18533 17985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 19902 18535 gene locus_tag LOCUS_01130 gene rsmB 19902 18535 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_01130 20830 19895 gene locus_tag LOCUS_01140 gene fmt 20830 19895 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266132.1 protein_id gnl|my_center|LOCUS_01140 21367 20831 gene locus_tag LOCUS_01150 gene def 21367 20831 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_01150 21801 22925 gene locus_tag LOCUS_01160 21801 22925 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_01160 22897 24039 gene locus_tag LOCUS_01170 gene dprA 22897 24039 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807293.1 protein_id gnl|my_center|LOCUS_01170 24072 24548 gene locus_tag LOCUS_01180 24072 24548 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461440.1 protein_id gnl|my_center|LOCUS_01180 24624 26927 gene locus_tag LOCUS_01190 gene topA 24624 26927 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_01190 26933 27490 gene locus_tag LOCUS_01200 26933 27490 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 protein_id gnl|my_center|LOCUS_01200 27487 28401 gene locus_tag LOCUS_01210 gene hemF 27487 28401 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 protein_id gnl|my_center|LOCUS_01210 29069 28494 gene locus_tag LOCUS_01220 29069 28494 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_01220 29404 29066 gene locus_tag LOCUS_01230 29404 29066 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_01230 29571 29401 gene locus_tag LOCUS_01240 29571 29401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 30526 29798 gene locus_tag LOCUS_01250 30526 29798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 31088 30555 gene locus_tag LOCUS_01260 31088 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 31660 31085 gene locus_tag LOCUS_01270 31660 31085 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_01270 32253 31816 gene locus_tag LOCUS_01280 gene dtd 32253 31816 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 protein_id gnl|my_center|LOCUS_01280 32369 32250 gene locus_tag LOCUS_01290 32369 32250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence0004 259 618 gene locus_tag LOCUS_01300 259 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2329 806 gene locus_tag LOCUS_01310 gene ilvA 2329 806 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082739.1 protein_id gnl|my_center|LOCUS_01310 2419 3081 gene locus_tag LOCUS_01320 gene rpiA 2419 3081 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482455.1 protein_id gnl|my_center|LOCUS_01320 4397 3414 gene locus_tag LOCUS_01330 gene porB 4397 3414 CDS product trimeric porin PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244345.1 protein_id gnl|my_center|LOCUS_01330 4985 4593 gene locus_tag LOCUS_01340 gene rpsI 4985 4593 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_01340 5439 5011 gene locus_tag LOCUS_01350 gene rplM 5439 5011 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_01350 6193 5888 gene locus_tag LOCUS_01360 6193 5888 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_01360 6253 7395 gene locus_tag LOCUS_01370 gene glcF 6253 7395 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338662.1 protein_id gnl|my_center|LOCUS_01370 7406 8056 gene locus_tag LOCUS_01380 gene coq7 7406 8056 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_01380 9187 8123 gene locus_tag LOCUS_01390 gene hemE 9187 8123 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704014.1 protein_id gnl|my_center|LOCUS_01390 9875 9255 gene locus_tag LOCUS_01400 9875 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 10031 10660 gene locus_tag LOCUS_01410 10031 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 10666 12612 gene locus_tag LOCUS_01420 10666 12612 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104250.1 protein_id gnl|my_center|LOCUS_01420 12612 13355 gene locus_tag LOCUS_01430 gene tagT 12612 13355 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_01430 13355 14566 gene locus_tag LOCUS_01440 gene tagS 13355 14566 CDS product type IV secretion associated ABC transporter permease TagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 protein_id gnl|my_center|LOCUS_01440 14577 15161 gene locus_tag LOCUS_01450 14577 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 15136 16224 gene locus_tag LOCUS_01460 15136 16224 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_01460 16224 16865 gene locus_tag LOCUS_01470 gene rsmG 16224 16865 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_01470 16969 17133 gene locus_tag LOCUS_01480 16969 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 17249 18466 gene locus_tag LOCUS_01490 17249 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01490 18549 19331 gene locus_tag LOCUS_01500 18549 19331 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_01500 19337 20218 gene locus_tag LOCUS_01510 19337 20218 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_01510 20358 20744 gene locus_tag LOCUS_01520 20358 20744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 20754 21617 gene locus_tag LOCUS_01530 gene atpB 20754 21617 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_01530 21668 21901 gene locus_tag LOCUS_01540 21668 21901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 21948 22418 gene locus_tag LOCUS_01550 gene atpF 21948 22418 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_01550 22427 22966 gene locus_tag LOCUS_01560 gene atpH 22427 22966 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074333.1 protein_id gnl|my_center|LOCUS_01560 22980 24521 gene locus_tag LOCUS_01570 gene atpA 22980 24521 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_01570 24560 25435 gene locus_tag LOCUS_01580 gene atpG 24560 25435 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_01580 25507 26886 gene locus_tag LOCUS_01590 gene atpD 25507 26886 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_01590 26908 27333 gene locus_tag LOCUS_01600 26908 27333 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_01600 27417 27917 gene locus_tag LOCUS_01610 27417 27917 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_01610 27931 29292 gene locus_tag LOCUS_01620 gene glmU 27931 29292 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074328.1 protein_id gnl|my_center|LOCUS_01620 29294 31120 gene locus_tag LOCUS_01630 gene glmS 29294 31120 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence0005 224 811 gene locus_tag LOCUS_01640 gene mobA 224 811 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_01640 1379 831 gene locus_tag LOCUS_01650 1379 831 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070536.1 protein_id gnl|my_center|LOCUS_01650 3650 1464 gene locus_tag LOCUS_01660 3650 1464 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144347086.1 protein_id gnl|my_center|LOCUS_01660 3952 3665 gene locus_tag LOCUS_01670 gene rpoZ 3952 3665 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116990.1 protein_id gnl|my_center|LOCUS_01670 4406 4122 gene locus_tag LOCUS_01680 4406 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01680 5772 4453 gene locus_tag LOCUS_01690 5772 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 6061 5810 gene locus_tag LOCUS_01700 6061 5810 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_01700 6556 6077 gene locus_tag LOCUS_01710 gene coaD 6556 6077 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_01710 7154 6579 gene locus_tag LOCUS_01720 gene rsmD 7154 6579 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455683.1 protein_id gnl|my_center|LOCUS_01720 7657 7154 gene locus_tag LOCUS_01730 7657 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01730 8450 7608 gene locus_tag LOCUS_01740 8450 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01740 9790 8447 gene locus_tag LOCUS_01750 9790 8447 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_01750 10071 11048 gene locus_tag LOCUS_01760 10071 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11059 11724 gene locus_tag LOCUS_01770 gene ftsE 11059 11724 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099140.1 protein_id gnl|my_center|LOCUS_01770 11721 12680 gene locus_tag LOCUS_01780 gene ftsX 11721 12680 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_01780 13118 13966 gene locus_tag LOCUS_01790 gene rpoH 13118 13966 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_01790 14187 14927 gene locus_tag LOCUS_01800 gene bioD 14187 14927 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269170.1 protein_id gnl|my_center|LOCUS_01800 15814 14960 gene locus_tag LOCUS_01810 15814 14960 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_01810 16574 15807 gene locus_tag LOCUS_01820 gene bioH 16574 15807 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703680.1 protein_id gnl|my_center|LOCUS_01820 17719 16571 gene locus_tag LOCUS_01830 gene bioF 17719 16571 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103160.1 protein_id gnl|my_center|LOCUS_01830 18729 17719 gene locus_tag LOCUS_01840 gene bioB 18729 17719 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_01840 18795 19493 gene locus_tag LOCUS_01850 18795 19493 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_01850 19551 20051 gene locus_tag LOCUS_01860 19551 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 20041 20652 gene locus_tag LOCUS_01870 20041 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 21736 20642 gene locus_tag LOCUS_01880 21736 20642 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_01880 22006 22752 gene locus_tag LOCUS_01890 22006 22752 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_01890 23239 22760 gene locus_tag LOCUS_01900 gene folK 23239 22760 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_01900 23595 23236 gene locus_tag LOCUS_01910 gene folB 23595 23236 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_01910 23668 24264 gene locus_tag LOCUS_01920 gene plsY 23668 24264 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217581.1 protein_id gnl|my_center|LOCUS_01920 25312 24272 gene locus_tag LOCUS_01930 gene tsaD 25312 24272 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_01930 25424 25639 gene locus_tag LOCUS_01940 gene rpsU 25424 25639 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085057.1 protein_id gnl|my_center|LOCUS_01940 25651 26100 gene locus_tag LOCUS_01950 25651 26100 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_01950 26123 27847 gene locus_tag LOCUS_01960 gene dnaG 26123 27847 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_01960 27944 29746 gene locus_tag LOCUS_01970 gene rpoD 27944 29746 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262669.1 protein_id gnl|my_center|LOCUS_01970 29838 29914 gene locus_tag LOCUS_t00060 29838 29914 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30328 30573 gene locus_tag LOCUS_01980 30328 30573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0006 399 890 gene locus_tag LOCUS_01990 gene pncC 399 890 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_01990 877 1599 gene locus_tag LOCUS_02000 877 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1618 2679 gene locus_tag LOCUS_02010 gene recA 1618 2679 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_02010 2715 3119 gene locus_tag LOCUS_02020 gene recX 2715 3119 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406202.1 protein_id gnl|my_center|LOCUS_02020 3236 5866 gene locus_tag LOCUS_02030 gene alaS 3236 5866 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_02030 5926 7149 gene locus_tag LOCUS_02040 5926 7149 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_02040 7304 7528 gene locus_tag LOCUS_02050 gene csrA 7304 7528 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_02050 7721 7810 gene locus_tag LOCUS_t00070 7721 7810 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7999 8075 gene locus_tag LOCUS_t00080 7999 8075 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8284 8120 gene locus_tag LOCUS_02060 8284 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 8455 9021 gene locus_tag LOCUS_02070 gene folE 8455 9021 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_02070 9021 9380 gene locus_tag LOCUS_02080 gene folX 9021 9380 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316983.1 protein_id gnl|my_center|LOCUS_02080 9373 9552 gene locus_tag LOCUS_02090 9373 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 10268 9558 gene locus_tag LOCUS_02100 10268 9558 CDS product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073732.1 protein_id gnl|my_center|LOCUS_02100 10321 11133 gene locus_tag LOCUS_02110 10321 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11147 11785 gene locus_tag LOCUS_02120 11147 11785 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207187.1 protein_id gnl|my_center|LOCUS_02120 11959 12408 gene locus_tag LOCUS_02130 11959 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 12405 14108 gene locus_tag LOCUS_02140 12405 14108 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940385.1 protein_id gnl|my_center|LOCUS_02140 14276 14157 gene locus_tag LOCUS_02150 14276 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 15078 14503 gene locus_tag LOCUS_02160 15078 14503 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 protein_id gnl|my_center|LOCUS_02160 15583 15146 gene locus_tag LOCUS_02170 15583 15146 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705484.1 protein_id gnl|my_center|LOCUS_02170 16515 15607 gene locus_tag LOCUS_02180 gene napH 16515 15607 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_02180 17378 16518 gene locus_tag LOCUS_02190 gene napG 17378 16518 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_02190 19966 17438 gene locus_tag LOCUS_02200 gene napA 19966 17438 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_02200 20234 19953 gene locus_tag LOCUS_02210 20234 19953 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071139.1 protein_id gnl|my_center|LOCUS_02210 20760 20239 gene locus_tag LOCUS_02220 gene napF 20760 20239 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071814.1 protein_id gnl|my_center|LOCUS_02220 21822 20956 gene locus_tag LOCUS_02230 21822 20956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 22418 21819 gene locus_tag LOCUS_02240 22418 21819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 23845 22421 gene locus_tag LOCUS_02250 23845 22421 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_02250 25263 23842 gene locus_tag LOCUS_02260 25263 23842 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_02260 25567 25911 gene locus_tag LOCUS_02270 25567 25911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 26028 26714 gene locus_tag LOCUS_02280 26028 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 26985 27209 gene locus_tag LOCUS_02290 26985 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 27288 28259 gene locus_tag LOCUS_02300 27288 28259 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210140.1 protein_id gnl|my_center|LOCUS_02300 28269 29264 gene locus_tag LOCUS_02310 28269 29264 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_02310 29261 29674 gene locus_tag LOCUS_02320 29261 29674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence0007 1320 202 gene locus_tag LOCUS_02330 gene asd 1320 202 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_02330 2489 1416 gene locus_tag LOCUS_02340 gene leuB 2489 1416 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 protein_id gnl|my_center|LOCUS_02340 3223 2576 gene locus_tag LOCUS_02350 gene leuD 3223 2576 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_02350 4747 3323 gene locus_tag LOCUS_02360 gene leuC 4747 3323 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_02360 4855 5715 gene locus_tag LOCUS_02370 4855 5715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_02370 5703 6326 gene locus_tag LOCUS_02380 5703 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6313 6531 gene locus_tag LOCUS_02390 6313 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7661 6687 gene locus_tag LOCUS_02400 gene cmoB 7661 6687 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_02400 8392 7658 gene locus_tag LOCUS_02410 gene cmoA 8392 7658 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 protein_id gnl|my_center|LOCUS_02410 8829 8452 gene locus_tag LOCUS_02420 8829 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9665 8826 gene locus_tag LOCUS_02430 9665 8826 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869030.1 protein_id gnl|my_center|LOCUS_02430 9900 9667 gene locus_tag LOCUS_02440 9900 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10120 10299 gene locus_tag LOCUS_02450 10120 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12310 10400 gene locus_tag LOCUS_02460 12310 10400 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_02460 12479 12403 gene locus_tag LOCUS_t00090 12479 12403 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12563 12488 gene locus_tag LOCUS_t00100 12563 12488 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12848 12576 gene locus_tag LOCUS_02470 12848 12576 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_02470 15571 13127 gene locus_tag LOCUS_02480 gene lon 15571 13127 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_02480 17167 15878 gene locus_tag LOCUS_02490 gene clpX 17167 15878 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_02490 17654 17481 gene locus_tag LOCUS_02500 17654 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 18267 17623 gene locus_tag LOCUS_02510 gene clpP 18267 17623 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552734.1 protein_id gnl|my_center|LOCUS_02510 19593 18283 gene locus_tag LOCUS_02520 gene tig 19593 18283 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198388.1 protein_id gnl|my_center|LOCUS_02520 19754 19670 gene locus_tag LOCUS_t00110 19754 19670 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20304 21872 gene locus_tag LOCUS_02530 20304 21872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 24097 22271 gene locus_tag LOCUS_02540 24097 22271 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_02540 25231 24101 gene locus_tag LOCUS_02550 25231 24101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 25608 25228 gene locus_tag LOCUS_02560 25608 25228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 25863 25624 gene locus_tag LOCUS_02570 gene tatA 25863 25624 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368844.1 protein_id gnl|my_center|LOCUS_02570 26262 25942 gene locus_tag LOCUS_02580 26262 25942 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105340.1 protein_id gnl|my_center|LOCUS_02580 27020 26259 gene locus_tag LOCUS_02590 gene hisF 27020 26259 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001007.1 protein_id gnl|my_center|LOCUS_02590 27759 27022 gene locus_tag LOCUS_02600 gene hisA 27759 27022 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_02600 28403 27759 gene locus_tag LOCUS_02610 gene hisH 28403 27759 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 protein_id gnl|my_center|LOCUS_02610 28993 28403 gene locus_tag LOCUS_02620 gene hisB 28993 28403 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence0008 812 45 gene locus_tag LOCUS_02630 gene soxA 812 45 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086298.1 protein_id gnl|my_center|LOCUS_02630 1315 809 gene locus_tag LOCUS_02640 gene soxX 1315 809 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_02640 1907 1290 gene locus_tag LOCUS_02650 gene rnhB 1907 1290 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 protein_id gnl|my_center|LOCUS_02650 3051 1900 gene locus_tag LOCUS_02660 gene lpxB 3051 1900 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071797.1 protein_id gnl|my_center|LOCUS_02660 3821 3051 gene locus_tag LOCUS_02670 gene lpxA 3821 3051 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071796.1 protein_id gnl|my_center|LOCUS_02670 4255 3818 gene locus_tag LOCUS_02680 gene fabZ 4255 3818 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_02680 5377 4325 gene locus_tag LOCUS_02690 gene lpxD 5377 4325 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765994.1 protein_id gnl|my_center|LOCUS_02690 5898 5395 gene locus_tag LOCUS_02700 5898 5395 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705101.1 protein_id gnl|my_center|LOCUS_02700 8301 5911 gene locus_tag LOCUS_02710 gene bamA 8301 5911 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_02710 9686 8319 gene locus_tag LOCUS_02720 gene rseP 9686 8319 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_02720 10870 9680 gene locus_tag LOCUS_02730 gene ispC 10870 9680 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_02730 11688 10867 gene locus_tag LOCUS_02740 11688 10867 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_02740 12404 11688 gene locus_tag LOCUS_02750 gene uppS 12404 11688 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071788.1 protein_id gnl|my_center|LOCUS_02750 12993 12436 gene locus_tag LOCUS_02760 gene frr 12993 12436 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705096.1 protein_id gnl|my_center|LOCUS_02760 13724 12990 gene locus_tag LOCUS_02770 gene pyrH 13724 12990 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_02770 14747 13863 gene locus_tag LOCUS_02780 gene tsf 14747 13863 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_02780 15614 14862 gene locus_tag LOCUS_02790 gene rpsB 15614 14862 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_02790 15801 16574 gene locus_tag LOCUS_02800 gene map 15801 16574 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_02800 16574 19207 gene locus_tag LOCUS_02810 16574 19207 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_02810 19882 19202 gene locus_tag LOCUS_02820 gene tsaB 19882 19202 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_02820 20135 19905 gene locus_tag LOCUS_02830 20135 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 21362 20199 gene locus_tag LOCUS_02840 21362 20199 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_02840 21634 21359 gene locus_tag LOCUS_02850 21634 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22025 21666 gene locus_tag LOCUS_02860 22025 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02860 22257 25118 gene locus_tag LOCUS_02870 22257 25118 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366703.1 protein_id gnl|my_center|LOCUS_02870 25115 26323 gene locus_tag LOCUS_02880 gene odhB 25115 26323 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958200.1 protein_id gnl|my_center|LOCUS_02880 26539 28059 gene locus_tag LOCUS_02890 26539 28059 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187501.1 protein_id gnl|my_center|LOCUS_02890 28056 28433 gene locus_tag LOCUS_02900 28056 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence0009 2813 1512 gene locus_tag LOCUS_02910 gene rhlB 2813 1512 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 protein_id gnl|my_center|LOCUS_02910 3086 3412 gene locus_tag LOCUS_02920 gene trxA 3086 3412 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_02920 3579 4838 gene locus_tag LOCUS_02930 gene rho 3579 4838 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 protein_id gnl|my_center|LOCUS_02930 4876 5550 gene locus_tag LOCUS_02940 4876 5550 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_02940 5528 6946 gene locus_tag LOCUS_02950 5528 6946 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_02950 6949 7983 gene locus_tag LOCUS_02960 6949 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8273 8617 gene locus_tag LOCUS_02970 8273 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9491 8601 gene locus_tag LOCUS_02980 gene galE 9491 8601 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_02980 9384 9653 gene locus_tag LOCUS_02990 9384 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10249 9641 gene locus_tag LOCUS_03000 10249 9641 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_03000 11211 10246 gene locus_tag LOCUS_03010 gene lipA 11211 10246 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_03010 11869 11204 gene locus_tag LOCUS_03020 gene lipB 11869 11204 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071393.1 protein_id gnl|my_center|LOCUS_03020 12167 11883 gene locus_tag LOCUS_03030 12167 11883 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021138.1 protein_id gnl|my_center|LOCUS_03030 13044 12160 gene locus_tag LOCUS_03040 13044 12160 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_03040 14204 13068 gene locus_tag LOCUS_03050 14204 13068 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444497.1 protein_id gnl|my_center|LOCUS_03050 15035 14241 gene locus_tag LOCUS_03060 15035 14241 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_03060 15984 15025 gene locus_tag LOCUS_03070 gene mltB 15984 15025 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_03070 17120 15981 gene locus_tag LOCUS_03080 gene rodA 17120 15981 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261454.1 protein_id gnl|my_center|LOCUS_03080 19009 17117 gene locus_tag LOCUS_03090 gene mrdA 19009 17117 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_03090 19487 18999 gene locus_tag LOCUS_03100 gene mreD 19487 18999 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210077.1 protein_id gnl|my_center|LOCUS_03100 20332 19484 gene locus_tag LOCUS_03110 gene mreC 20332 19484 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_03110 21483 20437 gene locus_tag LOCUS_03120 21483 20437 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_03120 21795 22094 gene locus_tag LOCUS_03130 gene gatC 21795 22094 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_03130 22091 23554 gene locus_tag LOCUS_03140 gene gatA 22091 23554 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_03140 23569 25014 gene locus_tag LOCUS_03150 gene gatB 23569 25014 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_03150 25017 25715 gene locus_tag LOCUS_03160 25017 25715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 <26390 25884 gene locus_tag LOCUS_03170 <26390 25884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000774684.1:demethylmenaquinone methyltransferase >Feature sequence0010 723 133 gene locus_tag LOCUS_03180 723 133 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_03180 1419 1108 gene locus_tag LOCUS_03190 1419 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1604 3412 gene locus_tag LOCUS_03200 gene ilvD 1604 3412 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528037.1 protein_id gnl|my_center|LOCUS_03200 3432 3953 gene locus_tag LOCUS_03210 3432 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4684 4004 gene locus_tag LOCUS_03220 4684 4004 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 protein_id gnl|my_center|LOCUS_03220 5636 4737 gene locus_tag LOCUS_03230 gene argF 5636 4737 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 protein_id gnl|my_center|LOCUS_03230 6799 5633 gene locus_tag LOCUS_03240 6799 5633 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_03240 8164 6947 gene locus_tag LOCUS_03250 8164 6947 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_03250 8393 8223 gene locus_tag LOCUS_03260 8393 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9362 8784 gene locus_tag LOCUS_03270 gene sodB 9362 8784 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_03270 9446 11035 gene locus_tag LOCUS_03280 9446 11035 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_03280 11039 12820 gene locus_tag LOCUS_03290 11039 12820 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_03290 13051 13257 gene locus_tag LOCUS_03300 13051 13257 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106983.1 protein_id gnl|my_center|LOCUS_03300 15105 13414 gene locus_tag LOCUS_03310 15105 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 15579 15109 gene locus_tag LOCUS_03320 15579 15109 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_03320 15627 18197 gene locus_tag LOCUS_03330 15627 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 18194 18820 gene locus_tag LOCUS_03340 gene fixJ 18194 18820 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_03340 19045 18827 gene locus_tag LOCUS_03350 19045 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 19568 19266 gene locus_tag LOCUS_03360 19568 19266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 19741 19562 gene locus_tag LOCUS_03370 19741 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 21296 19905 gene locus_tag LOCUS_03380 gene sthA 21296 19905 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_03380 21518 22477 gene locus_tag LOCUS_03390 21518 22477 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_03390 22470 24113 gene locus_tag LOCUS_03400 22470 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 24217 25449 gene locus_tag LOCUS_03410 24217 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence0011 2297 423 gene locus_tag LOCUS_03420 gene mnmG 2297 423 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 protein_id gnl|my_center|LOCUS_03420 2735 2370 gene locus_tag LOCUS_03430 2735 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2661 3665 gene locus_tag LOCUS_03440 2661 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3331 3430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3647 4573 gene locus_tag LOCUS_03450 3647 4573 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_03450 4570 6543 gene locus_tag LOCUS_03460 gene tgpA 4570 6543 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_03460 6636 7112 gene locus_tag LOCUS_03470 6636 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7765 7334 gene locus_tag LOCUS_03480 7765 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8928 7729 gene locus_tag LOCUS_03490 gene mnmE 8928 7729 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693343.1 protein_id gnl|my_center|LOCUS_03490 7811 7910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10610 8931 gene locus_tag LOCUS_03500 gene yidC 10610 8931 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_03500 10952 10623 gene locus_tag LOCUS_03510 gene rnpA 10952 10623 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647913.1 protein_id gnl|my_center|LOCUS_03510 11131 10997 gene locus_tag LOCUS_03520 gene rpmH 11131 10997 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 protein_id gnl|my_center|LOCUS_03520 11562 12920 gene locus_tag LOCUS_03530 gene dnaA 11562 12920 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 protein_id gnl|my_center|LOCUS_03530 13145 14257 gene locus_tag LOCUS_03540 gene dnaN 13145 14257 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_03540 14359 15447 gene locus_tag LOCUS_03550 gene recF 14359 15447 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_03550 15529 17946 gene locus_tag LOCUS_03560 gene gyrB 15529 17946 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_03560 18781 18059 gene locus_tag LOCUS_03570 18781 18059 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_03570 19335 18775 gene locus_tag LOCUS_03580 gene gmhB 19335 18775 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 protein_id gnl|my_center|LOCUS_03580 19853 19509 gene locus_tag LOCUS_03590 19853 19509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21939 19864 gene locus_tag LOCUS_03600 gene glyS 21939 19864 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291772.1 protein_id gnl|my_center|LOCUS_03600 22850 21936 gene locus_tag LOCUS_03610 gene glyQ 22850 21936 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence0012 94 309 gene locus_tag LOCUS_03620 94 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 1042 347 gene locus_tag LOCUS_03630 1042 347 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_03630 1692 1060 gene locus_tag LOCUS_03640 1692 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2762 1710 gene locus_tag LOCUS_03650 gene hypE 2762 1710 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_03650 3931 2759 gene locus_tag LOCUS_03660 gene hypD 3931 2759 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_03660 4137 3928 gene locus_tag LOCUS_03670 4137 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4669 4139 gene locus_tag LOCUS_03680 4669 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03680 4960 4682 gene locus_tag LOCUS_03690 gene hypC 4960 4682 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338277.1 protein_id gnl|my_center|LOCUS_03690 7455 4951 gene locus_tag LOCUS_03700 gene hypF 7455 4951 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817173.1 protein_id gnl|my_center|LOCUS_03700 8932 7457 gene locus_tag LOCUS_03710 8932 7457 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_03710 9945 8929 gene locus_tag LOCUS_03720 9945 8929 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_03720 11399 9963 gene locus_tag LOCUS_03730 11399 9963 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_03730 12877 11396 gene locus_tag LOCUS_03740 12877 11396 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_03740 13797 12877 gene locus_tag LOCUS_03750 13797 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 14138 13797 gene locus_tag LOCUS_03760 gene hypA 14138 13797 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_03760 15340 14138 gene locus_tag LOCUS_03770 15340 14138 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_03770 16038 15337 gene locus_tag LOCUS_03780 16038 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 16256 16035 gene locus_tag LOCUS_03790 16256 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03790 17169 16243 gene locus_tag LOCUS_03800 17169 16243 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_03800 17628 17173 gene locus_tag LOCUS_03810 17628 17173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 18087 17656 gene locus_tag LOCUS_03820 18087 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 18836 18087 gene locus_tag LOCUS_03830 18836 18087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 19115 20200 gene locus_tag LOCUS_03840 19115 20200 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_03840 20200 22005 gene locus_tag LOCUS_03850 20200 22005 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566012.1 protein_id gnl|my_center|LOCUS_03850 22020 22736 gene locus_tag LOCUS_03860 gene cybH 22020 22736 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence0013 83 676 gene locus_tag LOCUS_03870 83 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 1493 687 gene locus_tag LOCUS_03880 1493 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2874 1519 gene locus_tag LOCUS_03890 gene cpsG 2874 1519 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_03890 3420 2956 gene locus_tag LOCUS_03900 3420 2956 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_03900 3620 3545 gene locus_tag LOCUS_t00120 3620 3545 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3721 3646 gene locus_tag LOCUS_t00130 3721 3646 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5499 3838 gene locus_tag LOCUS_03910 gene glnS 5499 3838 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704748.1 protein_id gnl|my_center|LOCUS_03910 6896 5496 gene locus_tag LOCUS_03920 gene gltX 6896 5496 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_03920 7055 7678 gene locus_tag LOCUS_03930 gene lexA 7055 7678 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_03930 7675 8256 gene locus_tag LOCUS_03940 7675 8256 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_03940 9791 8280 gene locus_tag LOCUS_03950 9791 8280 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_03950 12913 9788 gene locus_tag LOCUS_03960 12913 9788 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_03960 14049 12910 gene locus_tag LOCUS_03970 14049 12910 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_03970 15032 14070 gene locus_tag LOCUS_03980 15032 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 16559 15090 gene locus_tag LOCUS_03990 gene thrC 16559 15090 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_03990 18150 16843 gene locus_tag LOCUS_04000 18150 16843 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_04000 19454 18249 gene locus_tag LOCUS_04010 gene alaC 19454 18249 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_04010 19770 20138 gene locus_tag LOCUS_04020 19770 20138 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_04020 20730 20146 gene locus_tag LOCUS_04030 20730 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 20807 22081 gene locus_tag LOCUS_04040 20807 22081 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence0014 1575 511 gene locus_tag LOCUS_04050 gene fba 1575 511 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_04050 3099 1651 gene locus_tag LOCUS_04060 gene pyk 3099 1651 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_04060 4338 3157 gene locus_tag LOCUS_04070 4338 3157 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_04070 5462 4461 gene locus_tag LOCUS_04080 gene gap 5462 4461 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_04080 7522 5531 gene locus_tag LOCUS_04090 gene tkt 7522 5531 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477253.1 protein_id gnl|my_center|LOCUS_04090 8422 7847 gene locus_tag LOCUS_04100 8422 7847 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_04100 8749 9927 gene locus_tag LOCUS_04110 gene metK 8749 9927 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_04110 10042 11436 gene locus_tag LOCUS_04120 gene ahcY 10042 11436 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198634.1 protein_id gnl|my_center|LOCUS_04120 11486 12358 gene locus_tag LOCUS_04130 gene metF 11486 12358 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_04130 12342 13073 gene locus_tag LOCUS_04140 12342 13073 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_04140 13529 13053 gene locus_tag LOCUS_04150 13529 13053 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 protein_id gnl|my_center|LOCUS_04150 19494 13522 gene locus_tag LOCUS_04160 19494 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 21609 19567 gene locus_tag LOCUS_04170 gene pilJ 21609 19567 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence0015 2255 855 gene locus_tag LOCUS_04180 2255 855 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390030.1 protein_id gnl|my_center|LOCUS_04180 2557 2267 gene locus_tag LOCUS_04190 2557 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3666 2569 gene locus_tag LOCUS_04200 3666 2569 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_04200 4818 3751 gene locus_tag LOCUS_04210 gene lptG 4818 3751 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_04210 5897 4815 gene locus_tag LOCUS_04220 gene lptF 5897 4815 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443992.1 protein_id gnl|my_center|LOCUS_04220 6100 7641 gene locus_tag LOCUS_04230 gene pepA 6100 7641 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_04230 7638 8060 gene locus_tag LOCUS_04240 7638 8060 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_04240 10351 8258 gene locus_tag LOCUS_04250 gene pnp 10351 8258 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_04250 10653 10390 gene locus_tag LOCUS_04260 gene rpsO 10653 10390 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 protein_id gnl|my_center|LOCUS_04260 11709 10783 gene locus_tag LOCUS_04270 gene truB 11709 10783 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_04270 12067 11702 gene locus_tag LOCUS_04280 gene rbfA 12067 11702 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948461.1 protein_id gnl|my_center|LOCUS_04280 14644 12080 gene locus_tag LOCUS_04290 gene infB 14644 12080 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_04290 16183 14657 gene locus_tag LOCUS_04300 gene nusA 16183 14657 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_04300 16828 16370 gene locus_tag LOCUS_04310 gene rimP 16828 16370 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_04310 17345 17034 gene locus_tag LOCUS_04320 17345 17034 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456005.1 protein_id gnl|my_center|LOCUS_04320 17785 17342 gene locus_tag LOCUS_04330 17785 17342 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_04330 19293 17785 gene locus_tag LOCUS_04340 19293 17785 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_04340 19382 19861 gene locus_tag LOCUS_04350 gene smpB 19382 19861 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0016 1897 416 gene locus_tag LOCUS_04360 1897 416 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_04360 2214 2780 gene locus_tag LOCUS_04370 2214 2780 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_04370 3215 2895 gene locus_tag LOCUS_04380 3215 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4385 3657 gene locus_tag LOCUS_04390 4385 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5103 4372 gene locus_tag LOCUS_04400 5103 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 6762 5164 gene locus_tag LOCUS_04410 6762 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 7124 6759 gene locus_tag LOCUS_04420 7124 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7182 7814 gene locus_tag LOCUS_04430 7182 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 7828 8112 gene locus_tag LOCUS_04440 7828 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_04440 8131 9825 gene locus_tag LOCUS_04450 8131 9825 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_04450 11363 9930 gene locus_tag LOCUS_04460 gene sbcB 11363 9930 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104954.1 protein_id gnl|my_center|LOCUS_04460 11793 11446 gene locus_tag LOCUS_04470 gene rplS 11793 11446 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_04470 12618 11869 gene locus_tag LOCUS_04480 gene trmD 12618 11869 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957578.1 protein_id gnl|my_center|LOCUS_04480 13160 12618 gene locus_tag LOCUS_04490 gene rimM 13160 12618 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098350.1 protein_id gnl|my_center|LOCUS_04490 13448 13185 gene locus_tag LOCUS_04500 gene rpsP 13448 13185 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653865.1 protein_id gnl|my_center|LOCUS_04500 13654 14097 gene locus_tag LOCUS_04510 13654 14097 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_04510 14112 14612 gene locus_tag LOCUS_04520 14112 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14616 16034 gene locus_tag LOCUS_04530 gene ddc 14616 16034 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693296.1 protein_id gnl|my_center|LOCUS_04530 16015 16506 gene locus_tag LOCUS_04540 16015 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 16509 17315 gene locus_tag LOCUS_04550 16509 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 17312 18220 gene locus_tag LOCUS_04560 17312 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 18220 19395 gene locus_tag LOCUS_04570 18220 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0017 673 1356 gene locus_tag LOCUS_04580 gene istB 673 1356 CDS product IS21-like element ISGsu6 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940725.1 protein_id gnl|my_center|LOCUS_04580 3642 2140 gene locus_tag LOCUS_04590 3642 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4375 3875 gene locus_tag LOCUS_04600 4375 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 6659 4353 gene locus_tag LOCUS_04610 gene gspD 6659 4353 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035910.1 protein_id gnl|my_center|LOCUS_04610 7346 6747 gene locus_tag LOCUS_04620 7346 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7924 7343 gene locus_tag LOCUS_04630 7924 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 9261 7921 gene locus_tag LOCUS_04640 9261 7921 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 protein_id gnl|my_center|LOCUS_04640 10195 9263 gene locus_tag LOCUS_04650 10195 9263 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_04650 10903 10196 gene locus_tag LOCUS_04660 10903 10196 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104493.1 protein_id gnl|my_center|LOCUS_04660 11274 10903 gene locus_tag LOCUS_04670 11274 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11726 11274 gene locus_tag LOCUS_04680 11726 11274 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246056.1 protein_id gnl|my_center|LOCUS_04680 12132 11731 gene locus_tag LOCUS_04690 gene gspG 12132 11731 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_04690 13393 12185 gene locus_tag LOCUS_04700 13393 12185 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_04700 15123 13393 gene locus_tag LOCUS_04710 gene gspE 15123 13393 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_04710 16991 15120 gene locus_tag LOCUS_04720 16991 15120 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_04720 18010 16991 gene locus_tag LOCUS_04730 18010 16991 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_04730 19400 18099 gene locus_tag LOCUS_04740 19400 18099 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0018 1226 45 gene locus_tag LOCUS_04750 1226 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1618 4275 gene locus_tag LOCUS_04760 gene aceE 1618 4275 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811941.1 protein_id gnl|my_center|LOCUS_04760 4287 5570 gene locus_tag LOCUS_04770 gene aceF 4287 5570 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_04770 5617 7374 gene locus_tag LOCUS_04780 gene lpdA 5617 7374 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_04780 7482 8252 gene locus_tag LOCUS_04790 7482 8252 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_04790 8266 9081 gene locus_tag LOCUS_04800 gene xthA 8266 9081 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_04800 9346 9143 gene locus_tag LOCUS_04810 9346 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140188.1 protein_id gnl|my_center|LOCUS_04810 10690 9407 gene locus_tag LOCUS_04820 gene mtaB 10690 9407 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_04820 11029 12543 gene locus_tag LOCUS_04830 11029 12543 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_04830 13323 12550 gene locus_tag LOCUS_04840 13323 12550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940872.1 protein_id gnl|my_center|LOCUS_04840 13965 13330 gene locus_tag LOCUS_04850 gene nth 13965 13330 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654382.1 protein_id gnl|my_center|LOCUS_04850 14657 13962 gene locus_tag LOCUS_04860 14657 13962 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_04860 15314 14667 gene locus_tag LOCUS_04870 gene rsxG 15314 14667 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_04870 16350 15307 gene locus_tag LOCUS_04880 gene rsxD 16350 15307 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_04880 17927 16347 gene locus_tag LOCUS_04890 17927 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 18493 17924 gene locus_tag LOCUS_04900 gene rsxB 18493 17924 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706450.1 protein_id gnl|my_center|LOCUS_04900 19076 18495 gene locus_tag LOCUS_04910 gene rsxA 19076 18495 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence0019 475 140 gene locus_tag LOCUS_04920 475 140 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137286.1 protein_id gnl|my_center|LOCUS_04920 1350 472 gene locus_tag LOCUS_04930 1350 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3627 1357 gene locus_tag LOCUS_04940 3627 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3762 5528 gene locus_tag LOCUS_04950 3762 5528 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_04950 6028 5564 gene locus_tag LOCUS_04960 6028 5564 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_04960 6647 6069 gene locus_tag LOCUS_04970 6647 6069 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 protein_id gnl|my_center|LOCUS_04970 8680 6647 gene locus_tag LOCUS_04980 gene prlC 8680 6647 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_04980 9132 8854 gene locus_tag LOCUS_04990 9132 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9406 10842 gene locus_tag LOCUS_05000 9406 10842 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_05000 10839 11579 gene locus_tag LOCUS_05010 10839 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 11829 13136 gene locus_tag LOCUS_05020 gene glrR 11829 13136 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703177.1 protein_id gnl|my_center|LOCUS_05020 14940 13216 gene locus_tag LOCUS_05030 14940 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_05030 15895 14948 gene locus_tag LOCUS_05040 gene aroE 15895 14948 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_05040 16036 17601 gene locus_tag LOCUS_05050 16036 17601 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_05050 17921 18802 gene locus_tag LOCUS_05060 17921 18802 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_05060 18991 18803 gene locus_tag LOCUS_05070 18991 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 >Feature sequence0020 165 1742 gene locus_tag LOCUS_05080 165 1742 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_05080 1739 5002 gene locus_tag LOCUS_05090 1739 5002 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122713.1 protein_id gnl|my_center|LOCUS_05090 4999 6519 gene locus_tag LOCUS_05100 4999 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6519 8024 gene locus_tag LOCUS_05110 6519 8024 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_05110 8037 9542 gene locus_tag LOCUS_05120 8037 9542 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_05120 9697 11661 gene locus_tag LOCUS_05130 9697 11661 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_05130 11721 13430 gene locus_tag LOCUS_05140 11721 13430 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930710.1 protein_id gnl|my_center|LOCUS_05140 14492 13455 gene locus_tag LOCUS_05150 gene pyrC 14492 13455 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_05150 15116 14718 gene locus_tag LOCUS_05160 15116 14718 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194251.1 protein_id gnl|my_center|LOCUS_05160 15566 15141 gene locus_tag LOCUS_05170 15566 15141 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194168.1 protein_id gnl|my_center|LOCUS_05170 15975 15664 gene locus_tag LOCUS_05180 15975 15664 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947973.1 protein_id gnl|my_center|LOCUS_05180 16941 15979 gene locus_tag LOCUS_05190 16941 15979 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_05190 18319 16955 gene locus_tag LOCUS_05200 18319 16955 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_05200 18453 18638 gene locus_tag LOCUS_05210 18453 18638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence0021 108 755 gene locus_tag LOCUS_05220 108 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 786 947 gene locus_tag LOCUS_05230 786 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1127 1846 gene locus_tag LOCUS_05240 1127 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2074 3321 gene locus_tag LOCUS_05250 2074 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3318 4652 gene locus_tag LOCUS_05260 3318 4652 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_05260 4654 5502 gene locus_tag LOCUS_05270 gene napG 4654 5502 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_05270 5499 6470 gene locus_tag LOCUS_05280 gene napH 5499 6470 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_05280 6539 7402 gene locus_tag LOCUS_05290 6539 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7402 7881 gene locus_tag LOCUS_05300 7402 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 7888 8715 gene locus_tag LOCUS_05310 7888 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 8725 9192 gene locus_tag LOCUS_05320 8725 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 9196 10575 gene locus_tag LOCUS_05330 9196 10575 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554846.1 protein_id gnl|my_center|LOCUS_05330 10575 12254 gene locus_tag LOCUS_05340 gene menD 10575 12254 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989780.1 protein_id gnl|my_center|LOCUS_05340 12288 13109 gene locus_tag LOCUS_05350 gene menB 12288 13109 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639989.1 protein_id gnl|my_center|LOCUS_05350 13112 13984 gene locus_tag LOCUS_05360 13112 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 14160 15920 gene locus_tag LOCUS_05370 gene sppA 14160 15920 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_05370 16003 16629 gene locus_tag LOCUS_05380 16003 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 16998 16663 gene locus_tag LOCUS_05390 16998 16663 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929408.1 protein_id gnl|my_center|LOCUS_05390 17459 17034 gene locus_tag LOCUS_05400 17459 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 17952 17554 gene locus_tag LOCUS_05410 17952 17554 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217625.