COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..35694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..2129) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dxs CDS complement(2233..3153) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(3138..3383) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene xseB CDS 3690..4829 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4927..5838 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5899..6798 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7134..7442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 7439..9121 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 9123..9476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9742..10458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 10491..12647 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12722..14875 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930660.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(14931..16367) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267663.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(16502..17938) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(17953..21186) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(21215..22420) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(22699..23538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 23704..24618 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 24698..25000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 25153..25530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(25564..26547) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(26534..28027) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(28046..30616) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 30759..31217 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(31351..33126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(33319..35673) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene parC sequence002 source 1..32508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..718 product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene fixJ CDS 797..1645 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene folD CDS 1733..3199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 note possible pseudo, internal stop codon CDS 3209..3766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 note possible pseudo, internal stop codon CDS 3881..4537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(4589..4822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 note possible pseudo, frameshifted CDS 5315..6370 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(6428..6751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(6748..7143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(7211..7519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(7650..8765) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(8783..9820) product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene aphB tRNA complement(9937..10011) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(10050..10124) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(10166..10879) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene dnaQ CDS complement(10879..11217) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene fdx CDS complement(11251..13119) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene hscA CDS complement(13186..13704) product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene hscB CDS complement(13773..14096) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene iscA CDS complement(14102..14503) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene iscU CDS complement(14541..15761) product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(15866..16402) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene iscR CDS complement(16638..18656) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene uvrB CDS 18843..20039 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 20198..21976 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 note possible pseudo, internal stop codon, frameshifted CDS 21979..22857 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 22861..23298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(23362..24987) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(24984..26249) product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536181.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(26296..28218) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(28572..30296) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 misc_feature complement(30480..>32508) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065662.1:YgiQ family radical SAM protein locus_tag LOCUS_00560 sequence003 source 1..30800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(370..1332) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697938.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 1414..1806 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 tRNA complement(2084..2160) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(2214..3083) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene hrcA CDS 3247..4143 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 4146..5810 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene recN CDS 5814..6677 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815183.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene rapZ CDS complement(6787..7860) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene mutY CDS complement(7857..9752) product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(9933..10748) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene mutM CDS 10853..12577 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 12574..13089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 13099..13950 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene ispE tRNA 13992..14068 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 14116..15081 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 15235..15861 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 15996..16631 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene pth CDS complement(16695..16952) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 17128..18090 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 18087..18962 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 18959..19963 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966043.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 20038..20817 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 20916..22406 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 22510..23913 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(23980..24636) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 24766..25377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 25452..26138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(26128..26946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(27220..28101) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(28322..28744) product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(28748..29473) product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050480010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 misc_feature complement(29601..>30800) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807044.1:cardiolipin synthase ClsB locus_tag LOCUS_00860 sequence004 source 1..27713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..905) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063925.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(977..2353) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(2383..3531) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(3607..3786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(3816..4661) product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930787.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene hflC CDS complement(4731..5777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(6138..7262) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene hflX CDS complement(7380..7649) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene hfq CDS complement(7709..9052) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene der CDS complement(9072..10199) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene bamB CDS complement(10220..10897) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(10911..12200) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene hisS CDS complement(12298..13575) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene ispG CDS complement(13576..14544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(14537..15325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(15396..16520) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene rlmN CDS complement(16605..17030) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene ndk CDS complement(17107..18447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(18444..19148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(19299..20303) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(20318..21229) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(21241..22011) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(22011..22853) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene surE CDS 22930..23904 product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479781.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 23998..25521 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 25548..27140 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 sequence005 source 1..26539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..811 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097286.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 808..1527 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene queC CDS complement(1615..2961) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene argG CDS complement(3028..3345) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(3515..4183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(4297..4683) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 4731..6056 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene folC CDS 6071..6913 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015041541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 6954..7442 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 7520..9028 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene purF CDS 9159..10373 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 10370..11779 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532170.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene gltX tRNA 11845..11920 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 11941..12016 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 12063..12139 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 12148..12223 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 12255..12330 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 12386..12462 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(12582..12884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(13049..15352) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene metE CDS 15459..16349 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(16389..16643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(16693..17790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(17808..20261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(20758..21618) product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(21743..22924) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene prpF CDS complement(22964..25591) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene acnD misc_feature complement(25709..>26539) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065153.1:2-methylcitrate synthase locus_tag LOCUS_01340 sequence006 source 1..26243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197996.1:cytochrome c oxidase subunit I locus_tag LOCUS_01350 CDS 1053..1178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 1194..1814 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 1811..2020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 2079..2960 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(3138..3362) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200193.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 3378..4154 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 4096..4845 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 4851..6041 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 6038..6958 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene cyoE CDS 6968..7579 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 7726..9618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(9640..10422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(10671..11681) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(11807..12742) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195278.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene rpoH CDS 12932..13294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(13345..14493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 14523..15986 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 16002..17384 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 17435..18004 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene rsmD CDS 18148..18645 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene coaD CDS complement(18646..19746) product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186744778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(19836..20150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(20250..20795) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036245.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(20818..21210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(21266..21487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(21598..22941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 23095..23727 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(23844..24254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(24363..25127) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene moeB misc_feature complement(25194..>26243) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543824.1:S41 family peptidase locus_tag LOCUS_01650 sequence007 source 1..25837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1166..2941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(3005..3955) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene puuE CDS complement(3952..4629) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(4682..5596) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 5719..6816 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 6876..7853 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 7917..9233 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 9555..9905 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene uraH CDS complement(10092..10565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 10468..11292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 note possible pseudo, frameshifted CDS 11187..11552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 note possible pseudo, frameshifted CDS complement(11626..13083) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 13201..13893 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 14082..15287 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 15320..16603 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene guaD CDS 16694..17260 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene dcd CDS 17414..17662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 17741..18604 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 18720..20174 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(20268..20882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(20947..21495) product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(21492..22307) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(22328..23260) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(23235..24506) product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 misc_feature complement(24503..>25837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536481.1:NosR/NirI family protein locus_tag LOCUS_01900 sequence008 source 1..25681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3139..4158 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 4151..4819 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 4819..5196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 5201..6244 product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(6329..7135) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(7132..7731) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 7758..8309 product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 8443..8625 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene rpmF CDS 8748..9779 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821347.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene plsX CDS 9798..10775 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 10854..11786 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene fabD CDS 11783..12523 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 gene fabG CDS 12627..12866 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197638.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene acpP CDS 12925..14169 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028603047.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene fabF CDS 14261..14794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 14791..15426 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene rpoE CDS 15431..16090 product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(16240..16566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 16447..17181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 17321..18751 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 19193..21001 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene lepA CDS 21007..21984 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193513.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene lepB CDS 22012..22389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 22395..23081 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rnc CDS 23150..24091 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene era CDS 24345..25133 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene recO sequence009 source 1..24078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1305 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039235.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_02170 CDS 1377..2228 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene folP CDS 2241..3575 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene glmM CDS complement(3643..5865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(6155..6328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 6293..6934 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 7050..9221 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene ppk1 CDS 9218..9682 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene sixA CDS complement(9734..9991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(10234..11715) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene ppx CDS complement(11800..12903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(12965..13456) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 13702..14697 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199345.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene pstS CDS 14850..15788 product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene pstC CDS 15785..16666 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene pstA CDS 16689..17471 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene pstB CDS 17471..18187 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193271.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene phoU CDS 18204..18911 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene phoB CDS 18998..20395 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene phoR CDS complement(20340..21716) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(21716..23413) product UDP phosphate-alpha-4-amino-4-deoxy-L-arabinose arabinosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521317.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(23564..23818) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 sequence010 source 1..22903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 46..121 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(228..527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 656..1528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 1664..4417 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene secA CDS 4518..5747 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene argJ CDS 5802..6680 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 6677..7123 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(7192..7422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(7429..8184) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene zapD CDS 8074..8280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(8275..8898) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927124.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene coaE CDS complement(8900..9781) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(9781..10998) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(11019..12752) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene pilB tRNA complement(12992..13068) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(13090..14145) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 14243..14554 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene rplU CDS 14572..14829 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene rpmA CDS 14976..16049 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 gene obgE CDS 16123..17265 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene proB CDS complement(17312..18001) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194263.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 18122..19837 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 19858..20514 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219051.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(20600..21916) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368593.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(22095..22424) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene grxD sequence011 source 1..21811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 501..2366 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 2474..6616 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 tRNA 6722..6796 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(6827..7189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(7481..8884) product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(9217..9573) product glutaredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705616.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene arsC CDS complement(9642..11276) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 11520..12596 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(12640..13866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(13997..14704) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(14757..16052) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(16266..17228) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(17231..17764) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene pyrR CDS complement(17761..18180) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene ruvX CDS complement(18177..18776) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(18902..21811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 sequence012 source 1..21686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 118..194 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 199..274 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 306..381 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 439..515 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(573..1697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 2413..2694 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 3130..3660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 3731..5233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 5275..6111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 6150..6968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 6977..7711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 7729..7908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 7919..8980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 9094..10383 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 10402..12186 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 12187..13026 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136348290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 13048..13914 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 13921..14361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 14377..15150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 15203..15916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 16038..16337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 16337..16789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(16891..17649) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(17763..18791) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(18996..20858) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 21050..21403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 sequence013 source 1..19787 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1320 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082154.1:flagellar hook protein FlgE locus_tag LOCUS_02990 CDS 1347..2087 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene flgF CDS 2106..2888 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene flgG CDS 2912..3628 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 3629..4609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 4787..5911 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 5994..6938 product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene flgJ CDS 6965..8959 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene flgK CDS 8971..10233 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene flgL CDS 10322..11563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 11634..13040 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705197.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 13221..14699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(14749..16206) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 16351..16950 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 16947..17885 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 17949..19229 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275469.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 sequence014 source 1..19517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1091..2494 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539109.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(2730..3293) product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 3559..4053 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 4233..5429 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene pncB CDS 5494..6909 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527476.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 6989..7969 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 8045..9733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 9735..10922 product tetracycline efflux MFS transporter Tet(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene tet(B) CDS complement(10977..11840) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(11972..12367) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene crcB CDS complement(12410..13714) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(13730..14239) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(14279..15256) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 15460..16032 product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106702718.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(16078..17901) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927251.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 sequence015 source 1..19424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1015 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112542.1:thiolase locus_tag LOCUS_03300 CDS 1042..2199 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 2196..2618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(2695..3618) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 3674..5026 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(5034..6014) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523784.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(6366..7670) product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811716.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(7851..8768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(8798..9721) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 9841..10281 product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(10326..11252) product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194014.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cynR CDS 11401..12603 product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540534.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 12632..12928 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene catC CDS 12974..13897 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene catA CDS 13924..14916 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(15003..16415) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene ccoG CDS complement(16460..17074) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene petA CDS 17278..18630 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 sequence016 source 1..18616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(955..2268) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 2307..2885 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene orn CDS 3180..5045 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(5322..6557) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(6738..7226) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(7320..7712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(7790..8530) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 8699..10768 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 10779..11630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 note possible pseudo, internal stop codon CDS 11640..11909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 11894..13846 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 13932..17942 product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene cobN CDS 17956..18501 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 sequence017 source 1..18474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(31..115) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 135..2429 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene rnr CDS 2438..3226 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 3243..3956 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 3953..5227 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 5238..5627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 5746..6411 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810544.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rimP CDS 6481..7965 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene nusA CDS 7990..10821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 10834..11211 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199441.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rbfA CDS 11208..12209 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene truB CDS 12206..14035 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene typA CDS complement(14183..14389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 14289..15128 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 15125..16216 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(16167..17006) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(17037..17552) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(17569..17934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 sequence018 source 1..18401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..1452 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene cobT CDS 1730..2902 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene wecB CDS 2915..5140 product cyclic di-3',5'-guanylate-activated glycosyltransferase NrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene nrfB CDS 5154..7967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 8123..9856 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861073.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 9877..10704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764231.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(10742..11392) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene nth CDS 11497..12693 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(12705..13955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 14101..14574 product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(14607..15344) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene ytfE CDS 15439..15918 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(15947..16483) product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(16485..17201) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene serB CDS 17463..18290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 sequence019 source 1..16683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 275..1861 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 1865..2308 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 2305..3627 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 3617..4102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 4090..5391 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 5874..6704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(6965..7504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(7510..8040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(8104..9078) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene thiL CDS complement(9094..10218) product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(10208..11473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(11655..13637) product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(13634..14041) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene apaG CDS 14163..14843 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene rpe CDS complement(14883..15248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 15414..16139 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 sequence020 source 1..15812 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(18..740) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(797..1879) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(1876..2766) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(2763..3362) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404268.