>Feature sequence001 <1 720 gene locus_tag LOCUS_00010 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815010.1:ABC transporter ATP-binding protein 717 1433 gene locus_tag LOCUS_00020 717 1433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_00020 2602 1658 gene locus_tag LOCUS_00030 2602 1658 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819265.1 protein_id gnl|my_center|LOCUS_00030 4112 2658 gene locus_tag LOCUS_00040 gene rng 4112 2658 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_00040 4743 4126 gene locus_tag LOCUS_00050 4743 4126 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_00050 5236 4766 gene locus_tag LOCUS_00060 gene rlmH 5236 4766 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 protein_id gnl|my_center|LOCUS_00060 5357 5238 gene locus_tag LOCUS_00070 5357 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6313 5621 gene locus_tag LOCUS_00080 gene nadD 6313 5621 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_00080 7106 6303 gene locus_tag LOCUS_00090 7106 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7912 7121 gene locus_tag LOCUS_00100 7912 7121 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039159.1 protein_id gnl|my_center|LOCUS_00100 8909 7953 gene locus_tag LOCUS_00110 8909 7953 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_00110 9573 8941 gene locus_tag LOCUS_00120 9573 8941 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_00120 9893 9570 gene locus_tag LOCUS_00130 9893 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10724 9999 gene locus_tag LOCUS_00140 10724 9999 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_00140 10896 13658 gene locus_tag LOCUS_00150 gene polA 10896 13658 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_00150 14372 13755 gene locus_tag LOCUS_00160 14372 13755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_00160 14538 15716 gene locus_tag LOCUS_00170 14538 15716 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_00170 15727 18882 gene locus_tag LOCUS_00180 15727 18882 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_00180 18884 20359 gene locus_tag LOCUS_00190 gene oprM 18884 20359 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_00190 20432 21229 gene locus_tag LOCUS_00200 20432 21229 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_00200 21289 22323 gene locus_tag LOCUS_00210 21289 22323 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_00210 22858 22418 gene locus_tag LOCUS_00220 22858 22418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23130 25586 gene locus_tag LOCUS_00230 23130 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25687 27105 gene locus_tag LOCUS_00240 25687 27105 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_00240 27102 28475 gene locus_tag LOCUS_00250 27102 28475 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_00250 28888 28517 gene locus_tag LOCUS_00260 28888 28517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29203 28910 gene locus_tag LOCUS_00270 29203 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30906 29200 gene locus_tag LOCUS_00280 30906 29200 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198453.1 protein_id gnl|my_center|LOCUS_00280 31208 30915 gene locus_tag LOCUS_00290 31208 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31207 31812 gene locus_tag LOCUS_00300 31207 31812 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_00300 32023 32358 gene locus_tag LOCUS_00310 32023 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32526 33062 gene locus_tag LOCUS_00320 32526 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33066 34565 gene locus_tag LOCUS_00330 33066 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34562 35176 gene locus_tag LOCUS_00340 34562 35176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35173 35814 gene locus_tag LOCUS_00350 35173 35814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37260 35872 gene locus_tag LOCUS_00360 37260 35872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37474 38310 gene locus_tag LOCUS_00370 37474 38310 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_00370 38432 39154 gene locus_tag LOCUS_00380 38432 39154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966372.1 protein_id gnl|my_center|LOCUS_00380 39304 40059 gene locus_tag LOCUS_00390 gene modA 39304 40059 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_00390 40064 40741 gene locus_tag LOCUS_00400 gene modB 40064 40741 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_00400 40743 41828 gene locus_tag LOCUS_00410 gene modC 40743 41828 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_00410 41887 42786 gene locus_tag LOCUS_00420 41887 42786 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_00420 42830 43483 gene locus_tag LOCUS_00430 42830 43483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_00430 43985 43512 gene locus_tag LOCUS_00440 43985 43512 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_00440 44431 44048 gene locus_tag LOCUS_00450 44431 44048 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_00450 44700 44428 gene locus_tag LOCUS_00460 44700 44428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 44816 45757 gene locus_tag LOCUS_00470 44816 45757 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_00470 46313 45933 gene locus_tag LOCUS_00480 46313 45933 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_00480 47312 46335 gene locus_tag LOCUS_00490 gene cysK 47312 46335 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 protein_id gnl|my_center|LOCUS_00490 47511 50030 gene locus_tag LOCUS_00500 47511 50030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52875 50059 gene locus_tag LOCUS_00510 52875 50059 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_00510 53160 53819 gene locus_tag LOCUS_00520 53160 53819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00520 53853 54404 gene locus_tag LOCUS_00530 53853 54404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00530 54467 55228 gene locus_tag LOCUS_00540 54467 55228 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_00540 55436 55660 gene locus_tag LOCUS_00550 55436 55660 CDS product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111981.1 protein_id gnl|my_center|LOCUS_00550 56250 55801 gene locus_tag LOCUS_00560 gene cynS 56250 55801 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072180.1 protein_id gnl|my_center|LOCUS_00560 57264 56353 gene locus_tag LOCUS_00570 gene rlmA 57264 56353 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_00570 <58711 57399 gene locus_tag LOCUS_00580 <58711 57399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524499.1:trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence002 1696 920 gene locus_tag LOCUS_00590 gene fpr 1696 920 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_00590 1796 2722 gene locus_tag LOCUS_00600 1796 2722 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_00600 4376 2838 gene locus_tag LOCUS_00610 gene murJ 4376 2838 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_00610 4513 4779 gene locus_tag LOCUS_00620 gene rpsT 4513 4779 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_00620 5259 4969 gene locus_tag LOCUS_00630 5259 4969 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 protein_id gnl|my_center|LOCUS_00630 5630 6805 gene locus_tag LOCUS_00640 5630 6805 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_00640 6815 7738 gene locus_tag LOCUS_00650 gene argF 6815 7738 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_00650 7810 9039 gene locus_tag LOCUS_00660 7810 9039 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363593.1 protein_id gnl|my_center|LOCUS_00660 9111 9341 gene locus_tag LOCUS_00670 9111 9341 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212781.1 protein_id gnl|my_center|LOCUS_00670 9357 9692 gene locus_tag LOCUS_00680 9357 9692 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_00680 9715 10200 gene locus_tag LOCUS_00690 9715 10200 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_00690 10469 10648 gene locus_tag LOCUS_00700 10469 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 11105 10716 gene locus_tag LOCUS_00710 11105 10716 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_00710 12751 11201 gene locus_tag LOCUS_00720 12751 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 14092 12776 gene locus_tag LOCUS_00730 14092 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 14799 14176 gene locus_tag LOCUS_00740 14799 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 15362 14793 gene locus_tag LOCUS_00750 15362 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 15729 16370 gene locus_tag LOCUS_00760 15729 16370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 16449 17378 gene locus_tag LOCUS_00770 16449 17378 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_00770 17407 18588 gene locus_tag LOCUS_00780 17407 18588 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_00780 19098 18688 gene locus_tag LOCUS_00790 gene msrB 19098 18688 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_00790 20271 19102 gene locus_tag LOCUS_00800 20271 19102 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_00800 21254 20421 gene locus_tag LOCUS_00810 21254 20421 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_00810 21383 23749 gene locus_tag LOCUS_00820 gene ppsA 21383 23749 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_00820 23942 27037 gene locus_tag LOCUS_00830 23942 27037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 28632 27100 gene locus_tag LOCUS_00840 28632 27100 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_00840 28909 30873 gene locus_tag LOCUS_00850 gene acs 28909 30873 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_00850 31067 31267 gene locus_tag LOCUS_00860 31067 31267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 31281 34025 gene locus_tag LOCUS_00870 31281 34025 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092687825.1 protein_id gnl|my_center|LOCUS_00870 34056 34424 gene locus_tag LOCUS_00880 34056 34424 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_00880 34428 36656 gene locus_tag LOCUS_00890 34428 36656 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_00890 36691 38736 gene locus_tag LOCUS_00900 36691 38736 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_00900 39237 38815 gene locus_tag LOCUS_00910 39237 38815 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_00910 39427 42012 gene locus_tag LOCUS_00920 gene clpB 39427 42012 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_00920 42216 44111 gene locus_tag LOCUS_00930 gene ppiD 42216 44111 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969331.1 protein_id gnl|my_center|LOCUS_00930 45046 44249 gene locus_tag LOCUS_00940 gene fabI 45046 44249 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_00940 45241 47484 gene locus_tag LOCUS_00950 45241 47484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_00950 47484 48461 gene locus_tag LOCUS_00960 47484 48461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_00960 48470 49960 gene locus_tag LOCUS_00970 48470 49960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_00970 50106 51695 gene locus_tag LOCUS_00980 50106 51695 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_00980 51855 52616 gene locus_tag LOCUS_00990 51855 52616 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_00990 52875 54137 gene locus_tag LOCUS_01000 52875 54137 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193983.1 protein_id gnl|my_center|LOCUS_01000 54171 55835 gene locus_tag LOCUS_01010 54171 55835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence003 262 1683 gene locus_tag LOCUS_01020 gene boxB 262 1683 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_01020 1793 3043 gene locus_tag LOCUS_01030 1793 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 4792 3209 gene locus_tag LOCUS_01040 4792 3209 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_01040 5080 5991 gene locus_tag LOCUS_01050 5080 5991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_01050 6031 6639 gene locus_tag LOCUS_01060 6031 6639 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979815.1 protein_id gnl|my_center|LOCUS_01060 7432 6884 gene locus_tag LOCUS_01070 7432 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 7723 8754 gene locus_tag LOCUS_01080 7723 8754 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_01080 8967 10295 gene locus_tag LOCUS_01090 8967 10295 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 protein_id gnl|my_center|LOCUS_01090 11503 10283 gene locus_tag LOCUS_01100 11503 10283 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111432.1 protein_id gnl|my_center|LOCUS_01100 13329 11569 gene locus_tag LOCUS_01110 gene ngg 13329 11569 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_01110 15112 13340 gene locus_tag LOCUS_01120 15112 13340 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389742.1 protein_id gnl|my_center|LOCUS_01120 17106 15298 gene locus_tag LOCUS_01130 17106 15298 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821527.1 protein_id gnl|my_center|LOCUS_01130 17903 17136 gene locus_tag LOCUS_01140 17903 17136 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_01140 19184 17925 gene locus_tag LOCUS_01150 19184 17925 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267920.1 protein_id gnl|my_center|LOCUS_01150 19957 19181 gene locus_tag LOCUS_01160 19957 19181 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312496.1 protein_id gnl|my_center|LOCUS_01160 21840 19975 gene locus_tag LOCUS_01170 21840 19975 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921377.1 protein_id gnl|my_center|LOCUS_01170 23015 21870 gene locus_tag LOCUS_01180 23015 21870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_01180 23341 24243 gene locus_tag LOCUS_01190 23341 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 25205 24240 gene locus_tag LOCUS_01200 25205 24240 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 protein_id gnl|my_center|LOCUS_01200 25359 26399 gene locus_tag LOCUS_01210 gene gtdA 25359 26399 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706105.1 protein_id gnl|my_center|LOCUS_01210 26447 27157 gene locus_tag LOCUS_01220 26447 27157 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930981.1 protein_id gnl|my_center|LOCUS_01220 27184 28392 gene locus_tag LOCUS_01230 27184 28392 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 protein_id gnl|my_center|LOCUS_01230 28407 29045 gene locus_tag LOCUS_01240 gene maiA 28407 29045 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_01240 29098 30081 gene locus_tag LOCUS_01250 29098 30081 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_01250 30256 30753 gene locus_tag LOCUS_01260 30256 30753 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 protein_id gnl|my_center|LOCUS_01260 30750 32027 gene locus_tag LOCUS_01270 30750 32027 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_01270 32083 32628 gene locus_tag LOCUS_01280 32083 32628 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064361.1 protein_id gnl|my_center|LOCUS_01280 32734 33759 gene locus_tag LOCUS_01290 32734 33759 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_01290 35194 33869 gene locus_tag LOCUS_01300 35194 33869 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_01300 35715 35191 gene locus_tag LOCUS_01310 35715 35191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 36815 35790 gene locus_tag LOCUS_01320 36815 35790 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_01320 38324 37302 gene locus_tag LOCUS_01330 38324 37302 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_01330 39468 38473 gene locus_tag LOCUS_01340 39468 38473 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815513.1 protein_id gnl|my_center|LOCUS_01340 40546 39587 gene locus_tag LOCUS_01350 gene iolG 40546 39587 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193713.1 protein_id gnl|my_center|LOCUS_01350 41400 40546 gene locus_tag LOCUS_01360 41400 40546 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_01360 41870 41403 gene locus_tag LOCUS_01370 41870 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 42787 41873 gene locus_tag LOCUS_01380 42787 41873 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_01380 43596 42907 gene locus_tag LOCUS_01390 43596 42907 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_01390 44636 43611 gene locus_tag LOCUS_01400 44636 43611 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_01400 45727 44633 gene locus_tag LOCUS_01410 45727 44633 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_01410 45931 46830 gene locus_tag LOCUS_01420 45931 46830 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625915.1 protein_id gnl|my_center|LOCUS_01420 46908 47723 gene locus_tag LOCUS_01430 46908 47723 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_01430 49130 47811 gene locus_tag LOCUS_01440 49130 47811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 49360 49139 gene locus_tag LOCUS_01450 49360 49139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 49597 49379 gene locus_tag LOCUS_01460 49597 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 50161 49769 gene locus_tag LOCUS_01470 50161 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 51190 50198 gene locus_tag LOCUS_01480 51190 50198 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392896.1 protein_id gnl|my_center|LOCUS_01480 51777 51310 gene locus_tag LOCUS_01490 51777 51310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 52472 51777 gene locus_tag LOCUS_01500 52472 51777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 52921 52469 gene locus_tag LOCUS_01510 52921 52469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 53794 52940 gene locus_tag LOCUS_01520 53794 52940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 <54880 53903 gene locus_tag LOCUS_01530 <54880 53903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391988.1:molybdopterin-dependent oxidoreductase >Feature sequence004 1842 742 gene locus_tag LOCUS_01540 1842 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2027 2422 gene locus_tag LOCUS_01550 2027 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2550 4823 gene locus_tag LOCUS_01560 2550 4823 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_01560 5053 6039 gene locus_tag LOCUS_01570 5053 6039 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337702.1 protein_id gnl|my_center|LOCUS_01570 6059 7204 gene locus_tag LOCUS_01580 6059 7204 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 protein_id gnl|my_center|LOCUS_01580 7218 7385 gene locus_tag LOCUS_01590 7218 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7603 8859 gene locus_tag LOCUS_01600 7603 8859 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_01600 8852 9559 gene locus_tag LOCUS_01610 gene lolD 8852 9559 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_01610 9607 12093 gene locus_tag LOCUS_01620 9607 12093 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_01620 12202 13122 gene locus_tag LOCUS_01630 12202 13122 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_01630 14084 13140 gene locus_tag LOCUS_01640 gene rsgA 14084 13140 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_01640 15352 14081 gene locus_tag LOCUS_01650 15352 14081 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_01650 15520 16068 gene locus_tag LOCUS_01660 gene orn 15520 16068 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_01660 17860 16202 gene locus_tag LOCUS_01670 17860 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_01670 18273 18055 gene locus_tag LOCUS_01680 gene rpmE 18273 18055 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_01680 18449 19450 gene locus_tag LOCUS_01690 18449 19450 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_01690 19565 20239 gene locus_tag LOCUS_01700 19565 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 20340 21098 gene locus_tag LOCUS_01710 20340 21098 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_01710 21091 21420 gene locus_tag LOCUS_01720 21091 21420 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_01720 21547 21906 gene locus_tag LOCUS_01730 21547 21906 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_01730 22372 21956 gene locus_tag LOCUS_01740 22372 21956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 22546 22779 gene locus_tag LOCUS_01750 22546 22779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 23255 24256 gene locus_tag LOCUS_01760 23255 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 24474 24770 gene locus_tag LOCUS_01770 24474 24770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 24767 26176 gene locus_tag LOCUS_01780 24767 26176 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 protein_id gnl|my_center|LOCUS_01780 27103 26525 gene locus_tag LOCUS_01790 27103 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 29701 27545 gene locus_tag LOCUS_01800 29701 27545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 30585 29701 gene locus_tag LOCUS_01810 30585 29701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 33356 30588 gene locus_tag LOCUS_01820 gene mksF 33356 30588 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103377.1 protein_id gnl|my_center|LOCUS_01820 33955 33353 gene locus_tag LOCUS_01830 33955 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 35208 33952 gene locus_tag LOCUS_01840 gene mksB 35208 33952 CDS product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095037.1 protein_id gnl|my_center|LOCUS_01840 36379 35231 gene locus_tag LOCUS_01850 36379 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 38604 36379 gene locus_tag LOCUS_01860 38604 36379 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_01860 41608 38615 gene locus_tag LOCUS_01870 41608 38615 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_01870 42766 41612 gene locus_tag LOCUS_01880 42766 41612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 44294 42759 gene locus_tag LOCUS_01890 44294 42759 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_01890 45778 44282 gene locus_tag LOCUS_01900 45778 44282 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_01900 46030 47709 gene locus_tag LOCUS_01910 46030 47709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 47706 49193 gene locus_tag LOCUS_01920 47706 49193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence005 229 1365 gene locus_tag LOCUS_01930 229 1365 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_01930 1365 3761 gene locus_tag LOCUS_01940 1365 3761 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_01940 3780 4250 gene locus_tag LOCUS_01950 3780 4250 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_01950 4372 5454 gene locus_tag LOCUS_01960 4372 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 7321 5492 gene locus_tag LOCUS_01970 7321 5492 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_01970 7630 9624 gene locus_tag LOCUS_01980 7630 9624 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_01980 9661 10899 gene locus_tag LOCUS_01990 9661 10899 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539814.1 protein_id gnl|my_center|LOCUS_01990 10896 11387 gene locus_tag LOCUS_02000 10896 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11384 12766 gene locus_tag LOCUS_02010 gene accC 11384 12766 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064215.1 protein_id gnl|my_center|LOCUS_02010 12768 14255 gene locus_tag LOCUS_02020 12768 14255 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_02020 14248 15129 gene locus_tag LOCUS_02030 14248 15129 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 protein_id gnl|my_center|LOCUS_02030 15257 16792 gene locus_tag LOCUS_02040 15257 16792 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_02040 16815 17618 gene locus_tag LOCUS_02050 16815 17618 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_02050 17660 18406 gene locus_tag LOCUS_02060 17660 18406 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_02060 18448 19632 gene locus_tag LOCUS_02070 18448 19632 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111467.1 protein_id gnl|my_center|LOCUS_02070 19671 20678 gene locus_tag LOCUS_02080 19671 20678 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_02080 20753 21376 gene locus_tag LOCUS_02090 20753 21376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 21376 22725 gene locus_tag LOCUS_02100 21376 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 22885 23022 gene locus_tag LOCUS_02110 22885 23022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 23019 23369 gene locus_tag LOCUS_02120 23019 23369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 24223 23465 gene locus_tag LOCUS_02130 24223 23465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 25928 24237 gene locus_tag LOCUS_02140 25928 24237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886809.1 protein_id gnl|my_center|LOCUS_02140 26848 25928 gene locus_tag LOCUS_02150 26848 25928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 27042 26845 gene locus_tag LOCUS_02160 27042 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 27233 27039 gene locus_tag LOCUS_02170 27233 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 27519 28748 gene locus_tag LOCUS_02180 27519 28748 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_02180 28756 29466 gene locus_tag LOCUS_02190 28756 29466 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_02190 30698 29670 gene locus_tag LOCUS_02200 30698 29670 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188361.1 protein_id gnl|my_center|LOCUS_02200 31980 30802 gene locus_tag LOCUS_02210 31980 30802 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_02210 33155 31980 gene locus_tag LOCUS_02220 33155 31980 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_02220 34699 33236 gene locus_tag LOCUS_02230 34699 33236 CDS product benzaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920255.1 protein_id gnl|my_center|LOCUS_02230 34946 36097 gene locus_tag LOCUS_02240 34946 36097 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 protein_id gnl|my_center|LOCUS_02240 36286 37314 gene locus_tag LOCUS_02250 36286 37314 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_02250 38334 37363 gene locus_tag LOCUS_02260 38334 37363 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_02260 40583 38385 gene locus_tag LOCUS_02270 40583 38385 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_02270 41464 40679 gene locus_tag LOCUS_02280 41464 40679 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063886.1 protein_id gnl|my_center|LOCUS_02280 43206 41539 gene locus_tag LOCUS_02290 43206 41539 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815953.1 protein_id gnl|my_center|LOCUS_02290 43396 43980 gene locus_tag LOCUS_02300 43396 43980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 43988 44500 gene locus_tag LOCUS_02310 43988 44500 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_02310 44497 44994 gene locus_tag LOCUS_02320 44497 44994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 46220 45012 gene locus_tag LOCUS_02330 46220 45012 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_02330 47476 46283 gene locus_tag LOCUS_02340 47476 46283 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087191.1 protein_id gnl|my_center|LOCUS_02340 47749 48801 gene locus_tag LOCUS_02350 47749 48801 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence006 834 1703 gene locus_tag LOCUS_02360 834 1703 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_02360 2581 1739 gene locus_tag LOCUS_02370 2581 1739 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_02370 3465 2647 gene locus_tag LOCUS_02380 3465 2647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_02380 3736 3521 gene locus_tag LOCUS_02390 3736 3521 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_02390 3937 4491 gene locus_tag LOCUS_02400 gene greB 3937 4491 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_02400 4595 6526 gene locus_tag LOCUS_02410 gene htpG 4595 6526 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_02410 7627 6662 gene locus_tag LOCUS_02420 7627 6662 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 protein_id gnl|my_center|LOCUS_02420 8764 7715 gene locus_tag LOCUS_02430 8764 7715 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112296.1 protein_id gnl|my_center|LOCUS_02430 9615 8854 gene locus_tag LOCUS_02440 9615 8854 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 protein_id gnl|my_center|LOCUS_02440 11169 9754 gene locus_tag LOCUS_02450 11169 9754 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992237.1 protein_id gnl|my_center|LOCUS_02450 11384 11878 gene locus_tag LOCUS_02460 11384 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13258 12080 gene locus_tag LOCUS_02470 13258 12080 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_02470 14148 13297 gene locus_tag LOCUS_02480 14148 13297 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_02480 14307 14627 gene locus_tag LOCUS_02490 14307 14627 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185759.1 protein_id gnl|my_center|LOCUS_02490 14640 14978 gene locus_tag LOCUS_02500 14640 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 14997 16055 gene locus_tag LOCUS_02510 14997 16055 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_02510 16176 16751 gene locus_tag LOCUS_02520 16176 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 16754 17806 gene locus_tag LOCUS_02530 16754 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 18312 17857 gene locus_tag LOCUS_02540 18312 17857 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_02540 19025 18399 gene locus_tag LOCUS_02550 19025 18399 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_02550 20243 19116 gene locus_tag LOCUS_02560 20243 19116 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_02560 20927 20493 gene locus_tag LOCUS_02570 20927 20493 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_02570 21666 21034 gene locus_tag LOCUS_02580 gene nth 21666 21034 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_02580 22385 21681 gene locus_tag LOCUS_02590 22385 21681 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_02590 23056 22385 gene locus_tag LOCUS_02600 gene rsxG 23056 22385 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_02600 24072 23053 gene locus_tag LOCUS_02610 gene rsxD 24072 23053 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210599.1 protein_id gnl|my_center|LOCUS_02610 25807 24080 gene locus_tag LOCUS_02620 25807 24080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02620 26355 25804 gene locus_tag LOCUS_02630 gene rsxB 26355 25804 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_02630 27043 26459 gene locus_tag LOCUS_02640 gene rsxA 27043 26459 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072471.1 protein_id gnl|my_center|LOCUS_02640 27704 27156 gene locus_tag LOCUS_02650 27704 27156 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_02650 28806 27730 gene locus_tag LOCUS_02660 gene tal 28806 27730 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689551.1 protein_id gnl|my_center|LOCUS_02660 29768 28923 gene locus_tag LOCUS_02670 gene truC 29768 28923 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 protein_id gnl|my_center|LOCUS_02670 30391 29807 gene locus_tag LOCUS_02680 gene sodB 30391 29807 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_02680 31955 30570 gene locus_tag LOCUS_02690 gene xseA 31955 30570 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_02690 32302 32910 gene locus_tag LOCUS_02700 32302 32910 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_02700 32925 33356 gene locus_tag LOCUS_02710 32925 33356 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_02710 33367 34359 gene locus_tag LOCUS_02720 gene lpxK 33367 34359 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_02720 34340 34531 gene locus_tag LOCUS_02730 34340 34531 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_02730 34537 35346 gene locus_tag LOCUS_02740 gene kdsB 34537 35346 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367464.1 protein_id gnl|my_center|LOCUS_02740 35438 36091 gene locus_tag LOCUS_02750 gene adk 35438 36091 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_02750 36243 37499 gene locus_tag LOCUS_02760 36243 37499 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 protein_id gnl|my_center|LOCUS_02760 37540 38877 gene locus_tag LOCUS_02770 37540 38877 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706263.1 protein_id gnl|my_center|LOCUS_02770 41503 38888 gene locus_tag LOCUS_02780 gene ndvB 41503 38888 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_02780 41786 42178 gene locus_tag LOCUS_02790 41786 42178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 43726 42110 gene locus_tag LOCUS_02800 43726 42110 CDS product beta-1,6-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087383.1 protein_id gnl|my_center|LOCUS_02800 46790 43896 gene locus_tag LOCUS_02810 gene gcvP 46790 43896 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114051.1 protein_id gnl|my_center|LOCUS_02810 47324 46938 gene locus_tag LOCUS_02820 gene gcvH 47324 46938 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_02820 48496 47405 gene locus_tag LOCUS_02830 gene gcvT 48496 47405 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808404.