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence0022 149 472 gene locus_tag LOCUS_05420 149 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 487 879 gene locus_tag LOCUS_05430 487 879 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_05430 881 1339 gene locus_tag LOCUS_05440 881 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 2468 1359 gene locus_tag LOCUS_05450 2468 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2828 2514 gene locus_tag LOCUS_05460 2828 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4139 2844 gene locus_tag LOCUS_05470 gene cobB 4139 2844 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_05470 5526 4303 gene locus_tag LOCUS_05480 gene hmeB 5526 4303 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_05480 6314 5553 gene locus_tag LOCUS_05490 gene hmeA 6314 5553 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_05490 6697 6317 gene locus_tag LOCUS_05500 gene dsrJ 6697 6317 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754260.1 protein_id gnl|my_center|LOCUS_05500 8668 6719 gene locus_tag LOCUS_05510 8668 6719 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_05510 10274 8739 gene locus_tag LOCUS_05520 10274 8739 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_05520 11039 10320 gene locus_tag LOCUS_05530 gene dsrM 11039 10320 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_05530 11449 11117 gene locus_tag LOCUS_05540 11449 11117 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_05540 11805 11497 gene locus_tag LOCUS_05550 gene tusB 11805 11497 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_05550 12223 11816 gene locus_tag LOCUS_05560 gene tusC 12223 11816 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_05560 12631 12239 gene locus_tag LOCUS_05570 gene tusD 12631 12239 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_05570 13723 12650 gene locus_tag LOCUS_05580 gene dsrB 13723 12650 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_05580 15068 13809 gene locus_tag LOCUS_05590 gene dsrA 15068 13809 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_05590 15579 15779 gene locus_tag LOCUS_05600 15579 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 15785 16489 gene locus_tag LOCUS_05610 15785 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 16493 17185 gene locus_tag LOCUS_05620 16493 17185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 17276 17620 gene locus_tag LOCUS_05630 17276 17620 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706490.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence0023 1016 129 gene locus_tag LOCUS_05640 1016 129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868768.1 protein_id gnl|my_center|LOCUS_05640 1966 1013 gene locus_tag LOCUS_05650 1966 1013 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_05650 4162 2069 gene locus_tag LOCUS_05660 4162 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4161 4646 gene locus_tag LOCUS_05670 4161 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4784 5614 gene locus_tag LOCUS_05680 4784 5614 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_05680 5616 6236 gene locus_tag LOCUS_05690 5616 6236 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_05690 6270 6944 gene locus_tag LOCUS_05700 6270 6944 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_05700 6988 8205 gene locus_tag LOCUS_05710 6988 8205 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_05710 8202 9047 gene locus_tag LOCUS_05720 8202 9047 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_05720 9044 9799 gene locus_tag LOCUS_05730 gene scpB 9044 9799 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404130.1 protein_id gnl|my_center|LOCUS_05730 9783 10622 gene locus_tag LOCUS_05740 9783 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10686 11726 gene locus_tag LOCUS_05750 10686 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 11763 13664 gene locus_tag LOCUS_05760 11763 13664 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261137.1 protein_id gnl|my_center|LOCUS_05760 13661 17224 gene locus_tag LOCUS_05770 13661 17224 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_05770 17490 17203 gene locus_tag LOCUS_05780 17490 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence0024 214 570 gene locus_tag LOCUS_05790 214 570 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_05790 561 1058 gene locus_tag LOCUS_05800 561 1058 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_05800 1055 1768 gene locus_tag LOCUS_05810 1055 1768 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_05810 1761 3014 gene locus_tag LOCUS_05820 1761 3014 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_05820 3014 3559 gene locus_tag LOCUS_05830 gene nuoE 3014 3559 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_05830 3549 4823 gene locus_tag LOCUS_05840 gene nuoF 3549 4823 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_05840 4830 7148 gene locus_tag LOCUS_05850 gene nuoG 4830 7148 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_05850 7148 8188 gene locus_tag LOCUS_05860 gene nuoH 7148 8188 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017378.1 protein_id gnl|my_center|LOCUS_05860 8202 8702 gene locus_tag LOCUS_05870 gene nuoI 8202 8702 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_05870 8710 9315 gene locus_tag LOCUS_05880 8710 9315 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_05880 9315 9620 gene locus_tag LOCUS_05890 gene nuoK 9315 9620 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_05890 9625 11601 gene locus_tag LOCUS_05900 gene nuoL 9625 11601 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_05900 11608 13122 gene locus_tag LOCUS_05910 11608 13122 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_05910 13138 14592 gene locus_tag LOCUS_05920 gene nuoN 13138 14592 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_05920 14797 15102 gene locus_tag LOCUS_05930 14797 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 15153 15836 gene locus_tag LOCUS_05940 15153 15836 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_05940 15836 17215 gene locus_tag LOCUS_05950 15836 17215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_05950 17318 17662 gene locus_tag LOCUS_05960 17318 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence0025 1355 126 gene locus_tag LOCUS_05970 gene ftsA 1355 126 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_05970 2080 1355 gene locus_tag LOCUS_05980 2080 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 2961 2077 gene locus_tag LOCUS_05990 2961 2077 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_05990 3899 3000 gene locus_tag LOCUS_06000 gene murB 3899 3000 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_06000 4065 3883 gene locus_tag LOCUS_06010 4065 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5492 4053 gene locus_tag LOCUS_06020 gene murC 5492 4053 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_06020 6556 5489 gene locus_tag LOCUS_06030 gene murG 6556 5489 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_06030 7713 6544 gene locus_tag LOCUS_06040 gene ftsW 7713 6544 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 protein_id gnl|my_center|LOCUS_06040 9074 7710 gene locus_tag LOCUS_06050 gene murD 9074 7710 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_06050 10165 9083 gene locus_tag LOCUS_06060 gene mraY 10165 9083 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_06060 11529 10159 gene locus_tag LOCUS_06070 11529 10159 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_06070 13046 11526 gene locus_tag LOCUS_06080 13046 11526 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769454.1 protein_id gnl|my_center|LOCUS_06080 14809 13046 gene locus_tag LOCUS_06090 14809 13046 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_06090 15083 14799 gene locus_tag LOCUS_06100 15083 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 16018 15080 gene locus_tag LOCUS_06110 gene rsmH 16018 15080 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095568.1 protein_id gnl|my_center|LOCUS_06110 16477 16019 gene locus_tag LOCUS_06120 gene mraZ 16477 16019 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence0026 418 960 gene locus_tag LOCUS_06130 gene hslV 418 960 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_06130 960 2300 gene locus_tag LOCUS_06140 gene hslU 960 2300 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_06140 2382 2750 gene locus_tag LOCUS_06150 2382 2750 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_06150 2867 3619 gene locus_tag LOCUS_06160 gene ubiE 2867 3619 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 protein_id gnl|my_center|LOCUS_06160 3632 4255 gene locus_tag LOCUS_06170 3632 4255 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_06170 4255 5907 gene locus_tag LOCUS_06180 gene ubiB 4255 5907 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_06180 7176 5821 gene locus_tag LOCUS_06190 7176 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7792 7238 gene locus_tag LOCUS_06200 7792 7238 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_06200 9145 7850 gene locus_tag LOCUS_06210 gene cptA 9145 7850 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_06210 10353 9193 gene locus_tag LOCUS_06220 10353 9193 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_06220 11927 10353 gene locus_tag LOCUS_06230 gene gpmI 11927 10353 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_06230 12362 12718 gene locus_tag LOCUS_06240 12362 12718 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_06240 12816 13238 gene locus_tag LOCUS_06250 12816 13238 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208978.1 protein_id gnl|my_center|LOCUS_06250 13268 13723 gene locus_tag LOCUS_06260 gene secB 13268 13723 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_06260 13733 14740 gene locus_tag LOCUS_06270 gene gpsA 13733 14740 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070467.1 protein_id gnl|my_center|LOCUS_06270 15272 14808 gene locus_tag LOCUS_06280 gene trmL 15272 14808 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094923.1 protein_id gnl|my_center|LOCUS_06280 15297 16256 gene locus_tag LOCUS_06290 15297 16256 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence0027 730 116 gene locus_tag LOCUS_06300 730 116 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403056.1 protein_id gnl|my_center|LOCUS_06300 2494 734 gene locus_tag LOCUS_06310 gene argS 2494 734 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_06310 2616 3293 gene locus_tag LOCUS_06320 2616 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 5482 3287 gene locus_tag LOCUS_06330 5482 3287 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_06330 5816 6493 gene locus_tag LOCUS_06340 5816 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6568 7365 gene locus_tag LOCUS_06350 6568 7365 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_06350 7472 7912 gene locus_tag LOCUS_06360 7472 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8569 8060 gene locus_tag LOCUS_06370 gene folA 8569 8060 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_06370 8765 8631 gene locus_tag LOCUS_06380 8765 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 9812 8979 gene locus_tag LOCUS_06390 9812 8979 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211826335.1 protein_id gnl|my_center|LOCUS_06390 10660 9809 gene locus_tag LOCUS_06400 gene lgt 10660 9809 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_06400 11860 10664 gene locus_tag LOCUS_06410 11860 10664 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_06410 11952 13121 gene locus_tag LOCUS_06420 11952 13121 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_06420 13121 14284 gene locus_tag LOCUS_06430 13121 14284 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705059.1 protein_id gnl|my_center|LOCUS_06430 14850 14281 gene locus_tag LOCUS_06440 14850 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15333 14896 gene locus_tag LOCUS_06450 15333 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 15747 15376 gene locus_tag LOCUS_06460 15747 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 16449 15799 gene locus_tag LOCUS_06470 16449 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence0028 310 1071 gene locus_tag LOCUS_06480 310 1071 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_06480 1210 1845 gene locus_tag LOCUS_06490 gene ccmA 1210 1845 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 protein_id gnl|my_center|LOCUS_06490 1838 2506 gene locus_tag LOCUS_06500 gene ccmB 1838 2506 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_06500 2642 3376 gene locus_tag LOCUS_06510 gene ccmC 2642 3376 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_06510 3373 3552 gene locus_tag LOCUS_06520 3373 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3549 4010 gene locus_tag LOCUS_06530 gene ccmE 3549 4010 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532635.1 protein_id gnl|my_center|LOCUS_06530 4007 5959 gene locus_tag LOCUS_06540 4007 5959 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_06540 5956 6489 gene locus_tag LOCUS_06550 5956 6489 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_06550 6489 6950 gene locus_tag LOCUS_06560 6489 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6950 8212 gene locus_tag LOCUS_06570 gene ccmI 6950 8212 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_06570 9495 8410 gene locus_tag LOCUS_06580 9495 8410 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_06580 9534 10874 gene locus_tag LOCUS_06590 9534 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 11590 10850 gene locus_tag LOCUS_06600 gene olsA 11590 10850 CDS product lyso-ornithine lipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_06600 12138 11587 gene locus_tag LOCUS_06610 12138 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12196 14067 gene locus_tag LOCUS_06620 gene dxs 12196 14067 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103240.1 protein_id gnl|my_center|LOCUS_06620 15011 14142 gene locus_tag LOCUS_06630 15011 14142 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_06630 15587 15162 gene locus_tag LOCUS_06640 15587 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 16588 15521 gene locus_tag LOCUS_06650 16588 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 >Feature sequence0029 196 3060 gene locus_tag LOCUS_06660 196 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3123 3911 gene locus_tag LOCUS_06670 gene truA 3123 3911 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_06670 3921 4544 gene locus_tag LOCUS_06680 3921 4544 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_06680 4552 5742 gene locus_tag LOCUS_06690 gene trpB 4552 5742 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947035.1 protein_id gnl|my_center|LOCUS_06690 5739 6545 gene locus_tag LOCUS_06700 gene trpA 5739 6545 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_06700 6586 7449 gene locus_tag LOCUS_06710 gene accD 6586 7449 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_06710 7466 8743 gene locus_tag LOCUS_06720 gene folC 7466 8743 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_06720 9067 8813 gene locus_tag LOCUS_06730 9067 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 9506 9042 gene locus_tag LOCUS_06740 9506 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10487 9636 gene locus_tag LOCUS_06750 10487 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10669 11298 gene locus_tag LOCUS_06760 10669 11298 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_06760 11313 11891 gene locus_tag LOCUS_06770 11313 11891 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_06770 11968 13482 gene locus_tag LOCUS_06780 gene purF 11968 13482 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381064.1 protein_id gnl|my_center|LOCUS_06780 13484 14668 gene locus_tag LOCUS_06790 13484 14668 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_06790 14665 15249 gene locus_tag LOCUS_06800 14665 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 15250 15858 gene locus_tag LOCUS_06810 15250 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06810 15843 16301 gene locus_tag LOCUS_06820 15843 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06820 >Feature sequence0030 213 428 gene locus_tag LOCUS_06830 213 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 493 723 gene locus_tag LOCUS_06840 493 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2778 724 gene locus_tag LOCUS_06850 2778 724 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682194.1 protein_id gnl|my_center|LOCUS_06850 2777 3685 gene locus_tag LOCUS_06860 2777 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3687 4997 gene locus_tag LOCUS_06870 3687 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5029 6372 gene locus_tag LOCUS_06880 5029 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6804 7172 gene locus_tag LOCUS_06890 6804 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7226 13672 gene locus_tag LOCUS_06900 7226 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13801 14235 gene locus_tag LOCUS_06910 13801 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 14232 15656 gene locus_tag LOCUS_06920 14232 15656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15671 16174 gene locus_tag LOCUS_06930 15671 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 16186 16443 gene locus_tag LOCUS_06940 16186 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 >Feature sequence0031 212 27 gene locus_tag LOCUS_06950 212 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 763 278 gene locus_tag LOCUS_06960 763 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 800 976 gene locus_tag LOCUS_06970 800 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1017 3089 gene locus_tag LOCUS_06980 1017 3089 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_06980 3086 4207 gene locus_tag LOCUS_06990 3086 4207 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_06990 4313 5440 gene locus_tag LOCUS_07000 4313 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5437 6708 gene locus_tag LOCUS_07010 5437 6708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071651.1 protein_id gnl|my_center|LOCUS_07010 6705 7346 gene locus_tag LOCUS_07020 6705 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_07020 7343 7765 gene locus_tag LOCUS_07030 7343 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7762 9174 gene locus_tag LOCUS_07040 7762 9174 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_07040 9174 13328 gene locus_tag LOCUS_07050 9174 13328 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_07050 13318 15003 gene locus_tag LOCUS_07060 13318 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence0032 192 617 gene locus_tag LOCUS_07070 192 617 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_07070 2438 639 gene locus_tag LOCUS_07080 gene recD 2438 639 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775983.1 protein_id gnl|my_center|LOCUS_07080 5892 2431 gene locus_tag LOCUS_07090 gene recB 5892 2431 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 protein_id gnl|my_center|LOCUS_07090 9104 5889 gene locus_tag LOCUS_07100 gene recC 9104 5889 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022201.1 protein_id gnl|my_center|LOCUS_07100 9811 9098 gene locus_tag LOCUS_07110 9811 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 10497 9802 gene locus_tag LOCUS_07120 gene aat 10497 9802 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_07120 11457 10501 gene locus_tag LOCUS_07130 gene trxB 11457 10501 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_07130 11517 12569 gene locus_tag LOCUS_07140 gene ald 11517 12569 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338437.1 protein_id gnl|my_center|LOCUS_07140 12573 13259 gene locus_tag LOCUS_07150 gene pdsR 12573 13259 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_07150 13256 14122 gene locus_tag LOCUS_07160 13256 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 14216 15283 gene locus_tag LOCUS_07170 14216 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07170 16043 15312 gene locus_tag LOCUS_07180 16043 15312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence0033 164 2227 gene locus_tag LOCUS_07190 164 2227 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_07190 2239 2940 gene locus_tag LOCUS_07200 2239 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2954 3433 gene locus_tag LOCUS_07210 2954 3433 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_07210 3509 6463 gene locus_tag LOCUS_07220 3509 6463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6472 6681 gene locus_tag LOCUS_07230 6472 6681 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_07230 6674 7165 gene locus_tag LOCUS_07240 6674 7165 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_07240 7741 7265 gene locus_tag LOCUS_07250 7741 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07250 8426 7725 gene locus_tag LOCUS_07260 8426 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07260 11232 8467 gene locus_tag LOCUS_07270 11232 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 11938 12882 gene locus_tag LOCUS_07280 gene rluC 11938 12882 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_07280 12875 13531 gene locus_tag LOCUS_07290 12875 13531 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_07290 13590 14012 gene locus_tag LOCUS_07300 13590 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14603 14025 gene locus_tag LOCUS_07310 14603 14025 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_07310 15502 14603 gene locus_tag LOCUS_07320 gene ppk2 15502 14603 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241473.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0034 612 79 gene locus_tag LOCUS_07330 612 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1149 631 gene locus_tag LOCUS_07340 1149 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1328 2761 gene locus_tag LOCUS_07350 1328 2761 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_07350 2881 3801 gene locus_tag LOCUS_07360 2881 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3956 6385 gene locus_tag LOCUS_07370 3956 6385 CDS product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087338.1 protein_id gnl|my_center|LOCUS_07370 6523 6900 gene locus_tag LOCUS_07380 6523 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6905 7435 gene locus_tag LOCUS_07390 6905 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7416 8699 gene locus_tag LOCUS_07400 7416 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7436 7535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8743 9648 gene locus_tag LOCUS_07410 8743 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 9645 10838 gene locus_tag LOCUS_07420 gene trhU 9645 10838 CDS product IncHI-type conjugal transfer protein TrhU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011070.1 protein_id gnl|my_center|LOCUS_07420 11130 14525 gene locus_tag LOCUS_07430 11130 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 14522 15436 gene locus_tag LOCUS_07440 14522 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence0035 169 606 gene locus_tag LOCUS_07450 169 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 740 1387 gene locus_tag LOCUS_07460 gene adk 740 1387 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 protein_id gnl|my_center|LOCUS_07460 1477 1860 gene locus_tag LOCUS_07470 gene trxA 1477 1860 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224532.1 protein_id gnl|my_center|LOCUS_07470 2019 2492 gene locus_tag LOCUS_07480 2019 2492 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212183.1 protein_id gnl|my_center|LOCUS_07480 2561 3034 gene locus_tag LOCUS_07490 gene iscR 2561 3034 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_07490 3100 3630 gene locus_tag LOCUS_07500 3100 3630 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390869.1 protein_id gnl|my_center|LOCUS_07500 3652 3822 gene locus_tag LOCUS_07510 gene rpmF 3652 3822 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771287.1 protein_id gnl|my_center|LOCUS_07510 3880 4908 gene locus_tag LOCUS_07520 gene plsX 3880 4908 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_07520 4905 5882 gene locus_tag LOCUS_07530 4905 5882 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_07530 5948 6835 gene locus_tag LOCUS_07540 gene fabD 5948 6835 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_07540 6828 7571 gene locus_tag LOCUS_07550 gene fabG 6828 7571 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770626.1 protein_id gnl|my_center|LOCUS_07550 7744 7977 gene locus_tag LOCUS_07560 gene acpP 7744 7977 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_07560 8092 9336 gene locus_tag LOCUS_07570 gene fabF 8092 9336 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_07570 9333 10142 gene locus_tag LOCUS_07580 gene pabC 9333 10142 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_07580 10142 11161 gene locus_tag LOCUS_07590 gene mltG 10142 11161 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_07590 11161 11799 gene locus_tag LOCUS_07600 gene tmk 11161 11799 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771257.1 protein_id gnl|my_center|LOCUS_07600 11865 12776 gene locus_tag LOCUS_07610 11865 12776 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_07610 12746 13129 gene locus_tag LOCUS_07620 12746 13129 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_07620 13218 13991 gene locus_tag LOCUS_07630 13218 13991 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_07630 14220 14017 gene locus_tag LOCUS_07640 14220 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0036 3 290 gene locus_tag LOCUS_07650 3 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 580 1788 gene locus_tag LOCUS_07660 gene trbL 580 1788 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 protein_id gnl|my_center|LOCUS_07660 1856 2563 gene locus_tag LOCUS_07670 gene trbJ 1856 2563 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_07670 2574 2969 gene locus_tag LOCUS_07680 2574 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2981 4591 gene locus_tag LOCUS_07690 gene trbL 2981 4591 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039738.1 protein_id gnl|my_center|LOCUS_07690 4612 5076 gene locus_tag LOCUS_07700 4612 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082960809.1 protein_id gnl|my_center|LOCUS_07700 5085 5618 gene locus_tag LOCUS_07710 5085 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5622 6326 gene locus_tag LOCUS_07720 5622 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6329 6523 gene locus_tag LOCUS_07730 6329 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 6523 6702 gene locus_tag LOCUS_07740 6523 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6851 9079 gene locus_tag LOCUS_07750 gene cas3 6851 9079 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_07750 9099 9755 gene locus_tag LOCUS_07760 gene cas5c 9099 9755 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_07760 9752 11548 gene locus_tag LOCUS_07770 gene cas8c 9752 11548 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_07770 11545 12429 gene locus_tag LOCUS_07780 gene cas7c 11545 12429 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_07780 12522 12621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12703 12915 gene locus_tag LOCUS_07790 12703 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12903 13127 gene locus_tag LOCUS_07800 12903 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 13132 13758 gene locus_tag LOCUS_07810 gene cas4 13132 13758 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_07810 13755 14789 gene locus_tag LOCUS_07820 gene cas1c 13755 14789 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_07820 14799 15089 gene locus_tag LOCUS_07830 gene cas2 14799 15089 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence0037 87 359 gene locus_tag LOCUS_07840 87 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1599 1114 gene locus_tag LOCUS_07850 1599 1114 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766220.1 protein_id gnl|my_center|LOCUS_07850 3227 1596 gene locus_tag LOCUS_07860 gene nadB 3227 1596 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_07860 3369 3947 gene locus_tag LOCUS_07870 gene rpoE 3369 3947 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_07870 3960 4559 gene locus_tag LOCUS_07880 3960 4559 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_07880 4564 5562 gene locus_tag LOCUS_07890 4564 5562 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_07890 5599 6105 gene locus_tag LOCUS_07900 gene rseC 5599 6105 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703183.1 protein_id gnl|my_center|LOCUS_07900 6095 7522 gene locus_tag LOCUS_07910 gene mucD 6095 7522 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_07910 7631 9481 gene locus_tag LOCUS_07920 gene lepA 7631 9481 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_07920 9506 10393 gene locus_tag LOCUS_07930 gene lepB 9506 10393 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 protein_id gnl|my_center|LOCUS_07930 10407 10778 gene locus_tag LOCUS_07940 10407 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 10792 11469 gene locus_tag LOCUS_07950 gene rnc 10792 11469 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071557.1 protein_id gnl|my_center|LOCUS_07950 11466 12353 gene locus_tag LOCUS_07960 gene era 11466 12353 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_07960 12367 13071 gene locus_tag LOCUS_07970 gene recO 12367 13071 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_07970 13101 13835 gene locus_tag LOCUS_07980 gene pdxJ 13101 13835 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_07980 15100 13817 gene locus_tag LOCUS_07990 15100 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence0038 256 2355 gene locus_tag LOCUS_08000 gene fimX 256 2355 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_08000 3291 2365 gene locus_tag LOCUS_08010 3291 2365 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005617359.1 protein_id gnl|my_center|LOCUS_08010 3796 3293 gene locus_tag LOCUS_08020 3796 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4532 3894 gene locus_tag LOCUS_08030 4532 3894 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387714.1 protein_id gnl|my_center|LOCUS_08030 9015 4867 gene locus_tag LOCUS_08040 9015 4867 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_08040 10424 9273 gene locus_tag LOCUS_08050 10424 9273 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_08050 10926 10531 gene locus_tag LOCUS_08060 10926 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11534 13054 gene locus_tag LOCUS_08070 11534 13054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13068 13970 gene locus_tag LOCUS_08080 13068 13970 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_08080 14018 15076 gene locus_tag LOCUS_08090 gene nadA 14018 15076 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072333.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence0039 327 76 gene locus_tag LOCUS_08100 327 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 417 698 gene locus_tag LOCUS_08110 417 698 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556002.1 protein_id gnl|my_center|LOCUS_08110 4259 873 gene locus_tag LOCUS_08120 4259 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 4454 4263 gene locus_tag LOCUS_08130 4454 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6529 4469 gene locus_tag LOCUS_08140 6529 4469 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765275.1 protein_id gnl|my_center|LOCUS_08140 7066 6542 gene locus_tag LOCUS_08150 gene traF 7066 6542 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_08150 8970 7063 gene locus_tag LOCUS_08160 8970 7063 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_08160 11195 8967 gene locus_tag LOCUS_08170 11195 8967 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 protein_id gnl|my_center|LOCUS_08170 11591 11214 gene locus_tag LOCUS_08180 gene traJ 11591 11214 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 protein_id gnl|my_center|LOCUS_08180 11847 11584 gene locus_tag LOCUS_08190 11847 11584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12248 12625 gene locus_tag LOCUS_08200 12248 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 12625 13350 gene locus_tag LOCUS_08210 12625 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 13350 13775 gene locus_tag LOCUS_08220 13350 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 15093 13768 gene locus_tag LOCUS_08230 15093 13768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0040 928 1911 gene locus_tag LOCUS_08240 928 1911 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_08240 2337 2161 gene locus_tag LOCUS_08250 2337 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2944 4446 gene locus_tag LOCUS_08260 2944 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 7232 4476 gene locus_tag LOCUS_08270 7232 4476 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117924.1 protein_id gnl|my_center|LOCUS_08270 10273 7247 gene locus_tag LOCUS_08280 10273 7247 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459048.1 protein_id gnl|my_center|LOCUS_08280 10957 10277 gene locus_tag LOCUS_08290 10957 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14084 10962 gene locus_tag LOCUS_08300 14084 10962 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117919.1 protein_id gnl|my_center|LOCUS_08300 14278 14081 gene locus_tag LOCUS_08310 14278 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14584 14393 gene locus_tag LOCUS_08320 14584 14393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence0041 1907 432 gene locus_tag LOCUS_08330 1907 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2707 1904 gene locus_tag LOCUS_08340 2707 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3627 2704 gene locus_tag LOCUS_08350 3627 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3689 4528 gene locus_tag LOCUS_08360 3689 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 4532 5941 gene locus_tag LOCUS_08370 4532 5941 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105266.1 protein_id gnl|my_center|LOCUS_08370 5989 7725 gene locus_tag LOCUS_08380 5989 7725 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377131.1 protein_id gnl|my_center|LOCUS_08380 7718 8788 gene locus_tag LOCUS_08390 gene rffG 7718 8788 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261022.1 protein_id gnl|my_center|LOCUS_08390 8785 9660 gene locus_tag LOCUS_08400 gene rfbA 8785 9660 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_08400 9657 10226 gene locus_tag LOCUS_08410 gene rfbC 9657 10226 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_08410 10213 11124 gene locus_tag LOCUS_08420 gene rfbD 10213 11124 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_08420 11131 12057 gene locus_tag LOCUS_08430 11131 12057 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_08430 12058 13851 gene locus_tag LOCUS_08440 gene msbA 12058 13851 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704886.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0042 809 351 gene locus_tag LOCUS_08450 809 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1176 1589 gene locus_tag LOCUS_08460 1176 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2181 1738 gene locus_tag LOCUS_08470 2181 1738 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300228.1 protein_id gnl|my_center|LOCUS_08470 2577 4079 gene locus_tag LOCUS_08480 gene murJ 2577 4079 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_08480 4139 4942 gene locus_tag LOCUS_08490 4139 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4846 5052 gene locus_tag LOCUS_08500 4846 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5054 5983 gene locus_tag LOCUS_08510 gene ribF 5054 5983 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_08510 6012 8828 gene locus_tag LOCUS_08520 gene ileS 6012 8828 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073365.1 protein_id gnl|my_center|LOCUS_08520 8821 9306 gene locus_tag LOCUS_08530 gene lspA 8821 9306 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210508.1 protein_id gnl|my_center|LOCUS_08530 9552 9651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10731 9913 gene locus_tag LOCUS_08540 10731 9913 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_08540 11195 10731 gene locus_tag LOCUS_08550 gene ampD 11195 10731 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_08550 11573 13765 gene locus_tag LOCUS_08560 11573 13765 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 protein_id gnl|my_center|LOCUS_08560 13863 14447 gene locus_tag LOCUS_08570 13863 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence0043 224 670 gene locus_tag LOCUS_08580 224 670 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_08580 667 1359 gene locus_tag LOCUS_08590 667 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2851 1385 gene locus_tag LOCUS_08600 gene glgA 2851 1385 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209498.1 protein_id gnl|my_center|LOCUS_08600 5019 2848 gene locus_tag LOCUS_08610 gene glgB 5019 2848 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_08610 6386 5016 gene locus_tag LOCUS_08620 gene malQ 6386 5016 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940406.1 protein_id gnl|my_center|LOCUS_08620 8089 6389 gene locus_tag LOCUS_08630 8089 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9408 8086 gene locus_tag LOCUS_08640 gene glgC 9408 8086 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_08640 11118 9460 gene locus_tag LOCUS_08650 gene pgi 11118 9460 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817308.1 protein_id gnl|my_center|LOCUS_08650 12014 11304 gene locus_tag LOCUS_08660 12014 11304 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_08660 12162 14078 gene locus_tag LOCUS_08670 12162 14078 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0044 650 99 gene locus_tag LOCUS_08680 650 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1403 726 gene locus_tag LOCUS_08690 1403 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3168 1564 gene locus_tag LOCUS_08700 3168 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 3609 3181 gene locus_tag LOCUS_08710 3609 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5541 3616 gene locus_tag LOCUS_08720 5541 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6757 5531 gene locus_tag LOCUS_08730 6757 5531 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_08730 7236 6754 gene locus_tag LOCUS_08740 gene vsr 7236 6754 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_08740 8536 7229 gene locus_tag LOCUS_08750 8536 7229 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_08750 8865 9074 gene locus_tag LOCUS_08760 8865 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10647 9082 gene locus_tag LOCUS_08770 10647 9082 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 protein_id gnl|my_center|LOCUS_08770 11027 10659 gene locus_tag LOCUS_08780 11027 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12321 11011 gene locus_tag LOCUS_08790 12321 11011 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_08790 13412 12372 gene locus_tag LOCUS_08800 13412 12372 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038228.1 protein_id gnl|my_center|LOCUS_08800 13648 13415 gene locus_tag LOCUS_08810 13648 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence0045 156 356 gene locus_tag LOCUS_08820 156 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1072 350 gene locus_tag LOCUS_08830 gene cysZ 1072 350 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_08830 1557 1069 gene locus_tag LOCUS_08840 1557 1069 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_08840 1828 3159 gene locus_tag LOCUS_08850 1828 3159 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_08850 3220 4920 gene locus_tag LOCUS_08860 3220 4920 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_08860 4917 5993 gene locus_tag LOCUS_08870 4917 5993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_08870 6806 6003 gene locus_tag LOCUS_08880 6806 6003 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_08880 7487 6837 gene locus_tag LOCUS_08890 7487 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 7619 9343 gene locus_tag LOCUS_08900 gene recJ 7619 9343 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_08900 9340 9885 gene locus_tag LOCUS_08910 gene yjgA 9340 9885 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166277.1 protein_id gnl|my_center|LOCUS_08910 9891 10274 gene locus_tag LOCUS_08920 gene sdhC 9891 10274 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_08920 10268 10606 gene locus_tag LOCUS_08930 gene sdhD 10268 10606 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223854.1 protein_id gnl|my_center|LOCUS_08930 10603 12366 gene locus_tag LOCUS_08940 gene sdhA 10603 12366 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_08940 12366 13061 gene locus_tag LOCUS_08950 12366 13061 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072029.1 protein_id gnl|my_center|LOCUS_08950 13058 13303 gene locus_tag LOCUS_08960 13058 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 13792 13403 gene locus_tag LOCUS_08970 13792 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence0046 138 1322 gene locus_tag LOCUS_08980 138 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1322 2140 gene locus_tag LOCUS_08990 1322 2140 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_08990 2287 3012 gene locus_tag LOCUS_09000 gene rph 2287 3012 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_09000 3816 3103 gene locus_tag LOCUS_09010 3816 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4594 4842 gene locus_tag LOCUS_09020 4594 4842 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_09020 4897 5391 gene locus_tag LOCUS_09030 4897 5391 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946402.1 protein_id gnl|my_center|LOCUS_09030 6267 5524 gene locus_tag LOCUS_09040 6267 5524 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244437.1 protein_id gnl|my_center|LOCUS_09040 7986 6283 gene locus_tag LOCUS_09050 7986 6283 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531851.1 protein_id gnl|my_center|LOCUS_09050 8534 7983 gene locus_tag LOCUS_09060 8534 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8944 8531 gene locus_tag LOCUS_09070 8944 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9121 9717 gene locus_tag LOCUS_09080 9121 9717 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_09080 9710 10696 gene locus_tag LOCUS_09090 9710 10696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 11183 10707 gene locus_tag LOCUS_09100 11183 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 11956 11153 gene locus_tag LOCUS_09110 11956 11153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12042 12980 gene locus_tag LOCUS_09120 gene ispH 12042 12980 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769262.1 protein_id gnl|my_center|LOCUS_09120 13112 13663 gene locus_tag LOCUS_09130 13112 13663 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence0047 1688 258 gene locus_tag LOCUS_09140 1688 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1881 2471 gene locus_tag LOCUS_09150 1881 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2962 2498 gene locus_tag LOCUS_09160 2962 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3027 3503 gene locus_tag LOCUS_09170 3027 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3503 4792 gene locus_tag LOCUS_09180 3503 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4776 7343 gene locus_tag LOCUS_09190 4776 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7412 8440 gene locus_tag LOCUS_09200 7412 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 8492 8920 gene locus_tag LOCUS_09210 8492 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8933 9679 gene locus_tag LOCUS_09220 8933 9679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9717 10055 gene locus_tag LOCUS_09230 9717 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10061 11824 gene locus_tag LOCUS_09240 10061 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 11736 12497 gene locus_tag LOCUS_09250 11736 12497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 13175 12636 gene locus_tag LOCUS_09260 13175 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence0048 453 1448 gene locus_tag LOCUS_09270 453 1448 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_09270 2103 1501 gene locus_tag LOCUS_09280 gene can 2103 1501 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_09280 4090 2282 gene locus_tag LOCUS_09290 4090 2282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_09290 4173 4982 gene locus_tag LOCUS_09300 4173 4982 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_09300 4994 6292 gene locus_tag LOCUS_09310 gene tolC 4994 6292 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_09310 6292 7389 gene locus_tag LOCUS_09320 gene aroC 6292 7389 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_09320 7399 8550 gene locus_tag LOCUS_09330 7399 8550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_09330 8547 9791 gene locus_tag LOCUS_09340 8547 9791 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972901.1 protein_id gnl|my_center|LOCUS_09340 9784 12924 gene locus_tag LOCUS_09350 9784 12924 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence0049 766 5 gene locus_tag LOCUS_09360 gene fnr 766 5 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244356.1 protein_id gnl|my_center|LOCUS_09360 1374 982 gene locus_tag LOCUS_09370 1374 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1638 3272 gene locus_tag LOCUS_09380 1638 3272 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946915.1 protein_id gnl|my_center|LOCUS_09380 3278 4114 gene locus_tag LOCUS_09390 gene kdsA 3278 4114 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_09390 4171 5448 gene locus_tag LOCUS_09400 gene eno 4171 5448 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_09400 5456 5758 gene locus_tag LOCUS_09410 gene ftsB 5456 5758 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377835.1 protein_id gnl|my_center|LOCUS_09410 5755 6435 gene locus_tag LOCUS_09420 gene ispD 5755 6435 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 protein_id gnl|my_center|LOCUS_09420 7192 6386 gene locus_tag LOCUS_09430 7192 6386 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046235485.1 protein_id gnl|my_center|LOCUS_09430 8117 7185 gene locus_tag LOCUS_09440 8117 7185 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_09440 8238 9617 gene locus_tag LOCUS_09450 8238 9617 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_09450 9773 10582 gene locus_tag LOCUS_09460 9773 10582 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_09460 10621 12843 gene locus_tag LOCUS_09470 10621 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0050 1585 320 gene locus_tag LOCUS_09480 gene cca 1585 320 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_09480 1839 1591 gene locus_tag LOCUS_09490 1839 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2036 1836 gene locus_tag LOCUS_09500 2036 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2779 2033 gene locus_tag LOCUS_09510 2779 2033 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_09510 3491 2835 gene locus_tag LOCUS_09520 gene gph 3491 2835 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_09520 4243 3488 gene locus_tag LOCUS_09530 4243 3488 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_09530 5578 4262 gene locus_tag LOCUS_09540 5578 4262 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_09540 5642 6703 gene locus_tag LOCUS_09550 gene mtnA 5642 6703 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_09550 6825 9383 gene locus_tag LOCUS_09560 gene gyrA 6825 9383 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_09560 9442 10518 gene locus_tag LOCUS_09570 gene serC 9442 10518 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766746.1 protein_id gnl|my_center|LOCUS_09570 10533 11711 gene locus_tag LOCUS_09580 10533 11711 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_09580 11723 12808 gene locus_tag LOCUS_09590 gene pheA 11723 12808 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404232.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0051 1090 1293 gene locus_tag LOCUS_09600 1090 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1415 1675 gene locus_tag LOCUS_09610 1415 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1724 3970 gene locus_tag LOCUS_09620 1724 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3963 4553 gene locus_tag LOCUS_09630 3963 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4559 7777 gene locus_tag LOCUS_09640 4559 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7802 11620 gene locus_tag LOCUS_09650 7802 11620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 12226 11822 gene locus_tag LOCUS_09660 12226 11822 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence0052 1421 33 gene locus_tag LOCUS_09670 1421 33 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_09670 1707 1396 gene locus_tag LOCUS_09680 1707 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1915 2112 gene locus_tag LOCUS_09690 1915 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2492 2160 gene locus_tag LOCUS_09700 2492 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 3877 2495 gene locus_tag LOCUS_09710 gene cysS 3877 2495 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_09710 3985 4551 gene locus_tag LOCUS_09720 3985 4551 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_09720 4548 5036 gene locus_tag LOCUS_09730 4548 5036 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_09730 5182 5910 gene locus_tag LOCUS_09740 gene lpxH 5182 5910 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_09740 6599 5913 gene locus_tag LOCUS_09750 6599 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 7393 6587 gene locus_tag LOCUS_09760 7393 6587 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_09760 9143 7698 gene locus_tag LOCUS_09770 9143 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 10488 9238 gene locus_tag LOCUS_09780 10488 9238 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067368.1 protein_id gnl|my_center|LOCUS_09780 10519 11448 gene locus_tag LOCUS_09790 10519 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 11445 12482 gene locus_tag LOCUS_09800 11445 12482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence0053 1469 237 gene locus_tag LOCUS_09810 1469 237 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_09810 1953 1447 gene locus_tag LOCUS_09820 1953 1447 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 protein_id gnl|my_center|LOCUS_09820 3218 1923 gene locus_tag LOCUS_09830 3218 1923 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223883297.1 protein_id gnl|my_center|LOCUS_09830 3617 3405 gene locus_tag LOCUS_09840 3617 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4981 3896 gene locus_tag LOCUS_09850 4981 3896 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533282.1 protein_id gnl|my_center|LOCUS_09850 5140 4985 gene locus_tag LOCUS_09860 5140 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 6269 5142 gene locus_tag LOCUS_09870 6269 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 8152 6266 gene locus_tag LOCUS_09880 8152 6266 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037620.1 protein_id gnl|my_center|LOCUS_09880 9149 8118 gene locus_tag LOCUS_09890 gene virB11 9149 8118 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 protein_id gnl|my_center|LOCUS_09890 10299 9127 gene locus_tag LOCUS_09900 gene virB10 10299 9127 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967687.1 protein_id gnl|my_center|LOCUS_09900 11093 10296 gene locus_tag LOCUS_09910 gene virB9 11093 10296 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597362.1 protein_id gnl|my_center|LOCUS_09910 11777 11097 gene locus_tag LOCUS_09920 11777 11097 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967689.