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene cobU CDS complement(3359..4717) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(4740..6620) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 6979..7218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 7215..7559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(8201..8920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(8924..10306) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene hemN CDS 10556..11221 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene fnr CDS complement(11263..11493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(11627..11926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(11967..13409) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene ccoG CDS complement(13494..14408) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene ccoP CDS complement(14438..14575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(14590..15222) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene ccoO misc_feature complement(15242..>15812) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216619.1:cytochrome-c oxidase, cbb3-type subunit I locus_tag LOCUS_04270 sequence021 source 1..15695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1202..3784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(3781..5466) product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 5576..6253 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 6250..7710 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 7718..8551 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(8590..9492) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 9582..9929 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298602.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 9934..10377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064705.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 10399..10821 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 10919..11542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(11547..12119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(12530..13150) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(13323..13904) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385638.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 14011..15285 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene fabF CDS 15346..15612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 note possible pseudo, frameshifted sequence022 source 1..15357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..2187) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 2416..8436 product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205468.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 8523..9641 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 9735..11030 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 11044..11946 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 12095..12916 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815929.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 12987..13862 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(13875..14090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 14235..14612 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 sequence023 source 1..14929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(470..1528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 note possible pseudo, internal stop codon CDS complement(1538..2455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 note possible pseudo, internal stop codon CDS 2801..3916 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199345.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene pstS CDS complement(3938..5029) product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene apbC CDS complement(5108..6178) product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(6175..7245) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene selD CDS 7302..8423 product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene mnmH CDS 8578..9159 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928921.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 9188..10420 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 10480..12546 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene metG CDS 12630..12872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(12921..13952) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 sequence024 source 1..14713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(130..1047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 1220..1564 product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(1663..2223) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(2368..3369) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene gap CDS complement(3423..5459) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene tkt CDS 5623..6438 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(6462..7301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 7368..8759 product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 8843..10279 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene pyk CDS 10433..11497 product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene fba CDS 11712..12827 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 12861..13571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 13620..13949 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 sequence025 source 1..14674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1619 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205731.1:serine/threonine-protein kinase locus_tag LOCUS_04770 CDS 1732..2202 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene rplM CDS 2213..2605 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene rpsI CDS 2746..3462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 3516..3914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 3975..4349 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene erpA CDS complement(4412..5533) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(5546..6910) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 7134..8336 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194043.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene tyrS CDS complement(8407..8835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(9087..10097) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 10321..10689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 10881..12311 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene glmU CDS 12316..13086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(13121..13462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(13465..14460) product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 sequence026 source 1..14417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1074 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096931.1:sodium-dependent inorganic phosphate transporter locus_tag LOCUS_04930 CDS complement(1075..2043) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(2265..3086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(3083..4069) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 4235..5104 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(5124..7808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(7805..8908) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(9015..9845) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065068.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(10521..12032) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(12049..12537) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124220547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 misc_feature complement(12839..>14417) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130432088.1:GspE/PulE family protein locus_tag LOCUS_05030 sequence027 source 1..13880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1677) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(1679..2662) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(2812..4392) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(4648..5841) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(6174..7205) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930034.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 7655..8134 product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene coq7 CDS complement(8151..8600) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 8924..10486 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene ilvA CDS 10553..11365 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718969.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 11362..11973 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene cobC CDS complement(12030..12479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 12503..12982 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene gspG CDS 13166..13552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 sequence028 source 1..13626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039572.1:tripartite tricarboxylate transporter substrate binding protein locus_tag LOCUS_05170 CDS 649..1635 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 1679..3016 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene gudD CDS 3104..3535 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 3586..4338 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene aat CDS 4335..5075 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192823.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(5147..5560) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(5597..6298) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 6416..7354 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 7451..8554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 8551..9522 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene gluQRS CDS 9492..10274 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene trmB CDS 10295..11299 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 misc_feature complement(11447..>13626) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase locus_tag LOCUS_05300 sequence029 source 1..13603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 297..869 product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(939..1475) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 1607..2524 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 2650..3492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(3663..4436) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 4696..5883 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810076.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 6016..7923 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930654.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 7920..8678 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810082.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 8738..9454 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(9485..10402) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 10511..11320 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(11450..13183) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205414.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 note possible pseudo, frameshifted sequence030 source 1..13552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(653..985) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene trxA CDS 1170..3671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 3664..6969 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040290.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 7073..7768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 7785..9125 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(9210..9845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(10258..10536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 10774..12813 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 12843..13175 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 sequence031 source 1..13477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..993 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189741.1:ABC transporter ATP-binding protein/permease locus_tag LOCUS_05530 CDS 1048..1362 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(1476..2507) product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(2541..3839) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812401.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(3836..4426) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 4654..5592 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 5774..6664 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064670.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 6787..7686 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531996.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 7807..8559 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 8561..9232 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 9255..9992 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(10260..11312) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 11425..11856 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(11882..12517) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 misc_feature complement(12635..>13477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927717.1:HAD-IIB family hydrolase locus_tag LOCUS_05670 sequence032 source 1..13423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1303..1509) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(1572..2600) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(2615..3553) product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(3600..4040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(4110..5492) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene radA CDS 5602..5784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 5932..6546 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(6655..7674) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(7911..8744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(8753..9850) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene alr CDS 9991..11268 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene lplT CDS 11420..12361 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 12358..12843 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 sequence033 source 1..13418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..1883) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene arsA CDS 1997..2320 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 2343..2828 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 2846..3343 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 3345..4427 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene arsB CDS 4444..5610 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905835.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(5657..6574) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 6788..8485 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819848.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(8655..10187) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene gshA CDS complement(10360..11271) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 misc_feature complement(11477..>13418) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113639.1:DNA ligase D locus_tag LOCUS_05910 sequence034 source 1..13349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1486..1680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(1921..3882) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene acs CDS 4171..4695 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 4711..6249 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 6393..7409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(7496..8416) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(8442..9851) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene pmbA CDS 9977..10609 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene yjgA CDS 10602..11210 product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene mog CDS 11239..12885 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 sequence035 source 1..13339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1740..2585) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(2747..3139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(3136..4341) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(4355..4588) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(4585..5205) product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene fdh3B CDS complement(5216..8185) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(8207..8419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(8593..9231) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812672.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(9228..11291) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(11251..11934) product DUF3306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119012887.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(11927..12472) product DUF3305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 misc_feature complement(12530..>13339) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085105.1:formate dehydrogenase subunit alpha locus_tag LOCUS_06130 sequence036 source 1..13307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 213..1499 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene eno CDS 1526..1810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 1807..2271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(2364..3371) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene hslO CDS complement(3383..3883) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 3957..4763 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(4811..5002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 4980..6182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 6233..7528 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(7579..8556) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(8636..9547) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene xerD CDS complement(9604..10566) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 10719..11636 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(11691..12776) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene queG CDS 12759..13133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 sequence037 source 1..13083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2622..3089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(3126..3443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(3546..4529) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(4510..6687) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(6702..7184) product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(7224..7646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(7667..9049) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 9197..9526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 9526..10197 product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene feuP CDS 10194..11576 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 11624..12340 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 12337..12837 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 sequence038 source 1..12699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191786.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB locus_tag LOCUS_06420 CDS complement(751..1236) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(1271..1717) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(1741..2193) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(2248..2601) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 2690..3358 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803750.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 3355..4137 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 4459..5130 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene ribB CDS complement(5138..5740) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(5748..6356) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 6451..7353 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 7459..7791 product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene emrE CDS 7892..8425 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(8546..9613) product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 9709..10608 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(10857..12173) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(12186..12488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 sequence039 source 1..12627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..1883 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 1959..2519 product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189415.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(2928..3770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 3899..5053 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene moaA CDS 5114..5749 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene mobA CDS 5776..7134 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 7217..7552 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(7579..8025) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rnhA CDS complement(8064..8843) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 8842..9621 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927090.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene gloB CDS 9618..11132 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(11139..11327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 sequence040 source 1..12562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..591) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524510.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 826..1137 product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 1138..1854 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene lipB CDS 1868..2848 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene lipA CDS complement(2920..4329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 note possible pseudo, internal stop codon, frameshifted CDS complement(4339..4689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 note possible pseudo, internal stop codon CDS complement(4708..4977) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(4946..5395) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(5392..6630) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(6627..7190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 7444..7947 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(8043..8504) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 8685..9353 product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 9396..9911 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(10055..10561) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(10676..10945) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene rpsQ CDS complement(10955..11152) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene rpmC CDS complement(11165..11581) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rplP CDS complement(11584..12450) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rpsC sequence041 source 1..12493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1008..1331) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(1434..2822) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(2822..3754) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene cysD CDS complement(3816..4457) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(4454..4849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(4875..6665) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(6819..8738) product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene mnmC CDS complement(8775..9440) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(9661..9933) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 10072..11091 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 11293..11991 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 sequence042 source 1..12335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(308..529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 585..1544 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene ylqF CDS complement(1588..2061) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(2147..4141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(4321..4530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(4585..5154) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(5379..6137) product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene truC CDS complement(6182..6469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(6582..6845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 6990..7937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(7997..8401) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 8952..9803 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene rarD CDS 9892..10566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(10628..11668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 misc_feature complement(11771..>12335) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114324.1:pseudouridine synthase locus_tag LOCUS_07160 sequence043 source 1..12152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(452..1054) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(1072..1299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(1313..2155) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 2264..2923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(3218..3484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 3380..4282 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(4243..4677) product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 4676..5116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(5183..5986) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 6101..6796 product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 6824..7477 product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 7553..8764 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene pcaF CDS 8792..9592 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene pcaD CDS 9681..10673 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(10796..12151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 sequence044 source 1..12086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(559..1098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 1212..1628 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene fur CDS complement(1642..2598) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene hprK CDS complement(2620..3087) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene ptsN CDS complement(3221..3574) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene raiA CDS complement(3593..3967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 3951..4871 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(4925..7033) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(7247..8089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(8113..9021) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene trxA CDS 9205..9786 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 9922..10263 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 10335..10832 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene purE CDS 10829..12004 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 sequence045 source 1..11886 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1160..1564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 1568..2653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(2800..4206) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(4203..5441) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 5509..6312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(6423..7328) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(7363..8289) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(8338..8802) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(8799..9815) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192815.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(9903..10310) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(10383..11174) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 11390..11857 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 sequence046 source 1..11821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(494..1120) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974529.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 1008..1265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(1447..3318) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene ggt CDS 3603..8447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 8483..9616 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(9699..10667) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 10838..11632 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193115.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 sequence047 source 1..11638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2219..2854 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 3023..4852 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(4853..6022) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 6166..6612 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(6677..7900) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene chrA CDS complement(8035..8907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810430.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(9321..11408) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 sequence048 source 1..11568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(953..1672) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(1875..2642) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(2665..4185) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 4262..6295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(6327..7256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(7259..8071) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(8083..8280) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene thiS CDS complement(8277..9401) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 9694..10545 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene thiD CDS complement(10611..11087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(11346..11567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 sequence049 source 1..11482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..3100 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 3194..4123 product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195270.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene ybiB CDS 4120..4932 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198742.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene cobA CDS complement(4937..5437) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 5632..6798 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 6860..8110 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 8213..9418 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 9489..9788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(9856..10413) product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene sufT CDS complement(10410..10889) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(10886..11482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 sequence050 source 1..11285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1445) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088482926.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 1657..2661 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199459.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene dusA CDS complement(2651..5290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 5525..6595 product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 6765..8072 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185678.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene phaZ note possible pseudo, internal stop codon CDS 8081..8719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(8802..10304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 sequence051 source 1..11244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(635..1915) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene ftsW CDS complement(1912..3810) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene murD CDS complement(3807..4985) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene mraY CDS complement(4976..6424) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene murF CDS complement(6421..7926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(7923..9671) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(9668..9970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(10077..11003) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene rsmH sequence052 source 1..11053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1097) product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene hpnD CDS 1248..2135 product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 2141..3307 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(3393..4283) product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene hpnC CDS 4371..5624 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392398.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 5636..8785 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 tRNA 8875..8961 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 9040..10350 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521257.