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence007 848 84 gene locus_tag LOCUS_02840 848 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 1168 929 gene locus_tag LOCUS_02850 1168 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1919 1224 gene locus_tag LOCUS_02860 1919 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3468 3046 gene locus_tag LOCUS_02870 3468 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4019 3759 gene locus_tag LOCUS_02880 4019 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4532 4077 gene locus_tag LOCUS_02890 gene merR 4532 4077 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_02890 4605 4955 gene locus_tag LOCUS_02900 4605 4955 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_02900 4969 5268 gene locus_tag LOCUS_02910 gene merP 4969 5268 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_02910 5272 5523 gene locus_tag LOCUS_02920 gene merF 5272 5523 CDS product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_02920 5603 7213 gene locus_tag LOCUS_02930 gene merA 5603 7213 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_02930 8225 7248 gene locus_tag LOCUS_02940 8225 7248 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_02940 8419 8979 gene locus_tag LOCUS_02950 8419 8979 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 protein_id gnl|my_center|LOCUS_02950 8982 11951 gene locus_tag LOCUS_02960 8982 11951 CDS product Tn3-like element TnAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138014.1 protein_id gnl|my_center|LOCUS_02960 12451 11984 gene locus_tag LOCUS_02970 12451 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12587 12438 gene locus_tag LOCUS_02980 12587 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13361 12588 gene locus_tag LOCUS_02990 13361 12588 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_02990 13670 14299 gene locus_tag LOCUS_03000 13670 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 18283 14354 gene locus_tag LOCUS_03010 18283 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 18887 18399 gene locus_tag LOCUS_03020 18887 18399 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_03020 20325 18904 gene locus_tag LOCUS_03030 20325 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 20780 20343 gene locus_tag LOCUS_03040 20780 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 22251 21271 gene locus_tag LOCUS_03050 22251 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 22456 22253 gene locus_tag LOCUS_03060 22456 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 22982 22590 gene locus_tag LOCUS_03070 22982 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 23324 22986 gene locus_tag LOCUS_03080 23324 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 25964 23424 gene locus_tag LOCUS_03090 25964 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 26350 25964 gene locus_tag LOCUS_03100 26350 25964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 27355 26846 gene locus_tag LOCUS_03110 27355 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 28034 27360 gene locus_tag LOCUS_03120 28034 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 28732 28031 gene locus_tag LOCUS_03130 28732 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 28920 28750 gene locus_tag LOCUS_03140 28920 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 29398 28934 gene locus_tag LOCUS_03150 29398 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 29762 29424 gene locus_tag LOCUS_03160 29762 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 30786 29875 gene locus_tag LOCUS_03170 30786 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 31610 30786 gene locus_tag LOCUS_03180 31610 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 31990 31607 gene locus_tag LOCUS_03190 31990 31607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 32669 32577 gene locus_tag LOCUS_t00010 32669 32577 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33958 32732 gene locus_tag LOCUS_03200 33958 32732 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_03200 34214 34510 gene locus_tag LOCUS_03210 34214 34510 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 protein_id gnl|my_center|LOCUS_03210 35404 34526 gene locus_tag LOCUS_03220 35404 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 35492 35935 gene locus_tag LOCUS_03230 gene queD 35492 35935 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_03230 36678 36079 gene locus_tag LOCUS_03240 36678 36079 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211757.1 protein_id gnl|my_center|LOCUS_03240 37969 36671 gene locus_tag LOCUS_03250 37969 36671 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_03250 38742 37981 gene locus_tag LOCUS_03260 38742 37981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 39398 38742 gene locus_tag LOCUS_03270 gene purN 39398 38742 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185746.1 protein_id gnl|my_center|LOCUS_03270 39550 41481 gene locus_tag LOCUS_03280 gene mutL 39550 41481 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 protein_id gnl|my_center|LOCUS_03280 42001 41501 gene locus_tag LOCUS_03290 42001 41501 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_03290 41895 42098 gene locus_tag LOCUS_03300 41895 42098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 42442 43134 gene locus_tag LOCUS_03310 42442 43134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 43138 43704 gene locus_tag LOCUS_03320 43138 43704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 43792 44787 gene locus_tag LOCUS_03330 gene miaA 43792 44787 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527674.1 protein_id gnl|my_center|LOCUS_03330 44833 45378 gene locus_tag LOCUS_03340 44833 45378 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 protein_id gnl|my_center|LOCUS_03340 <46363 45447 gene locus_tag LOCUS_03350 <46363 45447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040502.1:efflux RND transporter permease subunit >Feature sequence008 1813 719 gene locus_tag LOCUS_03360 gene rlmM 1813 719 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_03360 2014 3066 gene locus_tag LOCUS_03370 2014 3066 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_03370 3207 4454 gene locus_tag LOCUS_03380 gene ugpB 3207 4454 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_03380 4495 5520 gene locus_tag LOCUS_03390 gene ispB 4495 5520 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_03390 5569 5645 gene locus_tag LOCUS_t00020 5569 5645 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6634 5930 gene locus_tag LOCUS_03400 6634 5930 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199255.1 protein_id gnl|my_center|LOCUS_03400 7850 6837 gene locus_tag LOCUS_03410 7850 6837 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_03410 8557 7979 gene locus_tag LOCUS_03420 8557 7979 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_03420 9173 8613 gene locus_tag LOCUS_03430 9173 8613 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_03430 9741 9205 gene locus_tag LOCUS_03440 9741 9205 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_03440 9929 13759 gene locus_tag LOCUS_03450 gene recC 9929 13759 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_03450 13785 17663 gene locus_tag LOCUS_03460 gene recB 13785 17663 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115861.1 protein_id gnl|my_center|LOCUS_03460 17660 19879 gene locus_tag LOCUS_03470 gene recD 17660 19879 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_03470 20004 22019 gene locus_tag LOCUS_03480 20004 22019 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_03480 22168 24138 gene locus_tag LOCUS_03490 22168 24138 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_03490 24205 24597 gene locus_tag LOCUS_03500 24205 24597 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_03500 24657 25145 gene locus_tag LOCUS_03510 24657 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 25142 25339 gene locus_tag LOCUS_03520 25142 25339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 25377 27689 gene locus_tag LOCUS_03530 25377 27689 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086220.1 protein_id gnl|my_center|LOCUS_03530 28085 27693 gene locus_tag LOCUS_03540 28085 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 28273 29358 gene locus_tag LOCUS_03550 28273 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 29355 30104 gene locus_tag LOCUS_03560 29355 30104 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626068.1 protein_id gnl|my_center|LOCUS_03560 30101 31828 gene locus_tag LOCUS_03570 30101 31828 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_03570 33048 31825 gene locus_tag LOCUS_03580 33048 31825 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973796.1 protein_id gnl|my_center|LOCUS_03580 34489 33335 gene locus_tag LOCUS_03590 34489 33335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813867.1 protein_id gnl|my_center|LOCUS_03590 35742 34552 gene locus_tag LOCUS_03600 35742 34552 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839729.1 protein_id gnl|my_center|LOCUS_03600 38123 35739 gene locus_tag LOCUS_03610 38123 35739 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_03610 38619 38137 gene locus_tag LOCUS_03620 38619 38137 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_03620 39472 38603 gene locus_tag LOCUS_03630 gene xdhB 39472 38603 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_03630 41095 39482 gene locus_tag LOCUS_03640 41095 39482 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_03640 41508 41092 gene locus_tag LOCUS_03650 41508 41092 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_03650 42638 41505 gene locus_tag LOCUS_03660 42638 41505 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_03660 <44102 42641 gene locus_tag LOCUS_03670 <44102 42641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393464.1:hydantoinase B/oxoprolinase family protein >Feature sequence009 1254 223 gene locus_tag LOCUS_03680 1254 223 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_03680 1502 2503 gene locus_tag LOCUS_03690 gene mltG 1502 2503 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_03690 2500 3204 gene locus_tag LOCUS_03700 gene tmk 2500 3204 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527198.1 protein_id gnl|my_center|LOCUS_03700 3425 3087 gene locus_tag LOCUS_03710 3425 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3429 4259 gene locus_tag LOCUS_03720 3429 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4256 4618 gene locus_tag LOCUS_03730 4256 4618 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 protein_id gnl|my_center|LOCUS_03730 4696 5496 gene locus_tag LOCUS_03740 4696 5496 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_03740 5525 6199 gene locus_tag LOCUS_03750 5525 6199 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_03750 6341 8047 gene locus_tag LOCUS_03760 gene sulP 6341 8047 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_03760 8912 8118 gene locus_tag LOCUS_03770 8912 8118 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086778.1 protein_id gnl|my_center|LOCUS_03770 9014 10240 gene locus_tag LOCUS_03780 9014 10240 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_03780 11238 10264 gene locus_tag LOCUS_03790 11238 10264 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_03790 13562 11235 gene locus_tag LOCUS_03800 gene xdhA 13562 11235 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_03800 14026 13541 gene locus_tag LOCUS_03810 14026 13541 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_03810 14537 14037 gene locus_tag LOCUS_03820 14537 14037 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965241.1 protein_id gnl|my_center|LOCUS_03820 14791 15789 gene locus_tag LOCUS_03830 gene cobS 14791 15789 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_03830 15795 17648 gene locus_tag LOCUS_03840 gene cobT 15795 17648 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_03840 17690 18043 gene locus_tag LOCUS_03850 17690 18043 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_03850 18393 18169 gene locus_tag LOCUS_03860 18393 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 18298 19485 gene locus_tag LOCUS_03870 18298 19485 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_03870 19485 21980 gene locus_tag LOCUS_03880 19485 21980 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_03880 22070 23263 gene locus_tag LOCUS_03890 22070 23263 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_03890 23339 23620 gene locus_tag LOCUS_03900 23339 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 24827 23670 gene locus_tag LOCUS_03910 gene ribA 24827 23670 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_03910 26206 25127 gene locus_tag LOCUS_03920 gene moaA 26206 25127 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064345.1 protein_id gnl|my_center|LOCUS_03920 26419 28848 gene locus_tag LOCUS_03930 26419 28848 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_03930 29471 28875 gene locus_tag LOCUS_03940 29471 28875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 30625 29666 gene locus_tag LOCUS_03950 30625 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 30877 31608 gene locus_tag LOCUS_03960 30877 31608 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_03960 31921 34293 gene locus_tag LOCUS_03970 31921 34293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 35512 34271 gene locus_tag LOCUS_03980 35512 34271 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103683.1 protein_id gnl|my_center|LOCUS_03980 36338 35721 gene locus_tag LOCUS_03990 36338 35721 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_03990 36564 36340 gene locus_tag LOCUS_04000 36564 36340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 36482 36724 gene locus_tag LOCUS_04010 36482 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 37545 36697 gene locus_tag LOCUS_04020 gene fghA 37545 36697 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 protein_id gnl|my_center|LOCUS_04020 37712 37637 gene locus_tag LOCUS_t00030 37712 37637 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 37877 37802 gene locus_tag LOCUS_t00040 37877 37802 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 <38784 37975 gene locus_tag LOCUS_04030 <38784 37975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198124.1:aspartate/tyrosine/aromatic aminotransferase >Feature sequence010 717 376 gene locus_tag LOCUS_04040 gene hypA 717 376 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_04040 1239 736 gene locus_tag LOCUS_04050 gene nusB 1239 736 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_04050 1739 1236 gene locus_tag LOCUS_04060 gene ribH 1739 1236 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_04060 2856 1765 gene locus_tag LOCUS_04070 gene ribBA 2856 1765 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 protein_id gnl|my_center|LOCUS_04070 3516 2902 gene locus_tag LOCUS_04080 3516 2902 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_04080 5476 3572 gene locus_tag LOCUS_04090 5476 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5847 5473 gene locus_tag LOCUS_04100 5847 5473 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_04100 5972 7024 gene locus_tag LOCUS_04110 5972 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 8395 7127 gene locus_tag LOCUS_04120 8395 7127 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_04120 8643 8401 gene locus_tag LOCUS_04130 8643 8401 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_04130 10739 8808 gene locus_tag LOCUS_04140 10739 8808 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_04140 11953 10922 gene locus_tag LOCUS_04150 11953 10922 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_04150 12894 11950 gene locus_tag LOCUS_04160 12894 11950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_04160 14848 12908 gene locus_tag LOCUS_04170 14848 12908 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975430.1 protein_id gnl|my_center|LOCUS_04170 15077 16822 gene locus_tag LOCUS_04180 15077 16822 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_04180 16825 17598 gene locus_tag LOCUS_04190 16825 17598 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_04190 17696 19126 gene locus_tag LOCUS_04200 17696 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 19780 19151 gene locus_tag LOCUS_04210 19780 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762975.1 protein_id gnl|my_center|LOCUS_04210 19888 21675 gene locus_tag LOCUS_04220 gene msbA 19888 21675 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_04220 22383 21703 gene locus_tag LOCUS_04230 22383 21703 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104989.1 protein_id gnl|my_center|LOCUS_04230 23078 22374 gene locus_tag LOCUS_04240 23078 22374 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405955.1 protein_id gnl|my_center|LOCUS_04240 23757 23263 gene locus_tag LOCUS_04250 23757 23263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 23928 24344 gene locus_tag LOCUS_04260 23928 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24368 24859 gene locus_tag LOCUS_04270 24368 24859 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_04270 24872 26200 gene locus_tag LOCUS_04280 24872 26200 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_04280 27700 26252 gene locus_tag LOCUS_04290 27700 26252 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_04290 28521 27697 gene locus_tag LOCUS_04300 gene rfaP 28521 27697 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_04300 29675 28536 gene locus_tag LOCUS_04310 29675 28536 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_04310 30763 29675 gene locus_tag LOCUS_04320 gene waaC 30763 29675 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_04320 31871 30771 gene locus_tag LOCUS_04330 gene waaF 31871 30771 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_04330 32866 31904 gene locus_tag LOCUS_04340 gene rfaD 32866 31904 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703796.1 protein_id gnl|my_center|LOCUS_04340 33867 32893 gene locus_tag LOCUS_04350 33867 32893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 34525 33974 gene locus_tag LOCUS_04360 34525 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence011 610 1497 gene locus_tag LOCUS_04370 610 1497 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_04370 1506 2912 gene locus_tag LOCUS_04380 gene radA 1506 2912 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_04380 3026 5035 gene locus_tag LOCUS_04390 3026 5035 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_04390 5600 5082 gene locus_tag LOCUS_04400 5600 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 7083 5611 gene locus_tag LOCUS_04410 7083 5611 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04410 7706 7164 gene locus_tag LOCUS_04420 7706 7164 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_04420 8422 7703 gene locus_tag LOCUS_04430 gene hoxU 8422 7703 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_04430 10224 8419 gene locus_tag LOCUS_04440 10224 8419 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_04440 11504 10221 gene locus_tag LOCUS_04450 11504 10221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853227.1 protein_id gnl|my_center|LOCUS_04450 11821 13512 gene locus_tag LOCUS_04460 gene ubiB 11821 13512 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04460 13673 14728 gene locus_tag LOCUS_04470 13673 14728 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_04470 14874 15182 gene locus_tag LOCUS_04480 14874 15182 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_04480 15329 16921 gene locus_tag LOCUS_04490 15329 16921 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_04490 18421 16982 gene locus_tag LOCUS_04500 18421 16982 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_04500 19079 18405 gene locus_tag LOCUS_04510 19079 18405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_04510 19260 20594 gene locus_tag LOCUS_04520 19260 20594 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_04520 20897 20628 gene locus_tag LOCUS_04530 20897 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 22380 21082 gene locus_tag LOCUS_04540 22380 21082 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_04540 22973 24433 gene locus_tag LOCUS_04550 22973 24433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 24470 25150 gene locus_tag LOCUS_04560 24470 25150 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_04560 25147 26415 gene locus_tag LOCUS_04570 25147 26415 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_04570 26417 27112 gene locus_tag LOCUS_04580 26417 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 27109 29205 gene locus_tag LOCUS_04590 27109 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 29202 30104 gene locus_tag LOCUS_04600 29202 30104 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_04600 30107 31321 gene locus_tag LOCUS_04610 30107 31321 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392000.1 protein_id gnl|my_center|LOCUS_04610 31318 32214 gene locus_tag LOCUS_04620 gene folD 31318 32214 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_04620 32269 32343 gene locus_tag LOCUS_t00050 32269 32343 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32415 32489 gene locus_tag LOCUS_t00060 32415 32489 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 3205 866 gene locus_tag LOCUS_04630 gene nuoG 3205 866 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_04630 4503 3199 gene locus_tag LOCUS_04640 gene nuoF 4503 3199 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_04640 4994 4515 gene locus_tag LOCUS_04650 gene nuoE 4994 4515 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_04650 6346 5093 gene locus_tag LOCUS_04660 6346 5093 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_04660 6944 6339 gene locus_tag LOCUS_04670 6944 6339 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_04670 7435 6959 gene locus_tag LOCUS_04680 7435 6959 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_04680 7813 7439 gene locus_tag LOCUS_04690 7813 7439 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_04690 8002 7918 gene locus_tag LOCUS_t00070 8002 7918 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8431 8069 gene locus_tag LOCUS_04700 gene secG 8431 8069 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_04700 9205 8468 gene locus_tag LOCUS_04710 gene tpiA 9205 8468 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_04710 9380 9760 gene locus_tag LOCUS_04720 9380 9760 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_04720 9757 10242 gene locus_tag LOCUS_04730 9757 10242 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_04730 10317 10679 gene locus_tag LOCUS_04740 gene arsD 10317 10679 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_04740 10843 12633 gene locus_tag LOCUS_04750 gene arsA 10843 12633 CDS product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 protein_id gnl|my_center|LOCUS_04750 12691 13773 gene locus_tag LOCUS_04760 gene arsB 12691 13773 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_04760 13925 14161 gene locus_tag LOCUS_04770 13925 14161 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_04770 14323 15264 gene locus_tag LOCUS_04780 14323 15264 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_04780 16107 15325 gene locus_tag LOCUS_04790 gene pstB 16107 15325 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_04790 17081 16152 gene locus_tag LOCUS_04800 gene pstA 17081 16152 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_04800 18033 17086 gene locus_tag LOCUS_04810 gene pstC 18033 17086 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_04810 19116 18118 gene locus_tag LOCUS_04820 19116 18118 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_04820 20586 19234 gene locus_tag LOCUS_04830 gene glmM 20586 19234 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_04830 21449 20619 gene locus_tag LOCUS_04840 gene folP 21449 20619 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193216.1 protein_id gnl|my_center|LOCUS_04840 23522 21630 gene locus_tag LOCUS_04850 gene ftsH 23522 21630 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_04850 24362 23643 gene locus_tag LOCUS_04860 24362 23643 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_04860 24467 24928 gene locus_tag LOCUS_04870 24467 24928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 25563 25087 gene locus_tag LOCUS_04880 gene greA 25563 25087 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_04880 <27956 25560 gene locus_tag LOCUS_04890 <27956 25560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809588.1:carbamoyl-phosphate synthase large subunit >Feature sequence013 68 832 gene locus_tag LOCUS_04900 68 832 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483201.1 protein_id gnl|my_center|LOCUS_04900 1945 890 gene locus_tag LOCUS_04910 1945 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2637 2209 gene locus_tag LOCUS_04920 2637 2209 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_04920 3289 2726 gene locus_tag LOCUS_04930 3289 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4639 3317 gene locus_tag LOCUS_04940 4639 3317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543738.1 protein_id gnl|my_center|LOCUS_04940 5743 5183 gene locus_tag LOCUS_04950 5743 5183 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_04950 8621 5871 gene locus_tag LOCUS_04960 8621 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8861 9463 gene locus_tag LOCUS_04970 gene ampD 8861 9463 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_04970 9839 10639 gene locus_tag LOCUS_04980 9839 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 12584 10737 gene locus_tag LOCUS_04990 12584 10737 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817018.1 protein_id gnl|my_center|LOCUS_04990 12987 15260 gene locus_tag LOCUS_05000 12987 15260 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_05000 15429 16520 gene locus_tag LOCUS_05010 15429 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16700 18568 gene locus_tag LOCUS_05020 16700 18568 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389731.1 protein_id gnl|my_center|LOCUS_05020 18579 19184 gene locus_tag LOCUS_05030 18579 19184 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389730.1 protein_id gnl|my_center|LOCUS_05030 20038 19235 gene locus_tag LOCUS_05040 20038 19235 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_05040 20255 23116 gene locus_tag LOCUS_05050 20255 23116 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338646.1 protein_id gnl|my_center|LOCUS_05050 23117 23512 gene locus_tag LOCUS_05060 23117 23512 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721306.1 protein_id gnl|my_center|LOCUS_05060 23509 25029 gene locus_tag LOCUS_05070 23509 25029 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 protein_id gnl|my_center|LOCUS_05070 25029 25556 gene locus_tag LOCUS_05080 25029 25556 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_05080 25553 25822 gene locus_tag LOCUS_05090 25553 25822 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721312.1 protein_id gnl|my_center|LOCUS_05090 25830 26231 gene locus_tag LOCUS_05100 25830 26231 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721315.1 protein_id gnl|my_center|LOCUS_05100 26449 27627 gene locus_tag LOCUS_05110 26449 27627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence014 438 1286 gene locus_tag LOCUS_05120 438 1286 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_05120 1450 3852 gene locus_tag LOCUS_05130 1450 3852 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_05130 3869 4243 gene locus_tag LOCUS_05140 3869 4243 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102247109.1 protein_id gnl|my_center|LOCUS_05140 4240 5103 gene locus_tag LOCUS_05150 4240 5103 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 protein_id gnl|my_center|LOCUS_05150 5100 6032 gene locus_tag LOCUS_05160 gene minC 5100 6032 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_05160 6066 6878 gene locus_tag LOCUS_05170 gene minD 6066 6878 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_05170 6880 7140 gene locus_tag LOCUS_05180 gene minE 6880 7140 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186076.1 protein_id gnl|my_center|LOCUS_05180 8694 7192 gene locus_tag LOCUS_05190 gene thrC 8694 7192 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_05190 8958 8746 gene locus_tag LOCUS_05200 8958 8746 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898900.1 protein_id gnl|my_center|LOCUS_05200 9125 8982 gene locus_tag LOCUS_05210 9125 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9815 9153 gene locus_tag LOCUS_05220 9815 9153 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113716.1 protein_id gnl|my_center|LOCUS_05220 11244 9937 gene locus_tag LOCUS_05230 11244 9937 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_05230 12610 11306 gene locus_tag LOCUS_05240 12610 11306 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_05240 12849 13238 gene locus_tag LOCUS_05250 12849 13238 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_05250 13453 13908 gene locus_tag LOCUS_05260 13453 13908 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_05260 13959 15422 gene locus_tag LOCUS_05270 13959 15422 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_05270 15419 17335 gene locus_tag LOCUS_05280 15419 17335 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_05280 17332 17973 gene locus_tag LOCUS_05290 17332 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 18212 18757 gene locus_tag LOCUS_05300 18212 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 19174 18848 gene locus_tag LOCUS_05310 19174 18848 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930920.1 protein_id gnl|my_center|LOCUS_05310 19306 20316 gene locus_tag LOCUS_05320 19306 20316 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_05320 22247 20583 gene locus_tag LOCUS_05330 22247 20583 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_05330 22383 23507 gene locus_tag LOCUS_05340 22383 23507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_05340 23504 24211 gene locus_tag LOCUS_05350 gene aat 23504 24211 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_05350 24244 24966 gene locus_tag LOCUS_05360 24244 24966 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_05360 25009 26016 gene locus_tag LOCUS_05370 25009 26016 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193208.1 protein_id gnl|my_center|LOCUS_05370 26828 26085 gene locus_tag LOCUS_05380 26828 26085 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965197.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence015 <1 1221 gene locus_tag LOCUS_05390 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538238.1:ABC-F family ATPase note possible pseudo, internal stop codon 1995 1300 gene locus_tag LOCUS_05400 1995 1300 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 protein_id gnl|my_center|LOCUS_05400 2452 2048 gene locus_tag LOCUS_05410 2452 2048 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367334.1 protein_id gnl|my_center|LOCUS_05410 3060 2449 gene locus_tag LOCUS_05420 3060 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 5360 3063 gene locus_tag LOCUS_05430 5360 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 7444 5357 gene locus_tag LOCUS_05440 gene flhA 7444 5357 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811905.1 protein_id gnl|my_center|LOCUS_05440 8625 7441 gene locus_tag LOCUS_05450 gene flhB 8625 7441 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 protein_id gnl|my_center|LOCUS_05450 9453 8782 gene locus_tag LOCUS_05460 gene cheZ 9453 8782 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164477.1 protein_id gnl|my_center|LOCUS_05460 9876 9487 gene locus_tag LOCUS_05470 gene cheY 9876 9487 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_05470 10980 9919 gene locus_tag LOCUS_05480 10980 9919 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 protein_id gnl|my_center|LOCUS_05480 11921 10977 gene locus_tag LOCUS_05490 11921 10977 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_05490 14149 11918 gene locus_tag LOCUS_05500 14149 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 14736 14239 gene locus_tag LOCUS_05510 gene cheW 14736 14239 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_05510 16895 14733 gene locus_tag LOCUS_05520 16895 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17898 16954 gene locus_tag LOCUS_05530 17898 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 18767 17895 gene locus_tag LOCUS_05540 gene motA 18767 17895 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 protein_id gnl|my_center|LOCUS_05540 19509 18928 gene locus_tag LOCUS_05550 gene flhC 19509 18928 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_05550 19823 19506 gene locus_tag LOCUS_05560 gene flhD 19823 19506 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_05560 20218 19907 gene locus_tag LOCUS_05570 20218 19907 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_05570 21563 20208 gene locus_tag LOCUS_05580 21563 20208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21973 21560 gene locus_tag LOCUS_05590 21973 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 22370 21966 gene locus_tag LOCUS_05600 gene fliS 22370 21966 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_05600 23874 22450 gene locus_tag LOCUS_05610 gene fliD 23874 22450 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211150.1 protein_id gnl|my_center|LOCUS_05610 25713 24028 gene locus_tag LOCUS_05620 25713 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence016 408 779 gene locus_tag LOCUS_05630 408 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1214 1450 gene locus_tag LOCUS_05640 1214 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1459 3078 gene locus_tag LOCUS_05650 1459 3078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_05650 3075 4493 gene locus_tag LOCUS_05660 3075 4493 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_05660 5210 4599 gene locus_tag LOCUS_05670 5210 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6408 5293 gene locus_tag LOCUS_05680 6408 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_05680 6877 6512 gene locus_tag LOCUS_05690 6877 6512 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_05690 6990 7892 gene locus_tag LOCUS_05700 gene argB 6990 7892 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_05700 8178 7927 gene locus_tag LOCUS_05710 8178 7927 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_05710 8300 9901 gene locus_tag LOCUS_05720 8300 9901 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_05720 9974 11227 gene locus_tag LOCUS_05730 9974 11227 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_05730 11735 11295 gene locus_tag LOCUS_05740 11735 11295 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_05740 12274 11891 gene locus_tag LOCUS_05750 12274 11891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 12636 12271 gene locus_tag LOCUS_05760 12636 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 12781 13110 gene locus_tag LOCUS_05770 gene grxD 12781 13110 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929959.1 protein_id gnl|my_center|LOCUS_05770 14741 13293 gene locus_tag LOCUS_05780 gene argH 14741 13293 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_05780 17734 14966 gene locus_tag LOCUS_05790 gene ppc 17734 14966 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_05790 17933 18865 gene locus_tag LOCUS_05800 gene hemC 17933 18865 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_05800 18891 19694 gene locus_tag LOCUS_05810 18891 19694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05810 19704 21125 gene locus_tag LOCUS_05820 19704 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 21136 22326 gene locus_tag LOCUS_05830 21136 22326 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193604.1 protein_id gnl|my_center|LOCUS_05830 23281 22370 gene locus_tag LOCUS_05840 gene hemF 23281 22370 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_05840 23620 23288 gene locus_tag LOCUS_05850 23620 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 25015 23738 gene locus_tag LOCUS_05860 gene purD 25015 23738 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_05860 <26065 25097 gene locus_tag LOCUS_05870 <26065 25097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194285.