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0054 1478 540 gene locus_tag LOCUS_09930 gene secF 1478 540 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_09930 3350 1494 gene locus_tag LOCUS_09940 gene secD 3350 1494 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880549.1 protein_id gnl|my_center|LOCUS_09940 3782 3444 gene locus_tag LOCUS_09950 gene yajC 3782 3444 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_09950 6132 3889 gene locus_tag LOCUS_09960 gene parC 6132 3889 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_09960 6590 6132 gene locus_tag LOCUS_09970 6590 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7615 6587 gene locus_tag LOCUS_09980 7615 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 9528 7615 gene locus_tag LOCUS_09990 gene parE 9528 7615 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195286.1 protein_id gnl|my_center|LOCUS_09990 10078 9521 gene locus_tag LOCUS_10000 10078 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10191 10511 gene locus_tag LOCUS_10010 gene xseB 10191 10511 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 protein_id gnl|my_center|LOCUS_10010 10498 11397 gene locus_tag LOCUS_10020 10498 11397 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_10020 11499 12299 gene locus_tag LOCUS_10030 gene folE2 11499 12299 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence0055 208 1383 gene locus_tag LOCUS_10040 gene hflK 208 1383 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_10040 1383 2255 gene locus_tag LOCUS_10050 gene hflC 1383 2255 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_10050 2341 2529 gene locus_tag LOCUS_10060 2341 2529 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_10060 2578 3774 gene locus_tag LOCUS_10070 2578 3774 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 protein_id gnl|my_center|LOCUS_10070 3834 5132 gene locus_tag LOCUS_10080 3834 5132 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 protein_id gnl|my_center|LOCUS_10080 5197 7572 gene locus_tag LOCUS_10090 gene mrcB 5197 7572 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_10090 7754 8029 gene locus_tag LOCUS_10100 7754 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8105 8878 gene locus_tag LOCUS_10110 8105 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 9593 10105 gene locus_tag LOCUS_10120 9593 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 10105 12018 gene locus_tag LOCUS_10130 10105 12018 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693783.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence0056 295 1476 gene locus_tag LOCUS_10140 295 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2242 2132 gene locus_tag LOCUS_r00010 2242 2132 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5258 2373 gene locus_tag LOCUS_r00020 5258 2373 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5570 5495 gene locus_tag LOCUS_t00140 5570 5495 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5736 5660 gene locus_tag LOCUS_t00150 5736 5660 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7367 5831 gene locus_tag LOCUS_r00030 7367 5831 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9172 7967 gene locus_tag LOCUS_10150 gene tyrS 9172 7967 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_10150 9410 10930 gene locus_tag LOCUS_10160 9410 10930 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_10160 10927 12048 gene locus_tag LOCUS_10170 10927 12048 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence0057 133 1194 gene locus_tag LOCUS_10180 gene hrcA 133 1194 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_10180 1386 1937 gene locus_tag LOCUS_10190 1386 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2029 3963 gene locus_tag LOCUS_10200 gene dnaK 2029 3963 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_10200 4083 5216 gene locus_tag LOCUS_10210 gene dnaJ 4083 5216 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_10210 5233 6036 gene locus_tag LOCUS_10220 gene dapB 5233 6036 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_10220 6103 6393 gene locus_tag LOCUS_10230 6103 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 6398 7570 gene locus_tag LOCUS_10240 gene lapB 6398 7570 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_10240 7567 8256 gene locus_tag LOCUS_10250 gene pyrF 7567 8256 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667227.1 protein_id gnl|my_center|LOCUS_10250 8675 9460 gene locus_tag LOCUS_10260 8675 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 9743 10045 gene locus_tag LOCUS_10270 9743 10045 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_10270 10042 10482 gene locus_tag LOCUS_10280 10042 10482 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_10280 10800 11999 gene locus_tag LOCUS_10290 gene sat 10800 11999 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence0058 1096 86 gene locus_tag LOCUS_10300 1096 86 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 protein_id gnl|my_center|LOCUS_10300 1284 3950 gene locus_tag LOCUS_10310 1284 3950 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_10310 4399 4187 gene locus_tag LOCUS_10320 4399 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4484 5560 gene locus_tag LOCUS_10330 4484 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5547 6107 gene locus_tag LOCUS_10340 5547 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6137 7339 gene locus_tag LOCUS_10350 gene cas7e 6137 7339 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_10350 7341 8048 gene locus_tag LOCUS_10360 gene cas5e 7341 8048 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_10360 8051 8779 gene locus_tag LOCUS_10370 8051 8779 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388099.1 protein_id gnl|my_center|LOCUS_10370 9255 9683 gene locus_tag LOCUS_10380 9255 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 9655 9951 gene locus_tag LOCUS_10390 gene cas2e 9655 9951 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388101.1 protein_id gnl|my_center|LOCUS_10390 10020 12061 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcccccgcacaagcggggatagaccc >Feature sequence0059 <1 599 gene locus_tag LOCUS_10400 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947252.1:type II secretion system F family protein 599 1474 gene locus_tag LOCUS_10410 599 1474 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_10410 1512 2117 gene locus_tag LOCUS_10420 gene coaE 1512 2117 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_10420 2176 2943 gene locus_tag LOCUS_10430 gene zapD 2176 2943 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368236.1 protein_id gnl|my_center|LOCUS_10430 4048 3110 gene locus_tag LOCUS_10440 4048 3110 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_10440 5267 4065 gene locus_tag LOCUS_10450 gene argJ 5267 4065 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208443.1 protein_id gnl|my_center|LOCUS_10450 8137 5339 gene locus_tag LOCUS_10460 gene secA 8137 5339 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_10460 9125 8280 gene locus_tag LOCUS_10470 9125 8280 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_10470 9197 9631 gene locus_tag LOCUS_10480 9197 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10552 9638 gene locus_tag LOCUS_10490 gene lpxC 10552 9638 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_10490 11891 10683 gene locus_tag LOCUS_10500 gene ftsZ 11891 10683 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0060 116 691 gene locus_tag LOCUS_10510 116 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 688 2811 gene locus_tag LOCUS_10520 gene pta 688 2811 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_10520 2894 4150 gene locus_tag LOCUS_10530 2894 4150 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_10530 4154 4654 gene locus_tag LOCUS_10540 gene nrdR 4154 4654 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771735.1 protein_id gnl|my_center|LOCUS_10540 4856 5974 gene locus_tag LOCUS_10550 gene ribD 4856 5974 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150417.1 protein_id gnl|my_center|LOCUS_10550 5981 6637 gene locus_tag LOCUS_10560 5981 6637 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103236.1 protein_id gnl|my_center|LOCUS_10560 7037 6702 gene locus_tag LOCUS_10570 7037 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 7410 8552 gene locus_tag LOCUS_10580 gene ribBA 7410 8552 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_10580 8564 9031 gene locus_tag LOCUS_10590 gene ribE 8564 9031 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_10590 9028 9462 gene locus_tag LOCUS_10600 gene nusB 9028 9462 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_10600 9455 10384 gene locus_tag LOCUS_10610 gene thiL 9455 10384 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742096.1 protein_id gnl|my_center|LOCUS_10610 10381 10857 gene locus_tag LOCUS_10620 10381 10857 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_10620 10854 11489 gene locus_tag LOCUS_10630 10854 11489 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence0061 589 825 gene locus_tag LOCUS_10640 gene rpmB 589 825 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_10640 837 1004 gene locus_tag LOCUS_10650 gene rpmG 837 1004 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_10650 2080 1019 gene locus_tag LOCUS_10660 gene pspF 2080 1019 CDS product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_10660 2299 2697 gene locus_tag LOCUS_10670 2299 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2724 3392 gene locus_tag LOCUS_10680 gene pspA 2724 3392 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_10680 3413 3643 gene locus_tag LOCUS_10690 3413 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3640 3876 gene locus_tag LOCUS_10700 gene pspB 3640 3876 CDS product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300084.1 protein_id gnl|my_center|LOCUS_10700 3873 4274 gene locus_tag LOCUS_10710 gene pspC 3873 4274 CDS product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 protein_id gnl|my_center|LOCUS_10710 4280 5368 gene locus_tag LOCUS_10720 gene vmeJ 4280 5368 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_10720 5371 8508 gene locus_tag LOCUS_10730 5371 8508 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262580.1 protein_id gnl|my_center|LOCUS_10730 8520 10010 gene locus_tag LOCUS_10740 8520 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9928 11304 gene locus_tag LOCUS_10750 9928 11304 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_10750 11776 11600 gene locus_tag LOCUS_10760 11776 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence0062 310 98 gene locus_tag LOCUS_10770 310 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1076 294 gene locus_tag LOCUS_10780 1076 294 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_10780 1872 1069 gene locus_tag LOCUS_10790 gene rfaP 1872 1069 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001357918.1 protein_id gnl|my_center|LOCUS_10790 2981 1869 gene locus_tag LOCUS_10800 2981 1869 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_10800 3991 2978 gene locus_tag LOCUS_10810 gene waaC 3991 2978 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_10810 4597 3992 gene locus_tag LOCUS_10820 gene cysC 4597 3992 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_10820 5615 4587 gene locus_tag LOCUS_10830 gene waaF 5615 4587 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_10830 5828 5640 gene locus_tag LOCUS_10840 5828 5640 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958359.1 protein_id gnl|my_center|LOCUS_10840 6763 5825 gene locus_tag LOCUS_10850 gene ilvE 6763 5825 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_10850 9582 6766 gene locus_tag LOCUS_10860 gene glnE 9582 6766 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266458.1 protein_id gnl|my_center|LOCUS_10860 9914 9582 gene locus_tag LOCUS_10870 9914 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10870 11655 10060 gene locus_tag LOCUS_10880 11655 10060 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198270.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence0063 541 92 gene locus_tag LOCUS_10890 541 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1588 671 gene locus_tag LOCUS_10900 gene mscS 1588 671 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896747.1 protein_id gnl|my_center|LOCUS_10900 1803 1727 gene locus_tag LOCUS_t00160 1803 1727 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1982 2440 gene locus_tag LOCUS_10910 1982 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2833 2477 gene locus_tag LOCUS_10920 2833 2477 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_10920 3092 2817 gene locus_tag LOCUS_10930 gene ihfA 3092 2817 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_10930 5497 3119 gene locus_tag LOCUS_10940 gene pheT 5497 3119 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267471.1 protein_id gnl|my_center|LOCUS_10940 6524 5511 gene locus_tag LOCUS_10950 gene pheS 6524 5511 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_10950 7038 6679 gene locus_tag LOCUS_10960 gene rplT 7038 6679 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393357.1 protein_id gnl|my_center|LOCUS_10960 7260 7066 gene locus_tag LOCUS_10970 gene rpmI 7260 7066 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_10970 7768 7358 gene locus_tag LOCUS_10980 7768 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9840 7933 gene locus_tag LOCUS_10990 gene thrS 9840 7933 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_10990 11046 10369 gene locus_tag LOCUS_11000 11046 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0064 149 1159 gene locus_tag LOCUS_11010 gene gnd 149 1159 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_11010 1892 1326 gene locus_tag LOCUS_11020 1892 1326 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421912.1 protein_id gnl|my_center|LOCUS_11020 2129 1917 gene locus_tag LOCUS_11030 2129 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4589 2133 gene locus_tag LOCUS_11040 gene copA 4589 2133 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_11040 5143 4586 gene locus_tag LOCUS_11050 5143 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 6567 5143 gene locus_tag LOCUS_11060 gene ccoG 6567 5143 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_11060 8081 7239 gene locus_tag LOCUS_11070 gene ccoP 8081 7239 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_11070 8284 8078 gene locus_tag LOCUS_11080 8284 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9002 8277 gene locus_tag LOCUS_11090 gene ccoO 9002 8277 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_11090 10440 9025 gene locus_tag LOCUS_11100 gene ccoN 10440 9025 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_11100 11254 10745 gene locus_tag LOCUS_11110 11254 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence0065 590 135 gene locus_tag LOCUS_11120 590 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 4270 671 gene locus_tag LOCUS_11130 4270 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4437 4255 gene locus_tag LOCUS_11140 4437 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4436 4816 gene locus_tag LOCUS_11150 4436 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4783 5526 gene locus_tag LOCUS_11160 4783 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6198 5509 gene locus_tag LOCUS_11170 6198 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6466 7071 gene locus_tag LOCUS_11180 6466 7071 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_11180 7083 9020 gene locus_tag LOCUS_11190 7083 9020 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_11190 9020 9922 gene locus_tag LOCUS_11200 9020 9922 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_11200 10376 9894 gene locus_tag LOCUS_11210 10376 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 10557 10923 gene locus_tag LOCUS_tm00010 10557 10923 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0066 4589 1173 gene locus_tag LOCUS_11220 4589 1173 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_11220 5522 4842 gene locus_tag LOCUS_11230 5522 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6718 5678 gene locus_tag LOCUS_11240 6718 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8906 6711 gene locus_tag LOCUS_11250 8906 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9951 8908 gene locus_tag LOCUS_11260 9951 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11090 9969 gene locus_tag LOCUS_11270 11090 9969 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938994.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence0067 408 333 gene locus_tag LOCUS_t00170 408 333 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1153 458 gene locus_tag LOCUS_11280 gene queC 1153 458 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_11280 1791 1150 gene locus_tag LOCUS_11290 gene queE 1791 1150 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_11290 2576 1791 gene locus_tag LOCUS_11300 gene ybgF 2576 1791 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_11300 3158 2634 gene locus_tag LOCUS_11310 gene pal 3158 2634 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072686.1 protein_id gnl|my_center|LOCUS_11310 4469 3171 gene locus_tag LOCUS_11320 gene tolB 4469 3171 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_11320 5422 4466 gene locus_tag LOCUS_11330 5422 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5844 5422 gene locus_tag LOCUS_11340 gene tolR 5844 5422 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_11340 6533 5844 gene locus_tag LOCUS_11350 gene tolQ 6533 5844 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123084.1 protein_id gnl|my_center|LOCUS_11350 6930 6523 gene locus_tag LOCUS_11360 gene ybgC 6930 6523 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406122.1 protein_id gnl|my_center|LOCUS_11360 7967 6927 gene locus_tag LOCUS_11370 gene ruvB 7967 6927 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096086.1 protein_id gnl|my_center|LOCUS_11370 8576 7974 gene locus_tag LOCUS_11380 gene ruvA 8576 7974 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_11380 9064 8573 gene locus_tag LOCUS_11390 gene ruvC 9064 8573 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 protein_id gnl|my_center|LOCUS_11390 9810 9061 gene locus_tag LOCUS_11400 9810 9061 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_11400 10173 11261 gene locus_tag LOCUS_11410 10173 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence0068 159 377 gene locus_tag LOCUS_11420 159 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 374 2110 gene locus_tag LOCUS_11430 374 2110 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706231.1 protein_id gnl|my_center|LOCUS_11430 2107 4047 gene locus_tag LOCUS_11440 gene pcrA 2107 4047 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_11440 4047 6146 gene locus_tag LOCUS_11450 4047 6146 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_11450 6147 7508 gene locus_tag LOCUS_11460 6147 7508 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_11460 7511 8215 gene locus_tag LOCUS_11470 7511 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8849 8190 gene locus_tag LOCUS_11480 gene istB 8849 8190 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_11480 9918 8839 gene locus_tag LOCUS_11490 9918 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 10333 9806 gene locus_tag LOCUS_11500 10333 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 10570 11067 gene locus_tag LOCUS_11510 10570 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0069 119 589 gene locus_tag LOCUS_11520 119 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 696 1661 gene locus_tag LOCUS_11530 696 1661 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704920.1 protein_id gnl|my_center|LOCUS_11530 3776 1686 gene locus_tag LOCUS_11540 gene plpD 3776 1686 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_11540 3741 3896 gene locus_tag LOCUS_11550 3741 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6672 3901 gene locus_tag LOCUS_11560 gene rapA 6672 3901 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704377.1 protein_id gnl|my_center|LOCUS_11560 7043 9910 gene locus_tag LOCUS_11570 7043 9910 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_11570 10020 11183 gene locus_tag LOCUS_11580 10020 11183 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence0070 416 3127 gene locus_tag LOCUS_11590 gene polA 416 3127 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099383.1 protein_id gnl|my_center|LOCUS_11590 3127 3624 gene locus_tag LOCUS_11600 3127 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3585 3773 gene locus_tag LOCUS_11610 3585 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3968 4621 gene locus_tag LOCUS_11620 3968 4621 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_11620 5879 4857 gene locus_tag LOCUS_11630 5879 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6596 5880 gene locus_tag LOCUS_11640 6596 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7496 6663 gene locus_tag LOCUS_11650 7496 6663 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339394.1 protein_id gnl|my_center|LOCUS_11650 7612 9708 gene locus_tag LOCUS_11660 gene recG 7612 9708 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_11660 10323 9784 gene locus_tag LOCUS_11670 10323 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10666 10313 gene locus_tag LOCUS_11680 10666 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 10930 11175 gene locus_tag LOCUS_11690 10930 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0071 341 1129 gene locus_tag LOCUS_11700 341 1129 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_11700 1126 1749 gene locus_tag LOCUS_11710 gene thiE 1126 1749 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763279.1 protein_id gnl|my_center|LOCUS_11710 1758 3044 gene locus_tag LOCUS_11720 gene hemL 1758 3044 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_11720 3104 5059 gene locus_tag LOCUS_11730 3104 5059 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_11730 5170 5421 gene locus_tag LOCUS_11740 5170 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5442 6125 gene locus_tag LOCUS_11750 5442 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6743 6132 gene locus_tag LOCUS_11760 6743 6132 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 protein_id gnl|my_center|LOCUS_11760 8146 6740 gene locus_tag LOCUS_11770 gene mpl 8146 6740 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_11770 8170 9321 gene locus_tag LOCUS_11780 gene rnd 8170 9321 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_11780 9408 9761 gene locus_tag LOCUS_11790 9408 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 10114 10665 gene locus_tag LOCUS_11800 10114 10665 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_11800 11134 10895 gene locus_tag LOCUS_11810 11134 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0072 453 1037 gene locus_tag LOCUS_11820 453 1037 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014841277.1 protein_id gnl|my_center|LOCUS_11820 1037 1204 gene locus_tag LOCUS_11830 1037 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1219 4452 gene locus_tag LOCUS_11840 1219 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 4728 6770 gene locus_tag LOCUS_11850 4728 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9705 6880 gene locus_tag LOCUS_11860 gene uvrA 9705 6880 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_11860 9778 10995 gene locus_tag LOCUS_11870 9778 10995 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0073 253 177 gene locus_tag LOCUS_t00180 253 177 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 383 310 gene locus_tag LOCUS_t00190 383 310 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1454 414 gene locus_tag LOCUS_11880 1454 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 2248 1352 gene locus_tag LOCUS_11890 2248 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 2330 2530 gene locus_tag LOCUS_11900 gene thiS 2330 2530 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432400.1 protein_id gnl|my_center|LOCUS_11900 2591 3376 gene locus_tag LOCUS_11910 2591 3376 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_11910 3379 4089 gene locus_tag LOCUS_11920 gene trmB 3379 4089 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786887.1 protein_id gnl|my_center|LOCUS_11920 4430 4086 gene locus_tag LOCUS_11930 4430 4086 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693989.1 protein_id gnl|my_center|LOCUS_11930 4534 5166 gene locus_tag LOCUS_11940 4534 5166 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_11940 5169 5972 gene locus_tag LOCUS_11950 gene fetB 5169 5972 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_11950 6038 6310 gene locus_tag LOCUS_11960 6038 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 6690 7088 gene locus_tag LOCUS_11970 6690 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7504 7106 gene locus_tag LOCUS_11980 7504 7106 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313571.1 protein_id gnl|my_center|LOCUS_11980 8117 7521 gene locus_tag LOCUS_11990 gene sspA 8117 7521 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_11990 9024 8296 gene locus_tag LOCUS_12000 9024 8296 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_12000 10250 9021 gene locus_tag LOCUS_12010 10250 9021 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_12010 10843 10247 gene locus_tag LOCUS_12020 gene petA 10843 10247 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0074 129 2246 gene locus_tag LOCUS_12030 129 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3475 2294 gene locus_tag LOCUS_12040 3475 2294 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_12040 3566 5023 gene locus_tag LOCUS_12050 gene glcD 3566 5023 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_12050 5023 6054 gene locus_tag LOCUS_12060 gene glcE 5023 6054 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_12060 6056 7282 gene locus_tag LOCUS_12070 gene glcF 6056 7282 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 protein_id gnl|my_center|LOCUS_12070 7974 7351 gene locus_tag LOCUS_12080 7974 7351 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_12080 8351 8043 gene locus_tag LOCUS_12090 8351 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10183 8531 gene locus_tag LOCUS_12100 10183 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10468 10202 gene locus_tag LOCUS_12110 10468 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence0075 2067 346 gene locus_tag LOCUS_12120 gene polX 2067 346 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_12120 2552 2085 gene locus_tag LOCUS_12130 2552 2085 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_12130 2848 2618 gene locus_tag LOCUS_12140 2848 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3972 2845 gene locus_tag LOCUS_12150 gene tgt 3972 2845 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736309.1 protein_id gnl|my_center|LOCUS_12150 4260 5867 gene locus_tag LOCUS_12160 gene cydA 4260 5867 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261597.1 protein_id gnl|my_center|LOCUS_12160 5864 7003 gene locus_tag LOCUS_12170 gene cydB 5864 7003 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073166.1 protein_id gnl|my_center|LOCUS_12170 7019 7141 gene locus_tag LOCUS_12180 gene cydX 7019 7141 CDS product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_12180 7203 8936 gene locus_tag LOCUS_12190 gene cydD 7203 8936 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_12190 8933 10675 gene locus_tag LOCUS_12200 gene cydC 8933 10675 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence0076 576 271 gene locus_tag LOCUS_12210 576 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2575 614 gene locus_tag LOCUS_12220 2575 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3969 2839 gene locus_tag LOCUS_12230 3969 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5348 3966 gene locus_tag LOCUS_12240 5348 3966 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261107.1 protein_id gnl|my_center|LOCUS_12240 7395 5509 gene locus_tag LOCUS_12250 7395 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9719 7515 gene locus_tag LOCUS_12260 9719 7515 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_12260 10283 9837 gene locus_tag LOCUS_12270 10283 9837 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_12270 10631 10323 gene locus_tag LOCUS_12280 gene nirD 10631 10323 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275366.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0077 252 866 gene locus_tag LOCUS_12290 252 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1138 923 gene locus_tag LOCUS_12300 1138 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1543 2415 gene locus_tag LOCUS_12310 1543 2415 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042007654.1 protein_id gnl|my_center|LOCUS_12310 3215 2430 gene locus_tag LOCUS_12320 gene gloB 3215 2430 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 protein_id gnl|my_center|LOCUS_12320 3655 3212 gene locus_tag LOCUS_12330 gene hisI 3655 3212 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389302.1 protein_id gnl|my_center|LOCUS_12330 4287 3652 gene locus_tag LOCUS_12340 4287 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4392 4709 gene locus_tag LOCUS_12350 4392 4709 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_12350 4720 5667 gene locus_tag LOCUS_12360 4720 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5719 6033 gene locus_tag LOCUS_12370 gene bolA 5719 6033 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_12370 6033 6395 gene locus_tag LOCUS_12380 6033 6395 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_12380 6567 7268 gene locus_tag LOCUS_12390 gene phoU 6567 7268 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262448.1 protein_id gnl|my_center|LOCUS_12390 7265 8500 gene locus_tag LOCUS_12400 7265 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 8848 8510 gene locus_tag LOCUS_12410 gene glnB 8848 8510 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_12410 10475 8874 gene locus_tag LOCUS_12420 10475 8874 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence0078 263 1261 gene locus_tag LOCUS_12430 263 1261 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_12430 1276 1800 gene locus_tag LOCUS_12440 1276 1800 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_12440 1800 2357 gene locus_tag LOCUS_12450 1800 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2344 2856 gene locus_tag LOCUS_12460 gene lptA 2344 2856 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_12460 2860 3588 gene locus_tag LOCUS_12470 gene lptB 2860 3588 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946572.1 protein_id gnl|my_center|LOCUS_12470 3784 5238 gene locus_tag LOCUS_12480 3784 5238 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073699.1 protein_id gnl|my_center|LOCUS_12480 5253 5585 gene locus_tag LOCUS_12490 gene hpf 5253 5585 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_12490 5680 6159 gene locus_tag LOCUS_12500 gene ptsN 5680 6159 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_12500 6137 7084 gene locus_tag LOCUS_12510 gene hprK 6137 7084 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_12510 7081 7485 gene locus_tag LOCUS_12520 7081 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_12520 7482 7751 gene locus_tag LOCUS_12530 7482 7751 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_12530 7748 9475 gene locus_tag LOCUS_12540 gene ptsP 7748 9475 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_12540 10149 9481 gene locus_tag LOCUS_12550 10149 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10303 10473 gene locus_tag LOCUS_12560 10303 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0079 862 356 gene locus_tag LOCUS_12570 862 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 2178 1147 gene locus_tag LOCUS_12580 2178 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2330 2644 gene locus_tag LOCUS_12590 2330 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3400 2681 gene locus_tag LOCUS_12600 3400 2681 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_12600 3690 3397 gene locus_tag LOCUS_12610 3690 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4327 3713 gene locus_tag LOCUS_12620 4327 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4427 5806 gene locus_tag LOCUS_12630 gene argH 4427 5806 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 protein_id gnl|my_center|LOCUS_12630 5803 6213 gene locus_tag LOCUS_12640 5803 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7832 6546 gene locus_tag LOCUS_12650 7832 6546 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_12650 8185 7847 gene locus_tag LOCUS_12660 gene glnK 8185 7847 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_12660 8902 8201 gene locus_tag LOCUS_12670 8902 8201 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_12670 9179 9430 gene locus_tag LOCUS_12680 9179 9430 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 protein_id gnl|my_center|LOCUS_12680 9601 10488 gene locus_tag LOCUS_12690 9601 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence0080 <1 1157 gene locus_tag LOCUS_12700 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939300.1:ISL3-like element ISDvu5 family transposase >Feature sequence0081 218 403 gene locus_tag LOCUS_12710 218 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 349 1023 gene locus_tag LOCUS_12720 349 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1906 1067 gene locus_tag LOCUS_12730 gene panC 1906 1067 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_12730 2703 1903 gene locus_tag LOCUS_12740 gene panB 2703 1903 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_12740 3179 2700 gene locus_tag LOCUS_12750 gene folK 3179 2700 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_12750 4321 3176 gene locus_tag LOCUS_12760 4321 3176 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_12760 4560 7406 gene locus_tag LOCUS_12770 4560 7406 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_12770 7481 8224 gene locus_tag LOCUS_12780 7481 8224 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_12780 8281 8955 gene locus_tag LOCUS_12790 8281 8955 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_12790 8960 9910 gene locus_tag LOCUS_12800 8960 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10373 10017 gene locus_tag LOCUS_12810 10373 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0082 426 115 gene locus_tag LOCUS_12820 426 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1504 419 gene locus_tag LOCUS_12830 gene hisC 1504 419 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_12830 2808 1507 gene locus_tag LOCUS_12840 gene hisD 2808 1507 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_12840 3439 2801 gene locus_tag LOCUS_12850 gene hisG 3439 2801 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739058.1 protein_id gnl|my_center|LOCUS_12850 4714 3455 gene locus_tag LOCUS_12860 gene murA 4714 3455 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739059.1 protein_id gnl|my_center|LOCUS_12860 5043 4777 gene locus_tag LOCUS_12870 5043 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5658 5047 gene locus_tag LOCUS_12880 5658 5047 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_12880 6129 5659 gene locus_tag LOCUS_12890 gene mlaD 6129 5659 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_12890 6914 6138 gene locus_tag LOCUS_12900 gene mlaE 6914 6138 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_12900 7828 6911 gene locus_tag LOCUS_12910 gene mlaF 7828 6911 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_12910 8294 8602 gene locus_tag LOCUS_12920 8294 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8702 8863 gene locus_tag LOCUS_12930 8702 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10341 8824 gene locus_tag LOCUS_12940 10341 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence0083 2733 1000 gene locus_tag LOCUS_12950 gene soxB 2733 1000 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_12950 3193 2879 gene locus_tag LOCUS_12960 gene soxZ 3193 2879 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_12960 3684 3214 gene locus_tag LOCUS_12970 gene soxY 3684 3214 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_12970 4079 3738 gene locus_tag LOCUS_12980 4079 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 4946 4095 gene locus_tag LOCUS_12990 gene soxA 4946 4095 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_12990 5331 4972 gene locus_tag LOCUS_13000 gene soxX 5331 4972 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_13000 6204 5575 gene locus_tag LOCUS_13010 6204 5575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401355.1 protein_id gnl|my_center|LOCUS_13010 8368 6194 gene locus_tag LOCUS_13020 8368 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 9452 8361 gene locus_tag LOCUS_13030 gene thiO 9452 8361 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_13030 10096 9557 gene locus_tag LOCUS_13040 10096 9557 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807752.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence0084 1687 365 gene locus_tag LOCUS_13050 gene pmbA 1687 365 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_13050 3126 1684 gene locus_tag LOCUS_13060 gene tldD 3126 1684 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_13060 3974 3144 gene locus_tag LOCUS_13070 3974 3144 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_13070 7772 4065 gene locus_tag LOCUS_13080 gene yhdP 7772 4065 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817280.1 protein_id gnl|my_center|LOCUS_13080 9220 7769 gene locus_tag LOCUS_13090 gene rng 9220 7769 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_13090 9793 9230 gene locus_tag LOCUS_13100 9793 9230 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_13100 10421 9807 gene locus_tag LOCUS_13110 10421 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0085 1985 318 gene locus_tag LOCUS_13120 gene ettA 1985 318 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_13120 2869 2009 gene locus_tag LOCUS_13130 gene folD 2869 2009 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_13130 4297 2942 gene locus_tag LOCUS_13140 4297 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5307 4294 gene locus_tag LOCUS_13150 5307 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6337 5300 gene locus_tag LOCUS_13160 6337 5300 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 protein_id gnl|my_center|LOCUS_13160 6840 6334 gene locus_tag LOCUS_13170 6840 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7760 6837 gene locus_tag LOCUS_13180 7760 6837 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_13180 8723 7767 gene locus_tag LOCUS_13190 8723 7767 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_13190 8965 9687 gene locus_tag LOCUS_13200 gene tpiA 8965 9687 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005661219.1 protein_id gnl|my_center|LOCUS_13200 9708 10136 gene locus_tag LOCUS_13210 9708 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 10150 10234 gene locus_tag LOCUS_t00200 10150 10234 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0086 3793 434 gene locus_tag LOCUS_13220 3793 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 7245 3802 gene locus_tag LOCUS_13230 gene brxC 7245 3802 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_13230 7811 7242 gene locus_tag LOCUS_13240 7811 7242 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_13240 8625 7786 gene locus_tag LOCUS_13250 8625 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_13250 8770 9138 gene locus_tag LOCUS_13260 8770 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 9369 9178 gene locus_tag LOCUS_13270 9369 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9594 10166 gene locus_tag LOCUS_13280 9594 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13280 >Feature sequence0087 <1 1509 gene locus_tag LOCUS_13290 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:EAL domain-containing protein 2175 1513 gene locus_tag LOCUS_13300 gene yrfG 2175 1513 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_13300 2257 3045 gene locus_tag LOCUS_13310 gene cysQ 2257 3045 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_13310 3042 3623 gene locus_tag LOCUS_13320 3042 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 3633 4070 gene locus_tag LOCUS_13330 3633 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4514 4086 gene locus_tag LOCUS_13340 4514 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5792 4593 gene locus_tag LOCUS_13350 gene trpB 5792 4593 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 protein_id gnl|my_center|LOCUS_13350 5906 9670 gene locus_tag LOCUS_13360 gene metH 5906 9670 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_13360 9670 10158 gene locus_tag LOCUS_13370 gene hutZ 9670 10158 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence0088 287 490 gene locus_tag LOCUS_13380 287 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 487 3432 gene locus_tag LOCUS_13390 gene cbrA 487 3432 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_13390 3429 4766 gene locus_tag LOCUS_13400 3429 4766 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412367.1 protein_id gnl|my_center|LOCUS_13400 5069 5320 gene locus_tag LOCUS_13410 5069 5320 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_13410 5334 7067 gene locus_tag LOCUS_13420 5334 7067 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106103.1 protein_id gnl|my_center|LOCUS_13420 7203 7655 gene locus_tag LOCUS_13430 7203 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 7668 9182 gene locus_tag LOCUS_13440 7668 9182 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13440 9086 9520 gene locus_tag LOCUS_13450 9086 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 9520 10119 gene locus_tag LOCUS_13460 9520 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0089 3152 2685 gene locus_tag LOCUS_13470 3152 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3850 3152 gene locus_tag LOCUS_13480 3850 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4599 3991 gene locus_tag LOCUS_13490 4599 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5908 4610 gene locus_tag LOCUS_13500 5908 4610 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039059.1 protein_id gnl|my_center|LOCUS_13500 6149 5916 gene locus_tag LOCUS_13510 6149 5916 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_13510 7435 6164 gene locus_tag LOCUS_13520 7435 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 8939 7425 gene locus_tag LOCUS_13530 8939 7425 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_13530 9526 8936 gene locus_tag LOCUS_13540 9526 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939815.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence0090 910 137 gene locus_tag LOCUS_13550 910 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1296 907 gene locus_tag LOCUS_13560 1296 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1576 3309 gene locus_tag LOCUS_13570 1576 3309 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_13570 3309 3800 gene locus_tag LOCUS_13580 gene ilvN 3309 3800 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_13580 3876 4892 gene locus_tag LOCUS_13590 gene ilvC 3876 4892 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_13590 5911 5120 gene locus_tag LOCUS_13600 5911 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 8673 5908 gene locus_tag LOCUS_13610 8673 5908 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_13610 8870 8670 gene locus_tag LOCUS_13620 8870 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9093 9842 gene locus_tag LOCUS_13630 gene pssA 9093 9842 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence0091 2379 340 gene locus_tag LOCUS_13640 2379 340 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_13640 3882 2446 gene locus_tag LOCUS_13650 gene cysG 3882 2446 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_13650 4073 4393 gene locus_tag LOCUS_13660 4073 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4484 4714 gene locus_tag LOCUS_13670 gene tusA 4484 4714 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_13670 4762 5244 gene locus_tag LOCUS_13680 4762 5244 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_13680 6321 5332 gene locus_tag LOCUS_13690 6321 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7045 6569 gene locus_tag LOCUS_13700 7045 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7453 8352 gene locus_tag LOCUS_13710 7453 8352 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_13710 8356 8748 gene locus_tag LOCUS_13720 8356 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8760 9839 gene locus_tag LOCUS_13730 8760 9839 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0092 1568 93 gene locus_tag LOCUS_13740 1568 93 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_13740 6235 1604 gene locus_tag LOCUS_13750 gene gltB 6235 1604 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973318.1 protein_id gnl|my_center|LOCUS_13750 7528 6437 gene locus_tag LOCUS_13760 gene aroB 7528 6437 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_13760 8048 7530 gene locus_tag LOCUS_13770 gene aroK 8048 7530 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208899.1 protein_id gnl|my_center|LOCUS_13770 9802 8162 gene locus_tag LOCUS_13780 9802 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence0093 793 113 gene locus_tag LOCUS_13790 793 113 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_13790 872 2464 gene locus_tag LOCUS_13800 872 2464 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_13800 2726 4858 gene locus_tag LOCUS_13810 2726 4858 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_13810 4877 5479 gene locus_tag LOCUS_13820 gene lolA 4877 5479 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207490.1 protein_id gnl|my_center|LOCUS_13820 5476 6810 gene locus_tag LOCUS_13830 5476 6810 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 protein_id gnl|my_center|LOCUS_13830 6884 7213 gene locus_tag LOCUS_13840 gene crcB 6884 7213 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_13840 7210 7518 gene locus_tag LOCUS_13850 7210 7518 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941172.1 protein_id gnl|my_center|LOCUS_13850 7520 8800 gene locus_tag LOCUS_13860 gene serS 7520 8800 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317946.1 protein_id gnl|my_center|LOCUS_13860 8978 8793 gene locus_tag LOCUS_13870 8978 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9796 9107 gene locus_tag LOCUS_13880 9796 9107 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence0094 405 70 gene locus_tag LOCUS_13890 405 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1775 405 gene locus_tag LOCUS_13900 gene radA 1775 405 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770187.1 protein_id gnl|my_center|LOCUS_13900 2842 1775 gene locus_tag LOCUS_13910 gene alr 2842 1775 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_13910 4275 2857 gene locus_tag LOCUS_13920 gene dnaB 4275 2857 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_13920 4897 4445 gene locus_tag LOCUS_13930 gene rplI 4897 4445 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 protein_id gnl|my_center|LOCUS_13930 5836 4922 gene locus_tag LOCUS_13940 5836 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_13940 6191 5964 gene locus_tag LOCUS_13950 gene rpsR 6191 5964 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_13950 6560 6207 gene locus_tag LOCUS_13960 gene rpsF 6560 6207 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 protein_id gnl|my_center|LOCUS_13960 7627 6734 gene locus_tag LOCUS_13970 7627 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 9573 7678 gene locus_tag LOCUS_13980 9573 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence0095 121 1038 gene locus_tag LOCUS_13990 121 1038 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705471.1 protein_id gnl|my_center|LOCUS_13990 1299 1054 gene locus_tag LOCUS_14000 1299 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2607 1399 gene locus_tag LOCUS_14010 gene gltS 2607 1399 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707131.1 protein_id gnl|my_center|LOCUS_14010 4264 2693 gene locus_tag LOCUS_14020 4264 2693 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_14020 4421 5194 gene locus_tag LOCUS_14030 gene yaaA 4421 5194 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_14030 5302 5490 gene locus_tag LOCUS_14040 5302 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 5490 7844 gene locus_tag LOCUS_14050 gene feoB 5490 7844 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_14050 7841 8101 gene locus_tag LOCUS_14060 7841 8101 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958427.1 protein_id gnl|my_center|LOCUS_14060 9339 8179 gene locus_tag LOCUS_14070 9339 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9553 9332 gene locus_tag LOCUS_14080 9553 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0096 111 590 gene locus_tag LOCUS_14090 111 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 615 2057 gene locus_tag LOCUS_14100 615 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2441 2079 gene locus_tag LOCUS_14110 2441 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2586 5147 gene locus_tag LOCUS_14120 gene leuS 2586 5147 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_14120 5147 5656 gene locus_tag LOCUS_14130 5147 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5661 6686 gene locus_tag LOCUS_14140 gene holA 5661 6686 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_14140 6718 7986 gene locus_tag LOCUS_14150 6718 7986 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_14150 8055 8684 gene locus_tag LOCUS_14160 gene nadD 8055 8684 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_14160 8687 9712 gene locus_tag LOCUS_14170 8687 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence0097 248 1147 gene locus_tag LOCUS_14180 248 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1160 1642 gene locus_tag LOCUS_14190 1160 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14190 1652 2542 gene locus_tag LOCUS_14200 1652 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14200 3265 2537 gene locus_tag LOCUS_14210 3265 2537 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_14210 3626 3258 gene locus_tag LOCUS_14220 3626 3258 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_14220 3998 3645 gene locus_tag LOCUS_14230 3998 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4133 5560 gene locus_tag LOCUS_14240 gene sufB 4133 5560 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_14240 5800 6552 gene locus_tag LOCUS_14250 gene sufC 5800 6552 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384245.1 protein_id gnl|my_center|LOCUS_14250 6549 7847 gene locus_tag LOCUS_14260 gene sufD 6549 7847 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_14260 7844 8170 gene locus_tag LOCUS_14270 7844 8170 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_14270 8221 8547 gene locus_tag LOCUS_14280 gene iscA 8221 8547 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_14280 8544 8960 gene locus_tag LOCUS_14290 8544 8960 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_14290 9376 8954 gene locus_tag LOCUS_14300 9376 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0098 344 3883 gene locus_tag LOCUS_14310 gene dnaE 344 3883 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294828.1 protein_id gnl|my_center|LOCUS_14310 3916 4872 gene locus_tag LOCUS_14320 gene accA 3916 4872 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_14320 4914 6224 gene locus_tag LOCUS_14330 gene tilS 4914 6224 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_14330 6212 6718 gene locus_tag LOCUS_14340 6212 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 7256 6795 gene locus_tag LOCUS_14350 7256 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 8987 7326 gene locus_tag LOCUS_14360 8987 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence0099 226 1320 gene locus_tag LOCUS_14370 226 1320 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_14370 1317 2012 gene locus_tag LOCUS_14380 gene pilW 1317 2012 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172603.