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene tig sequence053 source 1..11029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..1468 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 1556..2494 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(2716..3390) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(3425..4564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(4750..6249) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene dacB CDS 6282..6992 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene tsaB CDS 6989..7465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 note possible pseudo, frameshifted CDS 7462..8238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 8433..8927 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 8968..10815 product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 sequence054 source 1..10954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(300..1169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 note possible pseudo, frameshifted CDS complement(1100..1426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(1440..4964) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene smc CDS complement(5139..5471) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(5507..8650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 8823..10691 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 sequence055 source 1..10944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 588..1934 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 1986..3233 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 3266..4792 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 4970..5143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(5211..5891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(5888..6898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(6914..7723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(7833..8291) product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene cadR CDS 8332..10353 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 10350..10769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 sequence056 source 1..10924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 17..499 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036585.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene bfr CDS complement(510..938) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(1093..2949) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene ilvD CDS 2840..3061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 3179..4873 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene ilvD CDS complement(5006..5248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 5327..5662 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192706.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(5750..6259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(6610..8607) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene acs CDS 8813..9424 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 sequence057 source 1..10832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 644..1957 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene ugpB CDS 2088..2969 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene ugpA CDS 2972..3820 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene ugpE CDS 3884..4891 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930289.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 4917..5666 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene ugpQ CDS 5765..8287 product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(8360..9253) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(9264..10325) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 sequence058 source 1..10818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..1559 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 1801..2187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(2263..2751) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 2854..4026 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene tgt CDS 4106..4855 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267639.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(4852..6012) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155710829.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(6091..6891) product DUF2145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038687.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(6894..7379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(7376..7921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(7987..8496) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184509.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 8601..9653 product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 misc_feature complement(9693..>10818) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009937746.1:MFS transporter locus_tag LOCUS_08710 sequence059 source 1..10765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189458.1:recombinase RecA locus_tag LOCUS_08720 CDS 796..1251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 note possible pseudo, internal stop codon, frameshifted CDS complement(1485..3839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(3923..4876) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene secF CDS complement(4891..6789) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809414.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene secD CDS complement(6884..7213) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene yajC CDS 7095..7433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 7608..8738 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(8822..10759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 sequence060 source 1..10719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..782 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189444.1:glycine--tRNA ligase subunit alpha locus_tag LOCUS_08810 CDS 813..2975 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene glyS CDS 3060..3635 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene gmhB CDS 3713..4462 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 4464..5384 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064980.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 5414..5863 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(5956..6444) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene lysM CDS 6600..7376 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(7398..8060) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(8153..8626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 8809..9876 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene rfbB sequence061 source 1..10646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 558..2453 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(2698..6426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 note possible pseudo, internal stop codon, frameshifted CDS complement(6652..7590) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(7587..8135) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804574.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(8196..9749) product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 sequence062 source 1..10452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(507..839) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene yajC CDS complement(956..1456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1473..3614) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(3772..7338) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 tRNA 5378..5464 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 7515..8021 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 misc_feature complement(8210..>10452) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein locus_tag LOCUS_09020 sequence063 source 1..10337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(895..2118) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene fabB CDS complement(2115..2639) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene fabA CDS complement(2822..4288) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene lnt note possible pseudo, frameshifted CDS complement(4417..5298) product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(5404..6138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(6350..6832) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202739.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 6989..7921 product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033424.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 7921..8874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 9180..10325 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene hppD sequence064 source 1..10267 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 468..1571 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1640..2626) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(2671..3033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(3043..4395) product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 4492..5424 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 5553..6440 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(6558..7385) product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(7466..8641) product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 misc_feature complement(8963..>10267) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192088.1:dipeptide ABC transporter ATP-binding protein locus_tag LOCUS_09200 sequence065 source 1..10254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..594 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112452.1:DedA family protein/thiosulfate sulfurtransferase GlpE locus_tag LOCUS_09210 CDS complement(665..832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(852..1949) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(2057..3010) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(3147..5600) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(5597..6655) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene hemH CDS 6695..7387 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(7400..10138) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 sequence066 source 1..10119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 661..1245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1255..1902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(1899..2855) product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 2901..3953 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(4140..4490) product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 4623..5594 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(5858..6376) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(6373..7968) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522151.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene pcnB CDS complement(7965..8666) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(8717..9409) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene hda sequence067 source 1..10088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 597..893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 1084..1734 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1823..2473) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(2473..4623) product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(4623..5438) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(5435..9487) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 sequence068 source 1..10047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(461..988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(1022..1615) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1678..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(2395..3420) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403775.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 3636..4184 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 4181..4702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 4711..5991 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 6036..7046 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401457.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 7205..9022 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene edd CDS 9013..9660 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 sequence069 source 1..9973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1153 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191649.1:single-stranded-DNA-specific exonuclease RecJ locus_tag LOCUS_09550 CDS 1248..1928 product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 1925..2302 product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 2299..2973 product DUF799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(3082..4836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 5050..5928 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 5944..6579 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(6704..8773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(8776..9579) product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene nirQ sequence070 source 1..9826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807265.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_09640 CDS 872..1948 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 2025..3350 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 3547..4356 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 4449..5696 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 5888..6877 product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 7043..8080 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815063.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(8118..8441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(8462..9766) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 sequence071 source 1..9824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..738) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene yihA CDS 889..1527 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(1632..1829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1753..3849 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527907.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 3846..5180 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene ccsB CDS 5272..6270 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene msrP CDS 6270..6929 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene msrQ CDS complement(6997..7833) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(7898..9193) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene lysA CDS 9412..9741 product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene cyaY sequence072 source 1..9779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..980 product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 980..1387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1572..3653 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 3709..4722 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 4725..6062 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116611749.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(6092..8317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 misc_feature complement(8375..>9779) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814257.1:energy-dependent translational throttle protein EttA locus_tag LOCUS_09890 sequence073 source 1..9743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..1272) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(1281..1808) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(1827..2414) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(2496..3014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 3306..4682 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene cysS CDS 4728..5387 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 5436..6413 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 6559..8412 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525719.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 8505..9512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 sequence074 source 1..9725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..921 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064491.1:aminomethyl-transferring glycine dehydrogenase locus_tag LOCUS_09990 CDS 992..1393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 1469..3631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 3720..4355 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722188.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 4387..5169 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 5279..6463 product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 6608..7600 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(7696..8136) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(8231..8983) product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(9119..9631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence075 source 1..9684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2582..2995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 3032..3400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 3492..4442 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 4593..5420 product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(5687..7837) product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(8019..8660) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(8720..9295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 sequence076 source 1..9529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..684 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259342.1:deoxyribodipyrimidine photo-lyase locus_tag LOCUS_10160 tRNA 798..887 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 1351..3408 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704434.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(3589..4389) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene fabI CDS 4530..6353 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 6361..7398 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 7402..8499 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 sequence077 source 1..9501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 2024..3469 product efflux RND transporter outer membrane subunit OprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene oprB CDS 3590..4129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(4209..4748) product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142820828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(4788..5768) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(5865..6314) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 6459..7064 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 7086..7994 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 8020..8571 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275436.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(8620..9132) product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene pdeM sequence078 source 1..9392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(561..1547) product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1626..2252) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(2429..2812) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene rplS CDS complement(2926..3693) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene trmD CDS complement(3712..4311) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene rimM CDS complement(4374..4625) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189402.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rpsP CDS 4753..5274 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 5297..5743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(5881..6891) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(6951..7598) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(7771..8133) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(8253..8981) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 sequence079 source 1..9345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..953 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1015..1431 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1562..2320 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 2364..3803 product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 3839..4879 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(4886..5422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(5584..6015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(6405..7397) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 misc_feature complement(7601..>9345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208203.1:molecular chaperone HtpG locus_tag LOCUS_10520 sequence080 source 1..9303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1156 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810577.1:transcription termination factor Rho locus_tag LOCUS_10530 CDS 1495..2847 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 note possible pseudo, internal stop codon CDS 2868..3938 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 3963..6773 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene rbbA CDS 6777..7925 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188525.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 8012..8959 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 sequence081 source 1..9293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1965..2891 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene trxB CDS 3124..3357 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene rpmB CDS 3378..3548 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613503.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene rpmG CDS complement(3684..4895) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(5028..6305) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(6349..8256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 8271..8519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 8728..9285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 sequence082 source 1..9223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188178.1:aspartate-semialdehyde dehydrogenase locus_tag LOCUS_10670 CDS 1313..3292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 3446..3970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 4047..4865 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene truA CDS 4862..5605 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528978.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 5606..6874 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene trpB CDS 6871..7680 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene trpA CDS 7741..8613 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene accD misc_feature complement(8693..>9223) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194943.1:YggT family protein locus_tag LOCUS_10750 sequence083 source 1..9220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1052..1429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1816..2184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 2184..2924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 3160..4347 product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene rlmI CDS 4455..5564 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 5762..6433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 6487..8295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS 8389..8934 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818422.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene hslV sequence084 source 1..9219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 436..1389 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene ttcA CDS 1455..2069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 2097..2561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 2584..3228 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 3212..4393 product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 4574..6367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(6372..7433) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ruvB CDS 7604..8656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 misc_feature complement(8676..>9219) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194029.1:Holliday junction branch migration protein RuvA locus_tag LOCUS_10940 sequence085 source 1..9190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 note possible pseudo, internal stop codon CDS 519..1376 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS 1373..2146 product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 2274..3152 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene htpX CDS 3247..3609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(3623..4561) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 4694..6811 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 6954..8153 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 sequence086 source 1..9177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(910..2670) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(2853..4157) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene hemL CDS complement(4141..5088) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 5514..5807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 5807..6172 product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene pilH CDS 6189..6716 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 6738..9011 product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene pilJ sequence087 source 1..9078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1870..2976 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 3101..4306 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 4407..5507 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 5592..5849 product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(5928..7073) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 7121..7819 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(7889..8443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(8559..8729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 sequence088 source 1..9012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2115 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939885.1:PAS domain S-box protein locus_tag LOCUS_11190 CDS 2170..2883 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(2884..3771) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(3768..4901) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene queA CDS complement(4972..6231) product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 6383..8461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 sequence089 source 1..8942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(761..1366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1493..2125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 2438..3415 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(3485..4837) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 5007..7661 product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(7732..8376) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 sequence090 source 1..8909 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1713..2333) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(2512..3795) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(3819..4895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(4885..5703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(5706..6638) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene hemC sequence091 source 1..8797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 27..111 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 292..376 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 493..867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(925..1707) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1738..2367) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene rnhB CDS complement(2342..3499) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063750.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene lpxB CDS complement(3515..4306) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene lpxA CDS complement(4324..4761) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene fabZ CDS complement(4780..5754) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene lpxD CDS complement(5785..6306) product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(6306..8603) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene bamA sequence092 source 1..8526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1171..3837) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189243.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene gyrA CDS 4031..4687 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 4767..5480 product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ubiG CDS 5477..6154 product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene gph tmRNA 6168..6546 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(6894..7577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 note possible pseudo, frameshifted CDS complement(8007..8273) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143006761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 sequence093 source 1..8490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1283 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036209.1:DUF3488 and transglutaminase-like domain-containing protein locus_tag LOCUS_11510 CDS 1280..2344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(2453..3766) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(3831..4700) product DUF2242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267162.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 4892..5290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(5543..6748) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(6748..7518) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 misc_feature complement(7515..>8490) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924854.1:efflux RND transporter periplasmic adaptor subunit locus_tag LOCUS_11580 sequence094 source 1..8458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130566822.1:right-handed parallel beta-helix repeat-containing protein locus_tag LOCUS_11590 CDS 617..1519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1596..2330 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene rph CDS 2376..2993 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene rdgB CDS 3086..4321 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene hemW CDS complement(4402..4788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(4824..5291) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(5310..5894) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038763.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(5904..6512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(6864..7784) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 misc_feature complement(7937..>8458) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082850.1:YdeI/OmpD-associated family protein locus_tag LOCUS_11690 sequence095 source 1..8425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..989 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890091.1:AAA family ATPase locus_tag LOCUS_11700 tRNA complement(1267..1343) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1368..1757) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rplQ CDS complement(1847..2839) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene rpoA CDS complement(2950..3573) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene rpsD CDS complement(3662..4066) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197937.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene rpsK CDS complement(4084..4449) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene rpsM CDS complement(4731..6050) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene secY CDS complement(6074..6505) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene rplO CDS complement(6516..6698) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rpmD CDS complement(6713..7234) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene rpsE CDS complement(7250..7615) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene rplR CDS complement(7627..8160) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene rplF sequence096 source 1..8379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521351.1:30S ribosomal protein S12 methylthiotransferase RimO locus_tag LOCUS_11820 CDS complement(883..1242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1371..1676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1851..2753) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 2865..3836 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 3874..5082 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 5179..6180 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(6225..6683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(6848..7807) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 sequence097 source 1..8359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..1319 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692754.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene yahK CDS complement(1316..1585) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene infA CDS 2090..5503 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 5547..6380 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 6377..6976 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 6973..8121 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 sequence098 source 1..8308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 283..948 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 945..1253 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene nuoK CDS 1287..3302 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene nuoL CDS 3316..4791 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 4816..6309 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene nuoN CDS 6328..6651 product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 6664..7125 product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(7187..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 sequence099 source 1..8286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..503 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein locus_tag LOCUS_12050 CDS 734..1348 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925700.