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence017 732 394 gene locus_tag LOCUS_05880 732 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 713 3721 gene locus_tag LOCUS_05890 713 3721 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_05890 3718 4584 gene locus_tag LOCUS_05900 3718 4584 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809927.1 protein_id gnl|my_center|LOCUS_05900 4600 5013 gene locus_tag LOCUS_05910 4600 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5034 5378 gene locus_tag LOCUS_05920 5034 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5409 6290 gene locus_tag LOCUS_05930 5409 6290 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057750223.1 protein_id gnl|my_center|LOCUS_05930 6393 7646 gene locus_tag LOCUS_05940 6393 7646 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_05940 7749 8714 gene locus_tag LOCUS_05950 7749 8714 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_05950 8786 9277 gene locus_tag LOCUS_05960 8786 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 9282 10553 gene locus_tag LOCUS_05970 9282 10553 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_05970 11708 10674 gene locus_tag LOCUS_05980 11708 10674 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_05980 12561 11848 gene locus_tag LOCUS_05990 12561 11848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_05990 12984 15119 gene locus_tag LOCUS_06000 12984 15119 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_06000 15186 16586 gene locus_tag LOCUS_06010 gene lpdA 15186 16586 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_06010 16764 18263 gene locus_tag LOCUS_06020 gene gabD 16764 18263 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_06020 18352 19416 gene locus_tag LOCUS_06030 18352 19416 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_06030 19484 21691 gene locus_tag LOCUS_06040 19484 21691 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_06040 21704 22252 gene locus_tag LOCUS_06050 21704 22252 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_06050 22284 23579 gene locus_tag LOCUS_06060 22284 23579 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_06060 23670 24587 gene locus_tag LOCUS_06070 23670 24587 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665750.1 protein_id gnl|my_center|LOCUS_06070 24723 25730 gene locus_tag LOCUS_06080 24723 25730 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence018 <1 792 gene locus_tag LOCUS_06090 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114343.1:diaminopimelate decarboxylase 1138 1368 gene locus_tag LOCUS_06100 1138 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1380 2621 gene locus_tag LOCUS_06110 1380 2621 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388141.1 protein_id gnl|my_center|LOCUS_06110 2653 2949 gene locus_tag LOCUS_06120 gene xanC 2653 2949 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_06120 3059 3751 gene locus_tag LOCUS_06130 3059 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3813 5150 gene locus_tag LOCUS_06140 gene xanA2 3813 5150 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_06140 5147 5455 gene locus_tag LOCUS_06150 5147 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5598 6548 gene locus_tag LOCUS_06160 5598 6548 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_06160 6545 7120 gene locus_tag LOCUS_06170 6545 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7117 9480 gene locus_tag LOCUS_06180 7117 9480 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_06180 9484 10308 gene locus_tag LOCUS_06190 9484 10308 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_06190 10305 11078 gene locus_tag LOCUS_06200 10305 11078 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_06200 11114 12301 gene locus_tag LOCUS_06210 11114 12301 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_06210 12298 13149 gene locus_tag LOCUS_06220 12298 13149 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_06220 13146 13625 gene locus_tag LOCUS_06230 13146 13625 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_06230 13622 14341 gene locus_tag LOCUS_06240 gene fabG 13622 14341 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_06240 15116 14364 gene locus_tag LOCUS_06250 15116 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 15921 15133 gene locus_tag LOCUS_06260 15921 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 16511 16155 gene locus_tag LOCUS_06270 16511 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 16647 18158 gene locus_tag LOCUS_06280 gene dacB 16647 18158 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 protein_id gnl|my_center|LOCUS_06280 18638 18219 gene locus_tag LOCUS_06290 18638 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_06290 20262 18766 gene locus_tag LOCUS_06300 gene ubiD 20262 18766 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_06300 21188 20361 gene locus_tag LOCUS_06310 gene pyrF 21188 20361 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_06310 21644 21399 gene locus_tag LOCUS_06320 21644 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301252.1 protein_id gnl|my_center|LOCUS_06320 23112 21727 gene locus_tag LOCUS_06330 23112 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 24268 23396 gene locus_tag LOCUS_06340 gene ubiA 24268 23396 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence019 108 24 gene locus_tag LOCUS_t00080 108 24 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 373 3210 gene locus_tag LOCUS_06350 373 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3203 3955 gene locus_tag LOCUS_06360 gene rlmB 3203 3955 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_06360 4341 5081 gene locus_tag LOCUS_06370 gene bluB 4341 5081 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_06370 5331 7829 gene locus_tag LOCUS_06380 gene nirB 5331 7829 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 protein_id gnl|my_center|LOCUS_06380 7840 8193 gene locus_tag LOCUS_06390 gene nirD 7840 8193 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_06390 8339 9553 gene locus_tag LOCUS_06400 8339 9553 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 protein_id gnl|my_center|LOCUS_06400 9561 11243 gene locus_tag LOCUS_06410 9561 11243 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_06410 11353 14157 gene locus_tag LOCUS_06420 11353 14157 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_06420 14268 15950 gene locus_tag LOCUS_06430 14268 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15947 17020 gene locus_tag LOCUS_06440 gene cheB 15947 17020 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_06440 17017 18564 gene locus_tag LOCUS_06450 17017 18564 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_06450 18570 20729 gene locus_tag LOCUS_06460 18570 20729 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_06460 20754 21119 gene locus_tag LOCUS_06470 20754 21119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 21133 22815 gene locus_tag LOCUS_06480 21133 22815 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_06480 22812 23327 gene locus_tag LOCUS_06490 22812 23327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 23305 23715 gene locus_tag LOCUS_06500 23305 23715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence020 1112 342 gene locus_tag LOCUS_06510 1112 342 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 protein_id gnl|my_center|LOCUS_06510 3711 1132 gene locus_tag LOCUS_06520 gene mutS 3711 1132 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_06520 4676 3864 gene locus_tag LOCUS_06530 4676 3864 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_06530 4810 5550 gene locus_tag LOCUS_06540 gene trmJ 4810 5550 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_06540 5696 6451 gene locus_tag LOCUS_06550 gene cysE 5696 6451 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_06550 6602 7084 gene locus_tag LOCUS_06560 gene iscR 6602 7084 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_06560 7099 8295 gene locus_tag LOCUS_06570 7099 8295 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_06570 8315 9526 gene locus_tag LOCUS_06580 8315 9526 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_06580 9607 9990 gene locus_tag LOCUS_06590 gene iscU 9607 9990 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_06590 10029 10352 gene locus_tag LOCUS_06600 gene iscA 10029 10352 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_06600 10363 10896 gene locus_tag LOCUS_06610 gene hscB 10363 10896 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_06610 10914 12782 gene locus_tag LOCUS_06620 gene hscA 10914 12782 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_06620 12779 13120 gene locus_tag LOCUS_06630 gene fdx 12779 13120 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_06630 13122 13316 gene locus_tag LOCUS_06640 gene iscX 13122 13316 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_06640 14288 13350 gene locus_tag LOCUS_06650 gene prmB 14288 13350 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_06650 15547 14399 gene locus_tag LOCUS_06660 gene dapE 15547 14399 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191377.1 protein_id gnl|my_center|LOCUS_06660 16784 15609 gene locus_tag LOCUS_06670 16784 15609 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_06670 17646 16825 gene locus_tag LOCUS_06680 gene dapD 17646 16825 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_06680 18860 17667 gene locus_tag LOCUS_06690 gene dapC 18860 17667 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_06690 19158 22784 gene locus_tag LOCUS_06700 gene smc 19158 22784 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813877.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence021 <1 801 gene locus_tag LOCUS_06710 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192783.1:lysine--tRNA ligase 1650 856 gene locus_tag LOCUS_06720 1650 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1946 3874 gene locus_tag LOCUS_06730 gene mnmC 1946 3874 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204185.1 protein_id gnl|my_center|LOCUS_06730 5641 3989 gene locus_tag LOCUS_06740 5641 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7251 5839 gene locus_tag LOCUS_06750 gene gltX 7251 5839 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_06750 7580 12040 gene locus_tag LOCUS_06760 7580 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 12055 13260 gene locus_tag LOCUS_06770 12055 13260 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_06770 13335 13691 gene locus_tag LOCUS_06780 13335 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13750 14910 gene locus_tag LOCUS_06790 13750 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 16162 14972 gene locus_tag LOCUS_06800 gene rlmI 16162 14972 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_06800 16766 16374 gene locus_tag LOCUS_06810 16766 16374 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_06810 17290 16787 gene locus_tag LOCUS_06820 17290 16787 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_06820 17566 17291 gene locus_tag LOCUS_06830 17566 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 17752 19023 gene locus_tag LOCUS_06840 17752 19023 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 protein_id gnl|my_center|LOCUS_06840 19057 19662 gene locus_tag LOCUS_06850 gene gstA 19057 19662 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_06850 21735 19723 gene locus_tag LOCUS_06860 21735 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 22385 21732 gene locus_tag LOCUS_06870 22385 21732 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_06870 22750 22544 gene locus_tag LOCUS_06880 22750 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence022 1262 51 gene locus_tag LOCUS_06890 1262 51 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_06890 2458 1259 gene locus_tag LOCUS_06900 2458 1259 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_06900 3057 2455 gene locus_tag LOCUS_06910 3057 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4727 3228 gene locus_tag LOCUS_06920 4727 3228 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103754.1 protein_id gnl|my_center|LOCUS_06920 5386 4727 gene locus_tag LOCUS_06930 5386 4727 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_06930 6157 5507 gene locus_tag LOCUS_06940 6157 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_06940 6991 6170 gene locus_tag LOCUS_06950 6991 6170 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_06950 7655 7002 gene locus_tag LOCUS_06960 7655 7002 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_06960 9142 7652 gene locus_tag LOCUS_06970 9142 7652 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_06970 9830 9126 gene locus_tag LOCUS_06980 9830 9126 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_06980 10108 10602 gene locus_tag LOCUS_06990 10108 10602 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06990 10599 11591 gene locus_tag LOCUS_07000 10599 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 13071 11662 gene locus_tag LOCUS_07010 13071 11662 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_07010 13721 13059 gene locus_tag LOCUS_07020 13721 13059 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_07020 14114 13770 gene locus_tag LOCUS_07030 14114 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15316 14363 gene locus_tag LOCUS_07040 15316 14363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 15547 16209 gene locus_tag LOCUS_07050 15547 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16270 17589 gene locus_tag LOCUS_07060 16270 17589 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_07060 17713 18459 gene locus_tag LOCUS_07070 17713 18459 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_07070 18456 19583 gene locus_tag LOCUS_07080 18456 19583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 19654 20160 gene locus_tag LOCUS_07090 19654 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 20298 20945 gene locus_tag LOCUS_07100 gene can 20298 20945 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_07100 21293 20982 gene locus_tag LOCUS_07110 21293 20982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 21914 21297 gene locus_tag LOCUS_07120 21914 21297 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_07120 22036 22482 gene locus_tag LOCUS_07130 22036 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 >Feature sequence023 310 849 gene locus_tag LOCUS_07140 310 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1705 1046 gene locus_tag LOCUS_07150 1705 1046 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_07150 2062 4806 gene locus_tag LOCUS_07160 2062 4806 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_07160 4803 5450 gene locus_tag LOCUS_07170 4803 5450 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_07170 5450 6331 gene locus_tag LOCUS_07180 5450 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6419 6991 gene locus_tag LOCUS_07190 6419 6991 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_07190 6988 7290 gene locus_tag LOCUS_07200 6988 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07200 7361 8611 gene locus_tag LOCUS_07210 7361 8611 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391921.1 protein_id gnl|my_center|LOCUS_07210 8622 9878 gene locus_tag LOCUS_07220 8622 9878 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_07220 9889 11241 gene locus_tag LOCUS_07230 9889 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 11234 12568 gene locus_tag LOCUS_07240 gene paaF 11234 12568 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 protein_id gnl|my_center|LOCUS_07240 12610 14706 gene locus_tag LOCUS_07250 12610 14706 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_07250 14761 15168 gene locus_tag LOCUS_07260 14761 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 15448 15957 gene locus_tag LOCUS_07270 15448 15957 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311692.1 protein_id gnl|my_center|LOCUS_07270 17213 16077 gene locus_tag LOCUS_07280 17213 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 17551 17228 gene locus_tag LOCUS_07290 17551 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 19023 17548 gene locus_tag LOCUS_07300 gene scfB 19023 17548 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_07300 20611 19010 gene locus_tag LOCUS_07310 20611 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 20893 21621 gene locus_tag LOCUS_07320 20893 21621 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence024 710 2530 gene locus_tag LOCUS_07330 710 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2789 3523 gene locus_tag LOCUS_07340 2789 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 3520 4209 gene locus_tag LOCUS_07350 3520 4209 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093084.1 protein_id gnl|my_center|LOCUS_07350 4738 6174 gene locus_tag LOCUS_07360 4738 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8307 6289 gene locus_tag LOCUS_07370 8307 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9707 8949 gene locus_tag LOCUS_07380 9707 8949 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_07380 10335 9709 gene locus_tag LOCUS_07390 10335 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 10724 10341 gene locus_tag LOCUS_07400 10724 10341 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_07400 11247 10735 gene locus_tag LOCUS_07410 11247 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 13229 11244 gene locus_tag LOCUS_07420 13229 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13729 13226 gene locus_tag LOCUS_07430 13729 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 14277 13726 gene locus_tag LOCUS_07440 14277 13726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 14798 14274 gene locus_tag LOCUS_07450 14798 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 15609 14812 gene locus_tag LOCUS_07460 15609 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 17320 15590 gene locus_tag LOCUS_07470 17320 15590 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_07470 18531 17317 gene locus_tag LOCUS_07480 18531 17317 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_07480 19006 18557 gene locus_tag LOCUS_07490 gene gspG 19006 18557 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 protein_id gnl|my_center|LOCUS_07490 19216 19443 gene locus_tag LOCUS_07500 19216 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20357 19350 gene locus_tag LOCUS_07510 20357 19350 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_07510 21479 20487 gene locus_tag LOCUS_07520 21479 20487 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence025 188 595 gene locus_tag LOCUS_07530 188 595 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_07530 1341 613 gene locus_tag LOCUS_07540 gene dnaQ 1341 613 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_07540 1823 1362 gene locus_tag LOCUS_07550 gene rnhA 1823 1362 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_07550 2552 1824 gene locus_tag LOCUS_07560 2552 1824 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_07560 2580 3353 gene locus_tag LOCUS_07570 gene gloB 2580 3353 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526568.1 protein_id gnl|my_center|LOCUS_07570 3364 4752 gene locus_tag LOCUS_07580 3364 4752 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_07580 7032 4753 gene locus_tag LOCUS_07590 7032 4753 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_07590 7486 7001 gene locus_tag LOCUS_07600 7486 7001 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_07600 7958 7461 gene locus_tag LOCUS_07610 gene bcp 7958 7461 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_07610 8281 8889 gene locus_tag LOCUS_07620 gene lexA 8281 8889 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_07620 8894 9451 gene locus_tag LOCUS_07630 8894 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 11294 9492 gene locus_tag LOCUS_07640 11294 9492 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_07640 11600 12496 gene locus_tag LOCUS_07650 11600 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 12632 13021 gene locus_tag LOCUS_07660 12632 13021 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583114.1 protein_id gnl|my_center|LOCUS_07660 13036 14241 gene locus_tag LOCUS_07670 13036 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 14261 16837 gene locus_tag LOCUS_07680 14261 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 17057 17836 gene locus_tag LOCUS_07690 17057 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 18028 18456 gene locus_tag LOCUS_07700 18028 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 18643 19149 gene locus_tag LOCUS_07710 18643 19149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 19310 19885 gene locus_tag LOCUS_07720 19310 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 20404 20003 gene locus_tag LOCUS_07730 20404 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 20584 21123 gene locus_tag LOCUS_07740 20584 21123 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence026 1077 148 gene locus_tag LOCUS_07750 gene truB 1077 148 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_07750 1537 1115 gene locus_tag LOCUS_07760 gene rbfA 1537 1115 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_07760 4408 1541 gene locus_tag LOCUS_07770 4408 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5897 4422 gene locus_tag LOCUS_07780 gene nusA 5897 4422 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_07780 6401 5925 gene locus_tag LOCUS_07790 gene rimP 6401 5925 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_07790 7807 6668 gene locus_tag LOCUS_07800 7807 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8381 7779 gene locus_tag LOCUS_07810 8381 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9189 8359 gene locus_tag LOCUS_07820 9189 8359 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_07820 10429 9227 gene locus_tag LOCUS_07830 10429 9227 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_07830 11098 10439 gene locus_tag LOCUS_07840 11098 10439 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_07840 11831 11124 gene locus_tag LOCUS_07850 11831 11124 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_07850 12726 11863 gene locus_tag LOCUS_07860 12726 11863 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_07860 13760 12837 gene locus_tag LOCUS_07870 gene ylqF 13760 12837 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_07870 14022 14231 gene locus_tag LOCUS_07880 14022 14231 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_07880 14427 16355 gene locus_tag LOCUS_07890 14427 16355 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_07890 16526 19654 gene locus_tag LOCUS_07900 16526 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 20209 19643 gene locus_tag LOCUS_07910 20209 19643 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_07910 21006 20209 gene locus_tag LOCUS_07920 21006 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence027 330 1109 gene locus_tag LOCUS_07930 330 1109 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_07930 1314 1754 gene locus_tag LOCUS_07940 1314 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2574 2017 gene locus_tag LOCUS_07950 gene thpR 2574 2017 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_07950 3080 2586 gene locus_tag LOCUS_07960 gene ispF 3080 2586 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_07960 3786 3085 gene locus_tag LOCUS_07970 gene ispD 3786 3085 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_07970 3999 4823 gene locus_tag LOCUS_07980 3999 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 4810 5376 gene locus_tag LOCUS_07990 4810 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 5433 6554 gene locus_tag LOCUS_08000 gene amrS 5433 6554 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_08000 6780 10322 gene locus_tag LOCUS_08010 gene mfd 6780 10322 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_08010 10387 12156 gene locus_tag LOCUS_08020 10387 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 12183 13148 gene locus_tag LOCUS_08030 gene corA 12183 13148 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 protein_id gnl|my_center|LOCUS_08030 13448 14221 gene locus_tag LOCUS_08040 13448 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 14300 15076 gene locus_tag LOCUS_08050 14300 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 15185 15601 gene locus_tag LOCUS_08060 15185 15601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_08060 16162 15596 gene locus_tag LOCUS_08070 16162 15596 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_08070 17591 16203 gene locus_tag LOCUS_08080 17591 16203 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_08080 18476 17682 gene locus_tag LOCUS_08090 18476 17682 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195510.1 protein_id gnl|my_center|LOCUS_08090 19285 18476 gene locus_tag LOCUS_08100 19285 18476 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704666.1 protein_id gnl|my_center|LOCUS_08100 20121 19291 gene locus_tag LOCUS_08110 20121 19291 CDS product molybdenum cofactor biosynthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113031.1 protein_id gnl|my_center|LOCUS_08110 20216 20932 gene locus_tag LOCUS_08120 20216 20932 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275352.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence028 <1 1835 gene locus_tag LOCUS_08130 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389259.1:biotin-dependent carboxyltransferase family protein 1832 2608 gene locus_tag LOCUS_08140 1832 2608 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_08140 2715 5216 gene locus_tag LOCUS_08150 2715 5216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_08150 5914 5237 gene locus_tag LOCUS_08160 5914 5237 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_08160 7020 5911 gene locus_tag LOCUS_08170 7020 5911 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_08170 7492 7205 gene locus_tag LOCUS_08180 7492 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 8697 7489 gene locus_tag LOCUS_08190 8697 7489 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040687.1 protein_id gnl|my_center|LOCUS_08190 9664 8690 gene locus_tag LOCUS_08200 9664 8690 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_08200 10680 9661 gene locus_tag LOCUS_08210 gene pdhA 10680 9661 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_08210 12452 10677 gene locus_tag LOCUS_08220 gene acsA 12452 10677 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862102.1 protein_id gnl|my_center|LOCUS_08220 14115 12526 gene locus_tag LOCUS_08230 gene groL 14115 12526 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 protein_id gnl|my_center|LOCUS_08230 14874 14206 gene locus_tag LOCUS_08240 14874 14206 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_08240 15553 14987 gene locus_tag LOCUS_08250 gene pyrR 15553 14987 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_08250 15716 16345 gene locus_tag LOCUS_08260 15716 16345 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_08260 16342 17688 gene locus_tag LOCUS_08270 16342 17688 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_08270 19547 17793 gene locus_tag LOCUS_08280 19547 17793 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_08280 20563 19562 gene locus_tag LOCUS_08290 20563 19562 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence029 456 905 gene locus_tag LOCUS_08300 456 905 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_08300 892 1617 gene locus_tag LOCUS_08310 gene lptB 892 1617 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_08310 1640 3064 gene locus_tag LOCUS_08320 1640 3064 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_08320 3082 3405 gene locus_tag LOCUS_08330 gene raiA 3082 3405 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_08330 3542 4027 gene locus_tag LOCUS_08340 gene ptsN 3542 4027 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_08340 3996 4943 gene locus_tag LOCUS_08350 gene hprK 3996 4943 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_08350 5094 6623 gene locus_tag LOCUS_08360 gene ilvA 5094 6623 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_08360 7318 6698 gene locus_tag LOCUS_08370 7318 6698 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525893.1 protein_id gnl|my_center|LOCUS_08370 7361 9304 gene locus_tag LOCUS_08380 7361 9304 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995440.1 protein_id gnl|my_center|LOCUS_08380 9394 10350 gene locus_tag LOCUS_08390 9394 10350 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_08390 10398 11042 gene locus_tag LOCUS_08400 10398 11042 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_08400 11042 12340 gene locus_tag LOCUS_08410 11042 12340 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_08410 12453 13073 gene locus_tag LOCUS_08420 12453 13073 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 protein_id gnl|my_center|LOCUS_08420 13070 13873 gene locus_tag LOCUS_08430 13070 13873 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_08430 14078 16099 gene locus_tag LOCUS_08440 14078 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 17349 16174 gene locus_tag LOCUS_08450 17349 16174 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189567.1 protein_id gnl|my_center|LOCUS_08450 17544 18299 gene locus_tag LOCUS_08460 17544 18299 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_08460 18398 19330 gene locus_tag LOCUS_08470 gene ttcA 18398 19330 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706151.1 protein_id gnl|my_center|LOCUS_08470 19810 19385 gene locus_tag LOCUS_08480 19810 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19969 20370 gene locus_tag LOCUS_08490 19969 20370 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073390.