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14380 2094 3059 gene locus_tag LOCUS_14390 2094 3059 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705644.1 protein_id gnl|my_center|LOCUS_14390 3060 4334 gene locus_tag LOCUS_14400 gene hisS 3060 4334 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_14400 4339 4959 gene locus_tag LOCUS_14410 4339 4959 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_14410 4963 6132 gene locus_tag LOCUS_14420 gene bamB 4963 6132 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507731.1 protein_id gnl|my_center|LOCUS_14420 6136 7527 gene locus_tag LOCUS_14430 gene der 6136 7527 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_14430 7511 7999 gene locus_tag LOCUS_14440 gene ispF 7511 7999 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_14440 7992 9023 gene locus_tag LOCUS_14450 gene truD 7992 9023 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704773.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence0100 32 733 gene locus_tag LOCUS_14460 32 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1610 792 gene locus_tag LOCUS_14470 1610 792 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_14470 3498 1711 gene locus_tag LOCUS_14480 3498 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4119 5402 gene locus_tag LOCUS_14490 4119 5402 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_14490 5407 7722 gene locus_tag LOCUS_14500 5407 7722 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_14500 7735 8358 gene locus_tag LOCUS_14510 7735 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 8375 9274 gene locus_tag LOCUS_14520 8375 9274 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855106.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0101 5861 402 gene locus_tag LOCUS_14530 5861 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7453 5858 gene locus_tag LOCUS_14540 7453 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9246 7453 gene locus_tag LOCUS_14550 9246 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence0102 164 373 gene locus_tag LOCUS_14560 gene cspD 164 373 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_14560 1702 446 gene locus_tag LOCUS_14570 gene icd 1702 446 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_14570 1759 2310 gene locus_tag LOCUS_14580 1759 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2307 2756 gene locus_tag LOCUS_14590 2307 2756 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_14590 2753 3823 gene locus_tag LOCUS_14600 gene mnmA 2753 3823 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022640.1 protein_id gnl|my_center|LOCUS_14600 3823 4452 gene locus_tag LOCUS_14610 gene hflD 3823 4452 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024131182.1 protein_id gnl|my_center|LOCUS_14610 4449 4925 gene locus_tag LOCUS_14620 4449 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5008 7671 gene locus_tag LOCUS_14630 gene acnA 5008 7671 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_14630 7692 8477 gene locus_tag LOCUS_14640 7692 8477 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_14640 8474 9040 gene locus_tag LOCUS_14650 8474 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 9197 9042 gene locus_tag LOCUS_14660 9197 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence0103 105 539 gene locus_tag LOCUS_14670 105 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1844 630 gene locus_tag LOCUS_14680 1844 630 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_14680 2882 1926 gene locus_tag LOCUS_14690 2882 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3233 2901 gene locus_tag LOCUS_14700 3233 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4482 3307 gene locus_tag LOCUS_14710 4482 3307 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983782.1 protein_id gnl|my_center|LOCUS_14710 5735 4527 gene locus_tag LOCUS_14720 gene ubiH 5735 4527 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111180.1 protein_id gnl|my_center|LOCUS_14720 7039 5732 gene locus_tag LOCUS_14730 gene pepP 7039 5732 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_14730 7562 7026 gene locus_tag LOCUS_14740 7562 7026 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173516.1 protein_id gnl|my_center|LOCUS_14740 7641 7874 gene locus_tag LOCUS_14750 7641 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 7871 8185 gene locus_tag LOCUS_14760 7871 8185 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192718.1 protein_id gnl|my_center|LOCUS_14760 8350 9009 gene locus_tag LOCUS_14770 8350 9009 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence0104 158 913 gene locus_tag LOCUS_14780 gene tcdA 158 913 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_14780 995 4858 gene locus_tag LOCUS_14790 gene purL 995 4858 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_14790 4926 5246 gene locus_tag LOCUS_14800 gene clpS 4926 5246 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_14800 5308 7572 gene locus_tag LOCUS_14810 gene clpA 5308 7572 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_14810 7815 7597 gene locus_tag LOCUS_14820 gene infA 7815 7597 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 protein_id gnl|my_center|LOCUS_14820 8032 8505 gene locus_tag LOCUS_14830 8032 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9087 8548 gene locus_tag LOCUS_14840 9087 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence0105 636 1082 gene locus_tag LOCUS_14850 636 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1693 1175 gene locus_tag LOCUS_14860 1693 1175 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_14860 4478 1776 gene locus_tag LOCUS_14870 4478 1776 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480361.1 protein_id gnl|my_center|LOCUS_14870 5968 4829 gene locus_tag LOCUS_14880 5968 4829 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_14880 6945 5974 gene locus_tag LOCUS_14890 6945 5974 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150678942.1 protein_id gnl|my_center|LOCUS_14890 7067 8062 gene locus_tag LOCUS_14900 gene moaA 7067 8062 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975731.1 protein_id gnl|my_center|LOCUS_14900 8252 8476 gene locus_tag LOCUS_14910 8252 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 8926 8480 gene locus_tag LOCUS_14920 8926 8480 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942956.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0106 291 1217 gene locus_tag LOCUS_14930 gene gshB 291 1217 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261218.1 protein_id gnl|my_center|LOCUS_14930 1214 2284 gene locus_tag LOCUS_14940 1214 2284 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_14940 2281 3162 gene locus_tag LOCUS_14950 2281 3162 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_14950 3189 3752 gene locus_tag LOCUS_14960 3189 3752 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369734.1 protein_id gnl|my_center|LOCUS_14960 3745 4173 gene locus_tag LOCUS_14970 gene ruvX 3745 4173 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_14970 4184 4705 gene locus_tag LOCUS_14980 gene pyrR 4184 4705 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_14980 4702 5676 gene locus_tag LOCUS_14990 4702 5676 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_14990 5673 6962 gene locus_tag LOCUS_15000 5673 6962 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114891.1 protein_id gnl|my_center|LOCUS_15000 6959 7822 gene locus_tag LOCUS_15010 6959 7822 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_15010 8992 7856 gene locus_tag LOCUS_15020 gene pilU 8992 7856 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0107 424 1188 gene locus_tag LOCUS_15030 424 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2202 1261 gene locus_tag LOCUS_15040 2202 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2799 2251 gene locus_tag LOCUS_15050 gene napC 2799 2251 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431773.1 protein_id gnl|my_center|LOCUS_15050 4371 2986 gene locus_tag LOCUS_15060 4371 2986 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_15060 4864 4358 gene locus_tag LOCUS_15070 4864 4358 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_15070 5225 4884 gene locus_tag LOCUS_15080 5225 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5947 5228 gene locus_tag LOCUS_15090 5947 5228 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_15090 6010 8013 gene locus_tag LOCUS_15100 gene rep 6010 8013 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045224090.1 protein_id gnl|my_center|LOCUS_15100 8520 8023 gene locus_tag LOCUS_15110 8520 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 8681 8908 gene locus_tag LOCUS_15120 8681 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence0108 273 989 gene locus_tag LOCUS_15130 273 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 989 1747 gene locus_tag LOCUS_15140 989 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1744 2430 gene locus_tag LOCUS_15150 1744 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4271 2412 gene locus_tag LOCUS_15160 4271 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4368 5555 gene locus_tag LOCUS_15170 4368 5555 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836244.1 protein_id gnl|my_center|LOCUS_15170 5552 7750 gene locus_tag LOCUS_15180 5552 7750 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 protein_id gnl|my_center|LOCUS_15180 8045 8785 gene locus_tag LOCUS_15190 8045 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence0109 778 233 gene locus_tag LOCUS_15200 778 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3174 781 gene locus_tag LOCUS_15210 3174 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3434 3162 gene locus_tag LOCUS_15220 3434 3162 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_15220 3577 4029 gene locus_tag LOCUS_15230 3577 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4270 4560 gene locus_tag LOCUS_15240 gene groES 4270 4560 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_15240 4664 6307 gene locus_tag LOCUS_15250 gene groL 4664 6307 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_15250 7096 6713 gene locus_tag LOCUS_15260 7096 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7399 7118 gene locus_tag LOCUS_15270 7399 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7822 7439 gene locus_tag LOCUS_15280 7822 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8251 7829 gene locus_tag LOCUS_15290 8251 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8594 8283 gene locus_tag LOCUS_15300 8594 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence0110 845 144 gene locus_tag LOCUS_15310 gene dnaQ 845 144 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444532.1 protein_id gnl|my_center|LOCUS_15310 1282 842 gene locus_tag LOCUS_15320 gene rnhA 1282 842 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_15320 2043 1279 gene locus_tag LOCUS_15330 2043 1279 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_15330 2200 3543 gene locus_tag LOCUS_15340 2200 3543 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705461.1 protein_id gnl|my_center|LOCUS_15340 3644 4138 gene locus_tag LOCUS_15350 3644 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15350 4191 5147 gene locus_tag LOCUS_15360 4191 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 5358 5513 gene locus_tag LOCUS_15370 5358 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5528 7816 gene locus_tag LOCUS_15380 5528 7816 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_15380 7725 8567 gene locus_tag LOCUS_15390 gene oppB 7725 8567 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence0111 182 655 gene locus_tag LOCUS_15400 gene eco 182 655 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706134.1 protein_id gnl|my_center|LOCUS_15400 4315 809 gene locus_tag LOCUS_15410 4315 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_15410 4539 5279 gene locus_tag LOCUS_15420 4539 5279 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15420 5273 5443 gene locus_tag LOCUS_15430 5273 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 5549 6307 gene locus_tag LOCUS_15440 5549 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15440 6498 7868 gene locus_tag LOCUS_15450 6498 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence0112 565 651 gene locus_tag LOCUS_t00210 565 651 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1552 692 gene locus_tag LOCUS_15460 1552 692 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 protein_id gnl|my_center|LOCUS_15460 1715 2269 gene locus_tag LOCUS_15470 1715 2269 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_15470 2731 2279 gene locus_tag LOCUS_15480 2731 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3111 2737 gene locus_tag LOCUS_15490 3111 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3392 3069 gene locus_tag LOCUS_15500 3392 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3873 3433 gene locus_tag LOCUS_15510 gene rimI 3873 3433 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_15510 4617 3877 gene locus_tag LOCUS_15520 4617 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6168 4621 gene locus_tag LOCUS_15530 6168 4621 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_15530 7394 6393 gene locus_tag LOCUS_15540 7394 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15540 8196 7363 gene locus_tag LOCUS_15550 8196 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 8271 8735 gene locus_tag LOCUS_15560 8271 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence0113 258 557 gene locus_tag LOCUS_15570 258 557 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_15570 538 885 gene locus_tag LOCUS_15580 538 885 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533838.1 protein_id gnl|my_center|LOCUS_15580 1362 985 gene locus_tag LOCUS_15590 1362 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15590 2790 1399 gene locus_tag LOCUS_15600 2790 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15600 3189 2815 gene locus_tag LOCUS_15610 3189 2815 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_15610 4036 3182 gene locus_tag LOCUS_15620 4036 3182 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_15620 4103 5305 gene locus_tag LOCUS_15630 gene dapC 4103 5305 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_15630 5319 6140 gene locus_tag LOCUS_15640 gene dapD 5319 6140 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212128.1 protein_id gnl|my_center|LOCUS_15640 6140 6490 gene locus_tag LOCUS_15650 6140 6490 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967551.1 protein_id gnl|my_center|LOCUS_15650 6487 6978 gene locus_tag LOCUS_15660 gene pagP 6487 6978 CDS product palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082771.1 protein_id gnl|my_center|LOCUS_15660 6978 8105 gene locus_tag LOCUS_15670 gene dapE 6978 8105 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_15670 8587 8120 gene locus_tag LOCUS_15680 8587 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0114 130 309 gene locus_tag LOCUS_15690 130 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 318 869 gene locus_tag LOCUS_15700 318 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 866 1312 gene locus_tag LOCUS_15710 866 1312 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531117.1 protein_id gnl|my_center|LOCUS_15710 1708 1313 gene locus_tag LOCUS_15720 1708 1313 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941050.1 protein_id gnl|my_center|LOCUS_15720 1778 2095 gene locus_tag LOCUS_15730 1778 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2149 2559 gene locus_tag LOCUS_15740 2149 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3178 2585 gene locus_tag LOCUS_15750 3178 2585 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061759014.1 protein_id gnl|my_center|LOCUS_15750 3921 3175 gene locus_tag LOCUS_15760 gene moeB 3921 3175 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_15760 4751 3918 gene locus_tag LOCUS_15770 gene prmC 4751 3918 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103431.1 protein_id gnl|my_center|LOCUS_15770 5827 4748 gene locus_tag LOCUS_15780 gene prfA 5827 4748 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_15780 7077 5824 gene locus_tag LOCUS_15790 gene hemA 7077 5824 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266733.1 protein_id gnl|my_center|LOCUS_15790 7443 8093 gene locus_tag LOCUS_15800 7443 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8095 8403 gene locus_tag LOCUS_15810 8095 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0115 1461 535 gene locus_tag LOCUS_15820 gene xerC 1461 535 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_15820 2132 1458 gene locus_tag LOCUS_15830 2132 1458 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_15830 2953 2129 gene locus_tag LOCUS_15840 gene dapF 2953 2129 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_15840 3619 2957 gene locus_tag LOCUS_15850 3619 2957 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_15850 4863 3616 gene locus_tag LOCUS_15860 gene lysA 4863 3616 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_15860 5072 4863 gene locus_tag LOCUS_15870 5072 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5044 5691 gene locus_tag LOCUS_15880 5044 5691 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_15880 6299 5775 gene locus_tag LOCUS_15890 6299 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6622 6212 gene locus_tag LOCUS_15900 6622 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6947 6594 gene locus_tag LOCUS_15910 6947 6594 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_15910 7522 6944 gene locus_tag LOCUS_15920 7522 6944 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_15920 7588 7827 gene locus_tag LOCUS_15930 7588 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7776 8387 gene locus_tag LOCUS_15940 7776 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence0116 410 102 gene locus_tag LOCUS_15950 410 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1001 519 gene locus_tag LOCUS_15960 1001 519 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_15960 1560 1117 gene locus_tag LOCUS_15970 1560 1117 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_15970 2059 1583 gene locus_tag LOCUS_15980 2059 1583 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_15980 2553 2050 gene locus_tag LOCUS_15990 2553 2050 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_15990 3725 2556 gene locus_tag LOCUS_16000 gene nirF 3725 2556 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_16000 4051 3722 gene locus_tag LOCUS_16010 4051 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4467 4138 gene locus_tag LOCUS_16020 4467 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6412 4628 gene locus_tag LOCUS_16030 6412 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 8208 6574 gene locus_tag LOCUS_16040 gene nirS 8208 6574 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence0117 208 813 gene locus_tag LOCUS_16050 208 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 914 1459 gene locus_tag LOCUS_16060 914 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1656 2150 gene locus_tag LOCUS_16070 gene purE 1656 2150 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_16070 2147 3235 gene locus_tag LOCUS_16080 2147 3235 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105529.1 protein_id gnl|my_center|LOCUS_16080 3269 4276 gene locus_tag LOCUS_16090 3269 4276 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_16090 4479 4769 gene locus_tag LOCUS_16100 4479 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16100 4873 6291 gene locus_tag LOCUS_16110 4873 6291 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_16110 6303 8123 gene locus_tag LOCUS_16120 gene oadA 6303 8123 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_16120 8128 8358 gene locus_tag LOCUS_16130 8128 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence0118 529 71 gene locus_tag LOCUS_16140 529 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1279 698 gene locus_tag LOCUS_16150 1279 698 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_16150 1311 2843 gene locus_tag LOCUS_16160 gene ppx 1311 2843 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_16160 2895 3890 gene locus_tag LOCUS_16170 gene hemH 2895 3890 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 protein_id gnl|my_center|LOCUS_16170 3883 4275 gene locus_tag LOCUS_16180 3883 4275 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_16180 4686 4354 gene locus_tag LOCUS_16190 4686 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5520 4765 gene locus_tag LOCUS_16200 5520 4765 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225729.1 protein_id gnl|my_center|LOCUS_16200 5939 5517 gene locus_tag LOCUS_16210 5939 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6127 6672 gene locus_tag LOCUS_16220 6127 6672 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_16220 6673 6975 gene locus_tag LOCUS_16230 6673 6975 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967602.1 protein_id gnl|my_center|LOCUS_16230 6972 7871 gene locus_tag LOCUS_16240 6972 7871 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_16240 8240 7941 gene locus_tag LOCUS_16250 8240 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0119 409 1341 gene locus_tag LOCUS_16260 gene hemC 409 1341 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_16260 1338 2105 gene locus_tag LOCUS_16270 1338 2105 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704441.1 protein_id gnl|my_center|LOCUS_16270 2102 3337 gene locus_tag LOCUS_16280 2102 3337 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_16280 3321 4484 gene locus_tag LOCUS_16290 3321 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4481 5767 gene locus_tag LOCUS_16300 4481 5767 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_16300 6190 5783 gene locus_tag LOCUS_16310 6190 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16310 6652 6203 gene locus_tag LOCUS_16320 6652 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16320 7383 6604 gene locus_tag LOCUS_16330 7383 6604 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465158.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0120 247 1521 gene locus_tag LOCUS_16340 247 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 1518 2627 gene locus_tag LOCUS_16350 1518 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16350 2731 3183 gene locus_tag LOCUS_16360 2731 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 4192 3203 gene locus_tag LOCUS_16370 4192 3203 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_16370 5043 4189 gene locus_tag LOCUS_16380 5043 4189 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116577.1 protein_id gnl|my_center|LOCUS_16380 7040 5064 gene locus_tag LOCUS_16390 7040 5064 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_16390 7300 7794 gene locus_tag LOCUS_16400 7300 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence0121 1836 442 gene locus_tag LOCUS_16410 gene trbI 1836 442 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_16410 2275 1841 gene locus_tag LOCUS_16420 2275 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3186 2272 gene locus_tag LOCUS_16430 gene trbG 3186 2272 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_16430 3964 3206 gene locus_tag LOCUS_16440 3964 3206 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_16440 6513 3961 gene locus_tag LOCUS_16450 6513 3961 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974837.1 protein_id gnl|my_center|LOCUS_16450 6821 6510 gene locus_tag LOCUS_16460 6821 6510 CDS product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891626.1 protein_id gnl|my_center|LOCUS_16460 7246 6821 gene locus_tag LOCUS_16470 7246 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 8215 7256 gene locus_tag LOCUS_16480 gene trbB 8215 7256 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence0122 1621 254 gene locus_tag LOCUS_16490 1621 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1738 2382 gene locus_tag LOCUS_16500 1738 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16500 2361 3512 gene locus_tag LOCUS_16510 2361 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 4094 3519 gene locus_tag LOCUS_16520 gene rppH 4094 3519 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165374.1 protein_id gnl|my_center|LOCUS_16520 4384 4202 gene locus_tag LOCUS_16530 4384 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4590 4339 gene locus_tag LOCUS_16540 4590 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16540 4807 5478 gene locus_tag LOCUS_16550 4807 5478 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_16550 5459 6451 gene locus_tag LOCUS_16560 5459 6451 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_16560 6448 7221 gene locus_tag LOCUS_16570 6448 7221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_16570 7260 8216 gene locus_tag LOCUS_16580 7260 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence0123 449 363 gene locus_tag LOCUS_t00220 449 363 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 679 1665 gene locus_tag LOCUS_16590 gene glk 679 1665 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_16590 2277 1669 gene locus_tag LOCUS_16600 2277 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_16600 2624 2277 gene locus_tag LOCUS_16610 2624 2277 CDS product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 protein_id gnl|my_center|LOCUS_16610 3499 2621 gene locus_tag LOCUS_16620 3499 2621 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705460.1 protein_id gnl|my_center|LOCUS_16620 5019 3466 gene locus_tag LOCUS_16630 gene cls 5019 3466 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705220.1 protein_id gnl|my_center|LOCUS_16630 5403 5330 gene locus_tag LOCUS_t00230 5403 5330 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5631 5556 gene locus_tag LOCUS_t00240 5631 5556 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6242 5622 gene locus_tag LOCUS_16640 gene pgsA 6242 5622 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_16640 8062 6245 gene locus_tag LOCUS_16650 gene uvrC 8062 6245 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence0124 625 2406 gene locus_tag LOCUS_16660 gene btuB 625 2406 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_16660 2413 2955 gene locus_tag LOCUS_16670 2413 2955 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_16670 3397 4173 gene locus_tag LOCUS_16680 3397 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5137 4226 gene locus_tag LOCUS_16690 5137 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5348 6844 gene locus_tag LOCUS_16700 5348 6844 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889607.1 protein_id gnl|my_center|LOCUS_16700 6901 7284 gene locus_tag LOCUS_16710 6901 7284 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_16710 <8126 7372 gene locus_tag LOCUS_16720 <8126 7372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405476.1:IS110 family transposase >Feature sequence0125 1618 1298 gene locus_tag LOCUS_16730 1618 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3320 1917 gene locus_tag LOCUS_16740 gene hemG 3320 1917 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_16740 5340 3325 gene locus_tag LOCUS_16750 5340 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 6457 5333 gene locus_tag LOCUS_16760 6457 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7548 6490 gene locus_tag LOCUS_16770 7548 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence0126 335 39 gene locus_tag LOCUS_16780 335 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 657 319 gene locus_tag LOCUS_16790 657 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 3728 654 gene locus_tag LOCUS_16800 3728 654 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_16800 4810 3728 gene locus_tag LOCUS_16810 4810 3728 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494086.1 protein_id gnl|my_center|LOCUS_16810 5808 4807 gene locus_tag LOCUS_16820 5808 4807 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16820 5985 5821 gene locus_tag LOCUS_16830 5985 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6157 6489 gene locus_tag LOCUS_16840 6157 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6486 7145 gene locus_tag LOCUS_16850 6486 7145 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246025.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence0127 1959 2893 gene locus_tag LOCUS_r00040 1959 2893 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 16S ribosomal RNA 4494 7185 gene locus_tag LOCUS_r00050 4494 7185 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence0128 700 239 gene locus_tag LOCUS_16860 700 239 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158145.1 protein_id gnl|my_center|LOCUS_16860 920 2314 gene locus_tag LOCUS_16870 gene rhlE 920 2314 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_16870 2581 2925 gene locus_tag LOCUS_16880 gene grxD 2581 2925 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_16880 2994 4352 gene locus_tag LOCUS_16890 2994 4352 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_16890 4956 4267 gene locus_tag LOCUS_16900 gene rnt 4956 4267 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_16900 5092 5832 gene locus_tag LOCUS_16910 5092 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 6062 6421 gene locus_tag LOCUS_16920 6062 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 6662 7354 gene locus_tag LOCUS_16930 6662 7354 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence0129 622 344 gene locus_tag LOCUS_16940 622 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 696 1559 gene locus_tag LOCUS_16950 696 1559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_16950 3154 1568 gene locus_tag LOCUS_16960 gene gshA 3154 1568 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_16960 5240 3159 gene locus_tag LOCUS_16970 5240 3159 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_16970 6142 5258 gene locus_tag LOCUS_16980 6142 5258 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_16980 6935 6135 gene locus_tag LOCUS_16990 gene mazG 6935 6135 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704767.1 protein_id gnl|my_center|LOCUS_16990 6934 7302 gene locus_tag LOCUS_17000 6934 7302 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_17000 7747 7310 gene locus_tag LOCUS_17010 7747 7310 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240113.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence0130 115 546 gene locus_tag LOCUS_17020 gene norC 115 546 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_17020 576 1970 gene locus_tag LOCUS_17030 gene norB 576 1970 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_17030 2080 2652 gene locus_tag LOCUS_17040 2080 2652 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_17040 2658 2930 gene locus_tag LOCUS_17050 2658 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2943 3734 gene locus_tag LOCUS_17060 gene nirQ 2943 3734 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_17060 3737 4138 gene locus_tag LOCUS_17070 3737 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 4135 5091 gene locus_tag LOCUS_17080 4135 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5072 6952 gene locus_tag LOCUS_17090 5072 6952 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_17090 7481 7089 gene locus_tag LOCUS_17100 7481 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17100 >Feature sequence0131 687 415 gene locus_tag LOCUS_17110 687 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1374 700 gene locus_tag LOCUS_17120 gene virB5 1374 700 CDS product P-type DNA transfer protein VirB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042067.1 protein_id gnl|my_center|LOCUS_17120 3838 1388 gene locus_tag LOCUS_17130 3838 1388 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528660.1 protein_id gnl|my_center|LOCUS_17130 4489 4166 gene locus_tag LOCUS_17140 4489 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 4874 4452 gene locus_tag LOCUS_17150 4874 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5316 4834 gene locus_tag LOCUS_17160 5316 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5476 5754 gene locus_tag LOCUS_17170 5476 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6707 5757 gene locus_tag LOCUS_17180 6707 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 7318 6707 gene locus_tag LOCUS_17190 7318 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence0132 724 1383 gene locus_tag LOCUS_17200 724 1383 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_17200 2669 1413 gene locus_tag LOCUS_17210 gene waaA 2669 1413 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891574.1 protein_id gnl|my_center|LOCUS_17210 3439 2666 gene locus_tag LOCUS_17220 3439 2666 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_17220 4596 3430 gene locus_tag LOCUS_17230 4596 3430 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_17230 6017 4593 gene locus_tag LOCUS_17240 gene hldE 6017 4593 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_17240 6875 6024 gene locus_tag LOCUS_17250 6875 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7619 6939 gene locus_tag LOCUS_17260 7619 6939 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419194.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence0133 1251 385 gene locus_tag LOCUS_17270 1251 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 4143 1255 gene locus_tag LOCUS_17280 4143 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5373 4345 gene locus_tag LOCUS_17290 5373 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7187 6762 gene locus_tag LOCUS_17300 7187 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence0134 1974 145 gene locus_tag LOCUS_17310 1974 145 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_17310 2173 1949 gene locus_tag LOCUS_17320 2173 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4016 2265 gene locus_tag LOCUS_17330 4016 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17330 2374 2473 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4975 4013 gene locus_tag LOCUS_17340 4975 4013 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769151.1 protein_id gnl|my_center|LOCUS_17340 5456 4968 gene locus_tag LOCUS_17350 5456 4968 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_17350 6382 5453 gene locus_tag LOCUS_17360 6382 5453 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_17360 7334 6384 gene locus_tag LOCUS_17370 7334 6384 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence0135 270 1091 gene locus_tag LOCUS_17380 gene cysE 270 1091 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_17380 1228 1653 gene locus_tag LOCUS_17390 gene iscR 1228 1653 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_17390 1687 2901 gene locus_tag LOCUS_17400 1687 2901 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_17400 2914 3294 gene locus_tag LOCUS_17410 gene iscU 2914 3294 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117907.1 protein_id gnl|my_center|LOCUS_17410 3300 3626 gene locus_tag LOCUS_17420 gene iscA 3300 3626 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 protein_id gnl|my_center|LOCUS_17420 3650 4195 gene locus_tag LOCUS_17430 gene hscB 3650 4195 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 protein_id gnl|my_center|LOCUS_17430 4195 6066 gene locus_tag LOCUS_17440 gene hscA 4195 6066 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196624.1 protein_id gnl|my_center|LOCUS_17440 6083 6421 gene locus_tag LOCUS_17450 gene fdx 6083 6421 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_17450 6421 6621 gene locus_tag LOCUS_17460 gene iscX 6421 6621 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_17460 6634 6903 gene locus_tag LOCUS_17470 6634 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 6906 7286 gene locus_tag LOCUS_17480 6906 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 >Feature sequence0136 2811 28 gene locus_tag LOCUS_17490 2811 28 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_17490 3230 2808 gene locus_tag LOCUS_17500 3230 2808 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128084539.1 protein_id gnl|my_center|LOCUS_17500 4596 3187 gene locus_tag LOCUS_17510 4596 3187 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166082.1 protein_id gnl|my_center|LOCUS_17510 5402 4605 gene locus_tag LOCUS_17520 5402 4605 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_17520 6065 5415 gene locus_tag LOCUS_17530 6065 5415 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_17530 6417 6037 gene locus_tag LOCUS_17540 6417 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6771 6421 gene locus_tag LOCUS_17550 6771 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7087 6857 gene locus_tag LOCUS_17560 7087 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 7399 7097 gene locus_tag LOCUS_17570 7399 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence0137 737 201 gene locus_tag LOCUS_17580 737 201 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_17580 1564 752 gene locus_tag LOCUS_17590 gene mutM 1564 752 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225172.1 protein_id gnl|my_center|LOCUS_17590 2038 1568 gene locus_tag LOCUS_17600 2038 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3342 2035 gene locus_tag LOCUS_17610 3342 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 4073 3339 gene locus_tag LOCUS_17620 4073 3339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_17620 4981 4070 gene locus_tag LOCUS_17630 4981 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5300 5088 gene locus_tag LOCUS_17640 5300 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5272 6105 gene locus_tag LOCUS_17650 5272 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17650 6134 6511 gene locus_tag LOCUS_17660 6134 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17660 6483 6995 gene locus_tag LOCUS_17670 6483 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17670 7551 7195 gene locus_tag LOCUS_17680 7551 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence0138 810 1064 gene locus_tag LOCUS_17690 810 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1414 2112 gene locus_tag LOCUS_17700 gene phoB 1414 2112 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383141.1 protein_id gnl|my_center|LOCUS_17700 2105 3406 gene locus_tag LOCUS_17710 gene phoR 2105 3406 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_17710 3431 4447 gene locus_tag LOCUS_17720 gene hemB 3431 4447 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_17720 4731 6767 gene locus_tag LOCUS_17730 4731 6767 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_17730 6854 7564 gene locus_tag LOCUS_17740 6854 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0139 283 1137 gene locus_tag LOCUS_17750 283 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1489 1205 gene locus_tag LOCUS_17760 1489 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2079 1642 gene locus_tag LOCUS_17770 2079 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2296 3957 gene locus_tag LOCUS_17780 2296 3957 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_17780 3970 5784 gene locus_tag LOCUS_17790 3970 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 5781 6317 gene locus_tag LOCUS_17800 5781 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 6938 6318 gene locus_tag LOCUS_17810 6938 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7492 7052 gene locus_tag LOCUS_17820 7492 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0140 1118 363 gene locus_tag LOCUS_17830 1118 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 1635 2825 gene locus_tag LOCUS_17840 1635 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 3046 3312 gene locus_tag LOCUS_17850 3046 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4149 3385 gene locus_tag LOCUS_17860 gene kdsB 4149 3385 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007039689.1 protein_id gnl|my_center|LOCUS_17860 4328 4149 gene locus_tag LOCUS_17870 4328 4149 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_17870 5298 4309 gene locus_tag LOCUS_17880 gene lpxK 5298 4309 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957852.1 protein_id gnl|my_center|LOCUS_17880 5733 5305 gene locus_tag LOCUS_17890 5733 5305 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_17890 6352 5738 gene locus_tag LOCUS_17900 6352 5738 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_17900 7266 6517 gene locus_tag LOCUS_17910 7266 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 >Feature sequence0141 162 419 gene locus_tag LOCUS_17920 162 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1848 2180 gene locus_tag LOCUS_17930 1848 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2354 3961 gene locus_tag LOCUS_17940 2354 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence0142 437 3802 gene locus_tag LOCUS_17950 gene mscM 437 3802 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080723.1 protein_id gnl|my_center|LOCUS_17950 3820 4401 gene locus_tag LOCUS_17960 3820 4401 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024661443.1 protein_id gnl|my_center|LOCUS_17960 4394 5545 gene locus_tag LOCUS_17970 4394 5545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832356.1 protein_id gnl|my_center|LOCUS_17970 5542 6135 gene locus_tag LOCUS_17980 5542 6135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_17980 7056 6127 gene locus_tag LOCUS_17990 7056 6127 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_17990 7176 7252 gene locus_tag LOCUS_t00250 7176 7252 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0143 202 639 gene locus_tag LOCUS_18000 202 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 652 1224 gene locus_tag LOCUS_18010 652 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1310 2560 gene locus_tag LOCUS_18020 1310 2560 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_18020 2553 3233 gene locus_tag LOCUS_18030 gene lolD 2553 3233 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_18030 3730 3200 gene locus_tag LOCUS_18040 3730 3200 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706585.1 protein_id gnl|my_center|LOCUS_18040 4288 5415 gene locus_tag LOCUS_18050 4288 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5734 5531 gene locus_tag LOCUS_18060 5734 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6393 5986 gene locus_tag LOCUS_18070 6393 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6915 6394 gene locus_tag LOCUS_18080 6915 6394 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_18080 7193 6915 gene locus_tag LOCUS_18090 7193 6915 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence0144 288 563 gene locus_tag LOCUS_18100 288 563 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_18100 810 601 gene locus_tag LOCUS_18110 810 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1884 898 gene locus_tag LOCUS_18120 gene dusA 1884 898 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_18120 3023 1881 gene locus_tag LOCUS_18130 3023 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3630 3013 gene locus_tag LOCUS_18140 3630 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4946 3627 gene locus_tag LOCUS_18150 gene argA 4946 3627 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 protein_id gnl|my_center|LOCUS_18150 6116 4959 gene locus_tag LOCUS_18160 gene argE 6116 4959 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419049.1 protein_id gnl|my_center|LOCUS_18160 6125 6832 gene locus_tag LOCUS_18170 6125 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence0145 157 408 gene locus_tag LOCUS_18180 157 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 451 1911 gene locus_tag LOCUS_18190 451 1911 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_18190 1961 2629 gene locus_tag LOCUS_18200 1961 2629 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_18200 2626 6000 gene locus_tag LOCUS_18210 2626 6000 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_18210 5987 7162 gene locus_tag LOCUS_18220 5987 7162 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence0146 208 555 gene locus_tag LOCUS_18230 gene arsC 208 555 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098232.1 protein_id gnl|my_center|LOCUS_18230 552 1142 gene locus_tag LOCUS_18240 gene wrbA 552 1142 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363251.1 protein_id gnl|my_center|LOCUS_18240 1139 1828 gene locus_tag LOCUS_18250 gene hda 1139 1828 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369632.1 protein_id gnl|my_center|LOCUS_18250 1846 2403 gene locus_tag LOCUS_18260 1846 2403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_18260 2560 2826 gene locus_tag LOCUS_18270 2560 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18270 2845 3081 gene locus_tag LOCUS_18280 2845 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3078 3674 gene locus_tag LOCUS_18290 3078 3674 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_18290 3929 3702 gene locus_tag LOCUS_18300 3929 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 4855 3914 gene locus_tag LOCUS_18310 4855 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 5585 4848 gene locus_tag LOCUS_18320 5585 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 5864 5586 gene locus_tag LOCUS_18330 5864 5586 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_18330 7307 6021 gene locus_tag LOCUS_18340 7307 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence0147 93 608 gene locus_tag LOCUS_18350 93 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 861 1094 gene locus_tag LOCUS_18360 861 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1269 2471 gene locus_tag LOCUS_18370 1269 2471 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409683.1 protein_id gnl|my_center|LOCUS_18370 2693 4345 gene locus_tag LOCUS_18380 2693 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 4463 4786 gene locus_tag LOCUS_18390 4463 4786 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_18390 4788 5393 gene locus_tag LOCUS_18400 gene recR 4788 5393 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195026.1 protein_id gnl|my_center|LOCUS_18400 5390 5758 gene locus_tag LOCUS_18410 5390 5758 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_18410 5855 6988 gene locus_tag LOCUS_18420 5855 6988 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704993.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence0148 510 1394 gene locus_tag LOCUS_18430 gene prmA 510 1394 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145803.1 protein_id gnl|my_center|LOCUS_18430 1391 2368 gene locus_tag LOCUS_18440 1391 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2368 3639 gene locus_tag LOCUS_18450 2368 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3700 5262 gene locus_tag LOCUS_18460 gene purH 3700 5262 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_18460 5276 6565 gene locus_tag LOCUS_18470 gene purD 5276 6565 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 protein_id gnl|my_center|LOCUS_18470 6567 7034 gene locus_tag LOCUS_18480 6567 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0149 960 61 gene locus_tag LOCUS_18490 960 61 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_18490 4291 1412 gene locus_tag LOCUS_18500 4291 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 5158 4304 gene locus_tag LOCUS_18510 5158 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6425 5391 gene locus_tag LOCUS_18520 6425 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence0150 211 627 gene locus_tag LOCUS_18530 gene arfB 211 627 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_18530 2093 699 gene locus_tag LOCUS_18540 gene purB 2093 699 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_18540 3294 2119 gene locus_tag LOCUS_18550 3294 2119 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_18550 3376 5382 gene locus_tag LOCUS_18560 gene uvrB 3376 5382 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345654.1 protein_id gnl|my_center|LOCUS_18560 6231 5407 gene locus_tag LOCUS_18570 6231 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6555 6645 gene locus_tag LOCUS_t00260 6555 6645 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0151 299 862 gene locus_tag LOCUS_18580 299 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 1126 929 gene locus_tag LOCUS_18590 1126 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1479 2522 gene locus_tag LOCUS_18600 1479 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 2515 3738 gene locus_tag LOCUS_18610 2515 3738 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_18610 3738 5213 gene locus_tag LOCUS_18620 3738 5213 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_18620 5391 5765 gene locus_tag LOCUS_18630 5391 5765 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329747.1 protein_id gnl|my_center|LOCUS_18630 6358 5840 gene locus_tag LOCUS_18640 6358 5840 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_18640 7075 6392 gene locus_tag LOCUS_18650 7075 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence0152 842 177 gene locus_tag LOCUS_18660 842 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18660 3074 1701 gene locus_tag LOCUS_18670 3074 1701 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_18670 3703 3110 gene locus_tag LOCUS_18680 3703 3110 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_18680 4120 3767 gene locus_tag LOCUS_18690 4120 3767 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_18690 5888 4086 gene locus_tag LOCUS_18700 5888 4086 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_18700 5995 6912 gene locus_tag LOCUS_18710 gene rsmI 5995 6912 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence0153 565 425 gene locus_tag LOCUS_18720 565 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 729 1850 gene locus_tag LOCUS_18730 gene hisC 729 1850 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_18730 1847 2731 gene locus_tag LOCUS_18740 1847 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2738 4057 gene locus_tag LOCUS_18750 2738 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18750 4050 4727 gene locus_tag LOCUS_18760 gene cmk 4050 4727 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_18760 4841 6529 gene locus_tag LOCUS_18770 gene rpsA 4841 6529 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_18770 6581 6886 gene locus_tag LOCUS_18780 6581 6886 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence0154 207 19 gene locus_tag LOCUS_18790 207 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 1241 279 gene locus_tag LOCUS_18800 gene pdxA 1241 279 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241228.1 protein_id gnl|my_center|LOCUS_18800 2566 1238 gene locus_tag LOCUS_18810 2566 1238 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_18810 4655 2556 gene locus_tag LOCUS_18820 4655 2556 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243965.1 protein_id gnl|my_center|LOCUS_18820 4731 4940 gene locus_tag LOCUS_18830 4731 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 5303 6307 gene locus_tag LOCUS_18840 5303 6307 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_18840 6323 7018 gene locus_tag LOCUS_18850 6323 7018 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266245.