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1374..1538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1548..2486 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 2500..3786 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(3920..4651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 4905..6371 product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(6445..7602) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 7826..8248 product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 sequence100 source 1..8262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 667..1623 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1810..2973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(3029..3436) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene rnk CDS 3714..4871 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 4927..5226 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(5418..6290) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene fghA CDS complement(6397..7512) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(7550..7816) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 sequence101 source 1..8260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(337..1233) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1260..2597) product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205250.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(2675..3568) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084360451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene prmA CDS complement(3653..4987) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene accC CDS complement(5116..5580) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene accB CDS complement(5691..6278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(6275..6886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 sequence102 source 1..8244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 817..1275 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1272..1556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1553..2206 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 2706..4349 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 4588..5592 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200851.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 5690..5902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(5989..7113) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(7248..8243) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 sequence103 source 1..8212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(506..2071) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene murJ CDS 2176..2478 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene rpsT CDS complement(2656..2970) product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189028.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 3205..4401 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 4418..5335 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene argF CDS 5356..5529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 5673..6023 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(6155..6352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 misc_feature complement(6377..>8212) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037005.1:ferrous iron transporter B locus_tag LOCUS_12460 sequence104 source 1..8177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 537..2108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 note possible pseudo, internal stop codon, frameshifted CDS complement(2177..3535) product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970800.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(3532..4212) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 4357..5058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 5222..6874 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(6938..7519) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 misc_feature complement(7537..>8177) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766709.1:DTW domain-containing protein locus_tag LOCUS_12530 sequence105 source 1..8175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(359..1297) product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212189.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene ygiD CDS 1536..2246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 2355..2831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(2850..5390) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 5505..6098 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 6210..7622 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 7779..7982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 sequence106 source 1..8161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1917 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189879.1:FAD/FMN-binding oxidoreductase locus_tag LOCUS_12620 CDS 1914..2405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 2569..2985 product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 3110..3841 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene ubiE CDS 3880..4884 product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 5016..5543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 5540..7105 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene ubiB sequence107 source 1..8102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(398..1507) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene lptG CDS complement(1504..2595) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene lptF CDS 2619..4109 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 4135..4575 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 4572..5000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 5140..6267 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(6352..7359) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 sequence108 source 1..7944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..878) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 986..1732 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1732..2370 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2374..3306) product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(3486..3992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(4141..4719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(4796..5011) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020686626.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(5256..5861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(5951..6928) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(6928..7770) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(7773..7943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 sequence109 source 1..7918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(437..1663) product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(1891..2562) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(2559..4475) product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(4646..7087) product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 sequence110 source 1..7856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..1192) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1230..2204) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(2201..3421) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 3542..4441 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 4438..5550 product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene earP CDS 5717..6271 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene efp CDS complement(6387..6854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 misc_feature complement(6993..>7856) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814040.1:cation acetate symporter locus_tag LOCUS_12980 sequence111 source 1..7827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 755..1216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 1280..2443 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(2576..3085) product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(3212..3961) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(4013..4201) product 2-hydroxymuconate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870292.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4225..4461) product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(4568..6823) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 sequence112 source 1..7809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..521 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198600.1:NAD+ synthase locus_tag LOCUS_13070 CDS 590..928 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(979..1572) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1565..1966) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(2063..2623) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(2654..3478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(3492..3953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(3950..4516) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 4803..6599 product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 6740..7231 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene ilvN sequence113 source 1..7804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2419..4683) product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene pilJ CDS complement(4705..5232) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(5249..5614) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene pilH CDS complement(5626..6018) product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene pilG CDS 6377..7282 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 sequence114 source 1..7718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..870) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 930..2051 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(2088..4049) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810990.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(4046..4666) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(4794..5909) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 6342..7394 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(7487..7717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 sequence115 source 1..7694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1962 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein locus_tag LOCUS_13290 CDS complement(1998..4385) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene xdhB CDS complement(4382..5905) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene xdhA CDS 6086..7687 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184304236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 sequence116 source 1..7654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098025.1:transcriptional regulator TctD locus_tag LOCUS_13330 CDS 779..2182 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 2223..2648 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(2776..3078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(3215..4672) product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 4789..5205 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188904829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 5202..6362 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene prpC sequence117 source 1..7604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(468..797) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene flhD CDS complement(1101..1577) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene bfr CDS 1815..2378 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008501015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene ahpC CDS 2483..4039 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene ahpF CDS complement(4140..4970) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 5194..7584 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193522.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene ppsA sequence118 source 1..7590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..1219) product DNA-binding transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene hexR CDS complement(1213..2688) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene zwf CDS 2883..3833 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene tal CDS 3830..5446 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932668.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene pgi CDS complement(5477..6643) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 misc_feature complement(6914..>7590) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214867.1:chaperonin GroEL locus_tag LOCUS_13510 sequence119 source 1..7565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(746..2209) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(2292..3479) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809346.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(3560..5584) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537232.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(5841..6425) product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene metW misc_feature complement(6422..>7565) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198305.1:homoserine O-acetyltransferase locus_tag LOCUS_13560 sequence120 source 1..7528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 note possible pseudo, frameshifted CDS complement(573..980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1339..1755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1922..2908 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 2941..4419 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 4416..5525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 5902..7212 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040091.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 sequence121 source 1..7480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..583) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 687..1349 product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810518.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene kynB CDS 1423..2736 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene kynU CDS 2739..3608 product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene kynA CDS complement(3717..6161) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(6285..7337) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 sequence122 source 1..7427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 449..1231 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337285.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1249..1842 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1879..2463 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 2460..3944 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390270.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 3941..5110 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene pcaF CDS 5113..5811 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(5995..7182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 sequence123 source 1..7420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..476) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(517..1014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1484..2215 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930986.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 2264..2737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 2869..3237 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(3205..4674) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 4882..5385 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene moaC CDS complement(5410..6888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(6934..7413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 sequence124 source 1..7410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1432) product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene gspE CDS complement(1444..3669) product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene gspD CDS complement(3794..4606) product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196795.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(4623..5168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(5165..6394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 misc_feature complement(6454..>7410) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112726.1:type II secretion system minor pseudopilin GspK locus_tag LOCUS_13910 sequence125 source 1..7385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1594) product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811370.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene clsB CDS complement(1594..2364) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113348.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(2569..3486) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene cysK CDS 3730..3900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(4358..5581) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(5541..6800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 sequence126 source 1..7366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1446..2642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS 2649..3974 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 3976..6090 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 6087..7157 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(7203..7364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 sequence127 source 1..7223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(206..2233) product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(2528..5857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(6136..6561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 misc_feature complement(6636..>7223) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003691589.1:nitric-oxide reductase large subunit locus_tag LOCUS_14060 sequence128 source 1..7213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..553 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200776.1:N-acetylmuramoyl-L-alanine amidase locus_tag LOCUS_14070 CDS 588..920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1041..1271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1380..2042) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 2256..2507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 2551..4524 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene mutL CDS 4856..6199 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905419.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gdhA CDS complement(6266..6895) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 sequence129 source 1..7197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1800..2972) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(2989..4443) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267829.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(4440..5207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 misc_feature complement(5366..>7197) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196324.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase locus_tag LOCUS_14180 sequence130 source 1..7180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2385..4361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 4442..6088 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543612.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 sequence131 source 1..7169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(40..501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(498..1307) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1381..1740) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1757..2752) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(2749..3402) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene tmk CDS complement(3399..4400) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446696.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene mltG CDS 4446..5381 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(5441..6304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 misc_feature complement(6326..>7169) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521279.1:alpha/beta hydrolase locus_tag LOCUS_14290 sequence132 source 1..7164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 435..1151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(1202..1987) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(2055..2333) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(2330..2890) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(2887..3300) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene msrB CDS complement(3297..4784) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 4957..6594 product 3-(methylthio)propionyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 sequence133 source 1..7152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 866..1669 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1727..5203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 5237..5383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(5655..6755) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 sequence134 source 1..7143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(844..1674) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1634..2740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(2784..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3337..4161 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(4167..5957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(6056..6871) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 sequence135 source 1..7124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..690 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(794..1768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1662..2897 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(2971..4110) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931029.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(4115..4591) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(4688..6997) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197904.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 sequence136 source 1..7122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..2408 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 2422..3978 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 4004..4675 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(4761..5288) product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(5348..6475) product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 misc_feature complement(6487..>7122) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142072.1:sulfate ABC transporter permease subunit CysW locus_tag LOCUS_14580 sequence137 source 1..7089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..760 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707141.1:glycine betaine/L-proline ABC transporter ATP-binding protein ProV locus_tag LOCUS_14590 CDS 785..1987 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene proW CDS 2024..3103 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene proX CDS 3346..4833 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185705869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 4830..5558 product two-component system response regulator BaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137862.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene baeR CDS 5749..6525 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene crp misc_feature complement(6562..>7089) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707066.1:class II fumarate hydratase locus_tag LOCUS_14650 sequence138 source 1..7086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..574) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(754..1422) product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036403.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1799..3139 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268046.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 3158..6325 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268045.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 sequence139 source 1..7083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(285..1772) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(2077..3366) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(3374..5143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(5214..6173) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene puuE CDS complement(6170..6871) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812213.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 sequence140 source 1..7046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 487..912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 917..1462 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1683..1973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(2150..3376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(3381..4175) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203772.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 4285..5268 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 5345..6313 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807281.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(6378..6932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 sequence141 source 1..6871 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..896 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974618.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 893..1306 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1413..1850 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388338.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 1847..2626 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531842.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(2713..3006) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 3047..3280 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020728.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 3342..4937 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ggt CDS 5291..6709 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 sequence142 source 1..6802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..535 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807105.1:O-antigen biosynthesis protein WlbG locus_tag LOCUS_14910 CDS 572..2119 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene lysS CDS 2193..3218 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 3258..3926 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 4289..5410 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 5512..6438 product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene livH sequence143 source 1..6793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1305..2879 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 2952..4106 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 4151..5137 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 5366..6385 product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 sequence144 source 1..6768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..645 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 656..1672 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene lpxK CDS 1681..1863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1860..2648 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene kdsB CDS 2770..3426 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene adk CDS complement(3514..4452) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 4568..5242 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene lexA CDS 5404..5805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 5900..6427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 sequence145 source 1..6760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1037..1624 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1625..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(3325..3753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(3792..4382) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(4491..5222) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039400.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 sequence146 source 1..6747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(681..1637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1754..2944 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527614.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 3082..4335 product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 4328..5008 product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene lolD CDS complement(5064..5435) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 5549..5857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 5912..6109 product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 sequence147 source 1..6732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..2023 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 2023..2388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(2460..3878) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(4060..4512) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rplI CDS complement(4527..4808) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813094.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene rpsR CDS complement(4827..5117) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene priB CDS complement(5137..5514) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene rpsF CDS 5743..6294 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene grpE sequence148 source 1..6691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..1724 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1724..2302 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 2299..2919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 2924..3736 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(3810..4262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(4504..4869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 5348..5926 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 sequence149 source 1..6688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..1218) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1237..2202) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 2313..3239 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813028.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene gcvA CDS complement(3320..4765) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930991.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(4845..5519) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(5569..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 sequence150 source 1..6684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(840..1553) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 1580..2053 product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 2065..2832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(2890..3771) product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522262.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(3778..4191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(4203..4679) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192392.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene greA CDS complement(4807..6684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 sequence151 source 1..6654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..786 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 783..1565 product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene mlaE CDS 1600..2085 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene mlaD CDS 2082..2834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 3013..3660 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 3691..3960 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 4058..4975 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 4972..5727 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 5729..5977 product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 sequence152 source 1..6641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..669 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195192.1:excinuclease ABC subunit UvrA locus_tag LOCUS_15590 CDS 905..2398 product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene putP CDS complement(2460..4421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(4738..5709) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 misc_feature complement(5709..>6641) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815277.1:tripartite tricarboxylate transporter substrate binding protein locus_tag LOCUS_15630 sequence153 source 1..6640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..3452) product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(3899..4423) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene ampD CDS complement(4479..5987) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 tRNA 4843..4914 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 misc_feature complement(6003..>6640) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140816.1:sensor histidine kinase locus_tag LOCUS_15670 sequence154 source 1..6639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1491 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037879.1:DUF4153 domain-containing protein locus_tag LOCUS_15680 CDS 1631..2410 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 2462..2854 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930724.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene acpS CDS 2913..4013 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene nagZ CDS 4028..5080 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404839.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 5308..5760 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(6114..6362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 sequence155 source 1..6576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..579 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186494.1:polyribonucleotide nucleotidyltransferase locus_tag LOCUS_15750 CDS 679..1683 product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1671..2432 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene tpiA CDS 2471..2851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15780 tRNA 2980..3064 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 3141..3500 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040258.