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence030 <1 2065 gene locus_tag LOCUS_08500 <1 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521705.1:valine--tRNA ligase 2413 2183 gene locus_tag LOCUS_08510 2413 2183 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_08510 3927 2500 gene locus_tag LOCUS_08520 3927 2500 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_08520 4049 4537 gene locus_tag LOCUS_08530 gene moaC 4049 4537 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_08530 7384 4637 gene locus_tag LOCUS_08540 7384 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7755 7381 gene locus_tag LOCUS_08550 7755 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9476 7752 gene locus_tag LOCUS_08560 9476 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 10264 9509 gene locus_tag LOCUS_08570 10264 9509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_08570 10985 10269 gene locus_tag LOCUS_08580 10985 10269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_08580 11478 11113 gene locus_tag LOCUS_08590 11478 11113 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_08590 12041 11502 gene locus_tag LOCUS_08600 12041 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12817 12038 gene locus_tag LOCUS_08610 12817 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15673 12821 gene locus_tag LOCUS_08620 15673 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16083 15757 gene locus_tag LOCUS_08630 16083 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 16364 16107 gene locus_tag LOCUS_08640 16364 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 17742 16453 gene locus_tag LOCUS_08650 17742 16453 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_08650 19664 17817 gene locus_tag LOCUS_08660 19664 17817 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_08660 20157 19678 gene locus_tag LOCUS_08670 20157 19678 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941579.1 protein_id gnl|my_center|LOCUS_08670 20523 20230 gene locus_tag LOCUS_08680 20523 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence031 <1 873 gene locus_tag LOCUS_08690 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926826.1:DNA gyrase subunit A 870 1967 gene locus_tag LOCUS_08700 gene serC 870 1967 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_08700 2038 3105 gene locus_tag LOCUS_08710 gene pheA 2038 3105 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_08710 3298 4395 gene locus_tag LOCUS_08720 gene hisC 3298 4395 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08720 4409 5296 gene locus_tag LOCUS_08730 4409 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08730 5394 7346 gene locus_tag LOCUS_08740 5394 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08740 7435 9138 gene locus_tag LOCUS_08750 gene rpsA 7435 9138 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_08750 9150 9437 gene locus_tag LOCUS_08760 9150 9437 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_08760 9525 9833 gene locus_tag LOCUS_08770 9525 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9839 11014 gene locus_tag LOCUS_08780 gene lapB 9839 11014 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_08780 11065 11955 gene locus_tag LOCUS_08790 gene cysM 11065 11955 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_08790 11909 14011 gene locus_tag LOCUS_08800 11909 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14037 14216 gene locus_tag LOCUS_08810 14037 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 14213 14641 gene locus_tag LOCUS_08820 14213 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 14641 15429 gene locus_tag LOCUS_08830 14641 15429 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_08830 15497 15739 gene locus_tag LOCUS_08840 15497 15739 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_08840 15809 15885 gene locus_tag LOCUS_t00090 15809 15885 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16062 17978 gene locus_tag LOCUS_08850 gene thrS 16062 17978 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_08850 18095 18526 gene locus_tag LOCUS_08860 gene infC 18095 18526 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_08860 18671 18868 gene locus_tag LOCUS_08870 gene rpmI 18671 18868 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_08870 18881 19240 gene locus_tag LOCUS_08880 gene rplT 18881 19240 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_08880 19331 20362 gene locus_tag LOCUS_08890 gene pheS 19331 20362 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence032 65 952 gene locus_tag LOCUS_08900 65 952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_08900 998 1864 gene locus_tag LOCUS_08910 998 1864 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_08910 1929 2927 gene locus_tag LOCUS_08920 1929 2927 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_08920 3765 2959 gene locus_tag LOCUS_08930 3765 2959 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_08930 4052 4444 gene locus_tag LOCUS_08940 4052 4444 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_08940 4512 5423 gene locus_tag LOCUS_08950 4512 5423 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_08950 5483 6727 gene locus_tag LOCUS_08960 5483 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6754 7554 gene locus_tag LOCUS_08970 gene kdpE 6754 7554 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814052.1 protein_id gnl|my_center|LOCUS_08970 7644 8318 gene locus_tag LOCUS_08980 7644 8318 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_08980 8668 10023 gene locus_tag LOCUS_08990 8668 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10213 10995 gene locus_tag LOCUS_09000 10213 10995 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_09000 13062 11104 gene locus_tag LOCUS_09010 13062 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 15051 13594 gene locus_tag LOCUS_09020 15051 13594 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_09020 15824 15522 gene locus_tag LOCUS_09030 15824 15522 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_09030 16023 15829 gene locus_tag LOCUS_09040 16023 15829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 17910 16060 gene locus_tag LOCUS_09050 gene ilvD 17910 16060 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_09050 18009 18722 gene locus_tag LOCUS_09060 18009 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 18869 19663 gene locus_tag LOCUS_09070 gene lgt 18869 19663 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence033 116 514 gene locus_tag LOCUS_09080 gene rplQ 116 514 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_09080 854 630 gene locus_tag LOCUS_09090 854 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 792 1460 gene locus_tag LOCUS_09100 792 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09100 1464 1658 gene locus_tag LOCUS_09110 1464 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09110 4504 1619 gene locus_tag LOCUS_09120 gene uvrA 4504 1619 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195192.1 protein_id gnl|my_center|LOCUS_09120 4674 5882 gene locus_tag LOCUS_09130 4674 5882 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_09130 5940 6425 gene locus_tag LOCUS_09140 5940 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6533 7495 gene locus_tag LOCUS_09150 6533 7495 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_09150 7503 8306 gene locus_tag LOCUS_09160 gene tcdA 7503 8306 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_09160 8386 8772 gene locus_tag LOCUS_09170 8386 8772 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_09170 8853 9911 gene locus_tag LOCUS_09180 8853 9911 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_09180 9926 13201 gene locus_tag LOCUS_09190 9926 13201 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_09190 13198 13419 gene locus_tag LOCUS_09200 13198 13419 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_09200 13996 13493 gene locus_tag LOCUS_09210 13996 13493 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_09210 15043 14147 gene locus_tag LOCUS_09220 15043 14147 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 protein_id gnl|my_center|LOCUS_09220 15140 15739 gene locus_tag LOCUS_09230 15140 15739 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_09230 15858 16751 gene locus_tag LOCUS_09240 15858 16751 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_09240 17726 16809 gene locus_tag LOCUS_09250 gene ybiB 17726 16809 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210242.1 protein_id gnl|my_center|LOCUS_09250 17804 18685 gene locus_tag LOCUS_09260 17804 18685 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_09260 18696 19592 gene locus_tag LOCUS_09270 18696 19592 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_09270 19657 19848 gene locus_tag LOCUS_09280 19657 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence034 502 266 gene locus_tag LOCUS_09290 502 266 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810392.1 protein_id gnl|my_center|LOCUS_09290 1052 555 gene locus_tag LOCUS_09300 1052 555 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_09300 2481 1066 gene locus_tag LOCUS_09310 gene ccoG 2481 1066 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_09310 3469 2579 gene locus_tag LOCUS_09320 3469 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3650 3462 gene locus_tag LOCUS_09330 3650 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4297 3662 gene locus_tag LOCUS_09340 gene ccoO 4297 3662 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_09340 5743 4313 gene locus_tag LOCUS_09350 gene ccoN 5743 4313 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 protein_id gnl|my_center|LOCUS_09350 6729 6520 gene locus_tag LOCUS_09360 gene ccoS 6729 6520 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688317.1 protein_id gnl|my_center|LOCUS_09360 9238 6734 gene locus_tag LOCUS_09370 9238 6734 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951108.1 protein_id gnl|my_center|LOCUS_09370 9502 9427 gene locus_tag LOCUS_t00100 9502 9427 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9892 10674 gene locus_tag LOCUS_09380 9892 10674 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_09380 10679 11038 gene locus_tag LOCUS_09390 10679 11038 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_09390 11035 11769 gene locus_tag LOCUS_09400 11035 11769 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_09400 11836 13461 gene locus_tag LOCUS_09410 11836 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 13603 15672 gene locus_tag LOCUS_09420 gene fusA 13603 15672 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_09420 15727 16032 gene locus_tag LOCUS_09430 15727 16032 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_09430 16480 16091 gene locus_tag LOCUS_09440 16480 16091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 18463 16658 gene locus_tag LOCUS_09450 18463 16658 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_09450 18730 18476 gene locus_tag LOCUS_09460 18730 18476 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_09460 <20185 19049 gene locus_tag LOCUS_09470 <20185 19049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010909024.1:NADP-dependent isocitrate dehydrogenase >Feature sequence035 274 1083 gene locus_tag LOCUS_09480 gene siaD 274 1083 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_09480 2760 1129 gene locus_tag LOCUS_09490 2760 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 5091 2908 gene locus_tag LOCUS_09500 5091 2908 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_09500 5944 5093 gene locus_tag LOCUS_09510 5944 5093 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_09510 6672 5941 gene locus_tag LOCUS_09520 6672 5941 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_09520 8028 6835 gene locus_tag LOCUS_09530 8028 6835 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_09530 9190 8159 gene locus_tag LOCUS_09540 gene murB 9190 8159 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 protein_id gnl|my_center|LOCUS_09540 9660 9187 gene locus_tag LOCUS_09550 9660 9187 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061370.1 protein_id gnl|my_center|LOCUS_09550 11472 9850 gene locus_tag LOCUS_09560 11472 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11785 13107 gene locus_tag LOCUS_09570 11785 13107 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_09570 13987 13046 gene locus_tag LOCUS_09580 13987 13046 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_09580 14178 15107 gene locus_tag LOCUS_09590 14178 15107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_09590 18252 15166 gene locus_tag LOCUS_09600 18252 15166 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123023.1 protein_id gnl|my_center|LOCUS_09600 18495 19505 gene locus_tag LOCUS_09610 18495 19505 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244151.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence036 <1 678 gene locus_tag LOCUS_09620 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811950.1:M3 family metallopeptidase 2886 700 gene locus_tag LOCUS_09630 2886 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3974 2883 gene locus_tag LOCUS_09640 3974 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4401 5645 gene locus_tag LOCUS_09650 4401 5645 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105434.1 protein_id gnl|my_center|LOCUS_09650 6616 5663 gene locus_tag LOCUS_09660 6616 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6938 6708 gene locus_tag LOCUS_09670 6938 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 8143 7148 gene locus_tag LOCUS_09680 8143 7148 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_09680 8230 8427 gene locus_tag LOCUS_09690 8230 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 9312 8461 gene locus_tag LOCUS_09700 9312 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9684 9415 gene locus_tag LOCUS_09710 9684 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 10540 9695 gene locus_tag LOCUS_09720 10540 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 11102 10611 gene locus_tag LOCUS_09730 11102 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 11498 11169 gene locus_tag LOCUS_09740 11498 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 14269 11495 gene locus_tag LOCUS_09750 14269 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 14353 15003 gene locus_tag LOCUS_09760 14353 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 15005 15325 gene locus_tag LOCUS_09770 15005 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 16490 15987 gene locus_tag LOCUS_09780 16490 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 19171 16487 gene locus_tag LOCUS_09790 19171 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 19602 19168 gene locus_tag LOCUS_09800 19602 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 19805 19599 gene locus_tag LOCUS_09810 19805 19599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence037 <1 516 gene locus_tag LOCUS_09820 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931559.1:thiazole synthase 513 1262 gene locus_tag LOCUS_09830 gene trmB 513 1262 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_09830 1303 3150 gene locus_tag LOCUS_09840 gene sppA 1303 3150 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 protein_id gnl|my_center|LOCUS_09840 3252 3881 gene locus_tag LOCUS_09850 3252 3881 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_09850 5075 3894 gene locus_tag LOCUS_09860 gene ppk2 5075 3894 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_09860 6552 5335 gene locus_tag LOCUS_09870 gene hemW 6552 5335 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_09870 7251 6646 gene locus_tag LOCUS_09880 gene rdgB 7251 6646 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186211.1 protein_id gnl|my_center|LOCUS_09880 8029 7310 gene locus_tag LOCUS_09890 gene rph 8029 7310 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_09890 9105 8134 gene locus_tag LOCUS_09900 9105 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9168 10034 gene locus_tag LOCUS_09910 9168 10034 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_09910 10102 10479 gene locus_tag LOCUS_09920 10102 10479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10652 12784 gene locus_tag LOCUS_09930 10652 12784 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_09930 12796 13995 gene locus_tag LOCUS_09940 12796 13995 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_09940 13992 14558 gene locus_tag LOCUS_09950 13992 14558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 14625 15896 gene locus_tag LOCUS_09960 14625 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 16744 15944 gene locus_tag LOCUS_09970 16744 15944 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189681.1 protein_id gnl|my_center|LOCUS_09970 17549 16881 gene locus_tag LOCUS_09980 17549 16881 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971856.1 protein_id gnl|my_center|LOCUS_09980 19019 17619 gene locus_tag LOCUS_09990 gene yegQ 19019 17619 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_09990 19885 19016 gene locus_tag LOCUS_10000 gene ylqF 19885 19016 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence038 557 57 gene locus_tag LOCUS_10010 557 57 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_10010 1229 558 gene locus_tag LOCUS_10020 1229 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2534 1239 gene locus_tag LOCUS_10030 gene folC 2534 1239 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_10030 3439 2561 gene locus_tag LOCUS_10040 gene accD 3439 2561 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_10040 4257 3436 gene locus_tag LOCUS_10050 gene trpA 4257 3436 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_10050 5505 4300 gene locus_tag LOCUS_10060 gene trpB 5505 4300 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_10060 6121 5498 gene locus_tag LOCUS_10070 6121 5498 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_10070 6919 6122 gene locus_tag LOCUS_10080 gene truA 6919 6122 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_10080 7572 6916 gene locus_tag LOCUS_10090 7572 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 10541 7569 gene locus_tag LOCUS_10100 10541 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 11855 10722 gene locus_tag LOCUS_10110 gene asd 11855 10722 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_10110 12974 11910 gene locus_tag LOCUS_10120 gene leuB 12974 11910 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_10120 13663 13025 gene locus_tag LOCUS_10130 gene leuD 13663 13025 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_10130 13791 13663 gene locus_tag LOCUS_10140 13791 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 15230 13821 gene locus_tag LOCUS_10150 gene leuC 15230 13821 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219221.1 protein_id gnl|my_center|LOCUS_10150 16128 15310 gene locus_tag LOCUS_10160 16128 15310 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_10160 17301 16141 gene locus_tag LOCUS_10170 17301 16141 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_10170 18595 17465 gene locus_tag LOCUS_10180 gene aroC 18595 17465 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_10180 19054 18737 gene locus_tag LOCUS_10190 gene ilvN 19054 18737 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211026.1 protein_id gnl|my_center|LOCUS_10190 <19812 19054 gene locus_tag LOCUS_10200 <19812 19054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937667.1:acetolactate synthase large subunit >Feature sequence039 427 1368 gene locus_tag LOCUS_10210 427 1368 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_10210 1650 3269 gene locus_tag LOCUS_10220 1650 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3266 4636 gene locus_tag LOCUS_10230 gene atoC 3266 4636 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_10230 4922 6187 gene locus_tag LOCUS_10240 4922 6187 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_10240 6219 7532 gene locus_tag LOCUS_10250 6219 7532 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_10250 7644 8543 gene locus_tag LOCUS_10260 7644 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8543 9487 gene locus_tag LOCUS_10270 8543 9487 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_10270 9484 10269 gene locus_tag LOCUS_10280 9484 10269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_10280 10266 10913 gene locus_tag LOCUS_10290 10266 10913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_10290 10935 12089 gene locus_tag LOCUS_10300 10935 12089 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_10300 12179 13639 gene locus_tag LOCUS_10310 12179 13639 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_10310 13650 14807 gene locus_tag LOCUS_10320 13650 14807 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_10320 16202 14928 gene locus_tag LOCUS_10330 16202 14928 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_10330 17484 16375 gene locus_tag LOCUS_10340 17484 16375 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_10340 17831 18781 gene locus_tag LOCUS_10350 17831 18781 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_10350 19022 18831 gene locus_tag LOCUS_10360 19022 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence040 976 404 gene locus_tag LOCUS_10370 976 404 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 protein_id gnl|my_center|LOCUS_10370 1336 1016 gene locus_tag LOCUS_10380 1336 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1223 1513 gene locus_tag LOCUS_10390 1223 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1726 2871 gene locus_tag LOCUS_10400 1726 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2989 4158 gene locus_tag LOCUS_10410 2989 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4178 7177 gene locus_tag LOCUS_10420 4178 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7180 8328 gene locus_tag LOCUS_10430 7180 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 8338 8481 gene locus_tag LOCUS_10440 8338 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8501 9427 gene locus_tag LOCUS_10450 gene cmr4 8501 9427 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_10450 9441 9875 gene locus_tag LOCUS_10460 9441 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9886 11091 gene locus_tag LOCUS_10470 9886 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11097 12071 gene locus_tag LOCUS_10480 gene rhuM 11097 12071 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_10480 12068 12364 gene locus_tag LOCUS_10490 gene csx16 12068 12364 CDS product CRISPR-associated protein Csx16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060823.1 protein_id gnl|my_center|LOCUS_10490 12412 13548 gene locus_tag LOCUS_10500 12412 13548 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 protein_id gnl|my_center|LOCUS_10500 13554 14513 gene locus_tag LOCUS_10510 gene cas6 13554 14513 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_10510 14606 15100 gene locus_tag LOCUS_10520 14606 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 15222 15506 gene locus_tag LOCUS_10530 gene cas2 15222 15506 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_10530 15510 16496 gene locus_tag LOCUS_10540 gene cas1 15510 16496 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_10540 16496 17302 gene locus_tag LOCUS_10550 16496 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 17293 17622 gene locus_tag LOCUS_10560 17293 17622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 17741 18897 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtccggactgatgccctgaattcaaagggattaagac 19302 18955 gene locus_tag LOCUS_10570 19302 18955 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_10570 19488 19342 gene locus_tag LOCUS_10580 19488 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence041 277 2274 gene locus_tag LOCUS_10590 277 2274 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_10590 2881 2420 gene locus_tag LOCUS_10600 2881 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3028 3104 gene locus_tag LOCUS_t00110 3028 3104 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4238 3039 gene locus_tag LOCUS_10610 4238 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4627 5748 gene locus_tag LOCUS_10620 4627 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5763 6284 gene locus_tag LOCUS_10630 5763 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 7060 8442 gene locus_tag LOCUS_10640 7060 8442 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_10640 8596 10860 gene locus_tag LOCUS_10650 8596 10860 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_10650 11258 10875 gene locus_tag LOCUS_10660 11258 10875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11503 11252 gene locus_tag LOCUS_10670 11503 11252 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_10670 11691 12182 gene locus_tag LOCUS_10680 11691 12182 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_10680 12373 12218 gene locus_tag LOCUS_10690 12373 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 12648 12851 gene locus_tag LOCUS_10700 12648 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 12952 13296 gene locus_tag LOCUS_10710 12952 13296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 13293 13553 gene locus_tag LOCUS_10720 13293 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 14159 13725 gene locus_tag LOCUS_10730 14159 13725 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704258.1 protein_id gnl|my_center|LOCUS_10730 17025 14380 gene locus_tag LOCUS_10740 17025 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 18353 17436 gene locus_tag LOCUS_10750 18353 17436 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969642.1 protein_id gnl|my_center|LOCUS_10750 18491 19042 gene locus_tag LOCUS_10760 18491 19042 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence042 <1 1044 gene locus_tag LOCUS_10770 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879693.1:peptide-modifying radical SAM enzyme CbpB 2430 1117 gene locus_tag LOCUS_10780 2430 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3204 2929 gene locus_tag LOCUS_10790 gene hupB 3204 2929 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_10790 3531 4733 gene locus_tag LOCUS_10800 3531 4733 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_10800 5199 4702 gene locus_tag LOCUS_10810 5199 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5349 6437 gene locus_tag LOCUS_10820 gene mutY 5349 6437 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_10820 6682 6458 gene locus_tag LOCUS_10830 6682 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8114 6963 gene locus_tag LOCUS_10840 gene yiaY 8114 6963 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388685.1 protein_id gnl|my_center|LOCUS_10840 9767 8253 gene locus_tag LOCUS_10850 9767 8253 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969871.1 protein_id gnl|my_center|LOCUS_10850 10031 11917 gene locus_tag LOCUS_10860 10031 11917 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_10860 12896 11922 gene locus_tag LOCUS_10870 12896 11922 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338820.1 protein_id gnl|my_center|LOCUS_10870 13064 13696 gene locus_tag LOCUS_10880 13064 13696 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_10880 15896 13716 gene locus_tag LOCUS_10890 15896 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_10890 16652 16008 gene locus_tag LOCUS_10900 16652 16008 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_10900 18144 16801 gene locus_tag LOCUS_10910 gene gdhA 18144 16801 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905419.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence043 <1 1108 gene locus_tag LOCUS_10920 <1 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111532.1:nitrite reductase 1177 1788 gene locus_tag LOCUS_10930 1177 1788 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_10930 1834 2709 gene locus_tag LOCUS_10940 1834 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2847 3173 gene locus_tag LOCUS_10950 2847 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3290 3673 gene locus_tag LOCUS_10960 3290 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3750 4958 gene locus_tag LOCUS_10970 gene nirF 3750 4958 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_10970 4958 6016 gene locus_tag LOCUS_10980 4958 6016 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_10980 6009 6512 gene locus_tag LOCUS_10990 6009 6512 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_10990 6512 7066 gene locus_tag LOCUS_11000 6512 7066 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_11000 7172 8380 gene locus_tag LOCUS_11010 gene nirJ 7172 8380 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_11010 8377 10005 gene locus_tag LOCUS_11020 gene nirN 8377 10005 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_11020 10057 11244 gene locus_tag LOCUS_11030 10057 11244 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_11030 12093 11323 gene locus_tag LOCUS_11040 12093 11323 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_11040 14011 12098 gene locus_tag LOCUS_11050 14011 12098 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_11050 15031 14015 gene locus_tag LOCUS_11060 15031 14015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 15449 15039 gene locus_tag LOCUS_11070 15449 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 16308 15508 gene locus_tag LOCUS_11080 gene nirQ 16308 15508 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_11080 16586 16305 gene locus_tag LOCUS_11090 16586 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 17194 16598 gene locus_tag LOCUS_11100 17194 16598 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence044 <1 811 gene locus_tag LOCUS_11110 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813839.1:RluA family pseudouridine synthase 804 1460 gene locus_tag LOCUS_11120 804 1460 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_11120 2307 1567 gene locus_tag LOCUS_11130 2307 1567 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_11130 2879 2304 gene locus_tag LOCUS_11140 2879 2304 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_11140 3056 3553 gene locus_tag LOCUS_11150 3056 3553 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_11150 3584 3763 gene locus_tag LOCUS_11160 gene rpmF 3584 3763 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_11160 3851 4873 gene locus_tag LOCUS_11170 gene plsX 3851 4873 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_11170 4870 5835 gene locus_tag LOCUS_11180 4870 5835 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191537.1 protein_id gnl|my_center|LOCUS_11180 5872 6801 gene locus_tag LOCUS_11190 gene fabD 5872 6801 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_11190 6805 7554 gene locus_tag LOCUS_11200 gene fabG 6805 7554 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_11200 7644 7883 gene locus_tag LOCUS_11210 gene acpP 7644 7883 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_11210 7985 9220 gene locus_tag LOCUS_11220 gene fabF 7985 9220 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_11220 9248 9775 gene locus_tag LOCUS_11230 9248 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11460 9859 gene locus_tag LOCUS_11240 gene nadB 11460 9859 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_11240 11683 12282 gene locus_tag LOCUS_11250 gene rpoE 11683 12282 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_11250 12292 12840 gene locus_tag LOCUS_11260 12292 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 12837 13808 gene locus_tag LOCUS_11270 12837 13808 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_11270 13808 14275 gene locus_tag LOCUS_11280 13808 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 14272 15711 gene locus_tag LOCUS_11290 gene mucD 14272 15711 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_11290 15708 15983 gene locus_tag LOCUS_11300 15708 15983 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence045 87 1001 gene locus_tag LOCUS_11310 87 1001 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_11310 1028 1228 gene locus_tag LOCUS_11320 1028 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1858 1313 gene locus_tag LOCUS_11330 gene rfbC 1858 1313 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_11330 2742 1858 gene locus_tag LOCUS_11340 gene rfbA 2742 1858 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_11340 2947 4338 gene locus_tag LOCUS_11350 2947 4338 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_11350 4483 4680 gene locus_tag LOCUS_11360 4483 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7419 4786 gene locus_tag LOCUS_11370 gene alaS 7419 4786 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_11370 7568 8119 gene locus_tag LOCUS_11380 7568 8119 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_11380 9193 8120 gene locus_tag LOCUS_11390 gene dinB 9193 8120 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191702.1 protein_id gnl|my_center|LOCUS_11390 10417 9344 gene locus_tag LOCUS_11400 gene aroG 10417 9344 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_11400 10660 11592 gene locus_tag LOCUS_11410 gene msrP 10660 11592 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_11410 11710 12372 gene locus_tag LOCUS_11420 gene msrQ 11710 12372 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 protein_id gnl|my_center|LOCUS_11420 13537 12359 gene locus_tag LOCUS_11430 13537 12359 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_11430 14250 13660 gene locus_tag LOCUS_11440 gene mog 14250 13660 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926148.1 protein_id gnl|my_center|LOCUS_11440 15002 14385 gene locus_tag LOCUS_11450 15002 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15068 16432 gene locus_tag LOCUS_11460 gene pmbA 15068 16432 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence046 1963 650 gene locus_tag LOCUS_11470 1963 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529404.1 protein_id gnl|my_center|LOCUS_11470 2564 1995 gene locus_tag LOCUS_11480 2564 1995 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_11480 2836 2654 gene locus_tag LOCUS_11490 2836 2654 CDS product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820212.1 protein_id gnl|my_center|LOCUS_11490 3135 2944 gene locus_tag LOCUS_11500 3135 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3510 3256 gene locus_tag LOCUS_11510 3510 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3442 3771 gene locus_tag LOCUS_11520 3442 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4146 4445 gene locus_tag LOCUS_11530 4146 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4435 4725 gene locus_tag LOCUS_11540 4435 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5535 4852 gene locus_tag LOCUS_11550 5535 4852 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_11550 7313 5532 gene locus_tag LOCUS_11560 7313 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7566 8660 gene locus_tag LOCUS_11570 7566 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_11570 8666 9772 gene locus_tag LOCUS_11580 8666 9772 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_11580 10234 9830 gene locus_tag LOCUS_11590 10234 9830 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_11590 13641 10318 gene locus_tag LOCUS_11600 13641 10318 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_11600 14263 13793 gene locus_tag LOCUS_11610 14263 13793 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087013.1 protein_id gnl|my_center|LOCUS_11610 14481 14957 gene locus_tag LOCUS_11620 14481 14957 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_11620 16494 15082 gene locus_tag LOCUS_11630 16494 15082 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence047 <1 558 gene locus_tag LOCUS_11640 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529718.1:glutamate synthase large subunit 559 2022 gene locus_tag LOCUS_11650 559 2022 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_11650 2243 3205 gene locus_tag LOCUS_11660 2243 3205 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_11660 3298 3735 gene locus_tag LOCUS_11670 gene aroQ 3298 3735 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_11670 3877 5802 gene locus_tag LOCUS_11680 3877 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7578 5839 gene locus_tag LOCUS_11690 gene ggt 7578 5839 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_11690 8889 7684 gene locus_tag LOCUS_11700 8889 7684 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_11700 10289 8886 gene locus_tag LOCUS_11710 10289 8886 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 protein_id gnl|my_center|LOCUS_11710 10867 10361 gene locus_tag LOCUS_11720 10867 10361 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204886.1 protein_id gnl|my_center|LOCUS_11720 11049 11828 gene locus_tag LOCUS_11730 gene fabI 11049 11828 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_11730 11837 12433 gene locus_tag LOCUS_11740 11837 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 12922 12473 gene locus_tag LOCUS_11750 12922 12473 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_11750 13294 14655 gene locus_tag LOCUS_11760 gene glmU 13294 14655 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence048 259 1062 gene locus_tag LOCUS_11770 259 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1134 1589 gene locus_tag LOCUS_11780 1134 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4165 1730 gene locus_tag LOCUS_11790 4165 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5566 4181 gene locus_tag LOCUS_11800 5566 4181 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_11800 9438 5563 gene locus_tag