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence0155 2532 565 gene locus_tag LOCUS_18860 2532 565 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_18860 3799 2537 gene locus_tag LOCUS_18870 3799 2537 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_18870 5488 3896 gene locus_tag LOCUS_18880 5488 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 6673 5783 gene locus_tag LOCUS_18890 6673 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 6956 6687 gene locus_tag LOCUS_18900 6956 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence0156 700 11 gene locus_tag LOCUS_18910 700 11 CDS product LexA family transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848748.1 protein_id gnl|my_center|LOCUS_18910 813 1049 gene locus_tag LOCUS_18920 813 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1053 2630 gene locus_tag LOCUS_18930 1053 2630 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202097.1 protein_id gnl|my_center|LOCUS_18930 2636 3241 gene locus_tag LOCUS_18940 2636 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3234 4511 gene locus_tag LOCUS_18950 3234 4511 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301887.1 protein_id gnl|my_center|LOCUS_18950 4663 5436 gene locus_tag LOCUS_18960 4663 5436 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895544.1 protein_id gnl|my_center|LOCUS_18960 5517 5861 gene locus_tag LOCUS_18970 5517 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5901 6941 gene locus_tag LOCUS_18980 5901 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence0157 268 98 gene locus_tag LOCUS_18990 268 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2891 261 gene locus_tag LOCUS_19000 2891 261 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_19000 4419 2893 gene locus_tag LOCUS_19010 4419 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6158 4764 gene locus_tag LOCUS_19020 6158 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6442 6158 gene locus_tag LOCUS_19030 6442 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6621 6806 gene locus_tag LOCUS_19040 6621 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 6803 7006 gene locus_tag LOCUS_19050 6803 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence0158 226 2862 gene locus_tag LOCUS_19060 gene pepN 226 2862 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_19060 2859 3251 gene locus_tag LOCUS_19070 2859 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3232 3477 gene locus_tag LOCUS_19080 3232 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 6525 3478 gene locus_tag LOCUS_19090 6525 3478 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence0159 377 808 gene locus_tag LOCUS_19100 377 808 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_19100 801 1694 gene locus_tag LOCUS_19110 gene xerD 801 1694 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_19110 1958 2668 gene locus_tag LOCUS_19120 1958 2668 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_19120 2669 3442 gene locus_tag LOCUS_19130 2669 3442 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_19130 6019 3455 gene locus_tag LOCUS_19140 gene mutS 6019 3455 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_19140 6856 6050 gene locus_tag LOCUS_19150 gene djlA 6856 6050 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200595.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence0160 1049 174 gene locus_tag LOCUS_19160 gene cheR 1049 174 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204321.1 protein_id gnl|my_center|LOCUS_19160 1342 1046 gene locus_tag LOCUS_19170 1342 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4053 1345 gene locus_tag LOCUS_19180 4053 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 4330 4079 gene locus_tag LOCUS_19190 4330 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19190 6694 4622 gene locus_tag LOCUS_19200 6694 4622 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0161 1888 2028 gene locus_tag LOCUS_19210 1888 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2344 2541 gene locus_tag LOCUS_19220 2344 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3556 3362 gene locus_tag LOCUS_19230 3556 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 4495 4671 gene locus_tag LOCUS_19240 4495 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 4619 4771 gene locus_tag LOCUS_19250 4619 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5093 5233 gene locus_tag LOCUS_19260 5093 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 5230 5463 gene locus_tag LOCUS_19270 5230 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0162 147 320 gene locus_tag LOCUS_19280 147 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 414 614 gene locus_tag LOCUS_19290 gene rpmE 414 614 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_19290 771 2042 gene locus_tag LOCUS_19300 771 2042 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_19300 2103 3029 gene locus_tag LOCUS_19310 gene mdh 2103 3029 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_19310 3081 4379 gene locus_tag LOCUS_19320 3081 4379 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 protein_id gnl|my_center|LOCUS_19320 6848 4461 gene locus_tag LOCUS_19330 6848 4461 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence0163 <1 1170 gene locus_tag LOCUS_19340 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039057.1:class I SAM-dependent DNA methyltransferase 1157 2473 gene locus_tag LOCUS_19350 1157 2473 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691244.1 protein_id gnl|my_center|LOCUS_19350 2470 4212 gene locus_tag LOCUS_19360 2470 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4209 5171 gene locus_tag LOCUS_19370 4209 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 5175 6230 gene locus_tag LOCUS_19380 5175 6230 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939813.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence0164 144 452 gene locus_tag LOCUS_19390 144 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1622 510 gene locus_tag LOCUS_19400 gene queG 1622 510 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 protein_id gnl|my_center|LOCUS_19400 1621 3135 gene locus_tag LOCUS_19410 1621 3135 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_19410 3170 3613 gene locus_tag LOCUS_19420 gene tsaE 3170 3613 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_19420 3712 5058 gene locus_tag LOCUS_19430 gene amiB 3712 5058 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_19430 5162 5782 gene locus_tag LOCUS_19440 5162 5782 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_19440 5944 6594 gene locus_tag LOCUS_19450 5944 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6530 6880 gene locus_tag LOCUS_19460 6530 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence0165 352 756 gene locus_tag LOCUS_19470 352 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2811 826 gene locus_tag LOCUS_19480 gene slt 2811 826 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_19480 2943 3389 gene locus_tag LOCUS_19490 2943 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4522 3464 gene locus_tag LOCUS_19500 gene aroG 4522 3464 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_19500 5554 4583 gene locus_tag LOCUS_19510 5554 4583 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_19510 6638 5658 gene locus_tag LOCUS_19520 6638 5658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0166 136 1371 gene locus_tag LOCUS_19530 136 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1425 2312 gene locus_tag LOCUS_19540 gene argB 1425 2312 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_19540 2309 2890 gene locus_tag LOCUS_19550 gene slmA 2309 2890 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704178.1 protein_id gnl|my_center|LOCUS_19550 3874 2900 gene locus_tag LOCUS_19560 3874 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 3939 4685 gene locus_tag LOCUS_19570 3939 4685 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_19570 4764 5927 gene locus_tag LOCUS_19580 gene sucC 4764 5927 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_19580 5940 6812 gene locus_tag LOCUS_19590 gene sucD 5940 6812 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence0167 1657 1268 gene locus_tag LOCUS_19600 1657 1268 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_19600 1838 5344 gene locus_tag LOCUS_19610 gene smc 1838 5344 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_19610 5474 5608 gene locus_tag LOCUS_19620 5474 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 6041 6796 gene locus_tag LOCUS_19630 6041 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence0168 417 2099 gene locus_tag LOCUS_19640 417 2099 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_19640 2096 3079 gene locus_tag LOCUS_19650 gene birA 2096 3079 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_19650 3081 3836 gene locus_tag LOCUS_19660 3081 3836 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_19660 3833 4726 gene locus_tag LOCUS_19670 3833 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4751 4826 gene locus_tag LOCUS_t00270 4751 4826 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5010 5417 gene locus_tag LOCUS_19680 5010 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5443 6534 gene locus_tag LOCUS_19690 gene ychF 5443 6534 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_19690 6550 6684 gene locus_tag LOCUS_19700 6550 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0169 521 81 gene locus_tag LOCUS_19710 521 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 557 724 gene locus_tag LOCUS_19720 557 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 838 710 gene locus_tag LOCUS_19730 838 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2850 835 gene locus_tag LOCUS_19740 gene ligA 2850 835 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443665.1 protein_id gnl|my_center|LOCUS_19740 3704 2847 gene locus_tag LOCUS_19750 3704 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6608 3807 gene locus_tag LOCUS_19760 6608 3807 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence0170 198 581 gene locus_tag LOCUS_19770 198 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1887 544 gene locus_tag LOCUS_19780 1887 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4049 1887 gene locus_tag LOCUS_19790 4049 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4853 4260 gene locus_tag LOCUS_19800 4853 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 6443 4854 gene locus_tag LOCUS_19810 6443 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence0171 1230 364 gene locus_tag LOCUS_19820 gene trxA 1230 364 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_19820 1339 1785 gene locus_tag LOCUS_19830 gene trxC 1339 1785 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_19830 1977 3116 gene locus_tag LOCUS_19840 gene carA 1977 3116 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_19840 3141 6350 gene locus_tag LOCUS_19850 gene carB 3141 6350 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243709.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence0172 946 212 gene locus_tag LOCUS_19860 946 212 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_19860 1578 943 gene locus_tag LOCUS_19870 1578 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19870 2335 1472 gene locus_tag LOCUS_19880 2335 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19880 2414 2722 gene locus_tag LOCUS_19890 2414 2722 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530084.1 protein_id gnl|my_center|LOCUS_19890 2703 2996 gene locus_tag LOCUS_19900 2703 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 4639 3038 gene locus_tag LOCUS_19910 4639 3038 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_19910 4838 6001 gene locus_tag LOCUS_19920 4838 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0173 5564 4032 gene locus_tag LOCUS_19930 5564 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0174 1923 220 gene locus_tag LOCUS_19940 1923 220 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_19940 3567 2101 gene locus_tag LOCUS_19950 3567 2101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_19950 3937 6417 gene locus_tag LOCUS_19960 gene nirB 3937 6417 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence0175 267 2372 gene locus_tag LOCUS_19970 267 2372 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_19970 2373 3731 gene locus_tag LOCUS_19980 2373 3731 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_19980 3734 6130 gene locus_tag LOCUS_19990 3734 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 6130 6513 gene locus_tag LOCUS_20000 6130 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0176 239 847 gene locus_tag LOCUS_20010 gene dsbA 239 847 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_20010 831 1655 gene locus_tag LOCUS_20020 831 1655 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_20020 2286 1723 gene locus_tag LOCUS_20030 2286 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2346 3176 gene locus_tag LOCUS_20040 2346 3176 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_20040 3173 3901 gene locus_tag LOCUS_20050 3173 3901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_20050 3901 4731 gene locus_tag LOCUS_20060 3901 4731 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485751.1 protein_id gnl|my_center|LOCUS_20060 4728 4955 gene locus_tag LOCUS_20070 gene yidD 4728 4955 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_20070 4952 5992 gene locus_tag LOCUS_20080 4952 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5983 6354 gene locus_tag LOCUS_20090 5983 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0177 1283 141 gene locus_tag LOCUS_20100 gene dnaN 1283 141 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_20100 1522 1812 gene locus_tag LOCUS_20110 1522 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 1809 2003 gene locus_tag LOCUS_20120 1809 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2535 1945 gene locus_tag LOCUS_20130 2535 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 5225 2598 gene locus_tag LOCUS_20140 5225 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6137 5232 gene locus_tag LOCUS_20150 6137 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence0178 412 1524 gene locus_tag LOCUS_20160 412 1524 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_20160 1901 4642 gene locus_tag LOCUS_20170 1901 4642 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947500.1 protein_id gnl|my_center|LOCUS_20170 4848 5387 gene locus_tag LOCUS_20180 4848 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5501 6382 gene locus_tag LOCUS_20190 5501 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence0179 1453 305 gene locus_tag LOCUS_20200 gene hemW 1453 305 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105287.1 protein_id gnl|my_center|LOCUS_20200 2529 1450 gene locus_tag LOCUS_20210 gene dctP 2529 1450 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_20210 4901 2736 gene locus_tag LOCUS_20220 gene uvrD 4901 2736 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815343.1 protein_id gnl|my_center|LOCUS_20220 6017 4914 gene locus_tag LOCUS_20230 6017 4914 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence0180 280 35 gene locus_tag LOCUS_20240 280 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1057 290 gene locus_tag LOCUS_20250 1057 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2446 1349 gene locus_tag LOCUS_20260 2446 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 3300 2443 gene locus_tag LOCUS_20270 3300 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20270 3891 3322 gene locus_tag LOCUS_20280 3891 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20280 4352 3888 gene locus_tag LOCUS_20290 4352 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4744 4349 gene locus_tag LOCUS_20300 4744 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20300 5277 5014 gene locus_tag LOCUS_20310 5277 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5567 5277 gene locus_tag LOCUS_20320 gene mnhG 5567 5277 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080104.1 protein_id gnl|my_center|LOCUS_20320 5854 5588 gene locus_tag LOCUS_20330 5854 5588 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_20330 6342 5851 gene locus_tag LOCUS_20340 6342 5851 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence0181 273 2672 gene locus_tag LOCUS_20350 273 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2746 4608 gene locus_tag LOCUS_20360 2746 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5543 4689 gene locus_tag LOCUS_20370 5543 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 6143 5550 gene locus_tag LOCUS_20380 6143 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0182 117 479 gene locus_tag LOCUS_20390 117 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 484 1080 gene locus_tag LOCUS_20400 484 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2395 1217 gene locus_tag LOCUS_20410 2395 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2959 2618 gene locus_tag LOCUS_20420 2959 2618 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720603.1 protein_id gnl|my_center|LOCUS_20420 3112 4842 gene locus_tag LOCUS_20430 3112 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4868 5758 gene locus_tag LOCUS_20440 4868 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence0183 141 1673 gene locus_tag LOCUS_20450 141 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20450 1720 3735 gene locus_tag LOCUS_20460 1720 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20460 3817 5121 gene locus_tag LOCUS_20470 3817 5121 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_20470 5111 5764 gene locus_tag LOCUS_20480 5111 5764 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_20480 5887 6303 gene locus_tag LOCUS_20490 5887 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence0184 235 738 gene locus_tag LOCUS_20500 235 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 898 3069 gene locus_tag LOCUS_20510 gene relA 898 3069 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247360.1 protein_id gnl|my_center|LOCUS_20510 3600 3070 gene locus_tag LOCUS_20520 3600 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3493 3855 gene locus_tag LOCUS_20530 3493 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4062 3880 gene locus_tag LOCUS_20540 4062 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20540 4739 4059 gene locus_tag LOCUS_20550 gene modB 4739 4059 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_20550 5515 4736 gene locus_tag LOCUS_20560 gene modA 5515 4736 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_20560 6143 5523 gene locus_tag LOCUS_20570 gene dut 6143 5523 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence0185 3998 603 gene locus_tag LOCUS_20580 3998 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 4948 3998 gene locus_tag LOCUS_20590 4948 3998 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_20590 5168 6295 gene locus_tag LOCUS_20600 5168 6295 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence0186 724 200 gene locus_tag LOCUS_20610 724 200 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_20610 1457 717 gene locus_tag LOCUS_20620 gene yfiH 1457 717 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040163.1 protein_id gnl|my_center|LOCUS_20620 2475 1447 gene locus_tag LOCUS_20630 gene rluD 2475 1447 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_20630 2474 3289 gene locus_tag LOCUS_20640 2474 3289 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_20640 3317 3604 gene locus_tag LOCUS_20650 3317 3604 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_20650 4372 3662 gene locus_tag LOCUS_20660 4372 3662 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_20660 5309 4476 gene locus_tag LOCUS_20670 gene nadC 5309 4476 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_20670 5653 5309 gene locus_tag LOCUS_20680 5653 5309 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_20680 6125 5760 gene locus_tag LOCUS_20690 6125 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0187 202 678 gene locus_tag LOCUS_20700 202 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 675 1511 gene locus_tag LOCUS_20710 675 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880491.1 protein_id gnl|my_center|LOCUS_20710 2533 1994 gene locus_tag LOCUS_20720 2533 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4074 2533 gene locus_tag LOCUS_20730 gene nirN 4074 2533 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_20730 4703 4083 gene locus_tag LOCUS_20740 4703 4083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966671.1 protein_id gnl|my_center|LOCUS_20740 5839 4700 gene locus_tag LOCUS_20750 gene nirJ 5839 4700 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_20750 6194 5979 gene locus_tag LOCUS_20760 6194 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0188 756 202 gene locus_tag LOCUS_20770 756 202 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_20770 1830 760 gene locus_tag LOCUS_20780 1830 760 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_20780 2128 3180 gene locus_tag LOCUS_20790 gene purM 2128 3180 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 protein_id gnl|my_center|LOCUS_20790 3173 3826 gene locus_tag LOCUS_20800 gene purN 3173 3826 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_20800 3823 4527 gene locus_tag LOCUS_20810 3823 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4524 4946 gene locus_tag LOCUS_20820 4524 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689404.1 protein_id gnl|my_center|LOCUS_20820 6053 5115 gene locus_tag LOCUS_20830 6053 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20830 >Feature sequence0189 3658 164 gene locus_tag LOCUS_20840 3658 164 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_20840 4939 3677 gene locus_tag LOCUS_20850 4939 3677 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_20850 <6191 4967 gene locus_tag LOCUS_20860 <6191 4967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091102695.1:AAA family ATPase >Feature sequence0190 <1 2570 gene locus_tag LOCUS_20870 <1 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162006391.1:heavy metal translocating P-type ATPase 2595 2948 gene locus_tag LOCUS_20880 2595 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3182 3862 gene locus_tag LOCUS_20890 3182 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3935 5080 gene locus_tag LOCUS_20900 3935 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20900 5094 5567 gene locus_tag LOCUS_20910 5094 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence0191 266 1576 gene locus_tag LOCUS_20920 266 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5539 1682 gene locus_tag LOCUS_20930 5539 1682 CDS product FAD/FMN-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244102.1 protein_id gnl|my_center|LOCUS_20930 6037 5774 gene locus_tag LOCUS_20940 6037 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence0192 281 664 gene locus_tag LOCUS_20950 281 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1655 696 gene locus_tag LOCUS_20960 1655 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1920 2405 gene locus_tag LOCUS_20970 1920 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2421 2942 gene locus_tag LOCUS_20980 2421 2942 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881088.1 protein_id gnl|my_center|LOCUS_20980 2944 4209 gene locus_tag LOCUS_20990 2944 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4242 4952 gene locus_tag LOCUS_21000 4242 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4949 5218 gene locus_tag LOCUS_21010 4949 5218 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_21010 5973 5239 gene locus_tag LOCUS_21020 5973 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0193 1235 930 gene locus_tag LOCUS_21030 1235 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1657 1295 gene locus_tag LOCUS_21040 gene msrB 1657 1295 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 protein_id gnl|my_center|LOCUS_21040 1802 2407 gene locus_tag LOCUS_21050 1802 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2415 3314 gene locus_tag LOCUS_21060 2415 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4221 3271 gene locus_tag LOCUS_21070 gene epmA 4221 3271 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 protein_id gnl|my_center|LOCUS_21070 4787 4218 gene locus_tag LOCUS_21080 gene efp 4787 4218 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_21080 4857 5897 gene locus_tag LOCUS_21090 gene epmB 4857 5897 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence0194 877 80 gene locus_tag LOCUS_21100 877 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2398 917 gene locus_tag LOCUS_21110 gene lysS 2398 917 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 protein_id gnl|my_center|LOCUS_21110 3403 2501 gene locus_tag LOCUS_21120 gene prfB 3403 2501 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21120 3825 5864 gene locus_tag LOCUS_21130 3825 5864 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114620.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence0195 139 1125 gene locus_tag LOCUS_21140 gene dctP 139 1125 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_21140 1135 1659 gene locus_tag LOCUS_21150 1135 1659 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_21150 1659 2936 gene locus_tag LOCUS_21160 gene dctM 1659 2936 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_21160 2950 3882 gene locus_tag LOCUS_21170 gene oxyR 2950 3882 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_21170 4080 4499 gene locus_tag LOCUS_21180 4080 4499 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_21180 4558 5886 gene locus_tag LOCUS_21190 4558 5886 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence0196 439 92 gene locus_tag LOCUS_21200 439 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1513 527 gene locus_tag LOCUS_21210 1513 527 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609198.1 protein_id gnl|my_center|LOCUS_21210 1664 3475 gene locus_tag LOCUS_21220 1664 3475 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_21220 3567 3764 gene locus_tag LOCUS_21230 3567 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3761 5662 gene locus_tag LOCUS_21240 3761 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence0197 381 1085 gene locus_tag LOCUS_21250 gene sfsA 381 1085 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_21250 1915 1112 gene locus_tag LOCUS_21260 gene cpdA 1915 1112 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102066.1 protein_id gnl|my_center|LOCUS_21260 2519 2004 gene locus_tag LOCUS_21270 gene fabA 2519 2004 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_21270 4235 2526 gene locus_tag LOCUS_21280 gene proS 4235 2526 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163997.1 protein_id gnl|my_center|LOCUS_21280 4431 5651 gene locus_tag LOCUS_21290 4431 5651 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_21290 5894 5679 gene locus_tag LOCUS_21300 5894 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0198 1626 259 gene locus_tag LOCUS_21310 gene xseA 1626 259 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099131.1 protein_id gnl|my_center|LOCUS_21310 1830 3329 gene locus_tag LOCUS_21320 gene guaB 1830 3329 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_21320 3449 5026 gene locus_tag LOCUS_21330 gene guaA 3449 5026 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771001.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence0199 1023 667 gene locus_tag LOCUS_21340 1023 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1270 989 gene locus_tag LOCUS_21350 1270 989 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_21350 1987 1304 gene locus_tag LOCUS_21360 gene cas6e 1987 1304 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281434.1 protein_id gnl|my_center|LOCUS_21360 2691 1987 gene locus_tag LOCUS_21370 gene cas5e 2691 1987 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666425.1 protein_id gnl|my_center|LOCUS_21370 3735 2695 gene locus_tag LOCUS_21380 gene cas7e 3735 2695 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_21380 4289 3732 gene locus_tag LOCUS_21390 4289 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5881 4304 gene locus_tag LOCUS_21400 gene casA 5881 4304 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046083149.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence0200 2405 312 gene locus_tag LOCUS_21410 2405 312 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_21410 3100 2402 gene locus_tag LOCUS_21420 3100 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3931 3362 gene locus_tag LOCUS_21430 3931 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4707 3931 gene locus_tag LOCUS_21440 4707 3931 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_21440 5633 4704 gene locus_tag LOCUS_21450 5633 4704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence0201 1111 2121 gene locus_tag LOCUS_21460 1111 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2797 5658 gene locus_tag LOCUS_21470 2797 5658 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804175.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence0202 770 3 gene locus_tag LOCUS_21480 770 3 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_21480 2047 767 gene locus_tag LOCUS_21490 gene bioA 2047 767 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_21490 2910 2044 gene locus_tag LOCUS_21500 gene ubiA 2910 2044 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_21500 3079 3813 gene locus_tag LOCUS_21510 3079 3813 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_21510 5046 3862 gene locus_tag LOCUS_21520 5046 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5761 5090 gene locus_tag LOCUS_21530 5761 5090 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence0203 <1 2486 gene locus_tag LOCUS_21540 <1 2486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104585991.1:AAA family ATPase 2488 3750 gene locus_tag LOCUS_21550 2488 3750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence0204 253 77 gene locus_tag LOCUS_21560 253 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2036 423 gene locus_tag LOCUS_21570 2036 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4272 2029 gene locus_tag LOCUS_21580 gene topA 4272 2029 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_21580 4973 4257 gene locus_tag LOCUS_21590 4973 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 5630 5292 gene locus_tag LOCUS_21600 5630 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence0205 108 1205 gene locus_tag LOCUS_21610 108 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21610 1218 3047 gene locus_tag LOCUS_21620 1218 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21620 3210 4070 gene locus_tag LOCUS_21630 gene dapA 3210 4070 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_21630 4067 5266 gene locus_tag LOCUS_21640 gene bamC 4067 5266 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 protein_id gnl|my_center|LOCUS_21640 5292 5780 gene locus_tag LOCUS_21650 5292 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0206 1222 200 gene locus_tag LOCUS_21660 gene trpD 1222 200 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_21660 2057 1479 gene locus_tag LOCUS_21670 2057 1479 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_21670 3557 2061 gene locus_tag LOCUS_21680 gene trpE 3557 2061 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_21680 4397 3732 gene locus_tag LOCUS_21690 4397 3732 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_21690 5089 4400 gene locus_tag LOCUS_21700 gene rpe 5089 4400 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304938.1 protein_id gnl|my_center|LOCUS_21700 5726 5442 gene locus_tag LOCUS_21710 5726 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence0207 355 77 gene locus_tag LOCUS_21720 355 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1577 2206 gene locus_tag LOCUS_21730 1577 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence0208 241 116 gene locus_tag LOCUS_21740 241 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 552 286 gene locus_tag LOCUS_21750 552 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 643 1626 gene locus_tag LOCUS_21760 643 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2586 1936 gene locus_tag LOCUS_21770 2586 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3152 2586 gene locus_tag LOCUS_21780 3152 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 3383 3153 gene locus_tag LOCUS_21790 3383 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 4079 3456 gene locus_tag LOCUS_21800 4079 3456 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_21800 4142 5185 gene locus_tag LOCUS_21810 4142 5185 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_21810 5598 5215 gene locus_tag LOCUS_21820 5598 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence0209 <1 1406 gene locus_tag LOCUS_21830 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000350101.1:class I SAM-dependent DNA methyltransferase 1406 2713 gene locus_tag LOCUS_21840 1406 2713 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167385843.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0210 695 2560 gene locus_tag LOCUS_21850 gene hypF 695 2560 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338264.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21850 2653 2937 gene locus_tag LOCUS_21860 2653 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2967 3524 gene locus_tag LOCUS_21870 2967 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3621 4814 gene locus_tag LOCUS_21880 3621 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 5055 5648 gene locus_tag LOCUS_21890 5055 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence0211 <1 787 gene locus_tag LOCUS_21900 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978086.1:substrate-binding domain-containing protein 2042 831 gene locus_tag LOCUS_21910 gene pyk 2042 831 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_21910 2242 2090 gene locus_tag LOCUS_21920 2242 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21920 3534 2239 gene locus_tag LOCUS_21930 3534 2239 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_21930 4903 3542 gene locus_tag LOCUS_21940 gene pabB 4903 3542 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854998.1 protein_id gnl|my_center|LOCUS_21940 5593 4979 gene locus_tag LOCUS_21950 5593 4979 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence0212 1498 311 gene locus_tag LOCUS_21960 1498 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_21960 2139 1498 gene locus_tag LOCUS_21970 2139 1498 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071948.1 protein_id gnl|my_center|LOCUS_21970 2542 2141 gene locus_tag LOCUS_21980 2542 2141 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_21980 3096 2539 gene locus_tag LOCUS_21990 3096 2539 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_21990 4445 3099 gene locus_tag LOCUS_22000 4445 3099 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_22000 5224 4442 gene locus_tag LOCUS_22010 5224 4442 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_22010 5566 5399 gene locus_tag LOCUS_22020 5566 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence0213 383 126 gene locus_tag LOCUS_22030 383 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1462 563 gene locus_tag LOCUS_22040 1462 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22040 3575 1557 gene locus_tag LOCUS_22050 gene metG 3575 1557 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_22050 3789 4880 gene locus_tag LOCUS_22060 gene apbC 3789 4880 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence0214 149 1258 gene locus_tag LOCUS_22070 149 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533560.1 protein_id gnl|my_center|LOCUS_22070 1535 1804 gene locus_tag LOCUS_22080 1535 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1801 3135 gene locus_tag LOCUS_22090 1801 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3590 3189 gene locus_tag LOCUS_22100 3590 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3982 3587 gene locus_tag LOCUS_22110 gene gloA 3982 3587 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_22110 4148 4834 gene locus_tag LOCUS_22120 4148 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5308 5535 gene locus_tag LOCUS_22130 5308 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence0215 357 1022 gene locus_tag LOCUS_22140 357 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1097 1720 gene locus_tag LOCUS_22150 gene imuA 1097 1720 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_22150 1708 3141 gene locus_tag LOCUS_22160 1708 3141 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence0216 116 1402 gene locus_tag LOCUS_22170 116 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22170 1661 2107 gene locus_tag LOCUS_22180 1661 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 2104 3114 gene locus_tag LOCUS_22190 2104 3114 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_22190 3170 3562 gene locus_tag LOCUS_22200 3170 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4511 3576 gene locus_tag LOCUS_22210 4511 3576 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_22210 5170 4508 gene locus_tag LOCUS_22220 5170 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0217 904 128 gene locus_tag LOCUS_22230 gene rsmA 904 128 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_22230 982 1215 gene locus_tag LOCUS_22240 982 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1458 2804 gene locus_tag LOCUS_22250 gene miaB 1458 2804 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038553.1 protein_id gnl|my_center|LOCUS_22250 2812 3801 gene locus_tag LOCUS_22260 2812 3801 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_22260 3798 4250 gene locus_tag LOCUS_22270 gene ybeY 3798 4250 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418185.1 protein_id gnl|my_center|LOCUS_22270 4304 5110 gene locus_tag LOCUS_22280 4304 5110 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0218 427 2733 gene locus_tag LOCUS_22290 427 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2870 5143 gene locus_tag LOCUS_22300 2870 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence0219 322 116 gene locus_tag LOCUS_22310 322 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3192 697 gene locus_tag LOCUS_22320 3192 697 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022951227.1 protein_id gnl|my_center|LOCUS_22320 4706 3375 gene locus_tag LOCUS_22330 4706 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5217 4762 gene locus_tag LOCUS_22340 5217 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence0220 1193 114 gene locus_tag LOCUS_22350 1193 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2792 1287 gene locus_tag LOCUS_22360 2792 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3073 2789 gene locus_tag LOCUS_22370 3073 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4493 2970 gene locus_tag LOCUS_22380 4493 2970 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_22380 5191 4520 gene locus_tag LOCUS_22390 5191 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0221 957 130 gene locus_tag LOCUS_22400 957 130 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_22400 1033 2430 gene locus_tag LOCUS_22410 gene ffh 1033 2430 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462555.1 protein_id gnl|my_center|LOCUS_22410 2552 3034 gene locus_tag LOCUS_22420 2552 3034 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_22420 3294 3746 gene locus_tag LOCUS_22430 3294 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22430 3789 4415 gene locus_tag LOCUS_22440 3789 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22440 >Feature sequence0222 2496 562 gene locus_tag LOCUS_22450 2496 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2600 3526 gene locus_tag LOCUS_22460 gene prmB 2600 3526 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 protein_id gnl|my_center|LOCUS_22460 3523 3843 gene locus_tag LOCUS_22470 3523 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 3874 5256 gene locus_tag LOCUS_22480 gene hemN 3874 5256 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence0223 175 627 gene locus_tag LOCUS_22490 gene apaG 175 627 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 protein_id gnl|my_center|LOCUS_22490 633 1472 gene locus_tag LOCUS_22500 633 1472 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_22500 3448 1559 gene locus_tag LOCUS_22510 gene thiC 3448 1559 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_22510 4101 3673 gene locus_tag LOCUS_22520 4101 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 5237 4098 gene locus_tag LOCUS_22530 5237 4098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence0224 3 206 gene locus_tag LOCUS_22540 3 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1195 278 gene locus_tag LOCUS_22550 gene rdgC 1195 278 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368016.1 protein_id gnl|my_center|LOCUS_22550 2954 1245 gene locus_tag LOCUS_22560 2954 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 4663 3209 gene locus_tag LOCUS_22570 4663 3209 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_22570 5168 4680 gene locus_tag LOCUS_22580 5168 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence0225 1032 421 gene locus_tag LOCUS_22590 1032 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3091 1037 gene locus_tag LOCUS_22600 3091 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3182 3547 gene locus_tag LOCUS_22610 3182 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3939 3562 gene locus_tag LOCUS_22620 3939 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5204 4257 gene locus_tag LOCUS_22630 5204 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence0226 675 1787 gene locus_tag LOCUS_22640 gene repA 675 1787 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891622.1 protein_id gnl|my_center|LOCUS_22640 1794 2726 gene locus_tag LOCUS_22650 1794 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 3190 2924 gene locus_tag LOCUS_22660 3190 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5240 4224 gene locus_tag LOCUS_22670 5240 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence0227 941 258 gene locus_tag LOCUS_22680 941 258 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_22680 2319 934 gene locus_tag LOCUS_22690 2319 934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_22690 3082 2309 gene locus_tag LOCUS_22700 3082 2309 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_22700 3143 3808 gene locus_tag LOCUS_22710 gene pyrE 3143 3808 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815272.1 protein_id gnl|my_center|LOCUS_22710 4152 3976 gene locus_tag LOCUS_22720 4152 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 4723 4244 gene locus_tag LOCUS_22730 4723 4244 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_22730 4799 5176 gene locus_tag LOCUS_22740 4799 5176 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence0228 487 116 gene locus_tag LOCUS_22750 487 116 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_22750 1941 484 gene locus_tag LOCUS_22760 gene gcvPB 1941 484 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_22760 3399 1999 gene locus_tag LOCUS_22770 gene gcvPA 3399 1999 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_22770 3789 3403 gene locus_tag LOCUS_22780 gene gcvH 3789 3403 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_22780 4898 3813 gene locus_tag LOCUS_22790 gene gcvT 4898 3813 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence0229 746 895 gene locus_tag LOCUS_22800 746 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2698 1799 gene locus_tag LOCUS_22810 2698 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 3878 2691 gene locus_tag LOCUS_22820 gene repA 3878 2691 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891622.1 protein_id gnl|my_center|LOCUS_22820 4972 4142 gene locus_tag LOCUS_22830 4972 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence0230 254 2464 gene locus_tag LOCUS_22840 254 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence0231 3347 150 gene locus_tag LOCUS_22850 3347 150 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_22850 4574 3360 gene locus_tag LOCUS_22860 4574 3360 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_22860 4929 4687 gene locus_tag LOCUS_22870 4929 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence0232 125 2293 gene locus_tag LOCUS_22880 125 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3177 2359 gene locus_tag LOCUS_22890 gene fabI 3177 2359 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_22890 4227 3247 gene locus_tag LOCUS_22900 gene oppF 4227 3247 CDS product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262162.1 protein_id gnl|my_center|LOCUS_22900 <5194 4224 gene locus_tag LOCUS_22910 <5194 4224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706427.1:ABC transporter ATP-binding protein >Feature sequence0233 520 134 gene locus_tag LOCUS_22920 520 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1511 606 gene locus_tag LOCUS_22930 1511 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2524 1508 gene locus_tag LOCUS_22940 2524 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4959 2569 gene locus_tag LOCUS_22950 4959 2569 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484637.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0234 3646 170 gene locus_tag LOCUS_22960 gene mfd 3646 170 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_22960 3767 4552 gene locus_tag LOCUS_22970 3767 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 4768 4595 gene locus_tag LOCUS_22980 4768 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence0235 2524 1763 gene locus_tag LOCUS_22990 2524 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4601 4813 gene locus_tag LOCUS_23000 4601 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence0236 902 360 gene locus_tag LOCUS_23010 902 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 <5158 1119 gene locus_tag LOCUS_23020 <5158 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence0237 151 696 gene locus_tag LOCUS_23030 151 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 772 1245 gene locus_tag LOCUS_23040 772 1245 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443925.1 protein_id gnl|my_center|LOCUS_23040 1258 1941 gene locus_tag LOCUS_23050 1258 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2189 2662 gene locus_tag LOCUS_23060 2189 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23060 2563 2946 gene locus_tag LOCUS_23070 2563 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23070 2956 3723 gene locus_tag LOCUS_23080 2956 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3732 4031 gene locus_tag LOCUS_23090 3732 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence0238 2233 116 gene locus_tag LOCUS_23100 2233 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 3499 2246 gene locus_tag LOCUS_23110 3499 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4971 3496 gene locus_tag LOCUS_23120 gene ubiD 4971 3496 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence0239 694 245 gene locus_tag LOCUS_23130 694 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2105 810 gene locus_tag LOCUS_23140 2105 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 4740 2269 gene locus_tag LOCUS_23150 4740 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence0240 219 1220 gene locus_tag LOCUS_23160 219 1220 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_23160 2132 1227 gene locus_tag LOCUS_23170 2132 1227 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257436.1 protein_id gnl|my_center|LOCUS_23170 3956 2247 gene locus_tag LOCUS_23180 3956 2247 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_23180 4957 3839 gene locus_tag LOCUS_23190 4957 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0241 1475 57 gene locus_tag LOCUS_23200 1475 57 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 protein_id gnl|my_center|LOCUS_23200 1969 3888 gene locus_tag LOCUS_23210 gene htpG 1969 3888 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_23210 4002 4610 gene locus_tag LOCUS_23220 4002 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4607 4840 gene locus_tag LOCUS_23230 4607 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence0242 185 2197 gene locus_tag LOCUS_23240 185 2197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_23240 2267 2557 gene locus_tag LOCUS_23250 2267 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2703 3575 gene locus_tag LOCUS_23260 gene nei 2703 3575 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114002.1 protein_id gnl|my_center|LOCUS_23260 4185 3532 gene locus_tag LOCUS_23270 gene crp 4185 3532 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035725.1 protein_id gnl|my_center|LOCUS_23270 4327 4749 gene locus_tag LOCUS_23280 4327 4749 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_23280 4746 4955 gene locus_tag LOCUS_23290 4746 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence0243 184 2793 gene locus_tag LOCUS_23300 184 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4546 2846 gene locus_tag LOCUS_23310 4546 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0244 1840 311 gene locus_tag LOCUS_23320 1840 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23320 2059 1841 gene locus_tag LOCUS_23330 2059 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2122 2970 gene locus_tag LOCUS_23340 2122 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_23340 2970 4037 gene locus_tag LOCUS_23350 2970 4037 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_23350 4278 4949 gene locus_tag LOCUS_23360 4278 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence0245 40 393 gene locus_tag LOCUS_23370 40 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 835 431 gene locus_tag LOCUS_23380 835 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 1868 822 gene locus_tag LOCUS_23390 1868 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2057 4369 gene locus_tag LOCUS_23400 gene nosZ 2057 4369 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_23400 4484 4825 gene locus_tag LOCUS_23410 4484 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence0246 88 912 gene locus_tag LOCUS_23420 88 912 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_23420 1769 1275 gene locus_tag LOCUS_23430 1769 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2916 1837 gene locus_tag LOCUS_23440 2916 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3011 3110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3809 4096 gene locus_tag LOCUS_23450 3809 4096 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_23450 4108 4398 gene locus_tag LOCUS_23460 4108 4398 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_23460 4942 4436 gene locus_tag LOCUS_23470 4942 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0247 373 885 gene locus_tag LOCUS_23480 373 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1182 1388 gene locus_tag LOCUS_23490 1182 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1434 2429 gene locus_tag LOCUS_23500 1434 2429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_23500 2436 4790 gene locus_tag LOCUS_23510 2436 4790 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence0248 18 392 gene locus_tag LOCUS_23520 18 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 1746 562 gene locus_tag LOCUS_23530 1746 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_23530 2530 1751 gene locus_tag LOCUS_23540 2530 1751 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_23540 4812 2527 gene locus_tag LOCUS_23550 4812 2527 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence0249 1527 2004 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tggagtctcacttacacactccctgctggaacc >Feature sequence0250 212 1345 gene locus_tag LOCUS_23560 212 1345 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_23560 1347 1862 gene locus_tag LOCUS_23570 1347 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1855 2538 gene locus_tag LOCUS_23580 1855 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 2581 4689 gene locus_tag LOCUS_23590 gene recQ 2581 4689 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence0251 116 2707 gene locus_tag LOCUS_23600 116 2707 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_23600 2704 2985 gene locus_tag LOCUS_23610 2704 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3258 3025 gene locus_tag LOCUS_23620 3258 3025 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_23620 3725 3396 gene locus_tag LOCUS_23630 3725 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 4692 3736 gene locus_tag LOCUS_23640 4692 3736 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0252 1193 492 gene locus_tag LOCUS_23650 1193 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1982 1197 gene locus_tag LOCUS_23660 1982 1197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_23660 2259 3551 gene locus_tag LOCUS_23670 2259 3551 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_23670 3554 4594 gene locus_tag LOCUS_23680 3554 4594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence0253 588 247 gene locus_tag LOCUS_23690 588 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2064 655 gene locus_tag LOCUS_23700 gene glnA 2064 655 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_23700 3491 2325 gene locus_tag LOCUS_23710 3491 2325 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958179.1 protein_id gnl|my_center|LOCUS_23710 3733 3488 gene locus_tag LOCUS_23720 3733 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 4812 3721 gene locus_tag LOCUS_23730 4812 3721 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence0254 850 4707 gene locus_tag LOCUS_23740 850 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0255 1554 109 gene locus_tag LOCUS_23750 1554 109 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192128.1 protein_id gnl|my_center|LOCUS_23750 2399 1653 gene locus_tag LOCUS_23760 gene rlmB 2399 1653 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_23760 4651 2396 gene locus_tag LOCUS_23770 gene rnr 4651 2396 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429007.