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 3525..4004 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 4015..4623 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 4650..5903 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 5900..6391 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene nuoE sequence156 source 1..6570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 929..2188 product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(2261..3742) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(3804..5894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 sequence157 source 1..6546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..3504 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(3568..4821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 misc_feature complement(4857..>6546) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388628.1:DUF4384 domain-containing protein locus_tag LOCUS_15890 sequence158 source 1..6535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(478..1446) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1537..2793) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204969.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(2946..4142) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 4308..5261 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(5283..6008) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(6005..6379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 sequence159 source 1..6532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..1473 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 1594..2310 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 2339..3565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 3650..4213 product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 4210..4938 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113716.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(4946..6214) product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 sequence160 source 1..6501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1604..1948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(2490..4205) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939556.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 misc_feature complement(4217..>6501) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021173.1:PAS domain S-box protein locus_tag LOCUS_16040 sequence161 source 1..6500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1713..3677) product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011854083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene nosZ CDS complement(3665..4030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 4267..4686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 4723..5793 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 misc_feature complement(5900..>6500) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814962.1:symmetrical bis(5'-nucleosyl)-tetraphosphatase locus_tag LOCUS_16090 sequence162 source 1..6475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..1171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1381..1809 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1907..3004 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038743784.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 3014..3355 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 3439..4086 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 4177..5328 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 5479..5856 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene rpsL sequence163 source 1..6474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(583..1677) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063892.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 1852..2640 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 2690..4186 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene glpK CDS 4316..5182 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene proC CDS complement(5237..6109) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene ubiA sequence164 source 1..6445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(646..1140) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776902.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1157..2029) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(2043..3467) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931317.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(3509..3925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 3953..5236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 misc_feature complement(5261..>6445) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930255.1:hydroxysqualene dehydroxylase HpnE locus_tag LOCUS_16270 sequence165 source 1..6435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1473..1916 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(2022..3593) product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(3603..4406) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930717.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(4498..5523) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 misc_feature complement(5670..>6435) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930716.1:malonyl-CoA decarboxylase family protein locus_tag LOCUS_16320 sequence166 source 1..6434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 696..959 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene moaD CDS complement(966..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1374..1514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1627..1881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1948..2424 product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene moaE CDS 2493..5096 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene clpB CDS 5161..5466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(5550..5954) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 sequence167 source 1..6417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 427..1416 product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene hemF CDS 1587..2411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 2427..2894 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene rlmH CDS 2946..3572 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(3600..4364) product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene dnr CDS complement(4418..5974) product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 sequence168 source 1..6417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(752..1732) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene lipA CDS complement(1750..2442) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene lipB CDS complement(2454..2750) product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 2990..3478 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524510.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 3501..4364 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214802.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene atpB CDS 4416..4664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 4700..5170 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 5182..5724 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence169 source 1..6401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..1251) product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1422..2264) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 2532..3236 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(3329..4030) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(4103..5614) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 sequence170 source 1..6356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 382..1785 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene mnmE CDS 1843..2364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 2500..3336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(3372..3926) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(3997..5982) product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 sequence171 source 1..6356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 note possible pseudo, internal stop codon CDS 847..2055 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 2235..3185 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809986.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 3232..4800 product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 4828..5823 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 sequence172 source 1..6338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(921..2090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(2513..3151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 3456..4184 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 4275..4763 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene trmL CDS complement(4795..5259) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(5342..5962) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 sequence173 source 1..6296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(909..1844) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1972..3033 product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 3099..3599 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene ybaK CDS 3660..4280 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene plsY CDS complement(4359..5360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(5383..6027) product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(6044..6295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 sequence174 source 1..6291 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(600..1388) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene tatC CDS complement(1451..1930) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene tatB CDS complement(1963..2211) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene tatA CDS complement(2307..2690) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(2706..3746) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(3739..4125) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(4125..4523) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(4530..4919) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene hisI CDS complement(5033..5812) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene hisF sequence175 source 1..6277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..729) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 745..1401 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1417..2253) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(2348..3595) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527146.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(3629..3913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 4231..5961 product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene sulP sequence176 source 1..6270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1156 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene glnA CDS 1366..1869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1886..2974 product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene glnL CDS 3026..4561 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene ntrC CDS 4743..5696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(5739..6248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 sequence177 source 1..6257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 11..315 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagtgtagctatccggggtgagagagggagctacaac CDS complement(417..1019) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918676.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene wrbA CDS complement(1158..1901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(2216..3457) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 3607..4443 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(4500..5225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 misc_feature complement(5469..>6257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537965.1:peptidoglycan-binding domain-containing protein locus_tag LOCUS_17110 sequence178 source 1..6251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..755 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537877.1:acetyl-CoA C-acyltransferase locus_tag LOCUS_17120 CDS 836..1732 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1758..2600 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 2597..3394 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 3576..4058 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029306122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 4247..4798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(4851..5282) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 sequence179 source 1..6236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..708 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526207.1:sensor histidine kinase N-terminal domain-containing protein locus_tag LOCUS_17190 CDS complement(762..1418) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1442..4354) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 4465..5106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 5103..5960 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene birA sequence180 source 1..6218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1040..2590) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267548.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(2634..3638) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(3682..5007) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150740761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 5135..6088 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 sequence181 source 1..6195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..678 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186399.1:alanyl-tRNA editing protein locus_tag LOCUS_17280 CDS 749..2947 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(2948..3955) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 4158..5426 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681363.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene nhaA CDS 5476..5991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 note possible pseudo, internal stop codon, frameshifted sequence182 source 1..6173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(698..1819) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930435.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1873..2397 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(2491..2979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(3145..3591) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene dut CDS complement(3689..4909) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 gene coaBC sequence183 source 1..6155 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(111..1013) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113092.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(1023..1964) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1964..3064) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(3160..4059) product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(4175..5275) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 5294..6079 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 sequence184 source 1..6130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(354..1502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1779..2024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(2123..4957) product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228281.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(4963..5685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 tRNA 6005..6098 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 sequence185 source 1..6122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 666..1634 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1740..2627 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810324.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 2644..3438 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810326.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(3506..3970) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 4255..5226 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 5298..5798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 sequence186 source 1..6100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(43..118) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(177..252) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(316..1014) product response regulator transcription factor EsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935896.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene esaR CDS complement(1051..3339) product sensor histidine kinase EsaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene esaS CDS complement(3336..4007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(3958..5331) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929882.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 gene rsmB CDS complement(5328..5900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 sequence187 source 1..6077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1072..2940) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(3081..4376) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene gshA CDS complement(4441..5907) product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 sequence188 source 1..6019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..616 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102956.1:metallophosphoesterase family protein locus_tag LOCUS_17640 CDS 729..1151 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1152..1784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1855..2766) product HTH-type transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 2830..4194 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(4207..5397) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 sequence189 source 1..6018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1076..2089) product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 2292..3263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(3286..3819) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 3989..5050 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995141.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene dusB CDS 5031..5264 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 sequence190 source 1..5952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(426..1208) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1242..2330) product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene bamC CDS complement(2414..3202) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene dapA CDS complement(3237..3809) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(3812..3940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(3943..5241) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 sequence191 source 1..5926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 708..1880 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040791.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 2038..2982 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640265.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 3138..4337 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene dinB sequence192 source 1..5913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2182..2979 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(2942..5008) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 sequence193 source 1..5900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1628..1870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(1875..2636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 note possible pseudo, frameshifted CDS complement(2724..3989) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088887969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene ubiM CDS 4162..4401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 sequence194 source 1..5894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 304..603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(785..1096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 1270..2964 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039849.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene fliF CDS 2998..3993 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene fliG CDS 4003..4737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence195 source 1..5890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1737 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204769.1:penicillin-binding protein 2 locus_tag LOCUS_17960 CDS complement(1754..2653) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(2786..3538) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(3535..4317) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(4357..5118) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228488.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 misc_feature complement(5284..>5890) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808362.1:arginase locus_tag LOCUS_18010 sequence196 source 1..5878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(763..1596) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1718..2608) product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(2734..4092) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(4193..5326) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 sequence197 source 1..5870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..1678) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene mdtD CDS 1958..2536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 2673..3152 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(3244..4134) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089063.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(4198..5157) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 5283..5597 product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 sequence198 source 1..5864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..2566 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2580..3140) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene greB tRNA complement(3219..3295) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(3442..3714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 3965..4231 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene rpsO sequence199 source 1..5830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(651..1982) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2294..3343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 3405..5411 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919640.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene cyoB sequence200 source 1..5826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205549.1:nitrate reductase subunit beta locus_tag LOCUS_18190 CDS 1130..1828 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene narJ CDS 1825..2559 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene narI CDS 2651..3487 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528382.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 3509..4186 product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658644.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene cynT CDS 4223..5557 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358927.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 sequence201 source 1..5818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 510..782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 798..1421 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1514..3325 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene aspS CDS 3422..4225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 4236..4706 product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene nudB CDS 4703..5470 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 sequence202 source 1..5758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1030) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1027..1803) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene tam CDS complement(1816..2802) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 3003..3791 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 3929..4363 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene sdhC CDS 4411..4776 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene sdhD sequence203 source 1..5742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(146..949) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(946..1887) product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene ntrB CDS complement(1923..3167) product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(3498..4118) product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 4279..5439 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200893.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 sequence204 source 1..5706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 382..846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 849..2159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 2367..2939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2955..3959 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene fliM CDS 3949..4398 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene fliN CDS 4406..4768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 4761..5516 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene fliP sequence205 source 1..5686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..640 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000795656.1:flagellar motor protein MotB locus_tag LOCUS_18490 CDS 702..1088 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene cheY CDS 1091..1720 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene cheZ CDS 1943..3115 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene flhB CDS 3112..5196 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene flhA sequence206 source 1..5684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 200..275 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(261..446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 361..744 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene secE CDS 744..1334 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 gene nusG CDS 1444..1875 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rplK CDS 1876..2571 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rplA CDS 2813..3319 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene rplJ CDS 3369..3749 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene rplL sequence207 source 1..5679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..673) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene rplT CDS complement(700..1023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1077..1613) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene infC CDS complement(1754..3673) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene thrS CDS complement(3956..5287) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene aceA sequence208 source 1..5671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..774 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810200.1:TonB-dependent receptor locus_tag LOCUS_18660 CDS 798..1991 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(2038..3567) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529613.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(3658..4209) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339642.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(4343..5302) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392222.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 sequence209 source 1..5662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..704 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195799.1:phenylalanine 4-monooxygenase locus_tag LOCUS_18710 CDS complement(723..1634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 1775..3460 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027995529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 3495..4421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 sequence210 source 1..5658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1355 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194277.1:RNB domain-containing ribonuclease locus_tag LOCUS_18750 CDS 1435..2295 product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2295..3143 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184294754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene aroE CDS 3147..3869 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene mtgA note possible pseudo, frameshifted CDS 3949..4509 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene ruvC misc_feature complement(4546..>5658) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543739.1:methyl-accepting chemotaxis protein locus_tag LOCUS_18800 sequence211 source 1..5629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1107..1961) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039860.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(1995..2729) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(2758..3318) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene frr CDS complement(3367..4089) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene pyrH CDS complement(4148..5044) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene tsf sequence212 source 1..5625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..1373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 1370..2626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2701..3138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 note possible pseudo, internal stop codon CDS 3199..4410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 note possible pseudo, internal stop codon misc_feature complement(4519..>5625) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549948.1:MltA domain-containing protein locus_tag LOCUS_18900 sequence213 source 1..5566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926800.1:leucine--tRNA ligase locus_tag LOCUS_18910 CDS 834..1343 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene lptE CDS 1417..2463 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene holA CDS complement(2521..2814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 2905..4185 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 sequence214 source 1..5559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..881 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811151.1:MmgE/PrpD family protein locus_tag LOCUS_18960 CDS 970..1977 product tripartite tricarboxylate transporter substrate binding protein BugD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2041..2418 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2460..3317 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925778.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 3400..4623 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085485.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 misc_feature complement(4660..>5559) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525804.1:CaiB/BaiF CoA-transferase family protein locus_tag LOCUS_19010 sequence215 source 1..5542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(763..1947) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194932.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2041..2574) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene nusB CDS complement(2571..3035) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene ribH CDS complement(3039..4160) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene ribBA CDS complement(4420..4713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 misc_feature complement(4794..>5542) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063757.1:stomatin-like protein locus_tag LOCUS_19080 sequence216 source 1..5541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..526 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931278.1:adenosylhomocysteinase locus_tag LOCUS_19090 CDS 639..1637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 1634..2473 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene metF CDS 2484..3167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 3199..3903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(3948..4838) product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene rlmJ sequence217 source 1..5537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(395..1399) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926108.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(1392..2369) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene cbiB CDS 2497..3099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 3102..3788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 3799..4695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 4709..5518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 sequence218 source 1..5470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1213 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539133.1:Hsp70 family protein locus_tag LOCUS_19210 CDS 1224..1817 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968484.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 1822..4677 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 misc_feature complement(4674..>5470) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139327973.1:trypsin-like peptidase domain-containing protein locus_tag LOCUS_19240 sequence219 source 1..5466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(415..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2788..3636 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene purU CDS 3661..4581 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence220 source 1..5457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..914 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970133.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(1468..1947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(2084..2596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2551..3006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(3022..3576) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene rpoE CDS 3714..4040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 sequence221 source 1..5439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..1622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 tRNA 1720..1795 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1849..1922 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 2037..2112 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 2246..2337 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 2350..2970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 3071..5044 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene uvrC sequence222 source 1..5426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 129..758 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene upp CDS complement(842..3334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 3616..5331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 sequence223 source 1..5412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..640) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(752..1795) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224149877.