LOCUS_11810 9438 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 11135 9441 gene locus_tag LOCUS_11820 11135 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13129 11135 gene locus_tag LOCUS_11830 13129 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 13914 13135 gene locus_tag LOCUS_11840 13914 13135 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_11840 14580 14038 gene locus_tag LOCUS_11850 14580 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 14587 14832 gene locus_tag LOCUS_11860 14587 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 <16400 14933 gene locus_tag LOCUS_11870 <16400 14933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980762.1:DNA helicase II >Feature sequence049 1847 504 gene locus_tag LOCUS_11880 1847 504 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_11880 3653 1908 gene locus_tag LOCUS_11890 3653 1908 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_11890 5463 3688 gene locus_tag LOCUS_11900 5463 3688 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_11900 6074 5460 gene locus_tag LOCUS_11910 6074 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6276 7313 gene locus_tag LOCUS_11920 gene gmd 6276 7313 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_11920 7323 8207 gene locus_tag LOCUS_11930 7323 8207 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266714.1 protein_id gnl|my_center|LOCUS_11930 8209 9369 gene locus_tag LOCUS_11940 8209 9369 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_11940 9373 10518 gene locus_tag LOCUS_11950 gene wbpZ 9373 10518 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_11950 10581 11873 gene locus_tag LOCUS_11960 gene waaA 10581 11873 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_11960 13254 11929 gene locus_tag LOCUS_11970 13254 11929 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_11970 13606 13283 gene locus_tag LOCUS_11980 13606 13283 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_11980 14275 13622 gene locus_tag LOCUS_11990 14275 13622 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_11990 14513 15403 gene locus_tag LOCUS_12000 gene thiD 14513 15403 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence050 1138 1461 gene locus_tag LOCUS_12010 1138 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1526 1942 gene locus_tag LOCUS_12020 1526 1942 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_12020 1945 2214 gene locus_tag LOCUS_12030 gene grxC 1945 2214 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_12030 2340 2804 gene locus_tag LOCUS_12040 gene secB 2340 2804 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_12040 2815 3294 gene locus_tag LOCUS_12050 2815 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3291 4280 gene locus_tag LOCUS_12060 3291 4280 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_12060 4762 4292 gene locus_tag LOCUS_12070 gene trmL 4762 4292 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_12070 5621 4899 gene locus_tag LOCUS_12080 5621 4899 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526022.1 protein_id gnl|my_center|LOCUS_12080 5840 5655 gene locus_tag LOCUS_12090 5840 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5760 6668 gene locus_tag LOCUS_12100 gene bioB 5760 6668 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_12100 6680 7624 gene locus_tag LOCUS_12110 6680 7624 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_12110 7749 8396 gene locus_tag LOCUS_12120 7749 8396 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_12120 9536 8520 gene locus_tag LOCUS_12130 gene hemB 9536 8520 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687809.1 protein_id gnl|my_center|LOCUS_12130 10510 9794 gene locus_tag LOCUS_12140 gene yihA 10510 9794 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_12140 10630 11259 gene locus_tag LOCUS_12150 10630 11259 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_12150 11327 12574 gene locus_tag LOCUS_12160 11327 12574 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_12160 12608 13279 gene locus_tag LOCUS_12170 gene rpiA 12608 13279 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_12170 13400 14107 gene locus_tag LOCUS_12180 gene phoU 13400 14107 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_12180 14488 14216 gene locus_tag LOCUS_12190 14488 14216 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_12190 <15984 14568 gene locus_tag LOCUS_12200 <15984 14568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192168.1:amino-acid N-acetyltransferase >Feature sequence051 267 497 gene locus_tag LOCUS_12210 267 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1299 466 gene locus_tag LOCUS_12220 1299 466 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_12220 1489 1968 gene locus_tag LOCUS_12230 1489 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2048 2602 gene locus_tag LOCUS_12240 2048 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2703 4871 gene locus_tag LOCUS_12250 2703 4871 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930373.1 protein_id gnl|my_center|LOCUS_12250 4868 5500 gene locus_tag LOCUS_12260 4868 5500 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930374.1 protein_id gnl|my_center|LOCUS_12260 5632 5838 gene locus_tag LOCUS_12270 5632 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5852 8764 gene locus_tag LOCUS_12280 5852 8764 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 protein_id gnl|my_center|LOCUS_12280 8781 9407 gene locus_tag LOCUS_12290 gene fdh3B 8781 9407 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_12290 9404 9640 gene locus_tag LOCUS_12300 9404 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9651 10667 gene locus_tag LOCUS_12310 9651 10667 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_12310 10842 12011 gene locus_tag LOCUS_12320 10842 12011 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_12320 13235 12102 gene locus_tag LOCUS_12330 13235 12102 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_12330 14301 13258 gene locus_tag LOCUS_12340 14301 13258 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_12340 14416 15123 gene locus_tag LOCUS_12350 14416 15123 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence052 56 1012 gene locus_tag LOCUS_12360 56 1012 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530313.1 protein_id gnl|my_center|LOCUS_12360 1009 1812 gene locus_tag LOCUS_12370 1009 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1821 2624 gene locus_tag LOCUS_12380 1821 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2614 3306 gene locus_tag LOCUS_12390 gene nadD 2614 3306 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_12390 3423 3776 gene locus_tag LOCUS_12400 3423 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3778 4248 gene locus_tag LOCUS_12410 gene rlmH 3778 4248 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 protein_id gnl|my_center|LOCUS_12410 4259 4897 gene locus_tag LOCUS_12420 4259 4897 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_12420 4966 6420 gene locus_tag LOCUS_12430 gene rng 4966 6420 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_12430 6674 8446 gene locus_tag LOCUS_12440 6674 8446 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_12440 8554 9423 gene locus_tag LOCUS_12450 8554 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 9588 10553 gene locus_tag LOCUS_12460 9588 10553 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_12460 10622 11221 gene locus_tag LOCUS_12470 gene ruvA 10622 11221 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_12470 11277 12338 gene locus_tag LOCUS_12480 gene ruvB 11277 12338 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_12480 13446 12421 gene locus_tag LOCUS_12490 gene xerC 13446 12421 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523080.1 protein_id gnl|my_center|LOCUS_12490 14155 13514 gene locus_tag LOCUS_12500 14155 13514 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199066.1 protein_id gnl|my_center|LOCUS_12500 15161 14328 gene locus_tag LOCUS_12510 gene dapF 15161 14328 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_12510 15481 15200 gene locus_tag LOCUS_12520 15481 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence053 228 1001 gene locus_tag LOCUS_12530 228 1001 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930761.1 protein_id gnl|my_center|LOCUS_12530 1152 1319 gene locus_tag LOCUS_12540 1152 1319 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_12540 1383 2918 gene locus_tag LOCUS_12550 1383 2918 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_12550 3038 4801 gene locus_tag LOCUS_12560 3038 4801 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_12560 4798 7581 gene locus_tag LOCUS_12570 gene fdhF 4798 7581 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_12570 7776 9959 gene locus_tag LOCUS_12580 7776 9959 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038670.1 protein_id gnl|my_center|LOCUS_12580 11577 10033 gene locus_tag LOCUS_12590 11577 10033 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_12590 11480 11794 gene locus_tag LOCUS_12600 11480 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 12477 11743 gene locus_tag LOCUS_12610 12477 11743 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937181.1 protein_id gnl|my_center|LOCUS_12610 12506 13525 gene locus_tag LOCUS_12620 12506 13525 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_12620 13534 14286 gene locus_tag LOCUS_12630 gene pgeF 13534 14286 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_12630 14575 14360 gene locus_tag LOCUS_12640 14575 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence054 1324 278 gene locus_tag LOCUS_12650 1324 278 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_12650 2890 1430 gene locus_tag LOCUS_12660 2890 1430 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_12660 5095 3065 gene locus_tag LOCUS_12670 5095 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 6872 5343 gene locus_tag LOCUS_12680 gene ubiB 6872 5343 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_12680 7008 8771 gene locus_tag LOCUS_12690 gene argS 7008 8771 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_12690 8788 9393 gene locus_tag LOCUS_12700 8788 9393 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_12700 9463 10095 gene locus_tag LOCUS_12710 9463 10095 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_12710 12837 10216 gene locus_tag LOCUS_12720 12837 10216 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 protein_id gnl|my_center|LOCUS_12720 13914 12946 gene locus_tag LOCUS_12730 13914 12946 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975180.1 protein_id gnl|my_center|LOCUS_12730 14570 14067 gene locus_tag LOCUS_12740 14570 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <15461 14647 gene locus_tag LOCUS_12750 <15461 14647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390166.1:class I poly(R)-hydroxyalkanoic acid synthase >Feature sequence055 2938 2138 gene locus_tag LOCUS_12760 gene trpC 2938 2138 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_12760 3975 2935 gene locus_tag LOCUS_12770 gene trpD 3975 2935 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_12770 4581 3994 gene locus_tag LOCUS_12780 4581 3994 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 protein_id gnl|my_center|LOCUS_12780 6158 4686 gene locus_tag LOCUS_12790 gene trpE 6158 4686 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_12790 7134 6451 gene locus_tag LOCUS_12800 7134 6451 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_12800 7826 7131 gene locus_tag LOCUS_12810 gene rpe 7826 7131 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_12810 10255 7889 gene locus_tag LOCUS_12820 10255 7889 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_12820 11069 10302 gene locus_tag LOCUS_12830 11069 10302 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12830 11839 11189 gene locus_tag LOCUS_12840 11839 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 12868 11975 gene locus_tag LOCUS_12850 gene sucD 12868 11975 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_12850 14041 12881 gene locus_tag LOCUS_12860 gene sucC 14041 12881 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_12860 14834 14271 gene locus_tag LOCUS_12870 14834 14271 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence056 2973 208 gene locus_tag LOCUS_12880 2973 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4914 3088 gene locus_tag LOCUS_12890 4914 3088 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_12890 5776 4961 gene locus_tag LOCUS_12900 5776 4961 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_12900 6955 6053 gene locus_tag LOCUS_12910 6955 6053 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808402.1 protein_id gnl|my_center|LOCUS_12910 8314 7103 gene locus_tag LOCUS_12920 gene cfa 8314 7103 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 protein_id gnl|my_center|LOCUS_12920 8555 10531 gene locus_tag LOCUS_12930 8555 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 10679 11005 gene locus_tag LOCUS_12940 10679 11005 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_12940 11020 11613 gene locus_tag LOCUS_12950 gene recR 11020 11613 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_12950 11814 12407 gene locus_tag LOCUS_12960 gene petA 11814 12407 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_12960 12411 13679 gene locus_tag LOCUS_12970 12411 13679 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_12970 13676 14431 gene locus_tag LOCUS_12980 13676 14431 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence057 5523 2401 gene locus_tag LOCUS_12990 5523 2401 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_12990 6592 5531 gene locus_tag LOCUS_13000 6592 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7475 6582 gene locus_tag LOCUS_13010 7475 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 8568 7669 gene locus_tag LOCUS_13020 8568 7669 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_13020 10225 8645 gene locus_tag LOCUS_13030 10225 8645 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_13030 11109 10372 gene locus_tag LOCUS_13040 11109 10372 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 protein_id gnl|my_center|LOCUS_13040 11722 11216 gene locus_tag LOCUS_13050 11722 11216 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_13050 12033 14120 gene locus_tag LOCUS_13060 12033 14120 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence058 881 432 gene locus_tag LOCUS_13070 881 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1174 878 gene locus_tag LOCUS_13080 1174 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2047 1292 gene locus_tag LOCUS_13090 gene flgA 2047 1292 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_13090 2063 2284 gene locus_tag LOCUS_13100 2063 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2281 2685 gene locus_tag LOCUS_13110 gene flgB 2281 2685 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_13110 2711 3115 gene locus_tag LOCUS_13120 gene flgC 2711 3115 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_13120 3121 3807 gene locus_tag LOCUS_13130 gene flgD 3121 3807 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_13130 3893 5170 gene locus_tag LOCUS_13140 gene flgE 3893 5170 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367327.1 protein_id gnl|my_center|LOCUS_13140 5200 5958 gene locus_tag LOCUS_13150 gene flgF 5200 5958 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349311.1 protein_id gnl|my_center|LOCUS_13150 5981 6763 gene locus_tag LOCUS_13160 gene flgG 5981 6763 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 protein_id gnl|my_center|LOCUS_13160 6763 7455 gene locus_tag LOCUS_13170 gene flgH 6763 7455 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_13170 7439 8587 gene locus_tag LOCUS_13180 7439 8587 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367323.1 protein_id gnl|my_center|LOCUS_13180 8587 9798 gene locus_tag LOCUS_13190 8587 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9893 11542 gene locus_tag LOCUS_13200 gene flgK 9893 11542 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_13200 11562 12782 gene locus_tag LOCUS_13210 gene flgL 11562 12782 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_13210 13623 12829 gene locus_tag LOCUS_13220 gene fliR 13623 12829 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_13220 13907 13638 gene locus_tag LOCUS_13230 gene fliQ 13907 13638 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160414.1 protein_id gnl|my_center|LOCUS_13230 <14621 13930 gene locus_tag LOCUS_13240 <14621 13930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001253441.1:flagellar type III secretion system pore protein FliP >Feature sequence059 400 1644 gene locus_tag LOCUS_13250 400 1644 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_13250 1652 2893 gene locus_tag LOCUS_13260 1652 2893 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_13260 3246 2860 gene locus_tag LOCUS_13270 gene gloA 3246 2860 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_13270 4082 3309 gene locus_tag LOCUS_13280 4082 3309 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_13280 4834 4085 gene locus_tag LOCUS_13290 4834 4085 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_13290 5613 4831 gene locus_tag LOCUS_13300 5613 4831 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 protein_id gnl|my_center|LOCUS_13300 6994 5624 gene locus_tag LOCUS_13310 gene ffh 6994 5624 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807808.1 protein_id gnl|my_center|LOCUS_13310 7043 7873 gene locus_tag LOCUS_13320 gene ccsA 7043 7873 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_13320 8049 9329 gene locus_tag LOCUS_13330 8049 9329 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_13330 9418 11133 gene locus_tag LOCUS_13340 gene pilB 9418 11133 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_13340 11148 12377 gene locus_tag LOCUS_13350 11148 12377 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_13350 12381 13232 gene locus_tag LOCUS_13360 12381 13232 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770019.1 protein_id gnl|my_center|LOCUS_13360 13425 13649 gene locus_tag LOCUS_13370 13425 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 13651 14283 gene locus_tag LOCUS_13380 13651 14283 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence060 1357 215 gene locus_tag LOCUS_13390 gene carA 1357 215 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_13390 4085 1554 gene locus_tag LOCUS_13400 4085 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4932 4126 gene locus_tag LOCUS_13410 gene dapB 4932 4126 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_13410 5410 5000 gene locus_tag LOCUS_13420 5410 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5565 6023 gene locus_tag LOCUS_13430 gene fur 5565 6023 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_13430 7754 6084 gene locus_tag LOCUS_13440 gene recN 7754 6084 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_13440 8781 7897 gene locus_tag LOCUS_13450 8781 7897 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_13450 8912 9976 gene locus_tag LOCUS_13460 gene hrcA 8912 9976 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_13460 9989 11086 gene locus_tag LOCUS_13470 gene hemH 9989 11086 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 protein_id gnl|my_center|LOCUS_13470 12523 11162 gene locus_tag LOCUS_13480 12523 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 12740 14059 gene locus_tag LOCUS_13490 12740 14059 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence061 1722 1435 gene locus_tag LOCUS_13500 gene gatC 1722 1435 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_13500 1870 2913 gene locus_tag LOCUS_13510 1870 2913 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_13510 2982 3854 gene locus_tag LOCUS_13520 gene mreC 2982 3854 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_13520 3858 4379 gene locus_tag LOCUS_13530 gene mreD 3858 4379 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_13530 4392 6347 gene locus_tag LOCUS_13540 gene mrdA 4392 6347 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_13540 6344 7486 gene locus_tag LOCUS_13550 gene rodA 6344 7486 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 protein_id gnl|my_center|LOCUS_13550 7511 8626 gene locus_tag LOCUS_13560 7511 8626 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_13560 8748 9875 gene locus_tag LOCUS_13570 8748 9875 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_13570 9872 10744 gene locus_tag LOCUS_13580 9872 10744 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_13580 10734 11018 gene locus_tag LOCUS_13590 10734 11018 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_13590 11015 11776 gene locus_tag LOCUS_13600 11015 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 11888 12835 gene locus_tag LOCUS_13610 gene lipA 11888 12835 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_13610 13534 12887 gene locus_tag LOCUS_13620 13534 12887 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence062 1914 1069 gene locus_tag LOCUS_13630 1914 1069 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 protein_id gnl|my_center|LOCUS_13630 5882 1998 gene locus_tag LOCUS_13640 5882 1998 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009241452.1 protein_id gnl|my_center|LOCUS_13640 6157 8859 gene locus_tag LOCUS_13650 gene glnE 6157 8859 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_13650 8960 10489 gene locus_tag LOCUS_13660 8960 10489 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_13660 10545 11048 gene locus_tag LOCUS_13670 gene sixA 10545 11048 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_13670 11224 11799 gene locus_tag LOCUS_13680 11224 11799 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_13680 11911 12852 gene locus_tag LOCUS_13690 11911 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 13970 12873 gene locus_tag LOCUS_13700 gene mnmA 13970 12873 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence063 52 2190 gene locus_tag LOCUS_13710 52 2190 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_13710 4326 2254 gene locus_tag LOCUS_13720 gene ppk1 4326 2254 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_13720 4561 6060 gene locus_tag LOCUS_13730 gene ppx 4561 6060 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_13730 6076 7194 gene locus_tag LOCUS_13740 6076 7194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_13740 7191 7985 gene locus_tag LOCUS_13750 7191 7985 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_13750 7988 8932 gene locus_tag LOCUS_13760 7988 8932 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_13760 8964 9602 gene locus_tag LOCUS_13770 8964 9602 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925722.1 protein_id gnl|my_center|LOCUS_13770 9646 11298 gene locus_tag LOCUS_13780 9646 11298 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_13780 11400 12200 gene locus_tag LOCUS_13790 11400 12200 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_13790 12214 12984 gene locus_tag LOCUS_13800 12214 12984 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_13800 13596 12994 gene locus_tag LOCUS_13810 13596 12994 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence064 432 145 gene locus_tag LOCUS_13820 432 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1554 547 gene locus_tag LOCUS_13830 1554 547 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 protein_id gnl|my_center|LOCUS_13830 1804 2934 gene locus_tag LOCUS_13840 gene ald 1804 2934 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_13840 3133 4698 gene locus_tag LOCUS_13850 3133 4698 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_13850 4700 5344 gene locus_tag LOCUS_13860 4700 5344 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_13860 5449 5913 gene locus_tag LOCUS_13870 5449 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6115 5936 gene locus_tag LOCUS_13880 6115 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6210 6285 gene locus_tag LOCUS_t00120 6210 6285 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6358 6434 gene locus_tag LOCUS_t00130 6358 6434 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6533 7393 gene locus_tag LOCUS_13890 6533 7393 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537097.1 protein_id gnl|my_center|LOCUS_13890 8648 7461 gene locus_tag LOCUS_13900 gene pobA 8648 7461 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 protein_id gnl|my_center|LOCUS_13900 8807 9697 gene locus_tag LOCUS_13910 8807 9697 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_13910 9987 11153 gene locus_tag LOCUS_13920 9987 11153 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_13920 11234 12154 gene locus_tag LOCUS_13930 11234 12154 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_13930 12169 13203 gene locus_tag LOCUS_13940 12169 13203 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence065 <1 1225 gene locus_tag LOCUS_13950 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521865.1:phosphomethylpyrimidine synthase ThiC 1307 4588 gene locus_tag LOCUS_13960 1307 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5335 4670 gene locus_tag LOCUS_13970 5335 4670 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_13970 5855 5472 gene locus_tag LOCUS_13980 gene crcB 5855 5472 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208262.1 protein_id gnl|my_center|LOCUS_13980 6037 7779 gene locus_tag LOCUS_13990 6037 7779 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_13990 7804 7953 gene locus_tag LOCUS_14000 7804 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7967 9118 gene locus_tag LOCUS_14010 7967 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 9152 9844 gene locus_tag LOCUS_14020 9152 9844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_14020 9960 11168 gene locus_tag LOCUS_14030 9960 11168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_14030 11174 12373 gene locus_tag LOCUS_14040 11174 12373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence066 585 190 gene locus_tag LOCUS_14050 585 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1091 582 gene locus_tag LOCUS_14060 gene fliN 1091 582 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811853.1 protein_id gnl|my_center|LOCUS_14060 2122 1088 gene locus_tag LOCUS_14070 gene fliM 2122 1088 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 protein_id gnl|my_center|LOCUS_14070 2611 2138 gene locus_tag LOCUS_14080 2611 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4066 2738 gene locus_tag LOCUS_14090 4066 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14090 4624 4166 gene locus_tag LOCUS_14100 4624 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6039 4621 gene locus_tag LOCUS_14110 gene fliI 6039 4621 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 protein_id gnl|my_center|LOCUS_14110 6811 6032 gene locus_tag LOCUS_14120 6811 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 7817 6804 gene locus_tag LOCUS_14130 gene fliG 7817 6804 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367292.1 protein_id gnl|my_center|LOCUS_14130 9480 7810 gene locus_tag LOCUS_14140 gene fliF 9480 7810 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 protein_id gnl|my_center|LOCUS_14140 9703 10026 gene locus_tag LOCUS_14150 gene fliE 9703 10026 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534368.1 protein_id gnl|my_center|LOCUS_14150 10537 10175 gene locus_tag LOCUS_14160 10537 10175 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089169839.1 protein_id gnl|my_center|LOCUS_14160 12585 10597 gene locus_tag LOCUS_14170 12585 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 13252 12830 gene locus_tag LOCUS_14180 13252 12830 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769733.1 protein_id gnl|my_center|LOCUS_14180 13503 13249 gene locus_tag LOCUS_14190 13503 13249 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence067 759 49 gene locus_tag LOCUS_14200 759 49 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_14200 1195 1992 gene locus_tag LOCUS_14210 gene phnD 1195 1992 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_14210 1989 3440 gene locus_tag LOCUS_14220 1989 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3424 4779 gene locus_tag LOCUS_14230 gene gnfM 3424 4779 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_14230 5030 5422 gene locus_tag LOCUS_14240 5030 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5608 5970 gene locus_tag LOCUS_14250 5608 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5967 6329 gene locus_tag LOCUS_14260 5967 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6341 6571 gene locus_tag LOCUS_14270 6341 6571 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_14270 6574 6996 gene locus_tag LOCUS_14280 6574 6996 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250967.1 protein_id gnl|my_center|LOCUS_14280 7121 8203 gene locus_tag LOCUS_14290 7121 8203 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192988.1 protein_id gnl|my_center|LOCUS_14290 8214 8693 gene locus_tag LOCUS_14300 8214 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8706 8912 gene locus_tag LOCUS_14310 8706 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8961 11657 gene locus_tag LOCUS_14320 8961 11657 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_14320 13191 11854 gene locus_tag LOCUS_14330 13191 11854 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence068 233 481 gene locus_tag LOCUS_14340 233 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 478 687 gene locus_tag LOCUS_14350 gene yidD 478 687 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_14350 708 2366 gene locus_tag LOCUS_14360 gene yidC 708 2366 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_14360 2338 3693 gene locus_tag LOCUS_14370 gene mnmE 2338 3693 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_14370 4168 4938 gene locus_tag LOCUS_14380 4168 4938 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994212.1 protein_id gnl|my_center|LOCUS_14380 5022 5435 gene locus_tag LOCUS_14390 gene speD 5022 5435 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_14390 5439 6323 gene locus_tag LOCUS_14400 gene speE 5439 6323 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194193.1 protein_id gnl|my_center|LOCUS_14400 6484 7716 gene locus_tag LOCUS_14410 gene rsmB 6484 7716 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_14410 7667 8278 gene locus_tag LOCUS_14420 7667 8278 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_14420 8275 10395 gene locus_tag LOCUS_14430 8275 10395 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_14430 10399 11646 gene locus_tag LOCUS_14440 10399 11646 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690124.1 protein_id gnl|my_center|LOCUS_14440 11754 13157 gene locus_tag LOCUS_14450 gene trkA 11754 13157 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence069 <1 5844 gene locus_tag LOCUS_14460 <1 5844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 6039 7475 gene locus_tag LOCUS_14470 6039 7475 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656430.1 protein_id gnl|my_center|LOCUS_14470 7477 8499 gene locus_tag LOCUS_14480 7477 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 8496 9539 gene locus_tag LOCUS_14490 8496 9539 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459270.1 protein_id gnl|my_center|LOCUS_14490 9695 12013 gene locus_tag LOCUS_14500 9695 12013 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_14500 12724 12125 gene locus_tag LOCUS_14510 12724 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 12934 13515 gene locus_tag LOCUS_14520 gene rsxA 12934 13515 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence070 2622 1498 gene locus_tag LOCUS_14530 2622 1498 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_14530 3827 2745 gene locus_tag LOCUS_14540 gene aroB 3827 2745 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_14540 4318 3815 gene locus_tag LOCUS_14550 4318 3815 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_14550 6598 4430 gene locus_tag LOCUS_14560 gene pilQ 6598 4430 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_14560 7113 6595 gene locus_tag LOCUS_14570 7113 6595 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_14570 7826 7110 gene locus_tag LOCUS_14580 gene pilO 7826 7110 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_14580 8413 7823 gene locus_tag LOCUS_14590 8413 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9486 8410 gene locus_tag LOCUS_14600 9486 8410 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_14600 9662 12100 gene locus_tag LOCUS_14610 9662 12100 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_14610 12447 12121 gene locus_tag LOCUS_14620 gene cyaY 12447 12121 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225851.1 protein_id gnl|my_center|LOCUS_14620 12478 12666 gene locus_tag LOCUS_14630 12478 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence071 <1 729 gene locus_tag LOCUS_14640 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002243991.1:energy-dependent translational throttle protein EttA 1806 871 gene locus_tag LOCUS_14650 1806 871 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_14650 2698 1859 gene locus_tag LOCUS_14660 2698 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2964 2704 gene locus_tag LOCUS_14670 2964 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3274 3888 gene locus_tag LOCUS_14680 3274 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3959 4049 gene locus_tag LOCUS_t00140 3959 4049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4734 5297 gene locus_tag LOCUS_14690 4734 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7285 5468 gene locus_tag LOCUS_14700 7285 5468 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_14700 7284 7859 gene locus_tag LOCUS_14710 7284 7859 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418984.1 protein_id gnl|my_center|LOCUS_14710 8263 7895 gene locus_tag LOCUS_14720 8263 7895 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808610.1 protein_id gnl|my_center|LOCUS_14720 9485 8334 gene locus_tag LOCUS_14730 9485 8334 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_14730 9583 9927 gene locus_tag LOCUS_14740 9583 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9979 11949 gene locus_tag LOCUS_14750 9979 11949 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_14750 12063 12449 gene locus_tag LOCUS_14760 12063 12449 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814185.