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence0256 24 458 gene locus_tag LOCUS_23780 24 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 458 3106 gene locus_tag LOCUS_23790 458 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_23790 3085 4242 gene locus_tag LOCUS_23800 3085 4242 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_23800 4303 4659 gene locus_tag LOCUS_23810 4303 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 >Feature sequence0257 1433 426 gene locus_tag LOCUS_23820 gene rsgA 1433 426 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_23820 1721 1443 gene locus_tag LOCUS_23830 1721 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2985 1642 gene locus_tag LOCUS_23840 2985 1642 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_23840 3085 3630 gene locus_tag LOCUS_23850 gene orn 3085 3630 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099436.1 protein_id gnl|my_center|LOCUS_23850 4211 3621 gene locus_tag LOCUS_23860 4211 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4294 4719 gene locus_tag LOCUS_23870 gene fur 4294 4719 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121758.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence0258 788 210 gene locus_tag LOCUS_23880 788 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2131 791 gene locus_tag LOCUS_23890 gene accC 2131 791 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_23890 2573 2142 gene locus_tag LOCUS_23900 gene accB 2573 2142 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_23900 3036 2578 gene locus_tag LOCUS_23910 gene aroQ 3036 2578 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_23910 3523 4728 gene locus_tag LOCUS_23920 3523 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0259 4656 3778 gene locus_tag LOCUS_23930 4656 3778 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence0260 568 1365 gene locus_tag LOCUS_23940 568 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 1358 1951 gene locus_tag LOCUS_23950 1358 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 2081 3934 gene locus_tag LOCUS_23960 gene recG 2081 3934 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228555.1 protein_id gnl|my_center|LOCUS_23960 4136 4387 gene locus_tag LOCUS_23970 4136 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence0261 2500 194 gene locus_tag LOCUS_23980 gene metE 2500 194 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_23980 2596 3537 gene locus_tag LOCUS_23990 gene metR 2596 3537 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405405.1 protein_id gnl|my_center|LOCUS_23990 3958 3500 gene locus_tag LOCUS_24000 3958 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4626 4171 gene locus_tag LOCUS_24010 4626 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence0262 1232 810 gene locus_tag LOCUS_24020 1232 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 1756 1319 gene locus_tag LOCUS_24030 1756 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1795 2679 gene locus_tag LOCUS_24040 1795 2679 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_24040 2676 2933 gene locus_tag LOCUS_24050 2676 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 2930 3907 gene locus_tag LOCUS_24060 2930 3907 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_24060 3978 4124 gene locus_tag LOCUS_24070 3978 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence0263 424 543 gene locus_tag LOCUS_24080 424 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24080 543 1208 gene locus_tag LOCUS_24090 543 1208 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_24090 1595 1287 gene locus_tag LOCUS_24100 1595 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1735 3822 gene locus_tag LOCUS_24110 gene clpB 1735 3822 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24110 3823 4323 gene locus_tag LOCUS_24120 3823 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24120 >Feature sequence0264 1616 117 gene locus_tag LOCUS_24130 1616 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2144 3043 gene locus_tag LOCUS_24140 gene cysM 2144 3043 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_24140 3045 4376 gene locus_tag LOCUS_24150 gene rlmD 3045 4376 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242253.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence0265 314 21 gene locus_tag LOCUS_24160 314 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1373 387 gene locus_tag LOCUS_24170 1373 387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_24170 1499 1795 gene locus_tag LOCUS_24180 1499 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24180 1892 2671 gene locus_tag LOCUS_24190 1892 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24190 2678 3526 gene locus_tag LOCUS_24200 2678 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 4511 3579 gene locus_tag LOCUS_24210 4511 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 >Feature sequence0266 524 63 gene locus_tag LOCUS_24220 524 63 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_24220 985 566 gene locus_tag LOCUS_24230 985 566 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_24230 1737 982 gene locus_tag LOCUS_24240 1737 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2762 1734 gene locus_tag LOCUS_24250 gene argC 2762 1734 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 protein_id gnl|my_center|LOCUS_24250 2840 3478 gene locus_tag LOCUS_24260 2840 3478 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_24260 3536 3928 gene locus_tag LOCUS_24270 gene hemJ 3536 3928 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_24270 4430 4053 gene locus_tag LOCUS_24280 gene erpA 4430 4053 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence0267 1331 1158 gene locus_tag LOCUS_24290 1331 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2445 1318 gene locus_tag LOCUS_24300 2445 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence0268 4240 3263 gene locus_tag LOCUS_24310 gene cas1f 4240 3263 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0269 84 1958 gene locus_tag LOCUS_24320 84 1958 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_24320 1936 3309 gene locus_tag LOCUS_24330 1936 3309 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868807.1 protein_id gnl|my_center|LOCUS_24330 3318 3911 gene locus_tag LOCUS_24340 3318 3911 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 protein_id gnl|my_center|LOCUS_24340 3908 4195 gene locus_tag LOCUS_24350 3908 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4425 4279 gene locus_tag LOCUS_24360 4425 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0270 219 1130 gene locus_tag LOCUS_24370 219 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1127 1960 gene locus_tag LOCUS_24380 1127 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1957 3669 gene locus_tag LOCUS_24390 1957 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3591 4379 gene locus_tag LOCUS_24400 3591 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence0271 70 357 gene locus_tag LOCUS_24410 70 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence0272 40 540 gene locus_tag LOCUS_24420 40 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 581 2050 gene locus_tag LOCUS_24430 581 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24430 2162 3979 gene locus_tag LOCUS_24440 gene typA 2162 3979 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_24440 4421 4242 gene locus_tag LOCUS_24450 4421 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence0273 250 882 gene locus_tag LOCUS_24460 gene dnr 250 882 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_24460 1149 937 gene locus_tag LOCUS_24470 1149 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2007 1384 gene locus_tag LOCUS_24480 2007 1384 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869276.1 protein_id gnl|my_center|LOCUS_24480 3377 2004 gene locus_tag LOCUS_24490 3377 2004 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_24490 3809 3384 gene locus_tag LOCUS_24500 3809 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24500 <4539 3814 gene locus_tag LOCUS_24510 <4539 3814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228560.1:V-type ATP synthase subunit A note possible pseudo, frameshifted >Feature sequence0274 98 364 gene locus_tag LOCUS_24520 98 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 361 1140 gene locus_tag LOCUS_24530 361 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1137 4412 gene locus_tag LOCUS_24540 1137 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0275 2335 1028 gene locus_tag LOCUS_24550 gene hypD 2335 1028 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_24550 3073 2372 gene locus_tag LOCUS_24560 3073 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24560 3609 3268 gene locus_tag LOCUS_24570 gene hypA 3609 3268 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_24570 3820 3602 gene locus_tag LOCUS_24580 3820 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 4304 4173 gene locus_tag LOCUS_24590 4304 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence0276 1890 721 gene locus_tag LOCUS_24600 1890 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 3293 1887 gene locus_tag LOCUS_24610 3293 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3683 3315 gene locus_tag LOCUS_24620 3683 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 4414 3737 gene locus_tag LOCUS_24630 4414 3737 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence0277 881 195 gene locus_tag LOCUS_24640 881 195 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 protein_id gnl|my_center|LOCUS_24640 2996 945 gene locus_tag LOCUS_24650 2996 945 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_24650 3505 4410 gene locus_tag LOCUS_24660 3505 4410 CDS product IS110-like element IS621 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176527849.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence0278 549 136 gene locus_tag LOCUS_24670 549 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1166 549 gene locus_tag LOCUS_24680 1166 549 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478373.1 protein_id gnl|my_center|LOCUS_24680 1648 2292 gene locus_tag LOCUS_24690 1648 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 2292 2918 gene locus_tag LOCUS_24700 2292 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 2936 3898 gene locus_tag LOCUS_24710 2936 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence0279 313 771 gene locus_tag LOCUS_24720 313 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 731 1102 gene locus_tag LOCUS_24730 731 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 1381 1806 gene locus_tag LOCUS_24740 1381 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1871 2146 gene locus_tag LOCUS_24750 1871 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2133 3032 gene locus_tag LOCUS_24760 2133 3032 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_24760 3029 4000 gene locus_tag LOCUS_24770 3029 4000 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368572.1 protein_id gnl|my_center|LOCUS_24770 4400 3990 gene locus_tag LOCUS_24780 4400 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence0280 3099 844 gene locus_tag LOCUS_24790 3099 844 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_24790 3192 4100 gene locus_tag LOCUS_24800 3192 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4093 4392 gene locus_tag LOCUS_24810 4093 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence0281 949 452 gene locus_tag LOCUS_24820 949 452 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_24820 1784 960 gene locus_tag LOCUS_24830 gene dsbG 1784 960 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039720.1 protein_id gnl|my_center|LOCUS_24830 2224 1937 gene locus_tag LOCUS_24840 2224 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2414 2229 gene locus_tag LOCUS_24850 2414 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 4340 2505 gene locus_tag LOCUS_24860 gene recJ 4340 2505 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence0282 1117 881 gene locus_tag LOCUS_24870 1117 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2204 1122 gene locus_tag LOCUS_24880 2204 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1168 1267 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3723 2281 gene locus_tag LOCUS_24890 3723 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3870 3736 gene locus_tag LOCUS_24900 3870 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4323 3949 gene locus_tag LOCUS_24910 4323 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence0283 <1 4166 gene locus_tag LOCUS_24920 <1 4166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020262.1:ATP-binding protein >Feature sequence0284 374 1276 gene locus_tag LOCUS_24930 374 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1269 4097 gene locus_tag LOCUS_24940 1269 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0285 399 776 gene locus_tag LOCUS_24950 399 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 852 2324 gene locus_tag LOCUS_24960 gene lnt 852 2324 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_24960 2494 2285 gene locus_tag LOCUS_24970 2494 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2525 2911 gene locus_tag LOCUS_24980 2525 2911 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_24980 3336 2923 gene locus_tag LOCUS_24990 3336 2923 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_24990 4256 3342 gene locus_tag LOCUS_25000 4256 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence0286 1050 142 gene locus_tag LOCUS_25010 1050 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206813.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25010 1248 1108 gene locus_tag LOCUS_25020 1248 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 2306 1245 gene locus_tag LOCUS_25030 2306 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25030 2743 2261 gene locus_tag LOCUS_25040 2743 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3671 2745 gene locus_tag LOCUS_25050 3671 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 4240 3668 gene locus_tag LOCUS_25060 4240 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence0287 3106 743 gene locus_tag LOCUS_25070 3106 743 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_25070 3975 3241 gene locus_tag LOCUS_25080 3975 3241 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176599.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence0288 1419 529 gene locus_tag LOCUS_25090 1419 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 1788 2708 gene locus_tag LOCUS_25100 1788 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2913 3197 gene locus_tag LOCUS_25110 2913 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3194 3415 gene locus_tag LOCUS_25120 3194 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3436 4305 gene locus_tag LOCUS_25130 3436 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence0289 159 764 gene locus_tag LOCUS_25140 159 764 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_25140 868 1416 gene locus_tag LOCUS_25150 gene ppa 868 1416 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055068.1 protein_id gnl|my_center|LOCUS_25150 1465 2010 gene locus_tag LOCUS_25160 1465 2010 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111658546.1 protein_id gnl|my_center|LOCUS_25160 2007 2492 gene locus_tag LOCUS_25170 gene moaC 2007 2492 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_25170 2482 3087 gene locus_tag LOCUS_25180 gene yihA 2482 3087 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_25180 3091 4221 gene locus_tag LOCUS_25190 3091 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence0290 639 193 gene locus_tag LOCUS_25200 639 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25200 1005 1436 gene locus_tag LOCUS_25210 1005 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 1423 2424 gene locus_tag LOCUS_25220 1423 2424 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_25220 2424 3905 gene locus_tag LOCUS_25230 2424 3905 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_25230 >Feature sequence0291 136 540 gene locus_tag LOCUS_25240 136 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 643 1158 gene locus_tag LOCUS_25250 643 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1256 1684 gene locus_tag LOCUS_25260 1256 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1813 2475 gene locus_tag LOCUS_25270 1813 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3332 4246 gene locus_tag LOCUS_25280 3332 4246 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862398.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence0292 <4242 2356 gene locus_tag LOCUS_25290 <4242 2356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204890.1:DISARM system SNF2-like helicase DrmD >Feature sequence0293 207 455 gene locus_tag LOCUS_25300 207 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 798 1151 gene locus_tag LOCUS_25310 798 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1201 3516 gene locus_tag LOCUS_25320 1201 3516 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166873.1 protein_id gnl|my_center|LOCUS_25320 4006 4143 gene locus_tag LOCUS_25330 4006 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence0294 1838 1937 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0295 1161 1946 gene locus_tag LOCUS_25340 1161 1946 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 protein_id gnl|my_center|LOCUS_25340 2082 2588 gene locus_tag LOCUS_25350 2082 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3050 3397 gene locus_tag LOCUS_25360 3050 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3574 4095 gene locus_tag LOCUS_25370 3574 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence0296 2051 345 gene locus_tag LOCUS_25380 2051 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3565 2054 gene locus_tag LOCUS_25390 3565 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence0297 443 117 gene locus_tag LOCUS_25400 443 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 765 436 gene locus_tag LOCUS_25410 765 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1634 1164 gene locus_tag LOCUS_25420 1634 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2124 1702 gene locus_tag LOCUS_25430 2124 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3077 2289 gene locus_tag LOCUS_25440 gene trmJ 3077 2289 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_25440 3067 3864 gene locus_tag LOCUS_25450 gene suhB 3067 3864 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_25450 3920 4048 gene locus_tag LOCUS_25460 3920 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence0298 1426 83 gene locus_tag LOCUS_25470 1426 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1781 1431 gene locus_tag LOCUS_25480 1781 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3295 1913 gene locus_tag LOCUS_25490 3295 1913 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_25490 3832 3326 gene locus_tag LOCUS_25500 3832 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0299 379 810 gene locus_tag LOCUS_25510 gene dksA 379 810 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_25510 862 1737 gene locus_tag LOCUS_25520 gene gluQRS 862 1737 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221978.1 protein_id gnl|my_center|LOCUS_25520 3088 1730 gene locus_tag LOCUS_25530 gene nhaA 3088 1730 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_25530 3636 3214 gene locus_tag LOCUS_25540 3636 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25540 4007 3648 gene locus_tag LOCUS_25550 4007 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25550 >Feature sequence0300 1164 871 gene locus_tag LOCUS_25560 gene yhbY 1164 871 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054291.1 protein_id gnl|my_center|LOCUS_25560 1325 1915 gene locus_tag LOCUS_25570 gene rlmE 1325 1915 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_25570 2062 3999 gene locus_tag LOCUS_25580 gene ftsH 2062 3999 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence0301 1399 59 gene locus_tag LOCUS_25590 1399 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3433 1409 gene locus_tag LOCUS_25600 3433 1409 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_25600 3942 3430 gene locus_tag LOCUS_25610 3942 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence0302 108 821 gene locus_tag LOCUS_25620 108 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 942 1301 gene locus_tag LOCUS_25630 942 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 2724 1387 gene locus_tag LOCUS_25640 2724 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3493 2870 gene locus_tag LOCUS_25650 gene ompR 3493 2870 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704310.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 3622 4053 gene locus_tag LOCUS_25660 3622 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence0303 1423 83 gene locus_tag LOCUS_25670 1423 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3457 1433 gene locus_tag LOCUS_25680 3457 1433 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_25680 3966 3454 gene locus_tag LOCUS_25690 3966 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0304 905 456 gene locus_tag LOCUS_25700 905 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1209 955 gene locus_tag LOCUS_25710 gene moaD 1209 955 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390441.1 protein_id gnl|my_center|LOCUS_25710 2447 1206 gene locus_tag LOCUS_25720 2447 1206 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_25720 2979 2449 gene locus_tag LOCUS_25730 gene moaB 2979 2449 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_25730 3928 2996 gene locus_tag LOCUS_25740 3928 2996 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_25740 >Feature sequence0305 387 2099 gene locus_tag LOCUS_25750 387 2099 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_25750 2096 3964 gene locus_tag LOCUS_25760 2096 3964 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence0306 1093 152 gene locus_tag LOCUS_25770 gene miaA 1093 152 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_25770 2802 1093 gene locus_tag LOCUS_25780 gene mutL 2802 1093 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_25780 3400 2702 gene locus_tag LOCUS_25790 3400 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25790 3889 3404 gene locus_tag LOCUS_25800 3889 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25800 >Feature sequence0307 191 640 gene locus_tag LOCUS_25810 191 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 869 2356 gene locus_tag LOCUS_25820 gene zwf 869 2356 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_25820 2353 3015 gene locus_tag LOCUS_25830 gene pgl 2353 3015 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_25830 3008 3259 gene locus_tag LOCUS_25840 3008 3259 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_25840 3766 3254 gene locus_tag LOCUS_25850 3766 3254 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261221.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence0308 97 2193 gene locus_tag LOCUS_25860 97 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2259 2993 gene locus_tag LOCUS_25870 2259 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3439 3086 gene locus_tag LOCUS_25880 gene erpA 3439 3086 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420796.1 protein_id gnl|my_center|LOCUS_25880 3906 3574 gene locus_tag LOCUS_25890 3906 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence0309 926 564 gene locus_tag LOCUS_25900 926 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1354 1617 gene locus_tag LOCUS_25910 1354 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 >Feature sequence0310 127 1605 gene locus_tag LOCUS_25920 127 1605 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538218.1 protein_id gnl|my_center|LOCUS_25920 1984 2463 gene locus_tag LOCUS_25930 1984 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3280 2969 gene locus_tag LOCUS_25940 3280 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3873 3277 gene locus_tag LOCUS_25950 3873 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence0311 435 1172 gene locus_tag LOCUS_25960 435 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1353 1362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3821 1524 gene locus_tag LOCUS_25970 3821 1524 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099617780.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0312 1269 40 gene locus_tag LOCUS_25980 1269 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1948 1256 gene locus_tag LOCUS_25990 1948 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3074 1941 gene locus_tag LOCUS_26000 3074 1941 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_26000 3911 3078 gene locus_tag LOCUS_26010 3911 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0313 570 13 gene locus_tag LOCUS_26020 570 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2177 756 gene locus_tag LOCUS_26030 2177 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3212 2193 gene locus_tag LOCUS_26040 3212 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3877 3209 gene locus_tag LOCUS_26050 3877 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0314 3358 143 gene locus_tag LOCUS_26060 3358 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3449 3637 gene locus_tag LOCUS_26070 3449 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence0315 185 1255 gene locus_tag LOCUS_26080 gene cgtA 185 1255 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073450.1 protein_id gnl|my_center|LOCUS_26080 1255 2379 gene locus_tag LOCUS_26090 gene proB 1255 2379 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_26090 2447 3244 gene locus_tag LOCUS_26100 2447 3244 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_26100 3797 3237 gene locus_tag LOCUS_26110 3797 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence0316 259 3786 gene locus_tag LOCUS_26120 259 3786 CDS product DUF4020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004657.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0317 275 1546 gene locus_tag LOCUS_26130 275 1546 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_26130 1817 3076 gene locus_tag LOCUS_26140 gene ispG 1817 3076 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence0318 17 823 gene locus_tag LOCUS_26150 17 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2060 906 gene locus_tag LOCUS_26160 2060 906 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_26160 2838 2065 gene locus_tag LOCUS_26170 2838 2065 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_26170 3469 2924 gene locus_tag LOCUS_26180 3469 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence0319 478 1449 gene locus_tag LOCUS_26190 478 1449 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391834.1 protein_id gnl|my_center|LOCUS_26190 1460 3688 gene locus_tag LOCUS_26200 1460 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 >Feature sequence0320 2811 406 gene locus_tag LOCUS_26210 2811 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 3227 3442 gene locus_tag LOCUS_26220 3227 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 3456 3608 gene locus_tag LOCUS_26230 3456 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 3614 3760 gene locus_tag LOCUS_26240 3614 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence0321 2814 2599 gene locus_tag LOCUS_26250 2814 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence0322 237 1415 gene locus_tag LOCUS_26260 237 1415 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113214.1 protein_id gnl|my_center|LOCUS_26260 1405 3009 gene locus_tag LOCUS_26270 1405 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 2997 3656 gene locus_tag LOCUS_26280 gene narL 2997 3656 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence0323 1086 238 gene locus_tag LOCUS_26290 gene pstB 1086 238 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_26290 1789 1133 gene locus_tag LOCUS_26300 1789 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26300 2935 2399 gene locus_tag LOCUS_26310 2935 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 3136 3342 gene locus_tag LOCUS_26320 3136 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3437 3694 gene locus_tag LOCUS_26330 3437 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence0324 1785 148 gene locus_tag LOCUS_26340 1785 148 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_26340 2901 1888 gene locus_tag LOCUS_26350 2901 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3172 2870 gene locus_tag LOCUS_26360 3172 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3455 3216 gene locus_tag LOCUS_26370 3455 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence0325 1005 781 gene locus_tag LOCUS_26380 1005 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 1808 1575 gene locus_tag LOCUS_26390 1808 1575 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221759.1 protein_id gnl|my_center|LOCUS_26390 3394 1811 gene locus_tag LOCUS_26400 3394 1811 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_26400 3508 3705 gene locus_tag LOCUS_26410 3508 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence0326 <1 3562 gene locus_tag LOCUS_26420 <1 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181718.1:DUF4020 domain-containing protein >Feature sequence0327 2361 235 gene locus_tag LOCUS_26430 2361 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3093 3572 gene locus_tag LOCUS_26440 3093 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence0328 395 120 gene locus_tag LOCUS_26450 395 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1178 525 gene locus_tag LOCUS_26460 gene pmrA 1178 525 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_26460 1984 1175 gene locus_tag LOCUS_26470 1984 1175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_26470 2680 1994 gene locus_tag LOCUS_26480 2680 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477695.1 protein_id gnl|my_center|LOCUS_26480 3471 2806 gene locus_tag LOCUS_26490 3471 2806 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_26490 3634 3455 gene locus_tag LOCUS_26500 3634 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence0329 2755 1136 gene locus_tag LOCUS_26510 2755 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26510 <3767 2907 gene locus_tag LOCUS_26520 <3767 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065206.1:ATP-binding protein >Feature sequence0330 1251 223 gene locus_tag LOCUS_26530 gene queA 1251 223 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_26530 1328 1414 gene locus_tag LOCUS_t00280 1328 1414 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2780 1500 gene locus_tag LOCUS_26540 2780 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 3725 2805 gene locus_tag LOCUS_26550 3725 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence0331 563 862 gene locus_tag LOCUS_26560 563 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1322 3670 gene locus_tag LOCUS_26570 1322 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence0332 116 667 gene locus_tag LOCUS_26580 116 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 594 1340 gene locus_tag LOCUS_26590 594 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1337 2419 gene locus_tag LOCUS_26600 1337 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2435 3160 gene locus_tag LOCUS_26610 2435 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3444 3680 gene locus_tag LOCUS_26620 3444 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0333 126 225 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 732 920 gene locus_tag LOCUS_26630 732 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2681 2493 gene locus_tag LOCUS_26640 2681 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0334 639 962 gene locus_tag LOCUS_26650 639 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 1197 1424 gene locus_tag LOCUS_26660 1197 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 1424 2407 gene locus_tag LOCUS_26670 1424 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2404 3117 gene locus_tag LOCUS_26680 2404 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3120 3707 gene locus_tag LOCUS_26690 gene queC 3120 3707 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705697.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence0335 1443 190 gene locus_tag LOCUS_26700 1443 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1693 2037 gene locus_tag LOCUS_26710 1693 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2101 3357 gene locus_tag LOCUS_26720 2101 3357 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_26720 3394 3594 gene locus_tag LOCUS_26730 3394 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence0336 171 1196 gene locus_tag LOCUS_26740 171 1196 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_26740 1189 3600 gene locus_tag LOCUS_26750 gene ppsA 1189 3600 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence0337 945 2339 gene locus_tag LOCUS_26760 945 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2717 3424 gene locus_tag LOCUS_26770 2717 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence0338 1641 676 gene locus_tag LOCUS_26780 1641 676 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_26780 1814 2971 gene locus_tag LOCUS_26790 1814 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2974 3486 gene locus_tag LOCUS_26800 2974 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0339 <1 510 gene locus_tag LOCUS_26810 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein 1463 507 gene locus_tag LOCUS_26820 1463 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 2155 1460 gene locus_tag LOCUS_26830 2155 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26830 3467 2166 gene locus_tag LOCUS_26840 3467 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence0340 1152 205 gene locus_tag LOCUS_26850 gene rpoS 1152 205 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_26850 1979 1170 gene locus_tag LOCUS_26860 1979 1170 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_26860 2624 2043 gene locus_tag LOCUS_26870 2624 2043 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_26870 3286 2621 gene locus_tag LOCUS_26880 3286 2621 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_26880 3500 3291 gene locus_tag LOCUS_26890 3500 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence0341 >Feature sequence0342 2085 187 gene locus_tag LOCUS_26900 2085 187 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_26900 3439 2249 gene locus_tag LOCUS_26910 gene kbl 3439 2249 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175931.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence0343 862 539 gene locus_tag LOCUS_26920 862 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1203 862 gene locus_tag LOCUS_26930 1203 862 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_26930 2327 1293 gene locus_tag LOCUS_26940 2327 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3259 2324 gene locus_tag LOCUS_26950 3259 2324 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence0344 696 1004 gene locus_tag LOCUS_26960 696 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1708 1052 gene locus_tag LOCUS_26970 1708 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2130 1708 gene locus_tag LOCUS_26980 2130 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2203 3405 gene locus_tag LOCUS_26990 2203 3405 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence0345 462 656 gene locus_tag LOCUS_27000 462 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 818 1429 gene locus_tag LOCUS_27010 818 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1429 2646 gene locus_tag LOCUS_27020 1429 2646 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_27020 2643 3251 gene locus_tag LOCUS_27030 2643 3251 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence0346 203 646 gene locus_tag LOCUS_27040 203 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 649 1404 gene locus_tag LOCUS_27050 649 1404 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_27050 1415 2512 gene locus_tag LOCUS_27060 1415 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2689 3003 gene locus_tag LOCUS_27070 2689 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 2993 3262 gene locus_tag LOCUS_27080 2993 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27080 >Feature sequence0347 177 347 gene locus_tag LOCUS_27090 177 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 438 941 gene locus_tag LOCUS_27100 438 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 895 3231 gene locus_tag LOCUS_27110 895 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence0348 1514 1843 gene locus_tag LOCUS_27120 1514 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2116 2259 gene locus_tag LOCUS_27130 2116 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27130 2231 2788 gene locus_tag LOCUS_27140 2231 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2805 3353 gene locus_tag LOCUS_27150 2805 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0349 147 329 gene locus_tag LOCUS_27160 147 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2116 347 gene locus_tag LOCUS_27170 2116 347 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_27170 2278 2604 gene locus_tag LOCUS_27180 2278 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence0350 2307 1036 gene locus_tag LOCUS_27190 2307 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0351 1465 956 gene locus_tag LOCUS_27200 1465 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1832 2413 gene locus_tag LOCUS_27210 1832 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence0352 228 866 gene locus_tag LOCUS_27220 228 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 869 1471 gene locus_tag LOCUS_27230 869 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 1987 1475 gene locus_tag LOCUS_27240 1987 1475 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_27240 2563 1997 gene locus_tag LOCUS_27250 2563 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3240 2560 gene locus_tag LOCUS_27260 3240 2560 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence0353 764 54 gene locus_tag LOCUS_27270 764 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1527 757 gene locus_tag LOCUS_27280 1527 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0354 247 113 gene locus_tag LOCUS_27290 247 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 529 398 gene locus_tag LOCUS_27300 529 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence0355 1785 730 gene locus_tag LOCUS_27310 gene rhuM 1785 730 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 protein_id gnl|my_center|LOCUS_27310 3293 1782 gene locus_tag LOCUS_27320 3293 1782 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0356 <1 861 gene locus_tag LOCUS_27330 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065206.1:ATP-binding protein >Feature sequence0357 487 140 gene locus_tag LOCUS_27340 487 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1433 591 gene locus_tag LOCUS_27350 1433 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2582 1581 gene locus_tag LOCUS_27360 2582 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3352 2582 gene locus_tag LOCUS_27370 3352 2582 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0358 186 374 gene locus_tag LOCUS_27380 186 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 390 3200 gene locus_tag LOCUS_27390 gene brxC 390 3200 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence0359 233 2302 gene locus_tag LOCUS_27400 233 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2488 2697 gene locus_tag LOCUS_27410 2488 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2815 3099 gene locus_tag LOCUS_27420 2815 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence0360 164 322 gene locus_tag LOCUS_27430 164 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 858 430 gene locus_tag LOCUS_27440 858 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27440 1814 741 gene locus_tag LOCUS_27450 1814 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27450 3222 1792 gene locus_tag LOCUS_27460 3222 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence0361 1280 1405 gene locus_tag LOCUS_27470 1280 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 1705 2001 gene locus_tag LOCUS_27480 1705 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence0362 316 241 gene locus_tag LOCUS_t00290 316 241 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 658 389 gene locus_tag LOCUS_27490 658 389 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_27490 1731 655 gene locus_tag LOCUS_27500 gene mutY 1731 655 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_27500 1928 2398 gene locus_tag LOCUS_27510 1928 2398 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_27510 2456 3082 gene locus_tag LOCUS_27520 2456 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0363 447 1238 gene locus_tag LOCUS_27530 447 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27530 1195 2472 gene locus_tag LOCUS_27540 1195 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27540 2433 2987 gene locus_tag LOCUS_27550 2433 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0364 1029 370 gene locus_tag LOCUS_27560 1029 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2899 1178 gene locus_tag LOCUS_27570 2899 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence0365 33 2201 gene locus_tag LOCUS_27580 33 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2342 3157 gene locus_tag LOCUS_27590 2342 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence0366 501 67 gene locus_tag LOCUS_27600 501 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1351 698 gene locus_tag LOCUS_27610 1351 698 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_27610 3012 1351 gene locus_tag LOCUS_27620 3012 1351 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0367 74 826 gene locus_tag LOCUS_27630 74 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 823 1008 gene locus_tag LOCUS_27640 823 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1057 1395 gene locus_tag LOCUS_27650 1057 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27650 1392 2243 gene locus_tag LOCUS_27660 1392 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 2240 3199 gene locus_tag LOCUS_27670 2240 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence0368 230 1039 gene locus_tag LOCUS_27680 230 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 931 1818 gene locus_tag LOCUS_27690 931 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1815 2087 gene locus_tag LOCUS_27700 1815 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 2081 2680 gene locus_tag LOCUS_27710 2081 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence0369 709 494 gene locus_tag LOCUS_27720 709 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27720 928 761 gene locus_tag LOCUS_27730 928 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27730 2078 921 gene locus_tag LOCUS_27740 2078 921 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 protein_id gnl|my_center|LOCUS_27740 2206 2296 gene locus_tag LOCUS_t00300 2206 2296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0370 <1 2733 gene locus_tag LOCUS_27750 <1 2733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:Ig-like domain-containing protein 2890 3039 gene locus_tag LOCUS_27760 2890 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0371 3005 2565 gene locus_tag LOCUS_27770 3005 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence0372 395 661 gene locus_tag LOCUS_27780 395 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 658 2124 gene locus_tag LOCUS_27790 658 2124 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_27790 2480 2608 gene locus_tag LOCUS_27800 2480 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence0373 1132 272 gene locus_tag LOCUS_27810 1132 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1511 1137 gene locus_tag LOCUS_27820 1511 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2442 1450 gene locus_tag LOCUS_27830 2442 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 2926 2528 gene locus_tag LOCUS_27840 2926 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 >Feature sequence0374 370 2841 gene locus_tag LOCUS_27850 370 2841 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_27850 3034 2846 gene locus_tag LOCUS_27860 3034 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0375 99 377 gene locus_tag LOCUS_27870 99 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 993 355 gene locus_tag LOCUS_27880 993 355 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_27880 2139 1003 gene locus_tag LOCUS_27890 2139 1003 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446841.1 protein_id gnl|my_center|LOCUS_27890 2188 2940 gene locus_tag LOCUS_27900 2188 2940 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0376 <1 3101 gene locus_tag LOCUS_27910 <1 3101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055064929.1:type I restriction endonuclease subunit R >Feature sequence0377 602 177 gene locus_tag LOCUS_27920 602 177 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_27920 984 637 gene locus_tag LOCUS_27930 984 637 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_27930 1288 992 gene locus_tag LOCUS_27940 1288 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 1874 1950 gene locus_tag LOCUS_t00310 1874 1950 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1997 2073 gene locus_tag LOCUS_t00320 1997 2073 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2258 2333 gene locus_tag LOCUS_t00330 2258 2333 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0378 247 762 gene locus_tag LOCUS_27950 247 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 781 2100 gene locus_tag LOCUS_27960 781 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2097 3053 gene locus_tag LOCUS_27970 2097 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence0379 2073 724 gene locus_tag LOCUS_27980 gene glmM 2073 724 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071169.1 protein_id gnl|my_center|LOCUS_27980 2965 2114 gene locus_tag LOCUS_27990 gene folP 2965 2114 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703603.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence0380 >Feature sequence0381 >Feature sequence0382 186 1226 gene locus_tag LOCUS_28000 186 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 1241 2953 gene locus_tag LOCUS_28010 1241 2953 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence0383 767 1681 gene locus_tag LOCUS_28020 767 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1678 2589 gene locus_tag LOCUS_28030 1678 2589 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963602.1 protein_id gnl|my_center|LOCUS_28030 2771 2902 gene locus_tag LOCUS_28040 2771 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence0384 >Feature sequence0385 1485 1258 gene locus_tag LOCUS_28050 1485 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28050 2669 1440 gene locus_tag LOCUS_28060 2669 1440 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037593.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28060 >Feature sequence0386 341 1759 gene locus_tag LOCUS_28070 341 1759 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 protein_id gnl|my_center|LOCUS_28070 1752 2756 gene locus_tag LOCUS_28080 1752 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016656.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence0387 122 382 gene locus_tag LOCUS_28090 122 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 919 287 gene locus_tag LOCUS_28100 919 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence0388 183 16 gene locus_tag LOCUS_28110 183 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 376 167 gene locus_tag LOCUS_28120 376 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1441 443 gene locus_tag LOCUS_28130 1441 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2123 1431 gene locus_tag LOCUS_28140 2123 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 <3030 2120 gene locus_tag LOCUS_28150 <3030 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918063.1:type II secretion system ATPase GspE >Feature sequence0389 2773 1595 gene locus_tag LOCUS_28160 2773 1595 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141120.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence0390 1612 1385 gene locus_tag LOCUS_28170 1612 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 >Feature sequence0391 >Feature sequence0392 577 293 gene locus_tag LOCUS_28180 gene yggU 577 293 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718491.1 protein_id gnl|my_center|LOCUS_28180 1160 582 gene locus_tag LOCUS_28190 1160 582 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_28190 1987 1160 gene locus_tag LOCUS_28200 gene proC 1987 1160 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_28200 2673 1984 gene locus_tag LOCUS_28210 2673 1984 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence0393 2818 458 gene locus_tag LOCUS_28220 2818 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence0394 992 81 gene locus_tag LOCUS_28230 992 81 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_28230 1047 1475 gene locus_tag LOCUS_28240 1047 1475 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_28240 1476 1964 gene locus_tag LOCUS_28250 1476 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_28250 1979 2812 gene locus_tag LOCUS_28260 gene galU 1979 2812 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417439.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence0395 >Feature sequence0396 243 1652 gene locus_tag LOCUS_28270 243 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1734 2348 gene locus_tag LOCUS_28280 1734 2348 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_28280 2936 2388 gene locus_tag LOCUS_28290 2936 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence0397 >Feature sequence0398 2798 912 gene locus_tag LOCUS_28300 2798 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28300 >Feature sequence0399 808 95 gene locus_tag LOCUS_28310 808 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 <2947 805 gene locus_tag LOCUS_28320 <2947 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109314215.1:ATP-binding domain-containing protein >Feature sequence0400 145 468 gene locus_tag LOCUS_28330 145 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 1104 706 gene locus_tag LOCUS_28340 gene vapC 1104 706 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_28340 1334 1104 gene locus_tag LOCUS_28350 gene vapB 1334 1104 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380366.1 protein_id gnl|my_center|LOCUS_28350 2666 1542 gene locus_tag LOCUS_28360 2666 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 2619 2774 gene locus_tag LOCUS_28370 2619 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence0401 2600 183 gene locus_tag LOCUS_28380 2600 183 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819015.