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2062..2490) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(2533..2934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(3114..4061) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 4030..4281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(4290..4850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(4915..5244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 sequence224 source 1..5412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence225 source 1..5409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 684..1421 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(1872..3842) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(3889..4818) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene prmB misc_feature complement(4815..>5409) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191377.1:succinyl-diaminopimelate desuccinylase locus_tag LOCUS_19510 sequence226 source 1..5395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..677 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536419.1:UbiD family decarboxylase locus_tag LOCUS_19520 CDS 741..1901 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 1946..3310 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 3499..4455 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence227 source 1..5337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 752..1954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2001..2753 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2882..3712) product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(3825..4718) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 sequence228 source 1..5317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 613..1941 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2298..3227 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 3241..4317 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 4363..5121 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 sequence229 source 1..5308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815192.1:MetQ/NlpA family ABC transporter substrate-binding protein locus_tag LOCUS_19650 CDS complement(621..1283) product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409989.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene lysE CDS 1327..2238 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(2293..2793) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2883..3605 product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene ytfE CDS complement(3719..3970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(3970..4416) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(4435..5307) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 sequence230 source 1..5281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1705 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 1923..2753 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2822..3904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 misc_feature complement(4019..>5281) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522419.1:2-isopropylmalate synthase locus_tag LOCUS_19760 sequence231 source 1..5278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..1394) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(1475..2182) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2179..2958) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2955..3968) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(3974..4834) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 sequence232 source 1..5277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2004 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555739.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha locus_tag LOCUS_19820 CDS 2043..2963 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813179.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2992..3906 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 misc_feature complement(3921..>5277) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895689.1:diguanylate cyclase locus_tag LOCUS_19850 sequence233 source 1..5268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..1518) product copper resistance membrane spanning protein PcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046494163.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene pcoS CDS complement(1519..2202) product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2360..2695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 2695..4122 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 sequence234 source 1..5258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 419..1291 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene panC CDS complement(1596..2588) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2661..3113) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene secB CDS complement(3215..3472) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene grxC CDS complement(3523..3930) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 4004..4747 product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 gene gpmA sequence235 source 1..5241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..501 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103104.1:GGDEF domain-containing protein locus_tag LOCUS_19960 CDS 515..1402 product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene fleN CDS complement(1460..2365) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522639.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(2362..2766) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814742.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 misc_feature complement(2851..>5241) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114943.1:penicillin acylase family protein locus_tag LOCUS_20000 sequence236 source 1..5230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..653 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 756..2489 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 2592..4190 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 4382..4750 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene rplN CDS 4761..5081 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene rplX sequence237 source 1..5226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(898..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1166..2365) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2477..4132) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195844.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(4285..4947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 sequence238 source 1..5210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..2272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2307..2507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(2590..2862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2982..3860 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199067.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene dapF CDS 3857..4549 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 sequence239 source 1..5178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(21..96) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(157..684) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527881.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(717..1328) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(1424..2179) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2196..3617) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(3633..4232) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204996.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene petA CDS 4367..4795 product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene mscL sequence240 source 1..5162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1081..2094) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811351.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2318..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2740..3318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 3689..3925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 3954..4427 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(4481..4639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 sequence241 source 1..5146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..1719) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027069.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 1895..3175 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808608.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(3295..3840) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 3923..4630 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 sequence242 source 1..5126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(711..1796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(1850..2086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2115..3329) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207191.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene gltS sequence243 source 1..5108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1779..2825) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene nrfD CDS complement(2843..3625) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809144.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 4032..4646 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036512.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 sequence244 source 1..5082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1265 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene dmeF CDS 1277..1921 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 1947..2378 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119862.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2388..2582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2481..3356 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene murI CDS complement(3424..3963) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(4009..4998) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 sequence245 source 1..5049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(620..2269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2432..3979 product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 4060..4605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 note possible pseudo, internal stop codon sequence246 source 1..5042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 578..2173 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2349..3068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 3065..3496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(3516..4862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 sequence247 source 1..5022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(845..1051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 1033..1365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 1638..2390 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2477..2866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 2997..4052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 sequence248 source 1..5015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 705..1289 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 1355..1621 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813217.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 1757..2365 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene gstA CDS 2629..3753 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 3908..4180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 note possible pseudo, frameshifted CDS 4141..4656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 note possible pseudo, frameshifted sequence249 source 1..4966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1216..2562) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2648..3880) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 4033..4407 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 sequence250 source 1..4946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..1149) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(1161..2156) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(2227..3462) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526008.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(3498..4328) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389895.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 misc_feature complement(4438..>4946) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198292.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_20700 sequence251 source 1..4902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..674 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267624.1:PhzF family phenazine biosynthesis protein locus_tag LOCUS_20710 CDS 671..1648 product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 1823..2911 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2945..4204 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 sequence252 source 1..4892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..798 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814429.1:LPS-assembly protein LptD locus_tag LOCUS_20750 CDS 862..2259 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2256..3017 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rsmA CDS complement(3312..3737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(3925..4281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 note possible pseudo, internal stop codon sequence253 source 1..4890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815378.1:UbiH/UbiF family hydroxylase locus_tag LOCUS_20800 CDS 684..1394 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 1562..3343 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 3340..4173 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 tRNA 4200..4276 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 4370..4828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 sequence254 source 1..4869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..534 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970806.1:cytochrome b/b6 domain-containing protein locus_tag LOCUS_20850 CDS complement(610..2592) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 2604..3179 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197233.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 3309..3995 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 4013..4780 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 sequence255 source 1..4854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1243..1893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(1915..2319) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097782.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene flgC CDS complement(2341..2796) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884708.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene flgB CDS 3036..3737 product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene flgA CDS 3831..4154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 4202..4558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 sequence256 source 1..4845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1027..1866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 sequence257 source 1..4844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..3015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(3085..3648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 sequence258 source 1..4827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..284) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205393.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(451..861) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(868..1584) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(1602..2303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2410..2682) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2870..3217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 3337..3891 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene rraA misc_feature complement(3901..>4827) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525413.1:DMT family transporter locus_tag LOCUS_21060 sequence259 source 1..4826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040012.1:ABC transporter ATP-binding protein locus_tag LOCUS_21070 CDS 592..1662 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 1831..2706 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 2699..3511 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810948.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 3524..3832 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810949.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 sequence260 source 1..4810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1338..2186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 2373..4097 product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene nirS CDS 4117..4461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 sequence261 source 1..4783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 32..745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 810..1700 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene argB CDS 1894..2538 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927138.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene slmA CDS 2745..3410 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 sequence262 source 1..4782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1567..3555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 3563..4225 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 sequence263 source 1..4781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..698 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808339.1:molybdate ABC transporter permease subunit locus_tag LOCUS_21210 CDS 695..1783 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene modC CDS complement(1908..2675) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2772..3596) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(3593..4369) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 sequence264 source 1..4775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1066..1416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(1419..2576) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene lapB CDS complement(2566..2892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(3022..3333) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 misc_feature complement(3455..>4775) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189285.1:30S ribosomal protein S1 locus_tag LOCUS_21300 sequence265 source 1..4759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1057..1755) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene cheD CDS complement(1835..2728) product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2777..3265) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene cheW misc_feature complement(3299..>4759) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204177.1:chemotaxis protein CheA locus_tag LOCUS_21340 sequence266 source 1..4752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1895..4165) product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene cphA sequence267 source 1..4723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1111 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926811.1:TRAP transporter large permease locus_tag LOCUS_21360 CDS 1371..2519 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene gcvT CDS 2623..2997 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene gcvH sequence268 source 1..4685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(713..1672) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 1711..2631 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2636..3661 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 sequence269 source 1..4679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 181..936 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(1150..2136) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211480.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene corA CDS complement(2368..2667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2697..2951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(3041..4333) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 sequence270 source 1..4661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..662 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814441.1:oxaloacetate decarboxylase locus_tag LOCUS_21470 CDS complement(709..1638) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189234.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 1715..4105 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene metE CDS 4182..4640 product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 sequence271 source 1..4660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..563 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112522.1:ATP-dependent DNA helicase DinG locus_tag LOCUS_21510 CDS 748..945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 1061..1747 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 1955..2461 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869958.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2758..4023) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 sequence272 source 1..4635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1348 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818282.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG locus_tag LOCUS_21560 CDS 1345..2025 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806878.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene rsmG CDS 2060..2674 product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457206.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene leuE CDS 2691..3461 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 3548..4090 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 sequence273 source 1..4625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..815 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191560.1:phosphoenolpyruvate carboxylase locus_tag LOCUS_21610 CDS 825..3008 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene yccS CDS 3121..3720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 3735..4289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 sequence274 source 1..4611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1044..2276 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene xseA CDS 2424..3005 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene sodB sequence275 source 1..4602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..1405 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807718.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 sequence276 source 1..4599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1286 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123272.1:exodeoxyribonuclease I locus_tag LOCUS_21680 CDS 1295..2179 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 2250..4253 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 sequence277 source 1..4595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1137 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818860.1:ExeA family protein locus_tag LOCUS_21710 CDS 1718..1915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2062..2880 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 2937..3974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 note possible pseudo, internal stop codon, frameshifted sequence278 source 1..4557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 115..1053 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 1058..1264 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 1439..2680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2690..3847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 sequence279 source 1..4555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(1466..2704) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene glcF CDS complement(2731..3528) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 misc_feature complement(3531..>4555) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813049.1:glycolate oxidase subunit GlcE locus_tag LOCUS_21820 sequence280 source 1..4525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..948 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037811.1:efflux transporter outer membrane subunit locus_tag LOCUS_21830 CDS 1437..3902 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene nirB CDS 3979..4368 product nitrite reductase (NAD(P)H) small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204219.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 sequence281 source 1..4520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..1578) product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261548.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 1768..2712 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2720..3157) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983376.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 misc_feature complement(3294..>4520) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039964.1:GGDEF domain-containing protein locus_tag LOCUS_21890 sequence282 source 1..4519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1112..1450) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(1482..2258) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2240..2902) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 3033..3578 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene msrA CDS 3732..3971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 3997..4401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 sequence283 source 1..4474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(358..858) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(919..2778) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206873.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2917..3999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 sequence284 source 1..4415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..1174 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 1328..1915 product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2294..3214 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene egtD sequence285 source 1..4371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(705..1424) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312614.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 1533..1886 product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528650.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 1883..2287 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 2417..2629 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene rpsU CDS 2727..3188 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 sequence286 source 1..4369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..1004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(1156..1554) product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene gspI CDS complement(1551..1985) product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene gspH CDS complement(1982..2431) product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene gspG CDS 2497..2937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2966..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 sequence287 source 1..4328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(163..1305) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104093.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(1421..3595) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 sequence288 source 1..4311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 549..1094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(1205..3064) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene lpdA misc_feature complement(3081..>4311) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063727.1:dihydrolipoyllysine-residue acetyltransferase locus_tag LOCUS_22170 sequence289 source 1..4281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 550..900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 1144..3039 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene recQ CDS complement(3040..3726) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(3716..3907) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene nrdD sequence290 source 1..4272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(43..119) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(183..449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(686..1729) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2065..2916 product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357921.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene asd CDS complement(3225..3980) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene hutG sequence291 source 1..4269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 677..1999 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene tolB CDS 2039..2581 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene pal CDS 2581..3366 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene ybgF tRNA 4194..4269 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 sequence292 source 1..4237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2543 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350708.1:glutamate synthase-related protein locus_tag LOCUS_22300 CDS 2607..4085 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 sequence293 source 1..4236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..861 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525896.1:multifunctional CCA addition/repair protein locus_tag LOCUS_22320 CDS complement(1006..1443) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene trxC CDS 1570..2301 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203011.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene otsB CDS 2319..4118 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 sequence294 source 1..4212 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(267..343) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(554..2152) product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 misc_feature complement(2511..>4212) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197309.1:DEAD/DEAH box helicase locus_tag LOCUS_22370 sequence295 source 1..4192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..1204 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 1204..2124 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 2155..3303 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614499.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence296 source 1..4176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1022..2032) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706039.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(2029..3546) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391252.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 sequence297 source 1..4176 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1834 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193121.1:transcription-repair coupling factor locus_tag LOCUS_22430 CDS 1843..2517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 2559..3275 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene serB sequence298 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1285 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014328246.1:efflux RND transporter permease subunit locus_tag LOCUS_22460 CDS 1500..2087 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2382..2996) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 sequence299 source 1..4171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1713 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(1717..2397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 2530..3858 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene serS tRNA 3891..3980 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence300 source 1..4169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198639.1:flagellar biosynthesis protein FlhA locus_tag LOCUS_22520 CDS 796..2388 product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535477.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene flhF CDS 2378..3175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 3180..3893 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 sequence301 source 1..4159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(562..2232) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2412..3524) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene ribD CDS complement(3556..3939) product type IVa pilus pseudopilin TppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704652.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene tppA sequence302 source 1..4147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926448.1:peptide chain release factor 2 locus_tag LOCUS_22600 CDS 876..3587 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149504110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene pepN sequence303 source 1..4140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1241..1828) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(1825..2223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2220..2738) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193409.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2764..3666) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 sequence304 source 1..4132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1191..2051) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2127..2330) product DUF3460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 2475..2975 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524638.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene bamE CDS 3125..3811 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 sequence305 source 1..4130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 830..2320 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063671.