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence072 1464 976 gene locus_tag LOCUS_14770 1464 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2641 1616 gene locus_tag LOCUS_14780 2641 1616 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_14780 2819 3718 gene locus_tag LOCUS_14790 2819 3718 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095545.1 protein_id gnl|my_center|LOCUS_14790 3873 4175 gene locus_tag LOCUS_14800 3873 4175 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_14800 5675 4239 gene locus_tag LOCUS_14810 gene pqsA 5675 4239 CDS product anthranilate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112552.1 protein_id gnl|my_center|LOCUS_14810 5884 6834 gene locus_tag LOCUS_14820 5884 6834 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_14820 7479 6871 gene locus_tag LOCUS_14830 gene paaY 7479 6871 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 protein_id gnl|my_center|LOCUS_14830 9179 7515 gene locus_tag LOCUS_14840 gene paaN 9179 7515 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186941.1 protein_id gnl|my_center|LOCUS_14840 9389 10195 gene locus_tag LOCUS_14850 gene paaG 9389 10195 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_14850 10301 10792 gene locus_tag LOCUS_14860 gene paaI 10301 10792 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_14860 10789 12138 gene locus_tag LOCUS_14870 gene paaF 10789 12138 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038746825.1 protein_id gnl|my_center|LOCUS_14870 12208 13206 gene locus_tag LOCUS_14880 gene paaA 12208 13206 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence073 308 1525 gene locus_tag LOCUS_14890 308 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1630 1836 gene locus_tag LOCUS_14900 1630 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1838 2233 gene locus_tag LOCUS_14910 1838 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2237 3130 gene locus_tag LOCUS_14920 2237 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3298 5499 gene locus_tag LOCUS_14930 3298 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 5545 5760 gene locus_tag LOCUS_14940 5545 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5824 6339 gene locus_tag LOCUS_14950 5824 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070549.1 protein_id gnl|my_center|LOCUS_14950 8692 6581 gene locus_tag LOCUS_14960 8692 6581 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_14960 8908 10845 gene locus_tag LOCUS_14970 8908 10845 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_14970 10910 12004 gene locus_tag LOCUS_14980 10910 12004 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence074 299 224 gene locus_tag LOCUS_t00150 299 224 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1503 391 gene locus_tag LOCUS_14990 1503 391 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_14990 2680 1514 gene locus_tag LOCUS_15000 2680 1514 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_15000 3182 2691 gene locus_tag LOCUS_15010 gene purE 3182 2691 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_15010 4084 3197 gene locus_tag LOCUS_15020 gene folD 4084 3197 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_15020 5922 4180 gene locus_tag LOCUS_15030 5922 4180 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951021.1 protein_id gnl|my_center|LOCUS_15030 6715 6062 gene locus_tag LOCUS_15040 gene fixJ 6715 6062 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_15040 9398 6690 gene locus_tag LOCUS_15050 9398 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 9600 10862 gene locus_tag LOCUS_15060 9600 10862 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence075 2491 512 gene locus_tag LOCUS_15070 2491 512 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397097.1 protein_id gnl|my_center|LOCUS_15070 3789 2488 gene locus_tag LOCUS_15080 gene macA 3789 2488 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 protein_id gnl|my_center|LOCUS_15080 4071 4601 gene locus_tag LOCUS_15090 4071 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 5127 4711 gene locus_tag LOCUS_15100 5127 4711 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15100 5885 5127 gene locus_tag LOCUS_15110 5885 5127 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188455.1 protein_id gnl|my_center|LOCUS_15110 6619 5888 gene locus_tag LOCUS_15120 6619 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 7222 6743 gene locus_tag LOCUS_15130 gene bfr 7222 6743 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_15130 7458 7219 gene locus_tag LOCUS_15140 7458 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 7706 7500 gene locus_tag LOCUS_15150 7706 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8350 7892 gene locus_tag LOCUS_15160 8350 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 9548 8337 gene locus_tag LOCUS_15170 9548 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_15170 11992 9545 gene locus_tag LOCUS_15180 11992 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 <12867 12096 gene locus_tag LOCUS_15190 <12867 12096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440399.1:malonyl-CoA decarboxylase >Feature sequence076 1577 453 gene locus_tag LOCUS_15200 1577 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1878 3455 gene locus_tag LOCUS_15210 1878 3455 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_15210 5085 3523 gene locus_tag LOCUS_15220 5085 3523 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 protein_id gnl|my_center|LOCUS_15220 6197 5343 gene locus_tag LOCUS_15230 gene asd 6197 5343 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_15230 6530 7975 gene locus_tag LOCUS_15240 gene ahcY 6530 7975 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_15240 8024 8881 gene locus_tag LOCUS_15250 8024 8881 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327569.1 protein_id gnl|my_center|LOCUS_15250 8878 9711 gene locus_tag LOCUS_15260 gene metF 8878 9711 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_15260 9929 10531 gene locus_tag LOCUS_15270 9929 10531 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192970.1 protein_id gnl|my_center|LOCUS_15270 10584 11360 gene locus_tag LOCUS_15280 10584 11360 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192322.1 protein_id gnl|my_center|LOCUS_15280 <12774 11383 gene locus_tag LOCUS_15290 <12774 11383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050298776.1:DUF853 family protein >Feature sequence077 1686 1432 gene locus_tag LOCUS_15300 1686 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2216 1683 gene locus_tag LOCUS_15310 gene napF 2216 1683 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 protein_id gnl|my_center|LOCUS_15310 2986 2342 gene locus_tag LOCUS_15320 gene narL 2986 2342 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_15320 4961 3063 gene locus_tag LOCUS_15330 gene narX 4961 3063 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_15330 5221 5910 gene locus_tag LOCUS_15340 5221 5910 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_15340 7360 5939 gene locus_tag LOCUS_15350 7360 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7700 7512 gene locus_tag LOCUS_15360 7700 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9757 7760 gene locus_tag LOCUS_15370 9757 7760 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_15370 10203 9988 gene locus_tag LOCUS_15380 gene rpoZ 10203 9988 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_15380 10820 10206 gene locus_tag LOCUS_15390 gene gmk 10820 10206 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_15390 12095 10893 gene locus_tag LOCUS_15400 12095 10893 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_15400 <12697 12092 gene locus_tag LOCUS_15410 <12697 12092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192762.1:alpha/beta hydrolase >Feature sequence078 1056 217 gene locus_tag LOCUS_15420 gene folE2 1056 217 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_15420 3033 1177 gene locus_tag LOCUS_15430 gene dxs 3033 1177 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_15430 4008 3100 gene locus_tag LOCUS_15440 4008 3100 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_15440 4265 4005 gene locus_tag LOCUS_15450 4265 4005 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221918.1 protein_id gnl|my_center|LOCUS_15450 4395 5522 gene locus_tag LOCUS_15460 4395 5522 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_15460 5885 5556 gene locus_tag LOCUS_15470 5885 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6946 6008 gene locus_tag LOCUS_15480 gene ispH 6946 6008 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_15480 7429 7001 gene locus_tag LOCUS_15490 7429 7001 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_15490 7972 7451 gene locus_tag LOCUS_15500 gene lspA 7972 7451 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_15500 10775 7965 gene locus_tag LOCUS_15510 gene ileS 10775 7965 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 protein_id gnl|my_center|LOCUS_15510 11759 10815 gene locus_tag LOCUS_15520 11759 10815 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_15520 <12458 11888 gene locus_tag LOCUS_15530 <12458 11888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814330.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence079 745 554 gene locus_tag LOCUS_15540 745 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1353 742 gene locus_tag LOCUS_15550 1353 742 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_15550 1934 1350 gene locus_tag LOCUS_15560 1934 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017274729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 2042 2476 gene locus_tag LOCUS_15570 2042 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2717 2529 gene locus_tag LOCUS_15580 2717 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3492 2848 gene locus_tag LOCUS_15590 3492 2848 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_15590 4861 3533 gene locus_tag LOCUS_15600 4861 3533 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_15600 5368 6318 gene locus_tag LOCUS_15610 gene egtD 5368 6318 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_15610 7495 6341 gene locus_tag LOCUS_15620 7495 6341 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057240.1 protein_id gnl|my_center|LOCUS_15620 7531 8520 gene locus_tag LOCUS_15630 7531 8520 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_15630 8675 9538 gene locus_tag LOCUS_15640 8675 9538 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_15640 9558 10400 gene locus_tag LOCUS_15650 9558 10400 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_15650 10402 11244 gene locus_tag LOCUS_15660 10402 11244 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403550.1 protein_id gnl|my_center|LOCUS_15660 11288 12100 gene locus_tag LOCUS_15670 gene phnE 11288 12100 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_15670 12120 12425 gene locus_tag LOCUS_15680 12120 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence080 302 78 gene locus_tag LOCUS_15690 302 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 521 787 gene locus_tag LOCUS_15700 521 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 799 1119 gene locus_tag LOCUS_15710 799 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1138 1308 gene locus_tag LOCUS_15720 1138 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1338 1994 gene locus_tag LOCUS_15730 1338 1994 CDS product SOS response-associated peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206972.1 protein_id gnl|my_center|LOCUS_15730 2263 2874 gene locus_tag LOCUS_15740 2263 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2999 4198 gene locus_tag LOCUS_15750 2999 4198 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_15750 4405 5244 gene locus_tag LOCUS_15760 4405 5244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_15760 5244 5948 gene locus_tag LOCUS_15770 5244 5948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_15770 5963 6832 gene locus_tag LOCUS_15780 5963 6832 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_15780 6832 7779 gene locus_tag LOCUS_15790 6832 7779 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_15790 7837 9042 gene locus_tag LOCUS_15800 7837 9042 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_15800 9222 9713 gene locus_tag LOCUS_15810 9222 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 9727 10374 gene locus_tag LOCUS_15820 9727 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence081 2336 1707 gene locus_tag LOCUS_15830 2336 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3751 2333 gene locus_tag LOCUS_15840 3751 2333 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_15840 5952 3751 gene locus_tag LOCUS_15850 5952 3751 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_15850 6830 6213 gene locus_tag LOCUS_15860 6830 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8131 6845 gene locus_tag LOCUS_15870 8131 6845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_15870 8909 8175 gene locus_tag LOCUS_15880 8909 8175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769006.1 protein_id gnl|my_center|LOCUS_15880 9576 8971 gene locus_tag LOCUS_15890 9576 8971 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_15890 9702 10172 gene locus_tag LOCUS_15900 9702 10172 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15900 10169 10333 gene locus_tag LOCUS_15910 10169 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 10355 11242 gene locus_tag LOCUS_15920 10355 11242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_15920 11278 12144 gene locus_tag LOCUS_15930 11278 12144 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence082 284 4219 gene locus_tag LOCUS_15940 gene purL 284 4219 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100278782.1 protein_id gnl|my_center|LOCUS_15940 4343 4756 gene locus_tag LOCUS_15950 4343 4756 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926122.1 protein_id gnl|my_center|LOCUS_15950 4966 5421 gene locus_tag LOCUS_15960 4966 5421 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_15960 5600 7597 gene locus_tag LOCUS_15970 5600 7597 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546785.1 protein_id gnl|my_center|LOCUS_15970 9516 7708 gene locus_tag LOCUS_15980 gene lpdA 9516 7708 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700029.1 protein_id gnl|my_center|LOCUS_15980 11283 9601 gene locus_tag LOCUS_15990 gene aceF 11283 9601 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_15990 <12264 11304 gene locus_tag LOCUS_16000 <12264 11304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199569.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type >Feature sequence083 2733 1252 gene locus_tag LOCUS_16010 gene pap 2733 1252 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_16010 3475 2801 gene locus_tag LOCUS_16020 3475 2801 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_16020 3575 4384 gene locus_tag LOCUS_16030 3575 4384 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_16030 4482 5351 gene locus_tag LOCUS_16040 4482 5351 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_16040 6684 5359 gene locus_tag LOCUS_16050 6684 5359 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529892.1 protein_id gnl|my_center|LOCUS_16050 7627 6809 gene locus_tag LOCUS_16060 7627 6809 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930218.1 protein_id gnl|my_center|LOCUS_16060 8027 7689 gene locus_tag LOCUS_16070 8027 7689 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_16070 9611 8121 gene locus_tag LOCUS_16080 9611 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10158 9613 gene locus_tag LOCUS_16090 10158 9613 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 protein_id gnl|my_center|LOCUS_16090 11739 10306 gene locus_tag LOCUS_16100 11739 10306 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence084 <1 1858 gene locus_tag LOCUS_16110 <1 1858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810967.1:monovalent cation/H+ antiporter subunit A 1858 2199 gene locus_tag LOCUS_16120 1858 2199 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383783.1 protein_id gnl|my_center|LOCUS_16120 2196 3842 gene locus_tag LOCUS_16130 2196 3842 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394067.1 protein_id gnl|my_center|LOCUS_16130 3839 4357 gene locus_tag LOCUS_16140 3839 4357 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397128.1 protein_id gnl|my_center|LOCUS_16140 4354 4638 gene locus_tag LOCUS_16150 4354 4638 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554071.1 protein_id gnl|my_center|LOCUS_16150 4635 4991 gene locus_tag LOCUS_16160 gene mnhG 4635 4991 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 protein_id gnl|my_center|LOCUS_16160 5931 4993 gene locus_tag LOCUS_16170 5931 4993 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_16170 6590 7924 gene locus_tag LOCUS_16180 6590 7924 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_16180 8619 8110 gene locus_tag LOCUS_16190 8619 8110 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199982.1 protein_id gnl|my_center|LOCUS_16190 9424 8714 gene locus_tag LOCUS_16200 9424 8714 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_16200 9652 11460 gene locus_tag LOCUS_16210 9652 11460 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence085 188 1351 gene locus_tag LOCUS_16220 188 1351 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_16220 1367 2101 gene locus_tag LOCUS_16230 1367 2101 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_16230 3269 2205 gene locus_tag LOCUS_16240 3269 2205 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16240 3635 4525 gene locus_tag LOCUS_16250 3635 4525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_16250 4522 5469 gene locus_tag LOCUS_16260 4522 5469 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_16260 5695 5480 gene locus_tag LOCUS_16270 5695 5480 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195120.1 protein_id gnl|my_center|LOCUS_16270 6515 5760 gene locus_tag LOCUS_16280 gene zapD 6515 5760 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_16280 7263 6595 gene locus_tag LOCUS_16290 gene coaE 7263 6595 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_16290 8024 7233 gene locus_tag LOCUS_16300 8024 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 9443 8079 gene locus_tag LOCUS_16310 9443 8079 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_16310 10207 9476 gene locus_tag LOCUS_16320 10207 9476 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_16320 11040 10204 gene locus_tag LOCUS_16330 gene birA 11040 10204 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_16330 <11917 11237 gene locus_tag LOCUS_16340 <11917 11237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104661.1:two-component system response regulator NtrC >Feature sequence086 1293 2804 gene locus_tag LOCUS_16350 1293 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2804 4303 gene locus_tag LOCUS_16360 2804 4303 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188253.1 protein_id gnl|my_center|LOCUS_16360 4310 4963 gene locus_tag LOCUS_16370 4310 4963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_16370 5015 7240 gene locus_tag LOCUS_16380 5015 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7337 8116 gene locus_tag LOCUS_16390 gene hyi 7337 8116 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_16390 10959 8230 gene locus_tag LOCUS_16400 10959 8230 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_16400 <11685 11167 gene locus_tag LOCUS_16410 <11685 11167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002121243.1:inorganic diphosphatase >Feature sequence087 1055 2497 gene locus_tag LOCUS_16420 1055 2497 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836662.1 protein_id gnl|my_center|LOCUS_16420 2510 4399 gene locus_tag LOCUS_16430 2510 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4399 5670 gene locus_tag LOCUS_16440 4399 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6035 8332 gene locus_tag LOCUS_16450 6035 8332 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446507.1 protein_id gnl|my_center|LOCUS_16450 8462 9637 gene locus_tag LOCUS_16460 8462 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 9682 10656 gene locus_tag LOCUS_16470 9682 10656 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence088 365 1246 gene locus_tag LOCUS_16480 365 1246 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819545.1 protein_id gnl|my_center|LOCUS_16480 2501 1335 gene locus_tag LOCUS_16490 2501 1335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275363.1 protein_id gnl|my_center|LOCUS_16490 4539 2719 gene locus_tag LOCUS_16500 gene uvrC 4539 2719 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449735.1 protein_id gnl|my_center|LOCUS_16500 5959 4814 gene locus_tag LOCUS_16510 gene nagZ 5959 4814 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_16510 6336 5956 gene locus_tag LOCUS_16520 gene acpS 6336 5956 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_16520 7120 6365 gene locus_tag LOCUS_16530 gene pdxJ 7120 6365 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_16530 7872 7120 gene locus_tag LOCUS_16540 gene recO 7872 7120 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_16540 8820 7888 gene locus_tag LOCUS_16550 gene era 8820 7888 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_16550 9488 8817 gene locus_tag LOCUS_16560 9488 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9855 9493 gene locus_tag LOCUS_16570 9855 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 10789 10001 gene locus_tag LOCUS_16580 gene lepB 10789 10001 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_16580 11582 10836 gene locus_tag LOCUS_16590 11582 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence089 <1 1404 gene locus_tag LOCUS_16600 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555870.1:nitrate reductase subunit alpha 1542 3110 gene locus_tag LOCUS_16610 gene narH 1542 3110 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_16610 3127 3675 gene locus_tag LOCUS_16620 3127 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3686 4390 gene locus_tag LOCUS_16630 gene narI 3686 4390 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 protein_id gnl|my_center|LOCUS_16630 4502 6451 gene locus_tag LOCUS_16640 4502 6451 CDS product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 protein_id gnl|my_center|LOCUS_16640 6448 7173 gene locus_tag LOCUS_16650 6448 7173 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 protein_id gnl|my_center|LOCUS_16650 7626 7219 gene locus_tag LOCUS_16660 7626 7219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_16660 7787 8359 gene locus_tag LOCUS_16670 7787 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 8809 8363 gene locus_tag LOCUS_16680 gene smpB 8809 8363 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_16680 8941 9378 gene locus_tag LOCUS_16690 8941 9378 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_16690 9375 9707 gene locus_tag LOCUS_16700 9375 9707 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_16700 9939 11402 gene locus_tag LOCUS_16710 gene guaB 9939 11402 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence090 2472 1360 gene locus_tag LOCUS_16720 2472 1360 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_16720 3032 2469 gene locus_tag LOCUS_16730 3032 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4315 3050 gene locus_tag LOCUS_16740 4315 3050 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_16740 4794 4447 gene locus_tag LOCUS_16750 4794 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 5258 4923 gene locus_tag LOCUS_16760 5258 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5427 6113 gene locus_tag LOCUS_16770 5427 6113 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_16770 6116 7453 gene locus_tag LOCUS_16780 6116 7453 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815118.1 protein_id gnl|my_center|LOCUS_16780 7665 8084 gene locus_tag LOCUS_16790 7665 8084 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532263.1 protein_id gnl|my_center|LOCUS_16790 8801 8283 gene locus_tag LOCUS_16800 8801 8283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 9639 8968 gene locus_tag LOCUS_16810 9639 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 9923 9636 gene locus_tag LOCUS_16820 9923 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 10868 10323 gene locus_tag LOCUS_16830 10868 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence091 <1 1038 gene locus_tag LOCUS_16840 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815908.1:2-isopropylmalate synthase 1212 2096 gene locus_tag LOCUS_16850 1212 2096 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 protein_id gnl|my_center|LOCUS_16850 2333 4051 gene locus_tag LOCUS_16860 2333 4051 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535538.1 protein_id gnl|my_center|LOCUS_16860 4112 5242 gene locus_tag LOCUS_16870 4112 5242 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_16870 5457 7148 gene locus_tag LOCUS_16880 5457 7148 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_16880 7161 7352 gene locus_tag LOCUS_16890 7161 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 7469 7954 gene locus_tag LOCUS_16900 7469 7954 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192378.1 protein_id gnl|my_center|LOCUS_16900 10170 7972 gene locus_tag LOCUS_16910 10170 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 10139 10321 gene locus_tag LOCUS_16920 10139 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 <11343 10318 gene locus_tag LOCUS_16930 <11343 10318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063890.1:AAA family ATPase >Feature sequence092 <1 948 gene locus_tag LOCUS_16940 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523366.1:AAA family ATPase 984 2336 gene locus_tag LOCUS_16950 984 2336 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_16950 2344 3327 gene locus_tag LOCUS_16960 2344 3327 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_16960 3361 4302 gene locus_tag LOCUS_16970 3361 4302 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_16970 4319 5713 gene locus_tag LOCUS_16980 4319 5713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6295 5843 gene locus_tag LOCUS_16990 6295 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8296 6323 gene locus_tag LOCUS_17000 8296 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8538 9167 gene locus_tag LOCUS_17010 8538 9167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_17010 10616 9210 gene locus_tag LOCUS_17020 10616 9210 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522137.1 protein_id gnl|my_center|LOCUS_17020 10747 10831 gene locus_tag LOCUS_t00160 10747 10831 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 10915 10988 gene locus_tag LOCUS_t00170 10915 10988 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11006 11080 gene locus_tag LOCUS_t00180 11006 11080 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 556 1434 gene locus_tag LOCUS_17030 gene dapA 556 1434 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_17030 1461 2603 gene locus_tag LOCUS_17040 gene bamC 1461 2603 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_17040 3005 2667 gene locus_tag LOCUS_17050 3005 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3366 4724 gene locus_tag LOCUS_17060 gene rlmD 3366 4724 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_17060 4973 5060 gene locus_tag LOCUS_t00190 4973 5060 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5166 5825 gene locus_tag LOCUS_17070 5166 5825 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_17070 7417 5774 gene locus_tag LOCUS_17080 7417 5774 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_17080 9593 7422 gene locus_tag LOCUS_17090 9593 7422 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_17090 9713 10624 gene locus_tag LOCUS_17100 9713 10624 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence094 233 1486 gene locus_tag LOCUS_17110 233 1486 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_17110 1953 1612 gene locus_tag LOCUS_17120 1953 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2526 1969 gene locus_tag LOCUS_17130 2526 1969 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_17130 5922 2638 gene locus_tag LOCUS_17140 5922 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 8805 6187 gene locus_tag LOCUS_17150 8805 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 9624 8842 gene locus_tag LOCUS_17160 9624 8842 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_17160 9623 10309 gene locus_tag LOCUS_17170 gene pyrE 9623 10309 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_17170 10290 10949 gene locus_tag LOCUS_17180 10290 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence095 1566 2312 gene locus_tag LOCUS_17190 1566 2312 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039419.1 protein_id gnl|my_center|LOCUS_17190 3655 2348 gene locus_tag LOCUS_17200 3655 2348 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706614.1 protein_id gnl|my_center|LOCUS_17200 3837 4214 gene locus_tag LOCUS_17210 3837 4214 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 protein_id gnl|my_center|LOCUS_17210 5711 4272 gene locus_tag LOCUS_17220 5711 4272 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_17220 5930 6646 gene locus_tag LOCUS_17230 5930 6646 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_17230 6696 8630 gene locus_tag LOCUS_17240 6696 8630 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 protein_id gnl|my_center|LOCUS_17240 8966 8637 gene locus_tag LOCUS_17250 8966 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <11066 9096 gene locus_tag LOCUS_17260 <11066 9096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:retention module-containing protein >Feature sequence096 65 1546 gene locus_tag LOCUS_17270 65 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1543 2343 gene locus_tag LOCUS_17280 gene ugpQ 1543 2343 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073603.1 protein_id gnl|my_center|LOCUS_17280 2536 3720 gene locus_tag LOCUS_17290 2536 3720 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040173.1 protein_id gnl|my_center|LOCUS_17290 4726 3818 gene locus_tag LOCUS_17300 4726 3818 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_17300 5013 5849 gene locus_tag LOCUS_17310 5013 5849 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 protein_id gnl|my_center|LOCUS_17310 5846 7282 gene locus_tag LOCUS_17320 5846 7282 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706379.1 protein_id gnl|my_center|LOCUS_17320 7290 7961 gene locus_tag LOCUS_17330 7290 7961 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389165.1 protein_id gnl|my_center|LOCUS_17330 10740 8008 gene locus_tag LOCUS_17340 10740 8008 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence097 <1 1255 gene locus_tag LOCUS_17350 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator note possible pseudo, frameshifted 1245 2627 gene locus_tag LOCUS_17360 1245 2627 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462141.1 protein_id gnl|my_center|LOCUS_17360 2889 3191 gene locus_tag LOCUS_17370 2889 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3201 3788 gene locus_tag LOCUS_17380 3201 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3835 5385 gene locus_tag LOCUS_17390 3835 5385 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_17390 5499 6950 gene locus_tag LOCUS_17400 5499 6950 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089157.1 protein_id gnl|my_center|LOCUS_17400 7366 9069 gene locus_tag LOCUS_17410 7366 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9098 10462 gene locus_tag LOCUS_17420 9098 10462 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence098 937 446 gene locus_tag LOCUS_17430 gene mobB 937 446 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_17430 1481 1071 gene locus_tag LOCUS_17440 1481 1071 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_17440 2392 1469 gene locus_tag LOCUS_17450 2392 1469 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_17450 2414 3436 gene locus_tag LOCUS_17460 2414 3436 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_17460 3456 4592 gene locus_tag LOCUS_17470 3456 4592 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_17470 5005 4691 gene locus_tag LOCUS_17480 5005 4691 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_17480 6124 5279 gene locus_tag LOCUS_17490 gene queF 6124 5279 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 protein_id gnl|my_center|LOCUS_17490 7746 6121 gene locus_tag LOCUS_17500 7746 6121 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_17500 7868 8827 gene locus_tag LOCUS_17510 gene cbiB 7868 8827 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103680.1 protein_id gnl|my_center|LOCUS_17510 8820 9917 gene locus_tag LOCUS_17520 gene cobD 8820 9917 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence099 553 1005 gene locus_tag LOCUS_17530 553 1005 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_17530 1104 2204 gene locus_tag LOCUS_17540 gene nadA 1104 2204 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_17540 2232 2981 gene locus_tag LOCUS_17550 2232 2981 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_17550 2981 4135 gene locus_tag LOCUS_17560 gene clsB 2981 4135 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_17560 4566 4141 gene locus_tag LOCUS_17570 4566 4141 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078677.1 protein_id gnl|my_center|LOCUS_17570 5549 4635 gene locus_tag LOCUS_17580 gene gluQRS 5549 4635 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_17580 5690 6112 gene locus_tag LOCUS_17590 5690 6112 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_17590 6838 6224 gene locus_tag LOCUS_17600 6838 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 7224 6853 gene locus_tag LOCUS_17610 7224 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539929.1 protein_id gnl|my_center|LOCUS_17610 7493 7221 gene locus_tag LOCUS_17620 7493 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193682.1 protein_id gnl|my_center|LOCUS_17620 8038 7499 gene locus_tag LOCUS_17630 8038 7499 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192269.1 protein_id gnl|my_center|LOCUS_17630 8887 8072 gene locus_tag LOCUS_17640 8887 8072 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 protein_id gnl|my_center|LOCUS_17640 9849 8899 gene locus_tag LOCUS_17650 9849 8899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_17650 <10348 9821 gene locus_tag LOCUS_17660 <10348 9821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192948.1:nitrous oxide reductase family maturation protein NosD >Feature sequence100 <1 915 gene locus_tag LOCUS_17670 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188973.1:pyruvate kinase 1023 2087 gene locus_tag LOCUS_17680 gene fba 1023 2087 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_17680 2128 4536 gene locus_tag LOCUS_17690 2128 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5207 4557 gene locus_tag LOCUS_17700 5207 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5363 6298 gene locus_tag LOCUS_17710 5363 6298 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_17710 6371 7633 gene locus_tag LOCUS_17720 6371 7633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957570.1 protein_id gnl|my_center|LOCUS_17720 7812 8585 gene locus_tag LOCUS_17730 7812 8585 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence101 97 1644 gene locus_tag LOCUS_17740 gene purF 97 1644 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_17740 1692 2876 gene locus_tag LOCUS_17750 1692 2876 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_17750 3747 2992 gene locus_tag LOCUS_17760 gene lpxH 3747 2992 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_17760 4282 3788 gene locus_tag LOCUS_17770 4282 3788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_17770 4920 4330 gene locus_tag LOCUS_17780 4920 4330 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_17780 5191 6576 gene locus_tag LOCUS_17790 gene cysS 5191 6576 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_17790 6631 7122 gene locus_tag LOCUS_17800 6631 7122 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_17800 8409 7285 gene locus_tag LOCUS_17810 gene dnaJ 8409 7285 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_17810 <10078 8506 gene locus_tag LOCUS_17820 <10078 8506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814079.1:molecular chaperone DnaK >Feature sequence102 3173 1431 gene locus_tag LOCUS_17830 3173 1431 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_17830 4629 3262 gene locus_tag LOCUS_17840 4629 3262 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_17840 5366 4914 gene locus_tag LOCUS_17850 5366 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5814 5428 gene locus_tag LOCUS_17860 5814 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7340 5814 gene locus_tag LOCUS_17870 7340 5814 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_17870 8606 7635 gene locus_tag LOCUS_17880 8606 7635 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_17880 9684 8647 gene locus_tag LOCUS_17890 gene dctP 9684 8647 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965687.