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence0402 448 239 gene locus_tag LOCUS_28390 448 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 617 877 gene locus_tag LOCUS_28400 617 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28400 899 1468 gene locus_tag LOCUS_28410 899 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28410 1438 1866 gene locus_tag LOCUS_28420 1438 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28420 2668 1898 gene locus_tag LOCUS_28430 2668 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0403 413 1246 gene locus_tag LOCUS_28440 413 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2183 1296 gene locus_tag LOCUS_28450 2183 1296 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096380.1 protein_id gnl|my_center|LOCUS_28450 2834 2493 gene locus_tag LOCUS_28460 2834 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0404 365 889 gene locus_tag LOCUS_28470 365 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 965 2206 gene locus_tag LOCUS_28480 965 2206 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence0405 345 16 gene locus_tag LOCUS_28490 345 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 444 926 gene locus_tag LOCUS_28500 444 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2559 1513 gene locus_tag LOCUS_28510 2559 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence0406 432 860 gene locus_tag LOCUS_28520 432 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1226 921 gene locus_tag LOCUS_28530 1226 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1459 1220 gene locus_tag LOCUS_28540 1459 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1972 1511 gene locus_tag LOCUS_28550 1972 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2403 1969 gene locus_tag LOCUS_28560 2403 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence0407 1828 164 gene locus_tag LOCUS_28570 gene recN 1828 164 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_28570 2703 1828 gene locus_tag LOCUS_28580 2703 1828 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence0408 1906 1295 gene locus_tag LOCUS_28590 1906 1295 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_28590 2505 1906 gene locus_tag LOCUS_28600 2505 1906 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence0409 1099 425 gene locus_tag LOCUS_28610 gene radC 1099 425 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_28610 1312 2511 gene locus_tag LOCUS_28620 gene coaBC 1312 2511 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190972.1 protein_id gnl|my_center|LOCUS_28620 2592 2828 gene locus_tag LOCUS_28630 2592 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence0410 179 36 gene locus_tag LOCUS_28640 179 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1895 258 gene locus_tag LOCUS_28650 1895 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2749 1850 gene locus_tag LOCUS_28660 2749 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence0411 2282 339 gene locus_tag LOCUS_28670 2282 339 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_28670 2649 2275 gene locus_tag LOCUS_28680 2649 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 >Feature sequence0412 129 731 gene locus_tag LOCUS_28690 129 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1081 2187 gene locus_tag LOCUS_28700 1081 2187 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence0413 454 1302 gene locus_tag LOCUS_28710 454 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2686 1325 gene locus_tag LOCUS_28720 gene mgtE 2686 1325 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence0414 <1 2105 gene locus_tag LOCUS_28730 <1 2105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein 2102 2263 gene locus_tag LOCUS_28740 2102 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2250 2408 gene locus_tag LOCUS_28750 2250 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence0415 71 292 gene locus_tag LOCUS_28760 71 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 289 579 gene locus_tag LOCUS_28770 289 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 1181 849 gene locus_tag LOCUS_28780 1181 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence0416 2502 448 gene locus_tag LOCUS_28790 gene brxL 2502 448 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_28790 2831 2499 gene locus_tag LOCUS_28800 2831 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence0417 235 678 gene locus_tag LOCUS_28810 235 678 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_28810 825 1052 gene locus_tag LOCUS_28820 825 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1057 1374 gene locus_tag LOCUS_28830 1057 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1509 1979 gene locus_tag LOCUS_28840 1509 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0418 790 248 gene locus_tag LOCUS_28850 790 248 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_28850 1581 787 gene locus_tag LOCUS_28860 1581 787 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_28860 2015 1578 gene locus_tag LOCUS_28870 2015 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2638 2123 gene locus_tag LOCUS_28880 2638 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence0419 73 420 gene locus_tag LOCUS_28890 73 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence0420 1096 923 gene locus_tag LOCUS_28900 1096 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1809 1450 gene locus_tag LOCUS_28910 1809 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 2277 1990 gene locus_tag LOCUS_28920 2277 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 2691 2329 gene locus_tag LOCUS_28930 2691 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence0421 1899 2051 gene locus_tag LOCUS_28940 1899 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0422 610 906 gene locus_tag LOCUS_28950 610 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1058 1408 gene locus_tag LOCUS_28960 1058 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1729 1409 gene locus_tag LOCUS_28970 1729 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_28970 2039 1719 gene locus_tag LOCUS_28980 2039 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 <2796 2055 gene locus_tag LOCUS_28990 <2796 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086016636.1:IS3 family transposase >Feature sequence0423 67 348 gene locus_tag LOCUS_29000 67 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2371 425 gene locus_tag LOCUS_29010 gene acs 2371 425 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_29010 2476 2700 gene locus_tag LOCUS_29020 2476 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence0424 433 113 gene locus_tag LOCUS_29030 433 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_29030 2000 423 gene locus_tag LOCUS_29040 2000 423 CDS product IS66-like element ISBj7 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084592.1 protein_id gnl|my_center|LOCUS_29040 2399 2058 gene locus_tag LOCUS_29050 gene tnpB 2399 2058 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624701.1 protein_id gnl|my_center|LOCUS_29050 2701 2402 gene locus_tag LOCUS_29060 2701 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0425 661 179 gene locus_tag LOCUS_29070 661 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 2489 702 gene locus_tag LOCUS_29080 2489 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence0426 445 789 gene locus_tag LOCUS_29090 445 789 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_29090 791 1072 gene locus_tag LOCUS_29100 791 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 1164 2624 gene locus_tag LOCUS_29110 1164 2624 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence0427 379 17 gene locus_tag LOCUS_29120 379 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 1094 447 gene locus_tag LOCUS_29130 1094 447 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_29130 1558 1091 gene locus_tag LOCUS_29140 1558 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 2664 1864 gene locus_tag LOCUS_29150 2664 1864 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098801.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0428 1095 121 gene locus_tag LOCUS_29160 1095 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence0429 162 425 gene locus_tag LOCUS_29170 162 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 533 2329 gene locus_tag LOCUS_29180 gene aspS 533 2329 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence0430 227 90 gene locus_tag LOCUS_29190 227 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29190 479 234 gene locus_tag LOCUS_29200 479 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29200 768 2138 gene locus_tag LOCUS_29210 gene mltF 768 2138 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172712.1 protein_id gnl|my_center|LOCUS_29210 2581 2111 gene locus_tag LOCUS_29220 gene tadA 2581 2111 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0431 1434 508 gene locus_tag LOCUS_29230 1434 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 2282 1434 gene locus_tag LOCUS_29240 2282 1434 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908296.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence0432 251 1006 gene locus_tag LOCUS_29250 251 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1152 1535 gene locus_tag LOCUS_29260 gene pilG 1152 1535 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_29260 1532 1828 gene locus_tag LOCUS_29270 1532 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29270 1825 1947 gene locus_tag LOCUS_29280 1825 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29280 1947 2504 gene locus_tag LOCUS_29290 1947 2504 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116439.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence0433 177 455 gene locus_tag LOCUS_29300 177 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 530 991 gene locus_tag LOCUS_29310 530 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1440 1628 gene locus_tag LOCUS_29320 1440 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 2041 1640 gene locus_tag LOCUS_29330 2041 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2418 2038 gene locus_tag LOCUS_29340 2418 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0434 333 2327 gene locus_tag LOCUS_29350 333 2327 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_29350 >Feature sequence0435 2546 189 gene locus_tag LOCUS_29360 2546 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence0436 <1 1785 gene locus_tag LOCUS_29370 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205228200.1:BREX system P-loop protein BrxC >Feature sequence0437 <1 893 gene locus_tag LOCUS_29380 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257684.1:restriction endonuclease subunit S 893 1465 gene locus_tag LOCUS_29390 893 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1462 2382 gene locus_tag LOCUS_29400 1462 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence0438 386 96 gene locus_tag LOCUS_29410 386 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 2513 399 gene locus_tag LOCUS_29420 2513 399 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence0439 577 1236 gene locus_tag LOCUS_29430 577 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1673 1999 gene locus_tag LOCUS_29440 1673 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29440 2555 2082 gene locus_tag LOCUS_29450 2555 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence0440 1944 199 gene locus_tag LOCUS_29460 1944 199 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261757.1 protein_id gnl|my_center|LOCUS_29460 >Feature sequence0441 1254 184 gene locus_tag LOCUS_29470 1254 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence0442 <1 697 gene locus_tag LOCUS_29480 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001163403.1:IS21-like element IS1326 family helper ATPase IstB 1121 672 gene locus_tag LOCUS_29490 1121 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1800 1108 gene locus_tag LOCUS_29500 1800 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2437 1793 gene locus_tag LOCUS_29510 2437 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 >Feature sequence0443 <2667 1015 gene locus_tag LOCUS_29520 <2667 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385729.1:class I SAM-dependent DNA methyltransferase >Feature sequence0444 1634 903 gene locus_tag LOCUS_29530 1634 903 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_29530 2391 1708 gene locus_tag LOCUS_29540 2391 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29540 >Feature sequence0445 1908 2396 gene locus_tag LOCUS_29550 1908 2396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633911.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence0446 988 20 gene locus_tag LOCUS_29560 988 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 1983 988 gene locus_tag LOCUS_29570 gene rhuM 1983 988 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_29570 >Feature sequence0447 339 1967 gene locus_tag LOCUS_29580 gene pilS 339 1967 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_29580 >Feature sequence0448 785 201 gene locus_tag LOCUS_29590 785 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1309 1073 gene locus_tag LOCUS_29600 1309 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1363 2556 gene locus_tag LOCUS_29610 1363 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 >Feature sequence0449 291 692 gene locus_tag LOCUS_29620 291 692 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774559.1 protein_id gnl|my_center|LOCUS_29620 913 722 gene locus_tag LOCUS_29630 913 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2066 897 gene locus_tag LOCUS_29640 2066 897 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_29640 2262 2633 gene locus_tag LOCUS_29650 2262 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0450 122 556 gene locus_tag LOCUS_29660 122 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 751 675 gene locus_tag LOCUS_t00340 751 675 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1726 758 gene locus_tag LOCUS_29670 gene ispB 1726 758 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_29670 1923 2234 gene locus_tag LOCUS_29680 gene rplU 1923 2234 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_29680 2247 2504 gene locus_tag LOCUS_29690 gene rpmA 2247 2504 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002434222.1 protein_id gnl|my_center|LOCUS_29690 >Feature sequence0451 313 2343 gene locus_tag LOCUS_29700 313 2343 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence0452 1422 1793 gene locus_tag LOCUS_29710 1422 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1811 2041 gene locus_tag LOCUS_29720 1811 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 2041 2265 gene locus_tag LOCUS_29730 2041 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence0453 36 2459 gene locus_tag LOCUS_29740 36 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 >Feature sequence0454 224 1090 gene locus_tag LOCUS_29750 224 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1175 2329 gene locus_tag LOCUS_29760 1175 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 >Feature sequence0455 1331 519 gene locus_tag LOCUS_29770 1331 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 1483 2604 gene locus_tag LOCUS_29780 1483 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0456 117 776 gene locus_tag LOCUS_29790 117 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 883 959 gene locus_tag LOCUS_t00350 883 959 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1412 1074 gene locus_tag LOCUS_29800 1412 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 <2613 2014 gene locus_tag LOCUS_29810 <2613 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268280.1:sensor histidine kinase >Feature sequence0457 143 601 gene locus_tag LOCUS_29820 143 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 892 743 gene locus_tag LOCUS_29830 892 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1169 867 gene locus_tag LOCUS_29840 1169 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1182 2297 gene locus_tag LOCUS_29850 1182 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence0458 2118 1735 gene locus_tag LOCUS_29860 2118 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2337 2412 gene locus_tag LOCUS_t00360 2337 2412 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0459 326 2014 gene locus_tag LOCUS_29870 326 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence0460 672 1 gene locus_tag LOCUS_29880 672 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1240 1164 gene locus_tag LOCUS_t00370 1240 1164 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2441 1395 gene locus_tag LOCUS_29890 2441 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence0461 247 1863 gene locus_tag LOCUS_29900 247 1863 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071014.1 protein_id gnl|my_center|LOCUS_29900 1856 2275 gene locus_tag LOCUS_29910 1856 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0462 >Feature sequence0463 34 1317 gene locus_tag LOCUS_29920 gene csy1 34 1317 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_29920 1310 2269 gene locus_tag LOCUS_29930 gene csy2 1310 2269 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence0464 2520 241 gene locus_tag LOCUS_29940 2520 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0465 >Feature sequence0466 >Feature sequence0467 1486 560 gene locus_tag LOCUS_29950 1486 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 <2504 1560 gene locus_tag LOCUS_29960 <2504 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939304.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence0468 595 338 gene locus_tag LOCUS_29970 595 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 942 718 gene locus_tag LOCUS_29980 942 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29980 1086 946 gene locus_tag LOCUS_29990 1086 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29990 1796 1176 gene locus_tag LOCUS_30000 1796 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30000 1862 2422 gene locus_tag LOCUS_30010 1862 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence0469 3 1829 gene locus_tag LOCUS_30020 3 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 <2498 1838 gene locus_tag LOCUS_30030 <2498 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143639.1:glycosyltransferase family 2 protein >Feature sequence0470 >Feature sequence0471 2067 184 gene locus_tag LOCUS_30040 2067 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence0472 2329 113 gene locus_tag LOCUS_30050 2329 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence0473 95 1129 gene locus_tag LOCUS_30060 gene selD 95 1129 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211671.1 protein_id gnl|my_center|LOCUS_30060 1126 2226 gene locus_tag LOCUS_30070 gene mnmH 1126 2226 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064861.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence0474 2352 82 gene locus_tag LOCUS_30080 2352 82 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence0475 739 218 gene locus_tag LOCUS_30090 739 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2386 1211 gene locus_tag LOCUS_30100 2386 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0476 1460 1708 gene locus_tag LOCUS_30110 1460 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence0477 <1 597 gene locus_tag LOCUS_30120 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974286.1:KAP family P-loop domain protein 1041 1448 gene locus_tag LOCUS_30130 1041 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 >Feature sequence0478 29 619 gene locus_tag LOCUS_30140 29 619 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888854.1 protein_id gnl|my_center|LOCUS_30140 619 1353 gene locus_tag LOCUS_30150 619 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2244 1411 gene locus_tag LOCUS_30160 2244 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence0479 2381 63 gene locus_tag LOCUS_30170 2381 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence0480 >Feature sequence0481 >Feature sequence0482 195 674 gene locus_tag LOCUS_30180 195 674 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_30180 708 1736 gene locus_tag LOCUS_30190 gene nagZ 708 1736 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529339.1 protein_id gnl|my_center|LOCUS_30190 1740 2345 gene locus_tag LOCUS_30200 1740 2345 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence0483 1574 129 gene locus_tag LOCUS_30210 1574 129 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171507.1 protein_id gnl|my_center|LOCUS_30210 2253 2005 gene locus_tag LOCUS_30220 2253 2005 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence0484 130 1665 gene locus_tag LOCUS_30230 130 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 <2392 1662 gene locus_tag LOCUS_30240 <2392 1662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145723262.1:IS1380 family transposase >Feature sequence0485 19 318 gene locus_tag LOCUS_30250 19 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 315 1607 gene locus_tag LOCUS_30260 315 1607 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389727.1 protein_id gnl|my_center|LOCUS_30260 1604 1825 gene locus_tag LOCUS_30270 1604 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1812 2318 gene locus_tag LOCUS_30280 1812 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence0486 >Feature sequence0487 1718 1918 gene locus_tag LOCUS_30290 1718 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 >Feature sequence0488 1201 461 gene locus_tag LOCUS_30300 1201 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30300 1528 1322 gene locus_tag LOCUS_30310 1528 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2019 1525 gene locus_tag LOCUS_30320 2019 1525 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence0489 <1 1308 gene locus_tag LOCUS_30330 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070904.1:TonB-dependent receptor >Feature sequence0490 884 198 gene locus_tag LOCUS_30340 884 198 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_30340 1976 1416 gene locus_tag LOCUS_30350 1976 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence0491 70 1359 gene locus_tag LOCUS_30360 70 1359 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_30360 1349 1741 gene locus_tag LOCUS_30370 1349 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30370 1880 2233 gene locus_tag LOCUS_30380 1880 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence0492 155 502 gene locus_tag LOCUS_30390 155 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 495 1589 gene locus_tag LOCUS_30400 495 1589 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_30400 1590 1874 gene locus_tag LOCUS_30410 1590 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence0493 418 116 gene locus_tag LOCUS_30420 418 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 1728 418 gene locus_tag LOCUS_30430 1728 418 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_30430 1812 2159 gene locus_tag LOCUS_30440 1812 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence0494 <2313 752 gene locus_tag LOCUS_30450 <2313 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000350101.1:class I SAM-dependent DNA methyltransferase >Feature sequence0495 147 452 gene locus_tag LOCUS_30460 147 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1440 445 gene locus_tag LOCUS_30470 1440 445 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077244862.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence0496 <2294 892 gene locus_tag LOCUS_30480 <2294 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087198.1:F-type conjugal transfer pilus assembly protein TraB >Feature sequence0497 >Feature sequence0498 1765 623 gene locus_tag LOCUS_30490 1765 623 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200836483.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence0499 >Feature sequence0500 1300 32 gene locus_tag LOCUS_30500 1300 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 2149 1970 gene locus_tag LOCUS_30510 2149 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0501 73 1125 gene locus_tag LOCUS_30520 73 1125 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_30520 1491 1982 gene locus_tag LOCUS_30530 1491 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0502 632 27 gene locus_tag LOCUS_30540 632 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 708 1013 gene locus_tag LOCUS_30550 708 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1010 1747 gene locus_tag LOCUS_30560 1010 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence0503 902 153 gene locus_tag LOCUS_30570 902 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2120 1140 gene locus_tag LOCUS_30580 2120 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2013 2255 gene locus_tag LOCUS_30590 2013 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence0504 250 2220 gene locus_tag LOCUS_30600 250 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence0505 992 294 gene locus_tag LOCUS_30610 992 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence0506 305 1267 gene locus_tag LOCUS_30620 305 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1427 1624 gene locus_tag LOCUS_30630 1427 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 <2256 1676 gene locus_tag LOCUS_30640 <2256 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187437126.1:IS256 family transposase >Feature sequence0507 518 321 gene locus_tag LOCUS_30650 518 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30650 1217 537 gene locus_tag LOCUS_30660 1217 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30660 1594 1226 gene locus_tag LOCUS_30670 1594 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30670 2167 1703 gene locus_tag LOCUS_30680 2167 1703 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766304.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence0508 36 2015 gene locus_tag LOCUS_30690 36 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2012 2146 gene locus_tag LOCUS_30700 2012 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence0509 >Feature sequence0510 <1 1651 gene locus_tag LOCUS_30710 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268660.1:RecQ family ATP-dependent DNA helicase >Feature sequence0511 2232 118 gene locus_tag LOCUS_30720 2232 118 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_30720 >Feature sequence0512 >Feature sequence0513 666 157 gene locus_tag LOCUS_30730 666 157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922234.1 protein_id gnl|my_center|LOCUS_30730 1290 667 gene locus_tag LOCUS_30740 1290 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1769 1305 gene locus_tag LOCUS_30750 1769 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2051 1914 gene locus_tag LOCUS_30760 2051 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence0514 42 851 gene locus_tag LOCUS_30770 42 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1041 2192 gene locus_tag LOCUS_30780 1041 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence0515 >Feature sequence0516 133 474 gene locus_tag LOCUS_30790 133 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1033 701 gene locus_tag LOCUS_30800 1033 701 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202809.1 protein_id gnl|my_center|LOCUS_30800 1333 1037 gene locus_tag LOCUS_30810 1333 1037 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0517 >Feature sequence0518 <2187 622 gene locus_tag LOCUS_30820 <2187 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103418.1:class I SAM-dependent DNA methyltransferase >Feature sequence0519 >Feature sequence0520 1977 73 gene locus_tag LOCUS_30830 1977 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 >Feature sequence0521 >Feature sequence0522 <1 1583 gene locus_tag LOCUS_30840 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932366.1:AAA family ATPase 1576 2079 gene locus_tag LOCUS_30850 1576 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30850 >Feature sequence0523 1919 819 gene locus_tag LOCUS_30860 1919 819 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_30860 >Feature sequence0524 104 1891 gene locus_tag LOCUS_30870 104 1891 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390241.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0525 1286 129 gene locus_tag LOCUS_30880 1286 129 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946966.1 protein_id gnl|my_center|LOCUS_30880 <2124 1289 gene locus_tag LOCUS_30890 <2124 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258773.1:DNA cytosine methyltransferase >Feature sequence0526 1433 792 gene locus_tag LOCUS_30900 1433 792 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478451.1 protein_id gnl|my_center|LOCUS_30900 1854 1438 gene locus_tag LOCUS_30910 1854 1438 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence0527 <1 560 gene locus_tag LOCUS_30920 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145723262.1:IS1380 family transposase 1411 1743 gene locus_tag LOCUS_30930 1411 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2069 1740 gene locus_tag LOCUS_30940 2069 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence0528 277 438 gene locus_tag LOCUS_30950 277 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence0529 1439 1176 gene locus_tag LOCUS_30960 1439 1176 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_30960 1678 1436 gene locus_tag LOCUS_30970 1678 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence0530 618 130 gene locus_tag LOCUS_30980 618 130 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_30980 908 618 gene locus_tag LOCUS_30990 908 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 1841 1254 gene locus_tag LOCUS_31000 1841 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence0531 >Feature sequence0532 259 492 gene locus_tag LOCUS_31010 259 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 495 1964 gene locus_tag LOCUS_31020 495 1964 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0533 261 419 gene locus_tag LOCUS_31030 261 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 441 1808 gene locus_tag LOCUS_31040 441 1808 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence0534 749 1135 gene locus_tag LOCUS_31050 749 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 <2073 1339 gene locus_tag LOCUS_31060 <2073 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145723262.1:IS1380 family transposase >Feature sequence0535 559 1446 gene locus_tag LOCUS_31070 gene rdgC 559 1446 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0536 1283 2041 gene locus_tag LOCUS_31080 1283 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence0537 >Feature sequence0538 654 196 gene locus_tag LOCUS_31090 654 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 970 668 gene locus_tag LOCUS_31100 970 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 1049 1360 gene locus_tag LOCUS_31110 1049 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1523 1326 gene locus_tag LOCUS_31120 1523 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence0539 313 567 gene locus_tag LOCUS_31130 gene hfq 313 567 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_31130 618 1904 gene locus_tag LOCUS_31140 gene hflX 618 1904 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460351.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence0540 483 983 gene locus_tag LOCUS_31150 483 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1030 1347 gene locus_tag LOCUS_31160 1030 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1403 1867 gene locus_tag LOCUS_31170 gene ssb 1403 1867 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence0541 1538 1302 gene locus_tag LOCUS_31180 1538 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0542 180 16 gene locus_tag LOCUS_31190 180 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1564 197 gene locus_tag LOCUS_31200 1564 197 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_31200 1916 1575 gene locus_tag LOCUS_31210 1916 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence0543 401 237 gene locus_tag LOCUS_31220 401 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 464 901 gene locus_tag LOCUS_31230 464 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 901 1947 gene locus_tag LOCUS_31240 901 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence0544 974 360 gene locus_tag LOCUS_31250 gene gmk 974 360 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_31250 1833 967 gene locus_tag LOCUS_31260 1833 967 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175963.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence0545 683 255 gene locus_tag LOCUS_31270 683 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 1913 747 gene locus_tag LOCUS_31280 1913 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence0546 436 1074 gene locus_tag LOCUS_31290 436 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1150 2010 gene locus_tag LOCUS_31300 1150 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence0547 204 857 gene locus_tag LOCUS_31310 204 857 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 protein_id gnl|my_center|LOCUS_31310 871 1440 gene locus_tag LOCUS_31320 871 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1790 1407 gene locus_tag LOCUS_31330 1790 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0548 >Feature sequence0549 1842 316 gene locus_tag LOCUS_31340 1842 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence0550 1239 1048 gene locus_tag LOCUS_31350 1239 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1597 1457 gene locus_tag LOCUS_31360 1597 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence0551 100 429 gene locus_tag LOCUS_31370 100 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 1265 1486 gene locus_tag LOCUS_31380 1265 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence0552 <2003 656 gene locus_tag LOCUS_31390 <2003 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:Ig-like domain-containing protein >Feature sequence0553 107 1081 gene locus_tag LOCUS_31400 107 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 1805 1056 gene locus_tag LOCUS_31410 1805 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence0554 229 1224 gene locus_tag LOCUS_31420 229 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence0555 1083 196 gene locus_tag LOCUS_31430 gene rdgC 1083 196 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706841.1 protein_id gnl|my_center|LOCUS_31430 1709 1083 gene locus_tag LOCUS_31440 1709 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence0556 <1987 35 gene locus_tag LOCUS_31450 <1987 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964235.1:N-6 DNA methylase >Feature sequence0557 3 224 gene locus_tag LOCUS_31460 3 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 426 196 gene locus_tag LOCUS_31470 426 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 632 438 gene locus_tag LOCUS_31480 632 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1266 751 gene locus_tag LOCUS_31490 1266 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 1760 1263 gene locus_tag LOCUS_31500 1760 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence0558 1418 375 gene locus_tag LOCUS_31510 1418 375 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_31510 1662 1531 gene locus_tag LOCUS_31520 1662 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0559 407 78 gene locus_tag LOCUS_31530 407 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1197 394 gene locus_tag LOCUS_31540 1197 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_31540 1375 1190 gene locus_tag LOCUS_31550 1375 1190 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence0560 >Feature sequence0561 1890 850 gene locus_tag LOCUS_31560 1890 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0562 >Feature sequence0563 686 1699 gene locus_tag LOCUS_31570 686 1699 CDS product CbbQ/NirQ/NorQ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939317.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence0564 462 139 gene locus_tag LOCUS_31580 462 139 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_31580 1577 462 gene locus_tag LOCUS_31590 1577 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence0565 159 560 gene locus_tag LOCUS_31600 159 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 762 1895 gene locus_tag LOCUS_31610 762 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence0566 1932 1537 gene locus_tag LOCUS_31620 1932 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence0567 711 211 gene locus_tag LOCUS_31630 711 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 735 1913 gene locus_tag LOCUS_31640 735 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence0568 <1925 256 gene locus_tag LOCUS_31650 <1925 256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000213431.1:DEAD/DEAH box helicase >Feature sequence0569 204 350 gene locus_tag LOCUS_31660 204 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31660 578 1762 gene locus_tag LOCUS_31670 578 1762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence0570 >Feature sequence0571 >Feature sequence0572 942 1064 gene locus_tag LOCUS_31680 942 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 1365 1592 gene locus_tag LOCUS_31690 1365 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence0573 614 802 gene locus_tag LOCUS_31700 614 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 <1907 1033 gene locus_tag LOCUS_31710 <1907 1033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035868.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase >Feature sequence0574 1485 643 gene locus_tag LOCUS_31720 gene dinD 1485 643 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence0575 613 176 gene locus_tag LOCUS_31730 613 176 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142603.1 protein_id gnl|my_center|LOCUS_31730 842 597 gene locus_tag LOCUS_31740 842 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1215 853 gene locus_tag LOCUS_31750 1215 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 1403 1621 gene locus_tag LOCUS_31760 1403 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31760 >Feature sequence0576 78 221 gene locus_tag LOCUS_31770 78 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 225 614 gene locus_tag LOCUS_31780 225 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 759 1823 gene locus_tag LOCUS_31790 759 1823 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence0577 1533 415 gene locus_tag LOCUS_31800 1533 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence0578 578 126 gene locus_tag LOCUS_31810 578 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 1281 580 gene locus_tag LOCUS_31820 1281 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 1687 1400 gene locus_tag LOCUS_31830 1687 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence0579 48 398 gene locus_tag LOCUS_31840 48 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 695 1759 gene locus_tag LOCUS_31850 695 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence0580 134 778 gene locus_tag LOCUS_31860 gene uvrY 134 778 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611323.1 protein_id gnl|my_center|LOCUS_31860 775 1467 gene locus_tag LOCUS_31870 775 1467 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence0581 <1 1113 gene locus_tag LOCUS_31880 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968694.1:class I SAM-dependent DNA methyltransferase >Feature sequence0582 1479 106 gene locus_tag LOCUS_31890 1479 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 1829 1476 gene locus_tag LOCUS_31900 1829 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence0583 109 729 gene locus_tag LOCUS_31910 109 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 1316 1005 gene locus_tag LOCUS_31920 1316 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence0584 273 154 gene locus_tag LOCUS_31930 273 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 492 770 gene locus_tag LOCUS_31940 492 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 1610 852 gene locus_tag LOCUS_31950 1610 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence0585 6 488 gene locus_tag LOCUS_31960 6 488 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_31960 1735 554 gene locus_tag LOCUS_31970 1735 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence0586 1656 118 gene locus_tag LOCUS_31980 1656 118 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence0587 1670 939 gene locus_tag LOCUS_31990 1670 939 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_31990 >Feature sequence0588 1155 655 gene locus_tag LOCUS_32000 1155 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 <1802 1155 gene locus_tag LOCUS_32010 <1802 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein >Feature sequence0589 371 129 gene locus_tag LOCUS_32020 371 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1278 973 gene locus_tag LOCUS_32030 1278 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 1517 1278 gene locus_tag LOCUS_32040 1517 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence0590 160 1383 gene locus_tag LOCUS_32050 gene arsJ 160 1383 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence0591 >Feature sequence0592 950 597 gene locus_tag LOCUS_32060 950 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence0593 1404 562 gene locus_tag LOCUS_32070 gene dinD 1404 562 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence0594 972 436 gene locus_tag LOCUS_32080 972 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1277 1056 gene locus_tag LOCUS_32090 1277 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence0595 1535 648 gene locus_tag LOCUS_32100 1535 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence0596 1254 217 gene locus_tag LOCUS_32110 1254 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 >Feature sequence0597 108 734 gene locus_tag LOCUS_32120 108 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 731 1453 gene locus_tag LOCUS_32130 731 1453 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence0598 >Feature sequence0599 229 384 gene locus_tag LOCUS_32140 229 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence0600 538 347 gene locus_tag LOCUS_32150 538 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32150 >Feature sequence0601 >Feature sequence0602 321 632 gene locus_tag LOCUS_32160 321 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence0603 735 118 gene locus_tag LOCUS_32170 735 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 1375 725 gene locus_tag LOCUS_32180 1375 725 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_32180 1587 1396 gene locus_tag LOCUS_32190 1587 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0604 196 381 gene locus_tag LOCUS_32200 196 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence0605 1561 689 gene locus_tag LOCUS_32210 1561 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence0606 386 114 gene locus_tag LOCUS_32220 386 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 1056 541 gene locus_tag LOCUS_32230 1056 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1469 1053 gene locus_tag LOCUS_32240 1469 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence0607 916 212 gene locus_tag LOCUS_32250 gene istB 916 212 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_32250 <1734 982 gene locus_tag LOCUS_32260 <1734 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:IS21-like element ISPsy14 family transposase >Feature sequence0608 1712 1443 gene locus_tag LOCUS_32270 1712 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence0609 479 198 gene locus_tag LOCUS_32280 479 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 585 1520 gene locus_tag LOCUS_32290 585 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence0610 58 450 gene locus_tag LOCUS_32300 58 450 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_32300 443 1561 gene locus_tag LOCUS_32310 443 1561 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence0611 >Feature sequence0612 1170 349 gene locus_tag LOCUS_32320 1170 349 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence0613 >Feature sequence0614 >Feature sequence0615 >Feature sequence0616 956 93 gene locus_tag LOCUS_32330 956 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1047 1235 gene locus_tag LOCUS_32340 1047 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence0617 1498 146 gene locus_tag LOCUS_32350 1498 146 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence0618 127 441 gene locus_tag LOCUS_32360 127 441 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533370.1 protein_id gnl|my_center|LOCUS_32360 667 1287 gene locus_tag LOCUS_32370 667 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32370 >Feature sequence0619 1317 34 gene locus_tag LOCUS_32380 1317 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence0620 630 313 gene locus_tag LOCUS_32390 630 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 919 1485 gene locus_tag LOCUS_32400 gene dcd 919 1485 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_32400 >Feature sequence0621 >Feature sequence0622 326 814 gene locus_tag LOCUS_32410 326 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 811 1266 gene locus_tag LOCUS_32420 811 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence0623 >Feature sequence0624 >Feature sequence0625 >Feature sequence0626 1489 146 gene locus_tag LOCUS_32430 1489 146 CDS product ISNCY-like element ISRsp17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642802.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence0627 224 1297 gene locus_tag LOCUS_32440 224 1297 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence0628 1401 1198 gene locus_tag LOCUS_32450 1401 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence0629 197 625 gene locus_tag LOCUS_32460 197 625 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008131763.1 protein_id gnl|my_center|LOCUS_32460 851 1570 gene locus_tag LOCUS_32470 851 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence0630 214 762 gene locus_tag LOCUS_32480 214 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 765 1265 gene locus_tag LOCUS_32490 765 1265 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence0631 >Feature sequence0632 1324 1127 gene locus_tag LOCUS_32500 1324 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 1559 1419 gene locus_tag LOCUS_32510 1559 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0633 511 966 gene locus_tag LOCUS_32520 511 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 981 1196 gene locus_tag LOCUS_32530 981 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence0634 243 1514 gene locus_tag LOCUS_32540 243 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0635 1232 51 gene locus_tag LOCUS_32550 1232 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence0636 1597 257 gene locus_tag LOCUS_32560 1597 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence0637 58 720 gene locus_tag LOCUS_32570 58 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 717 1397 gene locus_tag LOCUS_32580 717 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence0638 1419 88 gene locus_tag LOCUS_32590 1419 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence0639 >Feature sequence0640 632 72 gene locus_tag LOCUS_32600 632 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1393 722 gene locus_tag LOCUS_32610 1393 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence0641 >Feature sequence0642 146 1162 gene locus_tag LOCUS_32620 146 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence0643 183 31 gene locus_tag LOCUS_32630 183 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 679 500 gene locus_tag LOCUS_32640 679 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence0644 <1 1332 gene locus_tag LOCUS_32650 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939302.1:BREX-1 system phosphatase PglZ type A >Feature sequence0645 >Feature sequence0646 1408 164 gene locus_tag LOCUS_32660 1408 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence0647 >Feature sequence0648 51 1004 gene locus_tag LOCUS_32670 51 1004 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003593.1 protein_id gnl|my_center|LOCUS_32670 1001 1348 gene locus_tag LOCUS_32680 1001 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32680 >Feature sequence0649 >Feature sequence0650 >Feature sequence0651 2 1387 gene locus_tag LOCUS_32690 gene istA 2 1387 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052821263.1 protein_id gnl|my_center|LOCUS_32690 >Feature sequence0652 1462 1304 gene locus_tag LOCUS_32700 1462 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence0653 1104 265 gene locus_tag LOCUS_32710 1104 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32710 1362 1210 gene locus_tag LOCUS_32720 1362 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence0654 379 146 gene locus_tag LOCUS_32730 379 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 464 1414 gene locus_tag LOCUS_32740 464 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence0655 302 808 gene locus_tag LOCUS_32750 302 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence0656 >Feature sequence0657 1025 150 gene locus_tag LOCUS_32760 1025 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32760 1321 1022 gene locus_tag LOCUS_32770 1321 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32770 >Feature sequence0658 1211 45 gene locus_tag LOCUS_32780 1211 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence0659 158 1075 gene locus_tag LOCUS_32790 158 1075 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_32790 1413 1213 gene locus_tag LOCUS_32800 1413 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence0660 1242 268 gene locus_tag LOCUS_32810 1242 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence0661 1090 386 gene locus_tag LOCUS_32820 1090 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence0662 175 1467 gene locus_tag LOCUS_32830 175 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence0663 345 623 gene locus_tag LOCUS_32840 345 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 838 665 gene locus_tag LOCUS_32850 838 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1261 839 gene locus_tag LOCUS_32860 gene tnpA 1261 839 CDS product IS200/IS605-like element ISDra2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887312.