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 tRNA 2489..2562 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS complement(2631..3590) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(3667..3930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 sequence306 source 1..4066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1039 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204325.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD locus_tag LOCUS_22730 CDS complement(1108..2619) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189216.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 sequence307 source 1..4057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 368..775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 817..1467 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene leuD CDS 1557..2636 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene leuB CDS 2800..3567 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 sequence308 source 1..4050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(733..1266) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919635.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(1256..2599) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2596..3405) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927848.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(3417..3836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 sequence309 source 1..4045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1351 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931196.1:metalloprotease TldD locus_tag LOCUS_22840 CDS 1374..1922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2176..3294 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene aroG CDS 3389..3700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 sequence310 source 1..4039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1175..1492) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(1606..2052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2250..3323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 3320..3949 product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene rqpR sequence311 source 1..4029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2117..2314 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366461.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 2311..2814 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene cueR CDS 2926..3141 product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 3154..3705 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 sequence312 source 1..4008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 369..803 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810864.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(834..1319) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 1423..1809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 1911..4007 product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546785.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 sequence313 source 1..4006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1..77) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(138..2381) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2378..3238) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039713.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 sequence314 source 1..3983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..1498) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160742.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene mhpD CDS 1561..2697 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 sequence315 source 1..3974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1417 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815208.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB locus_tag LOCUS_23050 CDS complement(1490..2173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2239..2949) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929769.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene pyrE CDS 2960..3763 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 sequence316 source 1..3963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..1097 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028646.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 1107..1532 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene arfB CDS 1645..2481 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2507..3172 product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 sequence317 source 1..3954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(864..2207) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450547.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 2348..3112 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 sequence318 source 1..3951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..1652) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(1695..1967) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(1973..2677) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 misc_feature complement(2708..>3951) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116225.1:succinate dehydrogenase flavoprotein subunit locus_tag LOCUS_23180 sequence319 source 1..3948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..1617) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene prfA CDS complement(1731..3041) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209421240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene hemA CDS 3116..3394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 misc_feature complement(3396..>3948) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931186.1:LysR substrate-binding domain-containing protein locus_tag LOCUS_23220 sequence320 source 1..3948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(36..1508) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene ffh CDS 1507..2307 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene ccsA CDS 2304..2534 product PP0621 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 sequence321 source 1..3942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1160..>3942) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526855.1:2-oxoglutarate dehydrogenase E1 component locus_tag LOCUS_23260 sequence322 source 1..3911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 524..1540 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 1681..2289 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 2292..3890 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243758.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 sequence323 source 1..3903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4..699) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 818..1486 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene maiA CDS 1492..2343 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene pgeF CDS complement(2260..2550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 sequence324 source 1..3897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2084 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188327.1:transglycosylase domain-containing protein locus_tag LOCUS_23340 CDS 2100..3302 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(3295..3843) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 sequence325 source 1..3875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..1244) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene argC CDS 1420..2580 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene sucC CDS 2600..3493 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 gene sucD sequence326 source 1..3840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..746 product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 893..1216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 1213..1818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 1863..2903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2900..3451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 sequence327 source 1..3838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 361..2985 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene mutS CDS 3152..3802 product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 sequence328 source 1..3817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..659) product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346101.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(727..1935) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206663.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 gene trpB CDS 2151..2537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2609..2995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528566.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 misc_feature complement(2982..>3817) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023853227.1:MFS transporter locus_tag LOCUS_23510 sequence329 source 1..3803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(574..1959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 note possible pseudo, internal stop codon misc_feature complement(1966..>3803) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096256.1:nitrate reductase subunit alpha note possible pseudo, internal stop codon locus_tag LOCUS_23530 sequence330 source 1..3781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..766 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 865..1770 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 1887..2222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 2230..3183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(3238..3750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 sequence331 source 1..3766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(59..970) product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411794.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene kdgD CDS complement(1058..2026) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2139..2945) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 sequence332 source 1..3755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..1038) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(1042..1824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(1824..3161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 misc_feature complement(3168..>3755) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191272.1:branched-chain amino acid ABC transporter permease locus_tag LOCUS_23650 sequence333 source 1..3744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194193.1:polyamine aminopropyltransferase locus_tag LOCUS_23660 CDS complement(1129..1902) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1892..2545) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2704..3504) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 sequence334 source 1..3728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..691 product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(810..1712) product HTH-type transcriptional regulator PtxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089264.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene ptxR CDS 1835..2470 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 misc_feature complement(2650..>3728) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064828.1:glutamine--fructose-6-phosphate transaminase (isomerizing) locus_tag LOCUS_23730 sequence335 source 1..3722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..556 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259301.1:cation diffusion facilitator family transporter locus_tag LOCUS_23740 CDS 553..1017 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene dtd CDS 1027..2436 product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene dbpA CDS complement(2464..3240) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(3399..3722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 sequence336 source 1..3710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..874 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205180.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 1028..1579 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(1706..2389) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401479.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 2484..3437 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 sequence337 source 1..3709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1398..1661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 1758..2264 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 misc_feature complement(2499..>3709) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010909024.1:NADP-dependent isocitrate dehydrogenase locus_tag LOCUS_23850 sequence338 source 1..3684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 643..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 1594..2628 product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038544.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 2840..3130 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene groES sequence339 source 1..3677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(602..1192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 1905..2618 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 2682..3515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 sequence340 source 1..3673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(375..1196) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(1196..2509) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 2608..3063 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 sequence341 source 1..3672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..455) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene rpsS CDS complement(466..1290) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 gene rplB CDS complement(1294..1608) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene rplW CDS complement(1605..2225) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene rplD CDS complement(2225..2899) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene rplC CDS complement(3150..3461) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 gene rpsJ sequence342 source 1..3663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..2027) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 gene leuA CDS complement(2249..3082) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 gene pssA sequence343 source 1..3600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1239..2471 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2481..2876) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931059.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2953..3543) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene recR sequence344 source 1..3582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(969..1943) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2203..3411) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925892.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 sequence345 source 1..3570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1246..1848 product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 sequence346 source 1..3561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1372..>3561) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197743.1:methionine synthase locus_tag LOCUS_24110 sequence347 source 1..3557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(559..1455) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931157.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(1473..2339) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene pyrF CDS 2447..3304 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399570.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 sequence348 source 1..3543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221142.1:type I-F CRISPR-associated helicase Cas3f locus_tag LOCUS_24150 sequence349 source 1..3533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..579 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930216.1:class I poly(R)-hydroxyalkanoic acid synthase locus_tag LOCUS_24160 CDS 721..1899 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2028..2369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 2546..3154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 sequence350 source 1..3532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1236..2510) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810338.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 2686..3306 product TetR family transcriptional regulator BpeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene bpeR tRNA 3361..3436 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 sequence351 source 1..3530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1157 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 1173..2075 product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS 2072..2893 product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 sequence352 source 1..3506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(687..1334) product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 gene lptA CDS complement(1520..2170) product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(2229..2855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 misc_feature complement(2868..>3506) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189649.1:arginine--tRNA ligase locus_tag LOCUS_24280 sequence353 source 1..3485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(974..1645) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039419.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(1902..2735) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene lgt CDS 2908..3381 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene bfr sequence354 source 1..3484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..1485) product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene rodA misc_feature complement(1542..>3484) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase locus_tag LOCUS_24330 sequence355 source 1..3475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(192..488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(485..958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(1029..1232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 1484..2905 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene dnaA sequence356 source 1..3469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..634 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814572.1:UDP-N-acetylmuramate--L-alanine ligase locus_tag LOCUS_24380 CDS 631..1629 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 1626..2459 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence357 source 1..3432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..1104) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene bioB CDS complement(1606..2067) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 misc_feature complement(2127..>3432) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387813.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha locus_tag LOCUS_24430 sequence358 source 1..3402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(328..1299) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391987.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 1423..1863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 misc_feature complement(2049..>3402) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003817018.1:phosphoenolpyruvate carboxykinase (GTP) locus_tag LOCUS_24460 sequence359 source 1..3389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(630..1844) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(1841..2557) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene radC CDS 2640..3116 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 sequence360 source 1..3383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 633..1571 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 1626..1931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2102..2368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 sequence361 source 1..3376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..773 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930096.1:3-phosphoserine/phosphohydroxythreonine transaminase locus_tag LOCUS_24530 CDS 890..2005 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene pheA CDS 2015..2899 product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930098.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 sequence362 source 1..3375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 945..2879 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807270.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 sequence363 source 1..3374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..1312) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191856.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 misc_feature complement(1358..>3374) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192524.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein locus_tag LOCUS_24580 sequence364 source 1..3348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 572..1378 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821323.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 1380..2093 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS 2138..3340 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 sequence365 source 1..3345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3258 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818292.1:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_24620 sequence366 source 1..3332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..958 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112947.1:phosphoglycerate dehydrogenase locus_tag LOCUS_24630 sequence367 source 1..3283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..650 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706827.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 650..1315 product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(1376..1924) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene lolA misc_feature complement(2070..>3283) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186104.1:DNA translocase FtsK locus_tag LOCUS_24670 sequence368 source 1..3262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..767 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202737.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 861..1739 product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 sequence369 source 1..3242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(690..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 1424..1756 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 1753..2640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 note possible pseudo, frameshifted sequence370 source 1..3240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 note possible pseudo, frameshifted CDS 389..1018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 1065..2201 product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2266..3195 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 sequence371 source 1..3235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2325 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255972.1:FtsX-like permease family protein locus_tag LOCUS_24770 sequence372 source 1..3219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113388.1:nitric oxide reductase transcriptional regulator NorR locus_tag LOCUS_24780 CDS 955..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 sequence373 source 1..3194 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 164..1591 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 1723..2673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 sequence374 source 1..3171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 793..1662 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 1659..2810 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 sequence375 source 1..3170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(412..1617) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 1818..2735 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(2839..3168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 sequence376 source 1..3169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(71..146) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(196..2118) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 tRNA complement(2178..2253) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(2268..2540) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 sequence377 source 1..3168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence378 source 1..3167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..583 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926363.1:class A beta-lactamase BOR-1 locus_tag LOCUS_24890 CDS complement(570..1916) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene argA misc_feature complement(2203..>3167) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225620.1:acyltransferase locus_tag LOCUS_24910 sequence379 source 1..3148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(480..1295) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 1401..1832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(1840..2724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508038.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 sequence380 source 1..3148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 929..1384 product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(1485..1817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 note possible pseudo, internal stop codon sequence381 source 1..3097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..924) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene mreC CDS complement(954..1997) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS 2203..2502 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189769.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene gatC sequence382 source 1..3064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 608..835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 881..2452 product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 2496..2882 product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187469.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 sequence383 source 1..3035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 412..1422 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(1498..2916) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338617.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene otsA sequence384 source 1..3017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(409..1668) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 1871..2383 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807300.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene def CDS 2380..2895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 sequence385 source 1..3011 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 294..920 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970933.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 996..1397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 1501..1848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 sequence386 source 1..3005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(904..1668) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(1948..2715) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 sequence387 source 1..2979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..683) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691360.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(729..1310) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(1355..1921) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 2163..2885 product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 sequence388 source 1..2974 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 902..1507 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(1610..2521) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039786.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 sequence389 source 1..2964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(419..2332) product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene nadN sequence390 source 1..2963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(891..1250) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene clpS misc_feature complement(1337..>2963) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522462.1:DNA polymerase III subunit alpha locus_tag LOCUS_25260 sequence391 source 1..2957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..1614 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807998.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 sequence392 source 1..2951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1213 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267428.1:Fe/S-dependent 2-methylisocitrate dehydratase AcnD locus_tag LOCUS_25280 CDS 1227..2429 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene prpF sequence393 source 1..2949 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 1069..2565 product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 2615..2836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 sequence394 source 1..2947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1905..2213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 misc_feature complement(2266..>2947) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193856.1:homoserine dehydrogenase locus_tag LOCUS_25340 sequence395 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1351 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 1397..2275 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 sequence396 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(499..1116) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(1205..2377) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2435..2944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 sequence397 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(892..2088) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 misc_feature complement(2172..>2944) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524520.1:ABC transporter substrate-binding protein locus_tag LOCUS_25410 sequence398 source 1..2930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 442..1518 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene murB misc_feature complement(1624..>2930) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815196.1:DASS family sodium-coupled anion symporter locus_tag LOCUS_25430 sequence399 source 1..2916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268309.1:monovalent cation/H+ antiporter subunit A locus_tag LOCUS_25440 CDS 2142..2507 product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 sequence400 source 1..2901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2386 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557112.1:oxygen sensor histidine kinase FixL locus_tag LOCUS_25460 sequence401 source 1..2883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(863..1198) product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189842.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(1195..1944) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 misc_feature complement(1941..>2883) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004549892.1:methionyl-tRNA formyltransferase locus_tag LOCUS_25490 sequence402 source 1..2882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..899 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190044.1:methionine ABC transporter ATP-binding protein locus_tag LOCUS_25500 CDS 910..1575 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189862.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 1738..2208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 misc_feature complement(2217..>2882) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199519479.1:IS3 family transposase locus_tag LOCUS_25530 sequence403 source 1..2865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(838..1638) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene trpC CDS complement(1709..1882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 misc_feature complement(1893..>2865) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186823.1:anthranilate phosphoribosyltransferase locus_tag LOCUS_25560 sequence404 source 1..2862 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 255..1994 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 misc_feature complement(2136..>2862) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814568.1:cell division protein FtsZ locus_tag LOCUS_25580 sequence405 source 1..2856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..833 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813626.1:dihydrolipoyl dehydrogenase locus_tag LOCUS_25590 CDS 911..2014 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene zapE CDS 2014..2700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 sequence406 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 349..1212 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 1295..1750 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 sequence407 source 1..2854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(325..>2854) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196276.1:DNA topoisomerase (ATP-hydrolyzing) subunit B locus_tag LOCUS_25640 sequence408 source 1..2849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(617..1399) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(1396..1905) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 misc_feature complement(1916..>2849) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528747.1:biotin-dependent carboxyl transferase locus_tag LOCUS_25670 sequence409 source 1..2837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1013..2143) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene dnaJ misc_feature complement(2239..>2837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194034.1:molecular chaperone DnaK locus_tag LOCUS_25690 sequence410 source 1..2825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 288..1754 product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 sequence411 source 1..2825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1020 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000980724.1:Tex family protein locus_tag LOCUS_25710 CDS 1093..1917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 sequence412 source 1..2815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(728..1588) product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene motA misc_feature complement(1795..