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence103 663 112 gene locus_tag LOCUS_17900 gene cobC 663 112 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_17900 1110 838 gene locus_tag LOCUS_17910 1110 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 997 1608 gene locus_tag LOCUS_17920 997 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1674 1934 gene locus_tag LOCUS_17930 1674 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2985 2206 gene locus_tag LOCUS_17940 2985 2206 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071295.1 protein_id gnl|my_center|LOCUS_17940 4055 3009 gene locus_tag LOCUS_17950 gene cobT 4055 3009 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193123.1 protein_id gnl|my_center|LOCUS_17950 4333 4052 gene locus_tag LOCUS_17960 4333 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 4915 4367 gene locus_tag LOCUS_17970 gene cobU 4915 4367 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_17970 5421 7250 gene locus_tag LOCUS_17980 gene btuB 5421 7250 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_17980 7257 8273 gene locus_tag LOCUS_17990 7257 8273 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_17990 8270 9073 gene locus_tag LOCUS_18000 8270 9073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_18000 9152 9760 gene locus_tag LOCUS_18010 gene cobO 9152 9760 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence104 2005 935 gene locus_tag LOCUS_18020 gene glcE 2005 935 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_18020 2385 2233 gene locus_tag LOCUS_18030 2385 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3911 2400 gene locus_tag LOCUS_18040 3911 2400 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_18040 5050 4169 gene locus_tag LOCUS_18050 5050 4169 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 protein_id gnl|my_center|LOCUS_18050 5225 5536 gene locus_tag LOCUS_18060 gene rplU 5225 5536 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_18060 5556 5819 gene locus_tag LOCUS_18070 gene rpmA 5556 5819 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_18070 5930 7129 gene locus_tag LOCUS_18080 gene obgE 5930 7129 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_18080 7296 8411 gene locus_tag LOCUS_18090 gene proB 7296 8411 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_18090 <9779 8544 gene locus_tag LOCUS_18100 <9779 8544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065113.1:propionate--CoA ligase >Feature sequence105 <1 2428 gene locus_tag LOCUS_18110 <1 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193113.1:phenylalanine--tRNA ligase subunit beta 2430 2735 gene locus_tag LOCUS_18120 2430 2735 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_18120 2716 3096 gene locus_tag LOCUS_18130 2716 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3157 3233 gene locus_tag LOCUS_t00200 3157 3233 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3365 4108 gene locus_tag LOCUS_18140 gene surE 3365 4108 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527164.1 protein_id gnl|my_center|LOCUS_18140 4105 4758 gene locus_tag LOCUS_18150 4105 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4773 5612 gene locus_tag LOCUS_18160 4773 5612 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_18160 5624 6559 gene locus_tag LOCUS_18170 gene rpoS 5624 6559 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_18170 7460 6657 gene locus_tag LOCUS_18180 7460 6657 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_18180 8650 7607 gene locus_tag LOCUS_18190 8650 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence106 219 914 gene locus_tag LOCUS_18200 219 914 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_18200 1460 999 gene locus_tag LOCUS_18210 1460 999 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 protein_id gnl|my_center|LOCUS_18210 3105 1624 gene locus_tag LOCUS_18220 3105 1624 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_18220 3353 4300 gene locus_tag LOCUS_18230 3353 4300 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_18230 4447 4917 gene locus_tag LOCUS_18240 4447 4917 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_18240 5533 5012 gene locus_tag LOCUS_18250 5533 5012 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195800.1 protein_id gnl|my_center|LOCUS_18250 5650 7278 gene locus_tag LOCUS_18260 gene ipdC 5650 7278 CDS product indolepyruvate/phenylpyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390529.1 protein_id gnl|my_center|LOCUS_18260 <9617 7358 gene locus_tag LOCUS_18270 <9617 7358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III >Feature sequence107 <1 729 gene locus_tag LOCUS_18280 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266627.1:protein-glutamate O-methyltransferase 729 1265 gene locus_tag LOCUS_18290 gene cheD 729 1265 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_18290 1265 2404 gene locus_tag LOCUS_18300 1265 2404 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_18300 3706 2420 gene locus_tag LOCUS_18310 gene guaD 3706 2420 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 protein_id gnl|my_center|LOCUS_18310 3605 3904 gene locus_tag LOCUS_18320 3605 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 3986 4318 gene locus_tag LOCUS_18330 3986 4318 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_18330 4472 4999 gene locus_tag LOCUS_18340 4472 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5001 6491 gene locus_tag LOCUS_18350 5001 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 6488 7102 gene locus_tag LOCUS_18360 6488 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 7099 7677 gene locus_tag LOCUS_18370 7099 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7974 7735 gene locus_tag LOCUS_18380 7974 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 <9368 8076 gene locus_tag LOCUS_18390 <9368 8076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529996.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence108 116 550 gene locus_tag LOCUS_18400 116 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 547 915 gene locus_tag LOCUS_18410 547 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 960 1202 gene locus_tag LOCUS_18420 960 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 1231 2022 gene locus_tag LOCUS_18430 1231 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2234 2590 gene locus_tag LOCUS_18440 2234 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3057 3698 gene locus_tag LOCUS_18450 3057 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4175 3765 gene locus_tag LOCUS_18460 gene arfB 4175 3765 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_18460 5042 4188 gene locus_tag LOCUS_18470 5042 4188 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_18470 5317 5039 gene locus_tag LOCUS_18480 5317 5039 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_18480 6680 5571 gene locus_tag LOCUS_18490 6680 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8902 6680 gene locus_tag LOCUS_18500 8902 6680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_18500 9048 8899 gene locus_tag LOCUS_18510 9048 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence109 1844 759 gene locus_tag LOCUS_18520 gene prfA 1844 759 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_18520 3156 1903 gene locus_tag LOCUS_18530 gene hemA 3156 1903 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807616.1 protein_id gnl|my_center|LOCUS_18530 4585 3377 gene locus_tag LOCUS_18540 4585 3377 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 protein_id gnl|my_center|LOCUS_18540 4776 4701 gene locus_tag LOCUS_t00210 4776 4701 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6375 4906 gene locus_tag LOCUS_18550 6375 4906 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_18550 7036 6350 gene locus_tag LOCUS_18560 7036 6350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_18560 8846 7203 gene locus_tag LOCUS_18570 gene groL 8846 7203 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538665.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence110 2623 3174 gene locus_tag LOCUS_18580 2623 3174 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_18580 4260 3178 gene locus_tag LOCUS_18590 gene mnmH 4260 3178 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_18590 4283 5323 gene locus_tag LOCUS_18600 gene selD 4283 5323 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_18600 6008 5370 gene locus_tag LOCUS_18610 6008 5370 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_18610 5995 6705 gene locus_tag LOCUS_18620 5995 6705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193988.1 protein_id gnl|my_center|LOCUS_18620 7566 6727 gene locus_tag LOCUS_18630 gene serB 7566 6727 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_18630 8642 7563 gene locus_tag LOCUS_18640 8642 7563 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence111 281 799 gene locus_tag LOCUS_18650 gene rimM 281 799 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_18650 807 1655 gene locus_tag LOCUS_18660 gene trmD 807 1655 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_18660 1753 2166 gene locus_tag LOCUS_18670 gene rplS 1753 2166 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_18670 3345 2269 gene locus_tag LOCUS_18680 gene lptG 3345 2269 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_18680 4591 3509 gene locus_tag LOCUS_18690 gene lptF 4591 3509 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_18690 4711 6216 gene locus_tag LOCUS_18700 4711 6216 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_18700 6248 6688 gene locus_tag LOCUS_18710 6248 6688 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065106.1 protein_id gnl|my_center|LOCUS_18710 6685 7245 gene locus_tag LOCUS_18720 6685 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence112 <1 1729 gene locus_tag LOCUS_18730 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388790.1:EAL domain-containing protein 1862 3619 gene locus_tag LOCUS_18740 1862 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4520 3633 gene locus_tag LOCUS_18750 4520 3633 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_18750 4689 5651 gene locus_tag LOCUS_18760 4689 5651 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_18760 5768 7450 gene locus_tag LOCUS_18770 5768 7450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_18770 7462 7686 gene locus_tag LOCUS_18780 7462 7686 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808487.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence113 216 37 gene locus_tag LOCUS_18790 216 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 491 955 gene locus_tag LOCUS_18800 491 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1076 3121 gene locus_tag LOCUS_18810 1076 3121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_18810 3141 3710 gene locus_tag LOCUS_18820 3141 3710 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_18820 5920 3788 gene locus_tag LOCUS_18830 gene katG 5920 3788 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_18830 6385 7623 gene locus_tag LOCUS_18840 6385 7623 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099122.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence114 278 1318 gene locus_tag LOCUS_18850 278 1318 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_18850 1938 1417 gene locus_tag LOCUS_18860 1938 1417 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_18860 2592 2179 gene locus_tag LOCUS_18870 2592 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3311 2898 gene locus_tag LOCUS_18880 3311 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4578 3514 gene locus_tag LOCUS_18890 4578 3514 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_18890 4850 5701 gene locus_tag LOCUS_18900 gene rpoH 4850 5701 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 protein_id gnl|my_center|LOCUS_18900 6396 5758 gene locus_tag LOCUS_18910 6396 5758 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_18910 7468 6572 gene locus_tag LOCUS_18920 gene cyoE 7468 6572 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815729.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence115 1408 878 gene locus_tag LOCUS_18930 gene tsaE 1408 878 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218833.1 protein_id gnl|my_center|LOCUS_18930 1424 2572 gene locus_tag LOCUS_18940 gene queG 1424 2572 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_18940 2603 2803 gene locus_tag LOCUS_18950 2603 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2797 3357 gene locus_tag LOCUS_18960 2797 3357 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_18960 3519 4967 gene locus_tag LOCUS_18970 3519 4967 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_18970 5540 5244 gene locus_tag LOCUS_18980 5540 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 6042 5632 gene locus_tag LOCUS_18990 6042 5632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 6897 6136 gene locus_tag LOCUS_19000 6897 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 7527 6931 gene locus_tag LOCUS_19010 7527 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence116 <1 953 gene locus_tag LOCUS_19020 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926191.1:aldehyde dehydrogenase family protein 1711 986 gene locus_tag LOCUS_19030 1711 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2062 1772 gene locus_tag LOCUS_19040 2062 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3317 2256 gene locus_tag LOCUS_19050 gene hypE 3317 2256 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_19050 4545 3403 gene locus_tag LOCUS_19060 gene hypD 4545 3403 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_19060 4808 4542 gene locus_tag LOCUS_19070 4808 4542 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_19070 6115 4811 gene locus_tag LOCUS_19080 6115 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 6783 6112 gene locus_tag LOCUS_19090 6783 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 7431 7090 gene locus_tag LOCUS_19100 gene hypA 7431 7090 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence117 965 2005 gene locus_tag LOCUS_19110 965 2005 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689901.1 protein_id gnl|my_center|LOCUS_19110 2062 2754 gene locus_tag LOCUS_19120 2062 2754 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_19120 2824 4164 gene locus_tag LOCUS_19130 2824 4164 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_19130 4157 5416 gene locus_tag LOCUS_19140 gene ubiH 4157 5416 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 protein_id gnl|my_center|LOCUS_19140 5655 5464 gene locus_tag LOCUS_19150 5655 5464 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_19150 6441 5770 gene locus_tag LOCUS_19160 6441 5770 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_19160 7284 6520 gene locus_tag LOCUS_19170 gene xth 7284 6520 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193531.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence118 <1 1212 gene locus_tag LOCUS_19180 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072961.1:alanine/glycine:cation symporter family protein 1284 2183 gene locus_tag LOCUS_19190 gene rapZ 1284 2183 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_19190 2180 2569 gene locus_tag LOCUS_19200 2180 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2550 3098 gene locus_tag LOCUS_19210 2550 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 4237 3347 gene locus_tag LOCUS_19220 4237 3347 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_19220 4541 4269 gene locus_tag LOCUS_19230 4541 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5093 5018 gene locus_tag LOCUS_t00220 5093 5018 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5874 5170 gene locus_tag LOCUS_19240 gene queC 5874 5170 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_19240 6625 5954 gene locus_tag LOCUS_19250 gene queE 6625 5954 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_19250 7343 6630 gene locus_tag LOCUS_19260 gene ybgF 7343 6630 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004418664.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence119 2944 1280 gene locus_tag LOCUS_19270 2944 1280 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_19270 3230 4012 gene locus_tag LOCUS_19280 3230 4012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_19280 4009 4800 gene locus_tag LOCUS_19290 gene mlaE 4009 4800 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219882.1 protein_id gnl|my_center|LOCUS_19290 4797 5276 gene locus_tag LOCUS_19300 gene mlaD 4797 5276 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_19300 5309 6154 gene locus_tag LOCUS_19310 5309 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 6170 6793 gene locus_tag LOCUS_19320 6170 6793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_19320 6790 7083 gene locus_tag LOCUS_19330 6790 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence120 180 647 gene locus_tag LOCUS_19340 180 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 684 1229 gene locus_tag LOCUS_19350 684 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1307 2017 gene locus_tag LOCUS_19360 gene fabG 1307 2017 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_19360 2664 3812 gene locus_tag LOCUS_19370 2664 3812 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_19370 3903 4958 gene locus_tag LOCUS_19380 3903 4958 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_19380 4955 6769 gene locus_tag LOCUS_19390 4955 6769 CDS product branched-chain amino acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813865.1 protein_id gnl|my_center|LOCUS_19390 6766 7536 gene locus_tag LOCUS_19400 6766 7536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813864.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence121 <1 1761 gene locus_tag LOCUS_19410 <1 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818282.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1841 2497 gene locus_tag LOCUS_19420 gene rsmG 1841 2497 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202905.1 protein_id gnl|my_center|LOCUS_19420 2612 3382 gene locus_tag LOCUS_19430 2612 3382 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_19430 3397 4248 gene locus_tag LOCUS_19440 3397 4248 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_19440 5573 4266 gene locus_tag LOCUS_19450 5573 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 5841 6182 gene locus_tag LOCUS_19460 5841 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 6185 7030 gene locus_tag LOCUS_19470 gene atpB 6185 7030 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 protein_id gnl|my_center|LOCUS_19470 7096 7341 gene locus_tag LOCUS_19480 gene atpE 7096 7341 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence122 <1 711 gene locus_tag LOCUS_19490 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194094.1:class II glutamine amidotransferase 772 1200 gene locus_tag LOCUS_19500 772 1200 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_19500 2611 1277 gene locus_tag LOCUS_19510 gene phoR 2611 1277 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_19510 3350 2640 gene locus_tag LOCUS_19520 gene phoB 3350 2640 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_19520 3587 4009 gene locus_tag LOCUS_19530 3587 4009 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_19530 4017 4754 gene locus_tag LOCUS_19540 gene ubiE 4017 4754 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_19540 4774 5649 gene locus_tag LOCUS_19550 4774 5649 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_19550 5704 6285 gene locus_tag LOCUS_19560 5704 6285 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 protein_id gnl|my_center|LOCUS_19560 6901 6476 gene locus_tag LOCUS_19570 6901 6476 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_19570 <7488 6955 gene locus_tag LOCUS_19580 <7488 6955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064897.1:F0F1 ATP synthase subunit beta >Feature sequence123 <1 1199 gene locus_tag LOCUS_19590 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194180.1:adenylosuccinate lyase 1287 1604 gene locus_tag LOCUS_19600 1287 1604 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_19600 2834 1902 gene locus_tag LOCUS_19610 gene secF 2834 1902 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_19610 4739 2859 gene locus_tag LOCUS_19620 gene secD 4739 2859 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_19620 5175 4849 gene locus_tag LOCUS_19630 gene yajC 5175 4849 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_19630 6428 5268 gene locus_tag LOCUS_19640 gene tgt 6428 5268 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064322.1 protein_id gnl|my_center|LOCUS_19640 <7472 6418 gene locus_tag LOCUS_19650 <7472 6418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064321.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA >Feature sequence124 763 284 gene locus_tag LOCUS_19660 763 284 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213216.1 protein_id gnl|my_center|LOCUS_19660 1377 799 gene locus_tag LOCUS_19670 1377 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 3338 1407 gene locus_tag LOCUS_19680 3338 1407 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869125.1 protein_id gnl|my_center|LOCUS_19680 4425 3556 gene locus_tag LOCUS_19690 4425 3556 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_19690 6052 4832 gene locus_tag LOCUS_19700 6052 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19700 7251 6049 gene locus_tag LOCUS_19710 7251 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19710 >Feature sequence125 <1 535 gene locus_tag LOCUS_19720 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029301722.1:EAL domain-containing response regulator 684 1304 gene locus_tag LOCUS_19730 684 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1309 2529 gene locus_tag LOCUS_19740 1309 2529 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_19740 2570 3514 gene locus_tag LOCUS_19750 2570 3514 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_19750 4043 3525 gene locus_tag LOCUS_19760 4043 3525 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_19760 5038 4121 gene locus_tag LOCUS_19770 5038 4121 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 protein_id gnl|my_center|LOCUS_19770 <7222 5052 gene locus_tag LOCUS_19780 <7222 5052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197743.1:methionine synthase >Feature sequence126 <1 1728 gene locus_tag LOCUS_19790 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814429.1:LPS-assembly protein LptD 1754 3082 gene locus_tag LOCUS_19800 1754 3082 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_19800 3079 4089 gene locus_tag LOCUS_19810 gene pdxA 3079 4089 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 protein_id gnl|my_center|LOCUS_19810 4109 4912 gene locus_tag LOCUS_19820 gene rsmA 4109 4912 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_19820 <7052 4938 gene locus_tag LOCUS_19830 <7052 4938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813231.1:DNA polymerase III subunit alpha >Feature sequence127 497 1732 gene locus_tag LOCUS_19840 497 1732 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 protein_id gnl|my_center|LOCUS_19840 3078 1834 gene locus_tag LOCUS_19850 3078 1834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_19850 3181 4080 gene locus_tag LOCUS_19860 3181 4080 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_19860 5305 4103 gene locus_tag LOCUS_19870 5305 4103 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_19870 5502 6191 gene locus_tag LOCUS_19880 5502 6191 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 protein_id gnl|my_center|LOCUS_19880 >Feature sequence128 34 624 gene locus_tag LOCUS_19890 34 624 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_19890 786 1556 gene locus_tag LOCUS_19900 786 1556 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_19900 1619 2830 gene locus_tag LOCUS_19910 1619 2830 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_19910 2976 4511 gene locus_tag LOCUS_19920 2976 4511 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_19920 4508 6634 gene locus_tag LOCUS_19930 4508 6634 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence129 213 608 gene locus_tag LOCUS_19940 213 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 809 734 gene locus_tag LOCUS_t00230 809 734 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1451 906 gene locus_tag LOCUS_19950 gene ruvC 1451 906 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_19950 1776 1459 gene locus_tag LOCUS_19960 1776 1459 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_19960 2657 1806 gene locus_tag LOCUS_19970 2657 1806 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_19970 3551 2826 gene locus_tag LOCUS_19980 3551 2826 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216723.1 protein_id gnl|my_center|LOCUS_19980 4564 3650 gene locus_tag LOCUS_19990 gene nhaR 4564 3650 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_19990 4754 5311 gene locus_tag LOCUS_20000 4754 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5317 6258 gene locus_tag LOCUS_20010 5317 6258 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_20010 6263 6565 gene locus_tag LOCUS_20020 6263 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306985.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence130 558 634 gene locus_tag LOCUS_t00240 558 634 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 997 1638 gene locus_tag LOCUS_20030 997 1638 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970538.1 protein_id gnl|my_center|LOCUS_20030 1649 2827 gene locus_tag LOCUS_20040 1649 2827 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 protein_id gnl|my_center|LOCUS_20040 2926 3930 gene locus_tag LOCUS_20050 2926 3930 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_20050 5719 4067 gene locus_tag LOCUS_20060 gene gpmI 5719 4067 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence131 723 520 gene locus_tag LOCUS_20070 gene thiS 723 520 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_20070 922 2049 gene locus_tag LOCUS_20080 922 2049 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_20080 2232 2822 gene locus_tag LOCUS_20090 gene metW 2232 2822 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_20090 3242 2925 gene locus_tag LOCUS_20100 3242 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815930.1 protein_id gnl|my_center|LOCUS_20100 3364 4719 gene locus_tag LOCUS_20110 3364 4719 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_20110 4781 5557 gene locus_tag LOCUS_20120 4781 5557 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_20120 6058 5660 gene locus_tag LOCUS_20130 6058 5660 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_20130 6291 6055 gene locus_tag LOCUS_20140 6291 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 <6934 6329 gene locus_tag LOCUS_20150 <6934 6329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941615.1:ABC transporter ATP-binding protein >Feature sequence132 1795 1151 gene locus_tag LOCUS_20160 1795 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2583 1855 gene locus_tag LOCUS_20170 2583 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3890 2571 gene locus_tag LOCUS_20180 3890 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5302 3887 gene locus_tag LOCUS_20190 5302 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 6505 5306 gene locus_tag LOCUS_20200 6505 5306 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence133 492 986 gene locus_tag LOCUS_20210 492 986 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_20210 1018 1401 gene locus_tag LOCUS_20220 1018 1401 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_20220 1473 2288 gene locus_tag LOCUS_20230 gene panB 1473 2288 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_20230 2322 3149 gene locus_tag LOCUS_20240 gene panC 2322 3149 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_20240 3315 3761 gene locus_tag LOCUS_20250 3315 3761 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_20250 6565 3872 gene locus_tag LOCUS_20260 gene pepN 6565 3872 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence134 1871 1530 gene locus_tag LOCUS_20270 1871 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2202 1864 gene locus_tag LOCUS_20280 2202 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2555 2199 gene locus_tag LOCUS_20290 2555 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3034 2693 gene locus_tag LOCUS_20300 3034 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3404 4915 gene locus_tag LOCUS_20310 3404 4915 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_20310 4912 5673 gene locus_tag LOCUS_20320 4912 5673 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_20320 6691 5687 gene locus_tag LOCUS_20330 6691 5687 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence135 674 2527 gene locus_tag LOCUS_20340 674 2527 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 protein_id gnl|my_center|LOCUS_20340 2524 3153 gene locus_tag LOCUS_20350 2524 3153 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970482.1 protein_id gnl|my_center|LOCUS_20350 6412 3317 gene locus_tag LOCUS_20360 6412 3317 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064356.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence136 1586 228 gene locus_tag LOCUS_20370 gene accC 1586 228 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_20370 2046 1594 gene locus_tag LOCUS_20380 gene accB 2046 1594 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_20380 1942 2319 gene locus_tag LOCUS_20390 1942 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2960 2409 gene locus_tag LOCUS_20400 2960 2409 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814954.1 protein_id gnl|my_center|LOCUS_20400 3577 2957 gene locus_tag LOCUS_20410 3577 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 3659 5032 gene locus_tag LOCUS_20420 gene mpl 3659 5032 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_20420 5821 5153 gene locus_tag LOCUS_20430 5821 5153 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_20430 6414 5821 gene locus_tag LOCUS_20440 6414 5821 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence137 <1 723 gene locus_tag LOCUS_20450 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208115026.1:ABC transporter ATP-binding protein 1370 753 gene locus_tag LOCUS_20460 1370 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_20460 1528 2133 gene locus_tag LOCUS_20470 1528 2133 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_20470 2182 3246 gene locus_tag LOCUS_20480 2182 3246 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940070.1 protein_id gnl|my_center|LOCUS_20480 3678 3899 gene locus_tag LOCUS_20490 3678 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3899 4306 gene locus_tag LOCUS_20500 3899 4306 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_20500 4674 4598 gene locus_tag LOCUS_t00250 4674 4598 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4878 5204 gene locus_tag LOCUS_20510 4878 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 5255 6607 gene locus_tag LOCUS_20520 gene miaB 5255 6607 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190165.