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence0664 >Feature sequence0665 >Feature sequence0666 301 516 gene locus_tag LOCUS_32870 301 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 673 1353 gene locus_tag LOCUS_32880 673 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence0667 885 208 gene locus_tag LOCUS_32890 885 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence0668 >Feature sequence0669 >Feature sequence0670 >Feature sequence0671 >Feature sequence0672 176 979 gene locus_tag LOCUS_32900 gene trpC 176 979 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_32900 1023 1370 gene locus_tag LOCUS_32910 1023 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence0673 331 1365 gene locus_tag LOCUS_32920 331 1365 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0674 >Feature sequence0675 874 596 gene locus_tag LOCUS_32930 874 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence0676 >Feature sequence0677 722 1090 gene locus_tag LOCUS_32940 722 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 1101 1244 gene locus_tag LOCUS_32950 1101 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1208 1417 gene locus_tag LOCUS_32960 1208 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence0678 766 293 gene locus_tag LOCUS_32970 766 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence0679 331 1269 gene locus_tag LOCUS_32980 331 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence0680 336 746 gene locus_tag LOCUS_32990 336 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence0681 493 918 gene locus_tag LOCUS_33000 493 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 915 1352 gene locus_tag LOCUS_33010 915 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 >Feature sequence0682 >Feature sequence0683 259 1302 gene locus_tag LOCUS_33020 259 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence0684 >Feature sequence0685 71 835 gene locus_tag LOCUS_33030 71 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 1012 1368 gene locus_tag LOCUS_33040 1012 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence0686 <1 739 gene locus_tag LOCUS_33050 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022091.1:restriction endonuclease subunit S 751 882 gene locus_tag LOCUS_33060 751 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence0687 >Feature sequence0688 193 1257 gene locus_tag LOCUS_33070 193 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence0689 33 218 gene locus_tag LOCUS_33080 33 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 235 606 gene locus_tag LOCUS_33090 235 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 >Feature sequence0690 <1399 399 gene locus_tag LOCUS_33100 <1399 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870274.1:restriction endonuclease subunit S >Feature sequence0691 >Feature sequence0692 1256 159 gene locus_tag LOCUS_33110 1256 159 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417625.1 protein_id gnl|my_center|LOCUS_33110 >Feature sequence0693 128 844 gene locus_tag LOCUS_33120 128 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 854 1186 gene locus_tag LOCUS_33130 854 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence0694 26 208 gene locus_tag LOCUS_33140 26 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 462 304 gene locus_tag LOCUS_33150 462 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence0695 914 408 gene locus_tag LOCUS_33160 gene tpx 914 408 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_33160 1086 1283 gene locus_tag LOCUS_33170 1086 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence0696 141 278 gene locus_tag LOCUS_33180 141 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1093 308 gene locus_tag LOCUS_33190 1093 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence0697 482 1195 gene locus_tag LOCUS_33200 482 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33200 >Feature sequence0698 342 190 gene locus_tag LOCUS_33210 342 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33210 1207 335 gene locus_tag LOCUS_33220 1207 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33220 >Feature sequence0699 <1 1272 gene locus_tag LOCUS_33230 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146477260.1:ATP-binding protein >Feature sequence0700 >Feature sequence0701 >Feature sequence0702 82 864 gene locus_tag LOCUS_33240 82 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1093 911 gene locus_tag LOCUS_33250 1093 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence0703 162 1202 gene locus_tag LOCUS_33260 gene tdh 162 1202 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence0704 57 569 gene locus_tag LOCUS_33270 57 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence0705 <1 841 gene locus_tag LOCUS_33280 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039057.1:class I SAM-dependent DNA methyltransferase >Feature sequence0706 647 934 gene locus_tag LOCUS_33290 647 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1144 1010 gene locus_tag LOCUS_33300 1144 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence0707 192 1253 gene locus_tag LOCUS_33310 192 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence0708 >Feature sequence0709 >Feature sequence0710 761 111 gene locus_tag LOCUS_33320 761 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 1166 873 gene locus_tag LOCUS_33330 1166 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence0711 649 957 gene locus_tag LOCUS_33340 649 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1066 1197 gene locus_tag LOCUS_33350 1066 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence0712 >Feature sequence0713 1040 132 gene locus_tag LOCUS_33360 1040 132 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819958.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence0714 552 911 gene locus_tag LOCUS_33370 552 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1040 1243 gene locus_tag LOCUS_33380 1040 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence0715 707 171 gene locus_tag LOCUS_33390 707 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 >Feature sequence0716 647 360 gene locus_tag LOCUS_33400 647 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 808 644 gene locus_tag LOCUS_33410 808 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 >Feature sequence0717 1087 443 gene locus_tag LOCUS_33420 1087 443 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence0718 >Feature sequence0719 376 999 gene locus_tag LOCUS_33430 376 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence0720 <1 570 gene locus_tag LOCUS_33440 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211867.1:type I-F CRISPR-associated protein Csy3 575 1138 gene locus_tag LOCUS_33450 gene cas6f 575 1138 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 protein_id gnl|my_center|LOCUS_33450 >Feature sequence0721 619 422 gene locus_tag LOCUS_33460 619 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence0722 250 131 gene locus_tag LOCUS_33470 250 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence0723 921 457 gene locus_tag LOCUS_33480 921 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33480 >Feature sequence0724 <1 653 gene locus_tag LOCUS_33490 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891943.1:helix-turn-helix domain-containing protein >Feature sequence0725 444 118 gene locus_tag LOCUS_33500 444 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33500 1074 580 gene locus_tag LOCUS_33510 1074 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33510 >Feature sequence0726 >Feature sequence0727 303 830 gene locus_tag LOCUS_33520 303 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence0728 223 720 gene locus_tag LOCUS_33530 223 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33530 717 1241 gene locus_tag LOCUS_33540 717 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33540 >Feature sequence0729 388 666 gene locus_tag LOCUS_33550 388 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 635 778 gene locus_tag LOCUS_33560 635 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 >Feature sequence0730 >Feature sequence0731 1258 104 gene locus_tag LOCUS_33570 1258 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence0732 93 557 gene locus_tag LOCUS_33580 93 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 561 1148 gene locus_tag LOCUS_33590 561 1148 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence0733 >Feature sequence0734 292 1062 gene locus_tag LOCUS_33600 292 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33600 >Feature sequence0735 1129 779 gene locus_tag LOCUS_33610 1129 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 >Feature sequence0736 1199 1059 gene locus_tag LOCUS_33620 1199 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence0737 386 99 gene locus_tag LOCUS_33630 386 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 1101 514 gene locus_tag LOCUS_33640 1101 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence0738 >Feature sequence0739 929 435 gene locus_tag LOCUS_33650 929 435 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233853.1 protein_id gnl|my_center|LOCUS_33650 >Feature sequence0740 >Feature sequence0741 >Feature sequence0742 561 46 gene locus_tag LOCUS_33660 561 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33660 1049 558 gene locus_tag LOCUS_33670 1049 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33670 >Feature sequence0743 <1245 511 gene locus_tag LOCUS_33680 <1245 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176598.1:PaeR7I family type II restriction endonuclease >Feature sequence0744 >Feature sequence0745 886 104 gene locus_tag LOCUS_33690 886 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence0746 344 21 gene locus_tag LOCUS_33700 344 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 1206 472 gene locus_tag LOCUS_33710 gene istB 1206 472 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence0747 1021 1158 gene locus_tag LOCUS_33720 1021 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence0748 638 102 gene locus_tag LOCUS_33730 638 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence0749 2 340 gene locus_tag LOCUS_33740 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 <1225 499 gene locus_tag LOCUS_33750 <1225 499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145723262.1:IS1380 family transposase >Feature sequence0750 893 468 gene locus_tag LOCUS_33760 893 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence0751 167 475 gene locus_tag LOCUS_33770 167 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 491 634 gene locus_tag LOCUS_33780 491 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence0752 >Feature sequence0753 264 133 gene locus_tag LOCUS_33790 264 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 870 277 gene locus_tag LOCUS_33800 870 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence0754 3 1001 gene locus_tag LOCUS_33810 3 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence0755 1031 132 gene locus_tag LOCUS_33820 1031 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 >Feature sequence0756 1097 573 gene locus_tag LOCUS_33830 1097 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence0757 237 545 gene locus_tag LOCUS_33840 237 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence0758 >Feature sequence0759 100 1173 gene locus_tag LOCUS_33850 100 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence0760 >Feature sequence0761 87 233 gene locus_tag LOCUS_33860 87 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence0762 >Feature sequence0763 128 964 gene locus_tag LOCUS_33870 128 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence0764 365 18 gene locus_tag LOCUS_33880 365 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 871 407 gene locus_tag LOCUS_33890 871 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1119 868 gene locus_tag LOCUS_33900 1119 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence0765 1024 83 gene locus_tag LOCUS_33910 1024 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 >Feature sequence0766 240 524 gene locus_tag LOCUS_33920 240 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence0767 1073 819 gene locus_tag LOCUS_33930 1073 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence0768 105 1091 gene locus_tag LOCUS_33940 105 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 >Feature sequence0769 >Feature sequence0770 >Feature sequence0771 >Feature sequence0772 <1201 434 gene locus_tag LOCUS_33950 <1201 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039254.1:AAA family ATPase >Feature sequence0773 72 644 gene locus_tag LOCUS_33960 72 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence0774 771 529 gene locus_tag LOCUS_33970 771 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 1039 749 gene locus_tag LOCUS_33980 1039 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence0775 300 752 gene locus_tag LOCUS_33990 300 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence0776 >Feature sequence0777 >Feature sequence0778 >Feature sequence0779 >Feature sequence0780 132 650 gene locus_tag LOCUS_34000 132 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence0781 46 171 gene locus_tag LOCUS_34010 46 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 >Feature sequence0782 >Feature sequence0783 >Feature sequence0784 <1 529 gene locus_tag LOCUS_34020 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039057.1:class I SAM-dependent DNA methyltransferase >Feature sequence0785 19 198 gene locus_tag LOCUS_34030 19 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 213 392 gene locus_tag LOCUS_34040 gene csrA 213 392 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006082602.1 protein_id gnl|my_center|LOCUS_34040 1011 805 gene locus_tag LOCUS_34050 1011 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence0786 237 425 gene locus_tag LOCUS_34060 237 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 388 537 gene locus_tag LOCUS_34070 388 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence0787 977 636 gene locus_tag LOCUS_34080 977 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence0788 160 1107 gene locus_tag LOCUS_34090 160 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence0789 1081 467 gene locus_tag LOCUS_34100 1081 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 >Feature sequence0790 1021 116 gene locus_tag LOCUS_34110 1021 116 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479860.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence0791 592 350 gene locus_tag LOCUS_34120 592 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 >Feature sequence0792 362 150 gene locus_tag LOCUS_34130 362 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 804 1055 gene locus_tag LOCUS_34140 804 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 >Feature sequence0796 992 426 gene locus_tag LOCUS_34150 992 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 >Feature sequence0797 >Feature sequence0798 273 938 gene locus_tag LOCUS_34160 273 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence0799 >Feature sequence0800 823 218 gene locus_tag LOCUS_34170 gene msrQ 823 218 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821340.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence0801 171 599 gene locus_tag LOCUS_34180 171 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 612 1079 gene locus_tag LOCUS_34190 612 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34190 >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 >Feature sequence0806 >Feature sequence0807 >Feature sequence0808 156 389 gene locus_tag LOCUS_34200 156 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 978 463 gene locus_tag LOCUS_34210 978 463 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378068.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence0809 2 853 gene locus_tag LOCUS_34220 2 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 >Feature sequence0810 <1 962 gene locus_tag LOCUS_34230 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167121745.1:VWA domain-containing protein >Feature sequence0811 <1 529 gene locus_tag LOCUS_34240 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039057.1:class I SAM-dependent DNA methyltransferase >Feature sequence0812 198 1103 gene locus_tag LOCUS_34250 198 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence0813 557 919 gene locus_tag LOCUS_34260 557 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 >Feature sequence0814 85 1026 gene locus_tag LOCUS_34270 85 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence0815 191 991 gene locus_tag LOCUS_34280 191 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence0816 >Feature sequence0817 359 814 gene locus_tag LOCUS_34290 359 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence0818 >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 696 992 gene locus_tag LOCUS_34300 696 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence0822 608 63 gene locus_tag LOCUS_34310 608 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence0823 534 998 gene locus_tag LOCUS_34320 534 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34320 >Feature sequence0824 166 1041 gene locus_tag LOCUS_34330 166 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence0825 >Feature sequence0826 >Feature sequence0827 >Feature sequence0828 354 94 gene locus_tag LOCUS_34340 354 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence0829 >Feature sequence0830 624 172 gene locus_tag LOCUS_34350 gene moaE 624 172 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191688.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence0831 >Feature sequence0832 1073 603 gene locus_tag LOCUS_34360 gene rlmH 1073 603 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence0833 683 111 gene locus_tag LOCUS_34370 683 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34370 >Feature sequence0834 241 990 gene locus_tag LOCUS_34380 241 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 >Feature sequence0835 940 572 gene locus_tag LOCUS_34390 940 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence0836 >Feature sequence0837 395 51 gene locus_tag LOCUS_34400 395 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 968 771 gene locus_tag LOCUS_34410 968 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence0838 117 272 gene locus_tag LOCUS_34420 117 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence0839 >Feature sequence0840 146 367 gene locus_tag LOCUS_34430 146 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence0841 716 81 gene locus_tag LOCUS_34440 716 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34440 996 694 gene locus_tag LOCUS_34450 996 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence0842 630 779 gene locus_tag LOCUS_34460 630 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence0843 251 805 gene locus_tag LOCUS_34470 251 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 483 160 gene locus_tag LOCUS_34480 483 160 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_34480 722 474 gene locus_tag LOCUS_34490 722 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 >Feature sequence0847 886 467 gene locus_tag LOCUS_34500 886 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence0848 128 583 gene locus_tag LOCUS_34510 128 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 >Feature sequence0849 >Feature sequence0850 902 447 gene locus_tag LOCUS_34520 902 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence0851 >Feature sequence0852 860 207 gene locus_tag LOCUS_34530 gene tsaA 860 207 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence0853 >Feature sequence0854 787 110 gene locus_tag LOCUS_34540 787 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence0855 945 652 gene locus_tag LOCUS_34550 945 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34550 >Feature sequence0856 186 947 gene locus_tag LOCUS_34560 186 947 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074050.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence0857 688 71 gene locus_tag LOCUS_34570 688 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence0858 602 72 gene locus_tag LOCUS_34580 602 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34580 1030 599 gene locus_tag LOCUS_34590 1030 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34590 >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 >Feature sequence0862 >Feature sequence0863 117 1010 gene locus_tag LOCUS_34600 117 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence0864 618 10 gene locus_tag LOCUS_34610 618 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 902 615 gene locus_tag LOCUS_34620 902 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 >Feature sequence0865 >Feature sequence0866 >Feature sequence0867 898 116 gene locus_tag LOCUS_34630 898 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence0868 66 746 gene locus_tag LOCUS_34640 66 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence0869 >Feature sequence0870 >Feature sequence0871 719 198 gene locus_tag LOCUS_34650 719 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence0872 >Feature sequence0873 799 128 gene locus_tag LOCUS_34660 799 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence0874 174 743 gene locus_tag LOCUS_34670 174 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 754 945 gene locus_tag LOCUS_34680 754 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence0875 703 407 gene locus_tag LOCUS_34690 703 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence0876 707 114 gene locus_tag LOCUS_34700 707 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence0877 >Feature sequence0878 243 434 gene locus_tag LOCUS_34710 243 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence0879 560 910 gene locus_tag LOCUS_34720 560 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence0880 635 970 gene locus_tag LOCUS_34730 635 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 >Feature sequence0881 >Feature sequence0882 81 575 gene locus_tag LOCUS_34740 81 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34740 >Feature sequence0883 361 927 gene locus_tag LOCUS_34750 361 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 >Feature sequence0884 >Feature sequence0885 >Feature sequence0886 716 417 gene locus_tag LOCUS_34760 716 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence0887 219 578 gene locus_tag LOCUS_34770 219 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence0888 1001 756 gene locus_tag LOCUS_34780 1001 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence0889 96 923 gene locus_tag LOCUS_34790 96 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence0890 482 838 gene locus_tag LOCUS_34800 482 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence0891 >Feature sequence0892 >Feature sequence0893 93 272 gene locus_tag LOCUS_34810 93 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 <995 322 gene locus_tag LOCUS_34820 <995 322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257162.1:Crp/Fnr family transcriptional regulator >Feature sequence0894 <1 806 gene locus_tag LOCUS_34830 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943149.1:EAL domain-containing protein >Feature sequence0895 >Feature sequence0896 >Feature sequence0897 >Feature sequence0898 467 48 gene locus_tag LOCUS_34840 467 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 816 538 gene locus_tag LOCUS_34850 816 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 >Feature sequence0899 >Feature sequence0900 104 631 gene locus_tag LOCUS_34860 104 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence0901 378 61 gene locus_tag LOCUS_34870 378 61 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_34870 651 382 gene locus_tag LOCUS_34880 651 382 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942006.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence0902 <978 64 gene locus_tag LOCUS_34890 <978 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037261.1:IS1595-like element ISXca4 family transposase >Feature sequence0903 >Feature sequence0904 46 918 gene locus_tag LOCUS_34900 46 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence0905 >Feature sequence0906 >Feature sequence0907 >Feature sequence0908 833 366 gene locus_tag LOCUS_34910 833 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence0909 876 79 gene locus_tag LOCUS_34920 876 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence0910 494 613 gene locus_tag LOCUS_34930 494 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 629 877 gene locus_tag LOCUS_34940 629 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence0911 >Feature sequence0912 219 58 gene locus_tag LOCUS_34950 219 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 434 730 gene locus_tag LOCUS_34960 434 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence0913 484 71 gene locus_tag LOCUS_34970 484 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence0914 >Feature sequence0915 913 341 gene locus_tag LOCUS_34980 913 341 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence0916 434 99 gene locus_tag LOCUS_34990 434 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34990 796 422 gene locus_tag LOCUS_35000 796 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35000 >Feature sequence0917 >Feature sequence0918 756 400 gene locus_tag LOCUS_35010 756 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 >Feature sequence0919 173 598 gene locus_tag LOCUS_35020 173 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 493 909 gene locus_tag LOCUS_35030 493 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35030 >Feature sequence0920 273 97 gene locus_tag LOCUS_35040 273 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence0921 181 831 gene locus_tag LOCUS_35050 181 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 >Feature sequence0922 839 126 gene locus_tag LOCUS_35060 839 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 >Feature sequence0923 >Feature sequence0924 315 752 gene locus_tag LOCUS_35070 315 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence0925 <954 43 gene locus_tag LOCUS_35080 <954 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_188583328.1:IS5 family transposase >Feature sequence0926 >Feature sequence0927 >Feature sequence0928 >Feature sequence0929 424 921 gene locus_tag LOCUS_35090 424 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence0930 >Feature sequence0931 454 768 gene locus_tag LOCUS_35100 454 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence0932 <942 123 gene locus_tag LOCUS_35110 <942 123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c peroxidase >Feature sequence0933 800 174 gene locus_tag LOCUS_35120 gene istB 800 174 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35120 >Feature sequence0934 >Feature sequence0935 828 253 gene locus_tag LOCUS_35130 828 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 >Feature sequence0936 928 440 gene locus_tag LOCUS_35140 928 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence0937 >Feature sequence0938 <1 666 gene locus_tag LOCUS_35150 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039727.1:site-specific integrase 892 650 gene locus_tag LOCUS_35160 892 650 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_35160 >Feature sequence0939 >Feature sequence0940 >Feature sequence0941 >Feature sequence0942 823 641 gene locus_tag LOCUS_35170 823 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence0943 191 457 gene locus_tag LOCUS_35180 191 457 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 protein_id gnl|my_center|LOCUS_35180 >Feature sequence0944 531 121 gene locus_tag LOCUS_35190 531 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence0945 >Feature sequence0946 869 102 gene locus_tag LOCUS_35200 869 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence0947 >Feature sequence0948 699 19 gene locus_tag LOCUS_35210 699 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence0949 330 82 gene locus_tag LOCUS_35220 330 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 804 640 gene locus_tag LOCUS_35230 804 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence0950 814 605 gene locus_tag LOCUS_35240 814 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence0951 >Feature sequence0952 >Feature sequence0953 696 460 gene locus_tag LOCUS_35250 696 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence0954 >Feature sequence0955 >Feature sequence0956 815 546 gene locus_tag LOCUS_35260 815 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 251 751 gene locus_tag LOCUS_35270 251 751 CDS product arsenate reductase (azurin) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229170.1 protein_id gnl|my_center|LOCUS_35270 >Feature sequence0960 >Feature sequence0961 277 546 gene locus_tag LOCUS_35280 277 546 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_35280 546 824 gene locus_tag LOCUS_35290 546 824 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421273.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence0962 >Feature sequence0963 <898 151 gene locus_tag LOCUS_35300 <898 151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086016636.1:IS3 family transposase >Feature sequence0964 559 849 gene locus_tag LOCUS_35310 559 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence0965 >Feature sequence0966 698 237 gene locus_tag LOCUS_35320 gene greA 698 237 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence0967 <886 112 gene locus_tag LOCUS_35330 <886 112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_045861227.1:restriction endonuclease subunit S >Feature sequence0968 >Feature sequence0969 331 212 gene locus_tag LOCUS_35340 331 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 261 761 gene locus_tag LOCUS_35350 261 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence0976 668 117 gene locus_tag LOCUS_35360 668 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence0977 132 434 gene locus_tag LOCUS_35370 132 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 >Feature sequence0982 >Feature sequence0983 545 351 gene locus_tag LOCUS_35380 545 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 <1 812 gene locus_tag LOCUS_35390 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926902.1:restriction endonuclease subunit S >Feature sequence0987 >Feature sequence0988 >Feature sequence0989 326 715 gene locus_tag LOCUS_35400 326 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence0990 <859 118 gene locus_tag LOCUS_35410 <859 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933292.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0991 >Feature sequence0992 >Feature sequence0993 >Feature sequence0994 177 761 gene locus_tag LOCUS_35420 177 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence0995 454 17 gene locus_tag LOCUS_35430 454 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 >Feature sequence0996 >Feature sequence0997 108 575 gene locus_tag LOCUS_35440 108 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 >Feature sequence0998 >Feature sequence0999 207 602 gene locus_tag LOCUS_35450 207 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 >Feature sequence1000 672 61 gene locus_tag LOCUS_35460 672 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 >Feature sequence1001 >Feature sequence1002 520 194 gene locus_tag LOCUS_35470 520 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence1003 151 783 gene locus_tag LOCUS_35480 151 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence1004 698 324 gene locus_tag LOCUS_35490 698 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence1005 <1 709 gene locus_tag LOCUS_35500 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077244862.1:IS481 family transposase >Feature sequence1006 >Feature sequence1007 >Feature sequence1008 297 473 gene locus_tag LOCUS_35510 297 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 >Feature sequence1009 743 351 gene locus_tag LOCUS_35520 743 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 737 501 gene locus_tag LOCUS_35530 737 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence1017 353 189 gene locus_tag LOCUS_35540 353 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 637 353 gene locus_tag LOCUS_35550 637 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence1018 27 812 gene locus_tag LOCUS_35560 27 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence1019 780 415 gene locus_tag LOCUS_35570 gene tnpB 780 415 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312010.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence1020 <828 43 gene locus_tag LOCUS_35580 <828 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065824.1:type I restriction endonuclease >Feature sequence1021 >Feature sequence1022 232 588 gene locus_tag LOCUS_35590 232 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence1023 114 293 gene locus_tag LOCUS_35600 114 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 345 548 gene locus_tag LOCUS_35610 345 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 >Feature sequence1024 >Feature sequence1025 281 742 gene locus_tag LOCUS_35620 281 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 >Feature sequence1026 >Feature sequence1027 178 516 gene locus_tag LOCUS_35630 178 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence1028 <1 503 gene locus_tag LOCUS_35640 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071694.1:IS91-like element ISSod25 family transposase >Feature sequence1029 613 233 gene locus_tag LOCUS_35650 613 233 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703163.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence1030 >Feature sequence1031 762 154 gene locus_tag LOCUS_35660 762 154 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence1032 >Feature sequence1033 370 675 gene locus_tag LOCUS_35670 370 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence1034 512 162 gene locus_tag LOCUS_35680 512 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence1035 716 543 gene locus_tag LOCUS_35690 716 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence1036 453 181 gene locus_tag LOCUS_35700 453 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence1037 >Feature sequence1038 233 703 gene locus_tag LOCUS_35710 233 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 553 344 gene locus_tag LOCUS_35720 553 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence1044 31 243 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgggtgtggggaacac >Feature sequence1045 315 509 gene locus_tag LOCUS_35730 315 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence1046 488 697 gene locus_tag LOCUS_35740 488 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence1047 293 583 gene locus_tag LOCUS_35750 293 583 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162670.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence1048 >Feature sequence1049 >Feature sequence1050 >Feature sequence1051 426 157 gene locus_tag LOCUS_35760 426 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence1052 >Feature sequence1053 >Feature sequence1054 >Feature sequence1055 772 356 gene locus_tag LOCUS_35770 772 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 523 532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1056 >Feature sequence1057 >Feature sequence1058 592 170 gene locus_tag LOCUS_35780 592 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 >Feature sequence1059 683 375 gene locus_tag LOCUS_35790 683 375 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence1060 >Feature sequence1061 144 494 gene locus_tag LOCUS_35800 144 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence1062 >Feature sequence1063 611 315 gene locus_tag LOCUS_35810 611 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence1064 >Feature sequence1065 >Feature sequence1066 587 108 gene locus_tag LOCUS_35820 587 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence1067 >Feature sequence1068 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 >Feature sequence1072 >Feature sequence1073 >Feature sequence1074 606 145 gene locus_tag LOCUS_35830 606 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 >Feature sequence1075 74 211 gene locus_tag LOCUS_35840 74 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence1076 44 172 gene locus_tag LOCUS_35850 44 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1077 617 498 gene locus_tag LOCUS_35860 617 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 >Feature sequence1078 >Feature sequence1079 110 487 gene locus_tag LOCUS_35870 110 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 438 665 gene locus_tag LOCUS_35880 438 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence1080 >Feature sequence1081 <1 664 gene locus_tag LOCUS_35890 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703864.1:RNA-guided endonuclease TnpB family protein >Feature sequence1082 <1 587 gene locus_tag LOCUS_35900 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058064.1:type I restriction endonuclease subunit R >Feature sequence1083 216 554 gene locus_tag LOCUS_35910 216 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence1084 >Feature sequence1085 <1 681 gene locus_tag LOCUS_35920 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968951.1:EAL domain-containing protein >Feature sequence1086 <738 70 gene locus_tag LOCUS_35930 <738 70 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145723262.1:IS1380 family transposase >Feature sequence1087 432 133 gene locus_tag LOCUS_35940 432 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence1088 440 721 gene locus_tag LOCUS_35950 440 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35950 >Feature sequence1089 <1 578 gene locus_tag LOCUS_35960 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948274.1:recombinase family protein >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 >Feature sequence1094 >Feature sequence1095 >Feature sequence1096 >Feature sequence1097 >Feature sequence1098 >Feature sequence1099 >Feature sequence1100 458 467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1101 >Feature sequence1102 505 110 gene locus_tag LOCUS_35970 505 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence1103 142 441 gene locus_tag LOCUS_35980 142 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 472 642 gene locus_tag LOCUS_35990 472 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence1104 >Feature sequence1105 >Feature sequence1106 <718 50 gene locus_tag LOCUS_36000 <718 50 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000873771.1:DUF1566 domain-containing protein >Feature sequence1107 304 170 gene locus_tag LOCUS_36010 304 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence1108 <1 643 gene locus_tag LOCUS_36020 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_019237880.1:error-prone DNA polymerase >Feature sequence1109 567 130 gene locus_tag LOCUS_36030 567 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence1110 252 551 gene locus_tag LOCUS_36040 252 551 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence1111 535 386 gene locus_tag LOCUS_36050 535 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence1112 >Feature sequence1113 383 111 gene locus_tag LOCUS_36060 383 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence1114 >Feature sequence1115 >Feature sequence1116 192 503 gene locus_tag LOCUS_36070 192 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence1117 >Feature sequence1118 223 630 gene locus_tag LOCUS_36080 223 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence1119 122 460 gene locus_tag LOCUS_36090 122 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence1120 606 442 gene locus_tag LOCUS_36100 606 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence1121 >Feature sequence1122 >Feature sequence1123 <699 43 gene locus_tag LOCUS_36110 <699 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116616918.1:HipA domain-containing protein >Feature sequence1124 573 307 gene locus_tag LOCUS_36120 573 307 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_36120 >Feature sequence1125 320 12 gene locus_tag LOCUS_36130 320 12 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_36130 594 313 gene locus_tag LOCUS_36140 594 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence1126 >Feature sequence1127 250 522 gene locus_tag LOCUS_36150 250 522 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971166.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence1128 1 204 gene locus_tag LOCUS_36160 gene yefM 1 204 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 protein_id gnl|my_center|LOCUS_36160 201 455 gene locus_tag LOCUS_36170 gene yoeB 201 455 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence1129 142 570 gene locus_tag LOCUS_36180 142 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence1130 >Feature sequence1131 >Feature sequence1132 >Feature sequence1133 259 68 gene locus_tag LOCUS_36190 259 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 418 681 gene locus_tag LOCUS_36200 418 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence1134 243 434 gene locus_tag LOCUS_36210 243 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 425 501 gene locus_tag LOCUS_t00380 425 501 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 >Feature sequence1138 >Feature sequence1139 >Feature sequence1140 >Feature sequence1141 <672 12 gene locus_tag LOCUS_36220 <672 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103017457.1:sigma 54-interacting transcriptional regulator >Feature sequence1142 102 314 gene locus_tag LOCUS_36230 102 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence1143 312 599 gene locus_tag LOCUS_36240 312 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1144 >Feature sequence1145 >Feature sequence1146 195 446 gene locus_tag LOCUS_36250 195 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 665 486 gene locus_tag LOCUS_36260 665 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 >Feature sequence1150 >Feature sequence1151 290 550 gene locus_tag LOCUS_36270 290 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence1152 >Feature sequence1153 >Feature sequence1154 >Feature sequence1155 >Feature sequence1156 >Feature sequence1157 198 515 gene locus_tag LOCUS_36280 198 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence1158 >Feature sequence1159 >Feature sequence1160 >Feature sequence1161 >Feature sequence1162 453 136 gene locus_tag LOCUS_36290 453 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 >Feature sequence1163 283 38 gene locus_tag LOCUS_36300 283 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 452 243 gene locus_tag LOCUS_36310 452 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence1164 >Feature sequence1165 >Feature sequence1166 461 165 gene locus_tag LOCUS_36320 461 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence1167 546 394 gene locus_tag LOCUS_36330 546 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 255 557 gene locus_tag LOCUS_36340 gene cas2e 255 557 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_36340 >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 >Feature sequence1178 268 531 gene locus_tag LOCUS_36350 268 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 >Feature sequence1179 >Feature sequence1180 >Feature sequence1181 >Feature sequence1182 243 491 gene locus_tag LOCUS_36360 243 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence1183 >Feature sequence1184 524 69 gene locus_tag LOCUS_36370 524 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 >Feature sequence1185 33 304 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcccccgcacaagcggggatagacc >Feature sequence1186 >Feature sequence1187 90 290 gene locus_tag LOCUS_36380 90 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence1188 >Feature sequence1189 304 567 gene locus_tag LOCUS_36390 304 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence1190 >Feature sequence1191 >Feature sequence1192 >Feature sequence1193 247 465 gene locus_tag LOCUS_36400 247 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence1194 410 105 gene locus_tag LOCUS_36410 410 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence1195 291 300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1196 >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 22 525 gene locus_tag LOCUS_36420 22 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence1200 110 505 gene locus_tag LOCUS_36430 110 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence1201 >Feature sequence1202 >Feature sequence1203 >Feature sequence1204 >Feature sequence1205 >Feature sequence1206 129 545 gene locus_tag LOCUS_36440 129 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence1207 >Feature sequence1208 623 159 gene locus_tag LOCUS_36450 623 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 >Feature sequence1209 357 509 gene locus_tag LOCUS_36460 357 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence1210 >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 >Feature sequence1214 >Feature sequence1215 >Feature sequence1216 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 >Feature sequence1220 <1 500 gene locus_tag LOCUS_36470 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037261.1:IS1595-like element ISXca4 family transposase >Feature sequence1221 15 446 gene locus_tag LOCUS_36480 15 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 >Feature sequence1222 205 327 gene locus_tag LOCUS_36490 205 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence1223 <613 49 gene locus_tag LOCUS_36500 <613 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111221702.1:IS3 family transposase >Feature sequence1224 >Feature sequence1225 <613 80 gene locus_tag LOCUS_36510 <613 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128955176.1:IS21 family transposase >Feature sequence1226 382 131 gene locus_tag LOCUS_36520 382 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 >Feature sequence1227 399 16 gene locus_tag LOCUS_36530 399 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 >Feature sequence1228 >Feature sequence1229 >Feature sequence1230 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 488 117 gene locus_tag LOCUS_36540 488 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence1234 >Feature sequence1235 429 271 gene locus_tag LOCUS_36550 429 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence1236 >Feature sequence1237 >Feature sequence1238 >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 >Feature sequence1245 >Feature sequence1246 >Feature sequence1247 >Feature sequence1248 >Feature sequence1249 >Feature sequence1250 >Feature sequence1251 >Feature sequence1252 >Feature sequence1253 360 166 gene locus_tag LOCUS_36560 360 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1254 399 115 gene locus_tag LOCUS_36570 399 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 >Feature sequence1255 >Feature sequence1256 >Feature sequence1257 576 265 gene locus_tag LOCUS_36580 576 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence1258 >Feature sequence1259 >Feature sequence1260 >Feature sequence1261 >Feature sequence1262 >Feature sequence1263 >Feature sequence1264 >Feature sequence1265 >Feature sequence1266 95 502 gene locus_tag LOCUS_36590 95 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence1267 >Feature sequence1268 249 76 gene locus_tag LOCUS_36600 249 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence1269 >Feature sequence1270 >Feature sequence1271 141 488 gene locus_tag LOCUS_36610 141 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 >Feature sequence1275 >Feature sequence1276 201 323 gene locus_tag LOCUS_36620 201 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence1277 >Feature sequence1278 303 61 gene locus_tag LOCUS_36630 303 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 >Feature sequence1279 461 78 gene locus_tag LOCUS_36640 461 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 >Feature sequence1280 329 36 gene locus_tag LOCUS_36650 329 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence1281 >Feature sequence1282 476 330 gene locus_tag LOCUS_36660 476 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence1283 >Feature sequence1284 >Feature sequence1285 >Feature sequence1286 90 443 gene locus_tag LOCUS_36670 90 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence1287 471 28 gene locus_tag LOCUS_36680 471 28 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261212.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence1288 >Feature sequence1289 >Feature sequence1290 >Feature sequence1291 >Feature sequence1292 324 506 gene locus_tag LOCUS_36690 324 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 >Feature sequence1293 >Feature sequence1294 >Feature sequence1295 >Feature sequence1296 >Feature sequence1297 >Feature sequence1298 193 471 gene locus_tag LOCUS_36700 193 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence1299 >Feature sequence1300 >Feature sequence1301 >Feature sequence1302 >Feature sequence1303 163 456 gene locus_tag LOCUS_36710 163 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 >Feature sequence1304 >Feature sequence1305 207 437 gene locus_tag LOCUS_36720 207 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence1306 240 85 gene locus_tag LOCUS_36730 240 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 >Feature sequence1310 324 509 gene locus_tag LOCUS_36740 324 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 >Feature sequence1314 >Feature sequence1315 >Feature sequence1316 >Feature sequence1317 >Feature sequence1318 146 337 gene locus_tag LOCUS_36750 146 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 >Feature sequence1319 >Feature sequence1320 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 >Feature sequence1328 >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 >Feature sequence1333 145 366 gene locus_tag LOCUS_36760 145 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence1334 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 >Feature sequence1338 >Feature sequence1339 >Feature sequence1340 >Feature sequence1341 >Feature sequence1342 530 405 gene locus_tag LOCUS_36770 530 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1343 184 444 gene locus_tag LOCUS_36780 184 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence1344 >Feature sequence1345 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 280 155 gene locus_tag LOCUS_36790 280 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 >Feature sequence1349 >Feature sequence1350 >Feature sequence1351 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 >Feature sequence1355 >Feature sequence1356 >Feature sequence1357 259 2 gene locus_tag LOCUS_36800 259 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 >Feature sequence1358 391 80 gene locus_tag LOCUS_36810 391 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence1359 >Feature sequence1360 400 278 gene locus_tag LOCUS_36820 400 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 >Feature sequence1361 >Feature sequence1362 >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 >Feature sequence1366 >Feature sequence1367 >Feature sequence1368 1 144 gene locus_tag LOCUS_36830 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence1369 >Feature sequence1370 >Feature sequence1371 >Feature sequence1372 375 217 gene locus_tag LOCUS_36840 375 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence1373 423 256 gene locus_tag LOCUS_36850 423 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence1374 >Feature sequence1375 >Feature sequence1376 >Feature sequence1377 >Feature sequence1378 >Feature sequence1379 257 266 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1380 >Feature sequence1381 133 441 gene locus_tag LOCUS_36860 133 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 >Feature sequence1382 189 407 gene locus_tag LOCUS_36870 189 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence1383 361 161 gene locus_tag LOCUS_36880 361 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 >Feature sequence1389 >Feature sequence1390 >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 400 116 gene locus_tag LOCUS_36890 400 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 >Feature sequence1397 >Feature sequence1398 >Feature sequence1399 310 53 gene locus_tag LOCUS_36900 310 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 349 501 gene locus_tag LOCUS_36910 349 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence1400 460 98 gene locus_tag LOCUS_36920 460 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence1401 >Feature sequence1402 >Feature sequence1403 >Feature sequence1404 >Feature sequence1405 283 101 gene locus_tag LOCUS_36930 283 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence1406 >Feature sequence1407 >Feature sequence1408 328 194 gene locus_tag LOCUS_36940 328 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 >Feature sequence1409 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1410 >Feature sequence1411 >Feature sequence1412 >Feature sequence1413 >Feature sequence1414 >Feature sequence1415 >Feature sequence1416 322 501 gene locus_tag LOCUS_36950 322 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence1417 >Feature sequence1418 107 331 gene locus_tag LOCUS_36960 107 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 >Feature sequence1419 360 124 gene locus_tag LOCUS_36970 360 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970