>2815) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112503.1:B-type flagellin locus_tag LOCUS_25740 sequence413 source 1..2810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..979 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927222.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase locus_tag LOCUS_25750 CDS 976..1626 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene hisG sequence414 source 1..2809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 471..1448 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene guaC tRNA 1533..1608 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(1727..2809) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338153.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 sequence415 source 1..2808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..797 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532108.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene sufC CDS 802..2049 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533956.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene sufD sequence416 source 1..2801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..2490 product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196309.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2625..2801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 sequence417 source 1..2799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 214..1020 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 1017..1811 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448787.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 1834..2640 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181512989.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 sequence418 source 1..2799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..1245 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191909.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene pheS sequence419 source 1..2789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1243..1563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 1773..2345 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 sequence420 source 1..2771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..831) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(927..1904) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 misc_feature complement(1922..>2771) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807985.1:class I adenylate-forming enzyme family protein locus_tag LOCUS_25910 sequence421 source 1..2771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(660..1532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 note possible pseudo, frameshifted CDS complement(1550..1942) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 sequence422 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1529) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103605.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 sequence423 source 1..2758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..2666) product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 sequence424 source 1..2755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2290 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198365.1:DNA-directed RNA polymerase subunit beta locus_tag LOCUS_25960 sequence425 source 1..2754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(874..1290) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 misc_feature complement(1366..>2754) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185243.1:F0F1 ATP synthase subunit beta locus_tag LOCUS_25980 sequence426 source 1..2752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..1263) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 gene queF CDS complement(1322..2191) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038527.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2215..2601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 sequence427 source 1..2745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 873..1895 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 sequence428 source 1..2737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 1137..2033 product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 sequence429 source 1..2719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(780..1181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(1457..2629) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 note possible pseudo, internal stop codon sequence430 source 1..2714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 1093..2466 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085999.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 sequence431 source 1..2713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(16..771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 996..1634 product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524145.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 sequence432 source 1..2703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1265) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 gene cysT CDS complement(1413..2420) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 sequence433 source 1..2694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(743..1933) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818204.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 misc_feature complement(1930..>2694) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525974.1:bifunctional isocitrate dehydrogenase kinase/phosphatase locus_tag LOCUS_26150 sequence434 source 1..2662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2426 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930621.1:hydantoinase B/oxoprolinase family protein locus_tag LOCUS_26160 sequence435 source 1..2655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..652 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004266572.1:chorismate synthase locus_tag LOCUS_26170 CDS complement(729..1178) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene nrdR CDS complement(1191..2450) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 sequence436 source 1..2650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 104..1246 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(1448..2458) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 sequence437 source 1..2650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2228 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527208.1:phosphoribosylformylglycinamidine synthase locus_tag LOCUS_26220 sequence438 source 1..2644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..805 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064549.1:SMP-30/gluconolactonase/LRE family protein locus_tag LOCUS_26230 CDS complement(834..1535) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 sequence439 source 1..2627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence440 source 1..2618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 sequence441 source 1..2605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 873..1454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(1541..1885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(1878..2318) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 sequence442 source 1..2604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(198..1238) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(1235..2008) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2005..2604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 sequence443 source 1..2591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1026 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004551047.1:nitronate monooxygenase locus_tag LOCUS_26320 CDS complement(1095..2081) product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196337679.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence444 source 1..2588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(511..1179) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene hisH CDS complement(1230..1862) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene hisB misc_feature complement(1859..>2588) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199913.1:histidinol-phosphate transaminase locus_tag LOCUS_26360 sequence445 source 1..2585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..834 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192539.1:NAD-dependent DNA ligase LigA locus_tag LOCUS_26370 CDS 835..1785 product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169303.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene rssA sequence446 source 1..2584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 sequence447 source 1..2574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 444..2330 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 sequence448 source 1..2558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 631..1128 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039646.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene lspA sequence449 source 1..2549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1407 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088615.1:galactarate dehydratase locus_tag LOCUS_26430 CDS 1457..2515 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 sequence450 source 1..2546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2087 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III locus_tag LOCUS_26450 CDS 2092..2442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 sequence451 source 1..2542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1211..1930) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930861.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 sequence452 source 1..2541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..1105 product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene cas1f sequence453 source 1..2540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1015 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004556617.1:aldehyde dehydrogenase family protein locus_tag LOCUS_26490 CDS 1111..2142 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene adhP sequence454 source 1..2537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..325) product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene priB CDS complement(351..728) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene rpsF CDS 975..1511 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene grpE sequence455 source 1..2524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1205 product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275299.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(1209..1676) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 sequence456 source 1..2518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 499..2178 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 sequence457 source 1..2516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence458 source 1..2516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence459 source 1..2514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..1051) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 sequence460 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1701..2513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 sequence461 source 1..2507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..564 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene ompR CDS 648..2153 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 sequence462 source 1..2504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..277) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054775.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(336..1019) product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086682.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(1013..2140) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872371.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 sequence463 source 1..2502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..1838 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 sequence464 source 1..2486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(823..1227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(1297..2463) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811748.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 sequence465 source 1..2467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 976..2376 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 sequence466 source 1..2465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1368 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391071.1:heavy metal translocating P-type ATPase metal-binding domain-containing protein locus_tag LOCUS_26680 sequence467 source 1..2464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1094 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(1160..1831) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 misc_feature complement(1892..>2464) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038986.1:SDR family oxidoreductase locus_tag LOCUS_26710 sequence468 source 1..2454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 719..901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 sequence469 source 1..2440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..1339 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 gene ruvA sequence470 source 1..2439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1224) product tricarballylate utilization LysR family transcriptional regulator TcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704753.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene tcuR CDS 1291..2403 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene mnmA sequence471 source 1..2404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..1166) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039165.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 misc_feature complement(1230..>2404) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085661.1:ABC transporter substrate-binding protein locus_tag LOCUS_26770 sequence472 source 1..2386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 521..913 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(1003..1917) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene ppk2 sequence473 source 1..2358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1054 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040647.1:F0F1 ATP synthase subunit alpha locus_tag LOCUS_26810 CDS 1073..1939 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene atpG sequence474 source 1..2347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..939 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096642.1:U32 family peptidase locus_tag LOCUS_26830 sequence475 source 1..2347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1583 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102804916.1:3-phosphoshikimate 1-carboxyvinyltransferase locus_tag LOCUS_26840 sequence476 source 1..2340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1522..1953 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192504.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 sequence477 source 1..2336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 278..354 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 593..1765 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene carA CDS 1787..2188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 sequence478 source 1..2326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(275..2119) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038764.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 gene thiC sequence479 source 1..2322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1105..1473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 1522..2178 product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene ccmA sequence480 source 1..2306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(337..588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 misc_feature complement(1665..>2306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038917.1:electron transfer flavoprotein subunit alpha/FixB family protein locus_tag LOCUS_26920 sequence481 source 1..2306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence482 source 1..2287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..641 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525818.1:chromosomal replication initiator protein DnaA locus_tag LOCUS_26930 CDS 786..1892 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene dnaN sequence483 source 1..2285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence484 source 1..2265 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(229..753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 950..1981 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 sequence485 source 1..2264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence486 source 1..2221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(307..1386) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 misc_feature complement(1405..>2221) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065013.1:phosphoribosylformylglycinamidine cyclo-ligase locus_tag LOCUS_26980 sequence487 source 1..2193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..847 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040039036.1:GNAT family N-acetyltransferase locus_tag LOCUS_26990 CDS 854..1207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 1252..1833 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 sequence488 source 1..2185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 653..1855 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 sequence489 source 1..2180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 207..1235 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene meaB sequence490 source 1..2171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(708..1571) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene nadC sequence491 source 1..2168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..852 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012695322.1:cobyric acid synthase locus_tag LOCUS_27050 CDS 1109..1867 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene bluB sequence492 source 1..2167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1260) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 misc_feature complement(1288..>2167) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521908.1:porphobilinogen synthase locus_tag LOCUS_27080 sequence493 source 1..2152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 654..1160 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 misc_feature complement(1229..>2152) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813554.1:GNAT family N-acetyltransferase locus_tag LOCUS_27100 sequence494 source 1..2133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 536..1819 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 sequence495 source 1..2129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1405 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193192.1:glutamine-hydrolyzing GMP synthase locus_tag LOCUS_27130 sequence496 source 1..2124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(861..1955) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene ychF sequence497 source 1..2105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(417..1781) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene rseP sequence498 source 1..2097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(723..1772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 sequence499 source 1..2092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1280..1801) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene mreD sequence500 source 1..2088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..1876) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 sequence501 source 1..2077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(478..1008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(1023..1592) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene cobO CDS complement(1630..1830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 sequence502 source 1..2076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(242..1117) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 sequence503 source 1..2062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(614..>2062) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039835.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type locus_tag LOCUS_27250 sequence504 source 1..2060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..1064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(1061..1738) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 sequence505 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence506 source 1..2009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(897..>2009) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin locus_tag LOCUS_27280 sequence507 source 1..1994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 301..1422 product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 sequence508 source 1..1979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence509 source 1..1975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(806..>1975) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012468297.1:NarK family nitrate/nitrite MFS transporter locus_tag LOCUS_27300 sequence510 source 1..1963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(250..1365) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 note possible pseudo, internal stop codon, frameshifted sequence511 source 1..1956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..533 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527888.1:histidinol dehydrogenase locus_tag LOCUS_27320 CDS 684..1400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 sequence512 source 1..1945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1109 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813930.1:NADH-quinone oxidoreductase subunit NuoF locus_tag LOCUS_27340 sequence513 source 1..1914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 367..1185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 sequence514 source 1..1888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526128.1:acyl-CoA dehydrogenase C-terminal domain-containing protein locus_tag LOCUS_27360 CDS 695..1069 product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526860.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 sequence515 source 1..1875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1053..1349) product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184704.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 sequence516 source 1..1854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1345..>1854) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930624.1:tripartite tricarboxylate transporter substrate binding protein locus_tag LOCUS_27390 sequence517 source 1..1842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(185..>1842) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064356.1:tetrathionate reductase subunit A locus_tag LOCUS_27400 sequence518 source 1..1822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence519 source 1..1822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1371 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186431.1:lipid A export permease/ATP-binding protein MsbA locus_tag LOCUS_27410 sequence520 source 1..1811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..1570) product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 sequence521 source 1..1807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(450..1166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 misc_feature complement(1273..>1807) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195818.1:ParB/RepB/Spo0J family partition protein locus_tag LOCUS_27440 sequence522 source 1..1774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1006..1491 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202739.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 sequence523 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..600 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114332.1:lytic murein transglycosylase locus_tag LOCUS_27460 CDS complement(693..1403) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 sequence524 source 1..1753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence525 source 1..1751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 1074..1502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 sequence526 source 1..1750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1038 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403067.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 misc_feature complement(1084..>1750) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038711.1:lysophospholipid acyltransferase family protein locus_tag LOCUS_27510 sequence527 source 1..1748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211867.1:type I-F CRISPR-associated protein Csy3 locus_tag LOCUS_27520 CDS 860..1453 product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene cas6f repeat_region 1582..1729 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcgtaggcagctcagaaa sequence528 source 1..1745 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence529 source 1..1734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 misc_feature complement(648..>1734) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064165.1:acetate--CoA ligase family protein locus_tag LOCUS_27550 sequence530 source 1..1722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..1027) product Bug family tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 misc_feature complement(1161..>1722) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225520.1:argininosuccinate lyase locus_tag LOCUS_27570 sequence531 source 1..1721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..1518) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383177.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 sequence532 source 1..1717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..921 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522260.1:phosphomannomutase/phosphoglucomutase locus_tag LOCUS_27590 sequence533 source 1..1686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(684..1235) product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene mobB sequence534 source 1..1685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence535 source 1..1672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..1042 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 sequence536 source 1..1671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence537 source 1..1660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 65..141 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 341..910 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene phaR sequence538 source 1..1658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1153 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193113.1:phenylalanine--tRNA ligase subunit beta locus_tag LOCUS_27630 CDS 1150..1500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 sequence539 source 1..1641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1070) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 misc_feature complement(1078..>1641) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004557251.1:4-hydroxy-tetrahydrodipicolinate reductase locus_tag LOCUS_27660 sequence540 source 1..1609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(435..>1609) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202033.1:ATP-dependent RNA helicase HrpA locus_tag LOCUS_27670 sequence541 source 1..1609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(585..1301) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 sequence542 source 1..1594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1462 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201419176.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase locus_tag LOCUS_27690 sequence543 source 1..1590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..1589) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 sequence544 source 1..1583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814268.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 sequence545 source 1..1571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1005 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227918.1:2-aminoadipate transaminase locus_tag LOCUS_27720 CDS 1011..1226 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 sequence546 source 1..1509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(487..>1509) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064994.1:CaiB/BaiF CoA-transferase family protein locus_tag LOCUS_27740 sequence547 source 1..1465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..1142 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 note possible pseudo, internal stop codon tRNA 1188..1280 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 sequence548 source 1..1454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1009 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704752.1:FAD-dependent tricarballylate dehydrogenase TcuA locus_tag LOCUS_27760 sequence549 source 1..1446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..1445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 sequence550 source 1..1434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(799..>1434) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813705.1:CTP synthase locus_tag LOCUS_27780 sequence551 source 1..1389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence552 source 1..1383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1156 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064327.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB locus_tag LOCUS_27790 sequence553 source 1..1362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(486..1139) product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815451.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene alkB sequence554 source 1..1354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(737..1129) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 sequence555 source 1..1350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 note possible pseudo, internal stop codon CDS 746..1306 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 sequence556 source 1..1346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence557 source 1..1314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence558 source 1..1313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence559 source 1..1309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(518..>1309) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198896.1:succinyldiaminopimelate transaminase locus_tag LOCUS_27840 sequence560 source 1..1302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 66..141 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(169..1203) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence561 source 1..1295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..926) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene yaaA sequence562 source 1..1255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence563 source 1..1253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(327..>1253) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928938.1:cyanophycin synthetase locus_tag LOCUS_27870 sequence564 source 1..1251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence565 source 1..1250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 sequence566 source 1..1246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 340..1041 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 sequence567 source 1..1243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 663..1208 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 sequence568 source 1..1228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..913) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494241.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 sequence569 source 1..1208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..862 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808393.1:arginine/lysine/ornithine decarboxylase locus_tag LOCUS_27930 sequence570 source 1..1180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(493..>1180) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994212.1:TSUP family transporter locus_tag LOCUS_27940 sequence571 source 1..1172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence572 source 1..1154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..826 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene ispH sequence573 source 1..1122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(612..902) product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065135.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 sequence574 source 1..1110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence575 source 1..1110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(431..>1110) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812368.1:IMP dehydrogenase locus_tag LOCUS_27970 sequence576 source 1..1105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence577 source 1..1097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence578 source 1..1097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence579 source 1..1095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..711 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194129.1:ribonucleotide-diphosphate reductase subunit beta locus_tag LOCUS_27980 sequence580 source 1..1089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(153..>1089) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815895.1:peptide chain release factor 3 locus_tag LOCUS_27990 sequence581 source 1..1052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..889 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene speD sequence582 source 1..1044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence583 source 1..1033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@