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence138 58 1326 gene locus_tag LOCUS_20530 gene clpX 58 1326 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_20530 1433 3859 gene locus_tag LOCUS_20540 gene lon 1433 3859 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_20540 3979 4347 gene locus_tag LOCUS_20550 3979 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4394 4469 gene locus_tag LOCUS_t00260 4394 4469 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4645 5868 gene locus_tag LOCUS_20560 4645 5868 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088899.1 protein_id gnl|my_center|LOCUS_20560 5975 6169 gene locus_tag LOCUS_20570 5975 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence139 199 927 gene locus_tag LOCUS_20580 199 927 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_20580 2482 935 gene locus_tag LOCUS_20590 gene hutH 2482 935 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114461.1 protein_id gnl|my_center|LOCUS_20590 4161 2485 gene locus_tag LOCUS_20600 gene hutU 4161 2485 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 protein_id gnl|my_center|LOCUS_20600 5164 4217 gene locus_tag LOCUS_20610 gene hutG 5164 4217 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 protein_id gnl|my_center|LOCUS_20610 6381 5161 gene locus_tag LOCUS_20620 gene hutI 6381 5161 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence140 69 1886 gene locus_tag LOCUS_20630 gene typA 69 1886 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_20630 2943 2041 gene locus_tag LOCUS_20640 gene galU 2943 2041 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522195.1 protein_id gnl|my_center|LOCUS_20640 5134 3020 gene locus_tag LOCUS_20650 gene ligA 5134 3020 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_20650 6233 5148 gene locus_tag LOCUS_20660 6233 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence141 1481 231 gene locus_tag LOCUS_20670 1481 231 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_20670 3272 1593 gene locus_tag LOCUS_20680 3272 1593 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 protein_id gnl|my_center|LOCUS_20680 3877 3269 gene locus_tag LOCUS_20690 3877 3269 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_20690 5101 4019 gene locus_tag LOCUS_20700 5101 4019 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812637.1 protein_id gnl|my_center|LOCUS_20700 5869 5219 gene locus_tag LOCUS_20710 5869 5219 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_20710 <6649 5995 gene locus_tag LOCUS_20720 <6649 5995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227769.1:TRAP transporter substrate-binding protein >Feature sequence142 <1 753 gene locus_tag LOCUS_20730 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197309.1:DEAD/DEAH box helicase 2238 859 gene locus_tag LOCUS_20740 2238 859 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_20740 2540 2235 gene locus_tag LOCUS_20750 2540 2235 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_20750 3679 2555 gene locus_tag LOCUS_20760 3679 2555 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_20760 4735 3956 gene locus_tag LOCUS_20770 4735 3956 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_20770 6029 4785 gene locus_tag LOCUS_20780 gene glcF 6029 4785 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_20780 <6591 6032 gene locus_tag LOCUS_20790 <6591 6032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000943100.1:glycolate oxidase subunit GlcE >Feature sequence143 910 443 gene locus_tag LOCUS_20800 910 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1683 907 gene locus_tag LOCUS_20810 1683 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20810 2532 1714 gene locus_tag LOCUS_20820 gene cobI 2532 1714 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_20820 3899 2529 gene locus_tag LOCUS_20830 3899 2529 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_20830 5205 4045 gene locus_tag LOCUS_20840 5205 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 5960 5265 gene locus_tag LOCUS_20850 5960 5265 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_20850 <6552 5979 gene locus_tag LOCUS_20860 <6552 5979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034944231.1:sirohydrochlorin chelatase >Feature sequence144 1598 408 gene locus_tag LOCUS_20870 gene earP 1598 408 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203004.1 protein_id gnl|my_center|LOCUS_20870 2152 2976 gene locus_tag LOCUS_20880 2152 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3723 2986 gene locus_tag LOCUS_20890 3723 2986 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_20890 3869 4342 gene locus_tag LOCUS_20900 3869 4342 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_20900 4457 5425 gene locus_tag LOCUS_20910 4457 5425 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_20910 5788 6243 gene locus_tag LOCUS_20920 5788 6243 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence145 <1 1759 gene locus_tag LOCUS_20930 <1 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814636.1:proline--tRNA ligase 1767 2429 gene locus_tag LOCUS_20940 1767 2429 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_20940 2966 2529 gene locus_tag LOCUS_20950 2966 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3604 4986 gene locus_tag LOCUS_20960 gene glrR 3604 4986 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_20960 5009 5194 gene locus_tag LOCUS_20970 5009 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 <6342 5285 gene locus_tag LOCUS_20980 <6342 5285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194084.1:metalloprotease TldD >Feature sequence146 753 1592 gene locus_tag LOCUS_20990 gene cpaB 753 1592 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_20990 1614 3329 gene locus_tag LOCUS_21000 1614 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3340 3621 gene locus_tag LOCUS_21010 3340 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3654 4970 gene locus_tag LOCUS_21020 3654 4970 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532599.1 protein_id gnl|my_center|LOCUS_21020 4982 5431 gene locus_tag LOCUS_21030 4982 5431 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205743.1 protein_id gnl|my_center|LOCUS_21030 5428 5871 gene locus_tag LOCUS_21040 5428 5871 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552238.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence147 <1 1420 gene locus_tag LOCUS_21050 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895543.1:nitrate reductase catalytic subunit NapA 1491 2366 gene locus_tag LOCUS_21060 gene napG 1491 2366 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_21060 2363 3298 gene locus_tag LOCUS_21070 gene napH 2363 3298 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_21070 3295 3747 gene locus_tag LOCUS_21080 3295 3747 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 protein_id gnl|my_center|LOCUS_21080 3771 4391 gene locus_tag LOCUS_21090 gene napC 3771 4391 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_21090 4570 5196 gene locus_tag LOCUS_21100 gene ccmA 4570 5196 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_21100 5190 5858 gene locus_tag LOCUS_21110 gene ccmB 5190 5858 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982362.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence148 1182 394 gene locus_tag LOCUS_21120 1182 394 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905911.1 protein_id gnl|my_center|LOCUS_21120 1405 1983 gene locus_tag LOCUS_21130 gene idi 1405 1983 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_21130 3439 2114 gene locus_tag LOCUS_21140 3439 2114 CDS product IS4-like element ISLpn6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946384.1 protein_id gnl|my_center|LOCUS_21140 3480 4454 gene locus_tag LOCUS_21150 gene aroC 3480 4454 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_21150 4461 4601 gene locus_tag LOCUS_21160 4461 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4719 4976 gene locus_tag LOCUS_21170 4719 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6026 5079 gene locus_tag LOCUS_21180 6026 5079 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence149 1443 46 gene locus_tag LOCUS_21190 gene murD 1443 46 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 protein_id gnl|my_center|LOCUS_21190 2528 1440 gene locus_tag LOCUS_21200 gene mraY 2528 1440 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_21200 3948 2548 gene locus_tag LOCUS_21210 gene murF 3948 2548 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_21210 5450 3945 gene locus_tag LOCUS_21220 5450 3945 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549955.1 protein_id gnl|my_center|LOCUS_21220 <6205 5447 gene locus_tag LOCUS_21230 <6205 5447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446492.1:penicillin-binding protein 2 >Feature sequence150 2 655 gene locus_tag LOCUS_21240 2 655 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448965.1 protein_id gnl|my_center|LOCUS_21240 664 2520 gene locus_tag LOCUS_21250 664 2520 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_21250 2551 4308 gene locus_tag LOCUS_21260 2551 4308 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_21260 4418 5479 gene locus_tag LOCUS_21270 4418 5479 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_21270 <6144 5525 gene locus_tag LOCUS_21280 <6144 5525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000776231.1:HTH-type transcriptional regulator CysB >Feature sequence151 3510 1801 gene locus_tag LOCUS_21290 3510 1801 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_21290 4048 3587 gene locus_tag LOCUS_21300 4048 3587 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_21300 4473 4150 gene locus_tag LOCUS_21310 4473 4150 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_21310 4770 5096 gene locus_tag LOCUS_21320 gene trxA 4770 5096 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence152 499 1536 gene locus_tag LOCUS_21330 499 1536 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_21330 2077 1631 gene locus_tag LOCUS_21340 2077 1631 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_21340 2262 2074 gene locus_tag LOCUS_21350 2262 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 2645 2959 gene locus_tag LOCUS_21360 2645 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 protein_id gnl|my_center|LOCUS_21360 3415 3068 gene locus_tag LOCUS_21370 3415 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 3636 4190 gene locus_tag LOCUS_21380 3636 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5090 4215 gene locus_tag LOCUS_21390 5090 4215 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_21390 <6126 5187 gene locus_tag LOCUS_21400 <6126 5187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198316.1:ATP-dependent protease ATPase subunit HslU >Feature sequence153 566 1303 gene locus_tag LOCUS_21410 566 1303 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_21410 1312 1818 gene locus_tag LOCUS_21420 1312 1818 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_21420 4402 1826 gene locus_tag LOCUS_21430 4402 1826 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 protein_id gnl|my_center|LOCUS_21430 5253 4432 gene locus_tag LOCUS_21440 gene map 5253 4432 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence154 1954 1475 gene locus_tag LOCUS_21450 gene rraA 1954 1475 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267431.1 protein_id gnl|my_center|LOCUS_21450 4424 2151 gene locus_tag LOCUS_21460 gene clpA 4424 2151 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_21460 4733 4425 gene locus_tag LOCUS_21470 gene clpS 4733 4425 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194131.1 protein_id gnl|my_center|LOCUS_21470 5137 5340 gene locus_tag LOCUS_21480 5137 5340 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_21480 5723 5556 gene locus_tag LOCUS_21490 gene rpmG 5723 5556 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810296.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence155 639 184 gene locus_tag LOCUS_21500 639 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2162 801 gene locus_tag LOCUS_21510 2162 801 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060859.1 protein_id gnl|my_center|LOCUS_21510 3994 2159 gene locus_tag LOCUS_21520 3994 2159 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_21520 4427 3999 gene locus_tag LOCUS_21530 4427 3999 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084121.1 protein_id gnl|my_center|LOCUS_21530 <5870 4424 gene locus_tag LOCUS_21540 <5870 4424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099653.1:TRAP transporter permease >Feature sequence156 775 2088 gene locus_tag LOCUS_21550 775 2088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_21550 2085 2624 gene locus_tag LOCUS_21560 2085 2624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_21560 4687 2642 gene locus_tag LOCUS_21570 4687 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 <5855 5034 gene locus_tag LOCUS_21580 <5855 5034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186874.1:redox-regulated ATPase YchF >Feature sequence157 2095 104 gene locus_tag LOCUS_21590 2095 104 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_21590 3765 2437 gene locus_tag LOCUS_21600 3765 2437 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_21600 4804 3821 gene locus_tag LOCUS_21610 gene meaB 4804 3821 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_21610 <5731 4804 gene locus_tag LOCUS_21620 <5731 4804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337301.1:methylmalonyl-CoA mutase >Feature sequence158 269 547 gene locus_tag LOCUS_21630 269 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2192 570 gene locus_tag LOCUS_21640 2192 570 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_21640 2268 2939 gene locus_tag LOCUS_21650 2268 2939 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 protein_id gnl|my_center|LOCUS_21650 3088 3318 gene locus_tag LOCUS_21660 3088 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3829 3413 gene locus_tag LOCUS_21670 3829 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 5225 3843 gene locus_tag LOCUS_21680 5225 3843 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766716.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence159 476 1084 gene locus_tag LOCUS_21690 gene nqrE 476 1084 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_21690 1100 2323 gene locus_tag LOCUS_21700 gene nqrF 1100 2323 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_21700 2461 3261 gene locus_tag LOCUS_21710 2461 3261 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_21710 3314 3775 gene locus_tag LOCUS_21720 3314 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence160 1936 338 gene locus_tag LOCUS_21730 1936 338 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_21730 2570 2103 gene locus_tag LOCUS_21740 2570 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4320 2743 gene locus_tag LOCUS_21750 4320 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence161 <1 1065 gene locus_tag LOCUS_21760 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929886.1:potassium transporter TrkG 1145 2245 gene locus_tag LOCUS_21770 gene hemE 1145 2245 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_21770 2649 4826 gene locus_tag LOCUS_21780 2649 4826 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_21780 <5709 4856 gene locus_tag LOCUS_21790 <5709 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113004.1:GntR family transcriptional regulator MpaR >Feature sequence162 <1 1112 gene locus_tag LOCUS_21800 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191649.1:single-stranded-DNA-specific exonuclease RecJ 1478 2149 gene locus_tag LOCUS_21810 1478 2149 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_21810 2475 3572 gene locus_tag LOCUS_21820 gene pdhA 2475 3572 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213838.1 protein_id gnl|my_center|LOCUS_21820 3639 4622 gene locus_tag LOCUS_21830 3639 4622 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence163 3224 1053 gene locus_tag LOCUS_21840 3224 1053 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_21840 3577 3236 gene locus_tag LOCUS_21850 3577 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3968 3588 gene locus_tag LOCUS_21860 3968 3588 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_21860 5119 3968 gene locus_tag LOCUS_21870 5119 3968 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence164 922 449 gene locus_tag LOCUS_21880 922 449 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_21880 1851 916 gene locus_tag LOCUS_21890 1851 916 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_21890 2030 2809 gene locus_tag LOCUS_21900 2030 2809 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_21900 2863 3783 gene locus_tag LOCUS_21910 2863 3783 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_21910 3806 4063 gene locus_tag LOCUS_21920 3806 4063 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_21920 4053 4331 gene locus_tag LOCUS_21930 4053 4331 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_21930 5198 4401 gene locus_tag LOCUS_21940 5198 4401 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence165 <1 1189 gene locus_tag LOCUS_21950 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065178.1:PepSY-associated TM helix domain-containing protein 1269 1592 gene locus_tag LOCUS_21960 1269 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1683 2111 gene locus_tag LOCUS_21970 1683 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940589.1 protein_id gnl|my_center|LOCUS_21970 4287 2173 gene locus_tag LOCUS_21980 4287 2173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035914.1 protein_id gnl|my_center|LOCUS_21980 <5274 4551 gene locus_tag LOCUS_21990 <5274 4551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390606.1:heavy metal translocating P-type ATPase >Feature sequence166 1074 586 gene locus_tag LOCUS_22000 1074 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2207 1173 gene locus_tag LOCUS_22010 2207 1173 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532439.1 protein_id gnl|my_center|LOCUS_22010 4502 2250 gene locus_tag LOCUS_22020 4502 2250 CDS product cytochrome P450/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187052.1 protein_id gnl|my_center|LOCUS_22020 <5202 4653 gene locus_tag LOCUS_22030 <5202 4653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391442.1:acetoacetate--CoA ligase >Feature sequence167 380 1831 gene locus_tag LOCUS_22040 gene ompQ 380 1831 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_22040 2044 4161 gene locus_tag LOCUS_22050 2044 4161 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_22050 4673 4299 gene locus_tag LOCUS_22060 4673 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence168 798 499 gene locus_tag LOCUS_22070 798 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3555 1162 gene locus_tag LOCUS_22080 3555 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4661 3675 gene locus_tag LOCUS_22090 4661 3675 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_22090 <5191 4672 gene locus_tag LOCUS_22100 <5191 4672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269200.1:RNA polymerase sigma factor >Feature sequence169 847 98 gene locus_tag LOCUS_22110 847 98 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_22110 1406 852 gene locus_tag LOCUS_22120 1406 852 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_22120 1580 2425 gene locus_tag LOCUS_22130 gene rlmJ 1580 2425 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 protein_id gnl|my_center|LOCUS_22130 2530 4110 gene locus_tag LOCUS_22140 2530 4110 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_22140 4145 4483 gene locus_tag LOCUS_22150 4145 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 <5078 4494 gene locus_tag LOCUS_22160 <5078 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528547.1:GTP cyclohydrolase I >Feature sequence170 262 774 gene locus_tag LOCUS_22170 gene nrdR 262 774 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_22170 785 1852 gene locus_tag LOCUS_22180 gene ribD 785 1852 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 protein_id gnl|my_center|LOCUS_22180 2616 1861 gene locus_tag LOCUS_22190 gene moeB 2616 1861 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_22190 3072 2623 gene locus_tag LOCUS_22200 3072 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4474 3092 gene locus_tag LOCUS_22210 gene cptA 4474 3092 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence171 810 61 gene locus_tag LOCUS_22220 gene hisA 810 61 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_22220 1496 858 gene locus_tag LOCUS_22230 gene hisH 1496 858 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_22230 2172 1585 gene locus_tag LOCUS_22240 gene hisB 2172 1585 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_22240 2320 3393 gene locus_tag LOCUS_22250 gene hisC 2320 3393 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_22250 4744 3410 gene locus_tag LOCUS_22260 gene hisD 4744 3410 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence172 1 333 gene locus_tag LOCUS_22270 1 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 386 622 gene locus_tag LOCUS_22280 386 622 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930778.1 protein_id gnl|my_center|LOCUS_22280 1141 698 gene locus_tag LOCUS_22290 1141 698 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_22290 1271 2713 gene locus_tag LOCUS_22300 1271 2713 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_22300 3496 2813 gene locus_tag LOCUS_22310 3496 2813 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_22310 3589 3969 gene locus_tag LOCUS_22320 3589 3969 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_22320 4731 4003 gene locus_tag LOCUS_22330 gene fnr 4731 4003 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence173 <1 963 gene locus_tag LOCUS_22340 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092351.1:S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase 1227 2837 gene locus_tag LOCUS_22350 1227 2837 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_22350 2926 4803 gene locus_tag LOCUS_22360 2926 4803 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence174 434 1528 gene locus_tag LOCUS_22370 434 1528 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_22370 1539 4619 gene locus_tag LOCUS_22380 1539 4619 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence175 237 830 gene locus_tag LOCUS_22390 237 830 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_22390 820 1410 gene locus_tag LOCUS_22400 820 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1407 2627 gene locus_tag LOCUS_22410 1407 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3739 2657 gene locus_tag LOCUS_22420 gene alr 3739 2657 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 protein_id gnl|my_center|LOCUS_22420 3904 4176 gene locus_tag LOCUS_22430 3904 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence176 <1 544 gene locus_tag LOCUS_22440 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193246.1:30S ribosomal protein S2 636 1532 gene locus_tag LOCUS_22450 gene tsf 636 1532 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_22450 1543 2256 gene locus_tag LOCUS_22460 gene pyrH 1543 2256 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_22460 2275 2832 gene locus_tag LOCUS_22470 gene frr 2275 2832 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_22470 2882 3667 gene locus_tag LOCUS_22480 gene uppS 2882 3667 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_22480 3660 4481 gene locus_tag LOCUS_22490 3660 4481 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521189.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence177 1644 736 gene locus_tag LOCUS_22500 1644 736 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926441.1 protein_id gnl|my_center|LOCUS_22500 2383 1826 gene locus_tag LOCUS_22510 2383 1826 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_22510 2701 2495 gene locus_tag LOCUS_22520 2701 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 3297 2911 gene locus_tag LOCUS_22530 3297 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 <4825 3338 gene locus_tag LOCUS_22540 <4825 3338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790618.1:efflux RND transporter permease subunit >Feature sequence178 370 1938 gene locus_tag LOCUS_22550 370 1938 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_22550 1980 2750 gene locus_tag LOCUS_22560 1980 2750 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_22560 3105 4004 gene locus_tag LOCUS_22570 3105 4004 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_22570 4158 4613 gene locus_tag LOCUS_22580 4158 4613 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence179 <1 549 gene locus_tag LOCUS_22590 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815810.1:twin-arginine translocase subunit TatC 1719 562 gene locus_tag LOCUS_22600 1719 562 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_22600 1809 2561 gene locus_tag LOCUS_22610 1809 2561 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_22610 3693 2581 gene locus_tag LOCUS_22620 3693 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3898 4452 gene locus_tag LOCUS_22630 3898 4452 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence180 <1 2244 gene locus_tag LOCUS_22640 <1 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203868.1:methionine--tRNA ligase 2393 4084 gene locus_tag LOCUS_22650 gene sulP 2393 4084 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence181 <1 870 gene locus_tag LOCUS_22660 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039561.1:AEC family transporter 1136 1498 gene locus_tag LOCUS_22670 1136 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 <4654 1514 gene locus_tag LOCUS_22680 <4654 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463895.1:mechanosensitive channel MscK >Feature sequence182 <1 546 gene locus_tag LOCUS_22690 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209474.1:tRNA (uridine(54)-C5)-methyltransferase TrmA 568 3360 gene locus_tag LOCUS_22700 568 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence183 1169 1756 gene locus_tag LOCUS_22710 1169 1756 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_22710 1833 3665 gene locus_tag LOCUS_22720 1833 3665 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence184 401 901 gene locus_tag LOCUS_22730 gene tpx 401 901 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195100.1 protein_id gnl|my_center|LOCUS_22730 2938 1055 gene locus_tag LOCUS_22740 2938 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 3310 3011 gene locus_tag LOCUS_22750 3310 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 <4262 3611 gene locus_tag LOCUS_22760 <4262 3611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080577701.1:response regulator transcription factor >Feature sequence185 38 496 gene locus_tag LOCUS_22770 gene ybgC 38 496 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_22770 493 1161 gene locus_tag LOCUS_22780 gene tolQ 493 1161 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_22780 1184 1597 gene locus_tag LOCUS_22790 gene tolR 1184 1597 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_22790 1594 2526 gene locus_tag LOCUS_22800 1594 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2567 3844 gene locus_tag LOCUS_22810 gene tolB 2567 3844 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533572.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence186 <1 1329 gene locus_tag LOCUS_22820 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:MMPL family transporter 1343 2383 gene locus_tag LOCUS_22830 1343 2383 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence187 301 1791 gene locus_tag LOCUS_22840 301 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2560 3003 gene locus_tag LOCUS_22850 gene mraZ 2560 3003 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_22850 3000 3938 gene locus_tag LOCUS_22860 gene rsmH 3000 3938 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938761.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence188 1400 177 gene locus_tag LOCUS_22870 1400 177 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_22870 2605 1418 gene locus_tag LOCUS_22880 2605 1418 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_22880 2764 3663 gene locus_tag LOCUS_22890 2764 3663 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence189 <1 669 gene locus_tag LOCUS_22900 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038832.1:LysM peptidoglycan-binding domain-containing protein 689 1861 gene locus_tag LOCUS_22910 gene dprA 689 1861 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_22910 1967 2437 gene locus_tag LOCUS_22920 1967 2437 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence190 111 1328 gene locus_tag LOCUS_22930 111 1328 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_22930 1376 2446 gene locus_tag LOCUS_22940 gene mtnA 1376 2446 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337453.1 protein_id gnl|my_center|LOCUS_22940 2443 3159 gene locus_tag LOCUS_22950 2443 3159 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_22950 3304 3513 gene locus_tag LOCUS_22960 3304 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3513 3791 gene locus_tag LOCUS_22970 3513 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence191 <1 654 gene locus_tag LOCUS_22980 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707571.1:A24 family peptidase 865 1062 gene locus_tag LOCUS_22990 865 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1112 1738 gene locus_tag LOCUS_23000 1112 1738 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_23000 1855 3654 gene locus_tag LOCUS_23010 gene aspS 1855 3654 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence192 208 600 gene locus_tag LOCUS_23020 gene rpsI 208 600 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_23020 792 1829 gene locus_tag LOCUS_23030 gene argC 792 1829 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_23030 1922 2272 gene locus_tag LOCUS_23040 gene erpA 1922 2272 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_23040 3623 2397 gene locus_tag LOCUS_23050 3623 2397 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence193 1149 1412 gene locus_tag LOCUS_23060 1149 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2342 1512 gene locus_tag LOCUS_23070 2342 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2608 3669 gene locus_tag LOCUS_23080 2608 3669 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence194 >Feature sequence195 <1 1738 gene locus_tag LOCUS_23090 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192715.1:Rne/Rng family ribonuclease note possible pseudo, internal stop codon, frameshifted 2299 1826 gene locus_tag LOCUS_23100 2299 1826 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_23100 <3880 2315 gene locus_tag LOCUS_23110 <3880 2315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199587.1:excinuclease ABC subunit UvrB >Feature sequence196 3244 2021 gene locus_tag LOCUS_23120 3244 2021 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_23120 3415 3852 gene locus_tag LOCUS_23130 gene trxC 3415 3852 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence197 28 381 gene locus_tag LOCUS_23140 gene rplR 28 381 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_23140 394 918 gene locus_tag LOCUS_23150 gene rpsE 394 918 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_23150 922 1104 gene locus_tag LOCUS_23160 gene rpmD 922 1104 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_23160 1106 1543 gene locus_tag LOCUS_23170 gene rplO 1106 1543 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_23170 1559 2884 gene locus_tag LOCUS_23180 gene secY 1559 2884 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_23180 2889 3107 gene locus_tag LOCUS_23190 gene infA 2889 3107 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_23190 3300 3662 gene locus_tag LOCUS_23200 gene rpsM 3300 3662 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence198 1233 442 gene locus_tag LOCUS_23210 1233 442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_23210 2189 1230 gene locus_tag LOCUS_23220 2189 1230 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_23220 <3676 2381 gene locus_tag LOCUS_23230 <3676 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920055.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor >Feature sequence199 1599 487 gene locus_tag LOCUS_23240 gene zapE 1599 487 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_23240 3191 1761 gene locus_tag LOCUS_23250 gene lpdA 3191 1761 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534933.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence200 750 1157 gene locus_tag LOCUS_23260 gene rnk 750 1157 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 protein_id gnl|my_center|LOCUS_23260 2528 1278 gene locus_tag LOCUS_23270 gene murA 2528 1278 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_23270 2793 2536 gene locus_tag LOCUS_23280 2793 2536 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_23280 <3557 2805 gene locus_tag LOCUS_23290 <3557 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199919.1:ABC transporter permease >Feature sequence201 1111 572 gene locus_tag LOCUS_23300 1111 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1309 2073 gene locus_tag LOCUS_23310 1309 2073 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252794.1 protein_id gnl|my_center|LOCUS_23310 2070 3386 gene locus_tag LOCUS_23320 2070 3386 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969540.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence202 61 498 gene locus_tag LOCUS_23330 61 498 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687152.1 protein_id gnl|my_center|LOCUS_23330 502 1035 gene locus_tag LOCUS_23340 502 1035 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_23340 1048 2586 gene locus_tag LOCUS_23350 gene atpA 1048 2586 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_23350 2608 3477 gene locus_tag LOCUS_23360 gene atpG 2608 3477 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence203 559 1716 gene locus_tag LOCUS_23370 559 1716 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence204 1099 272 gene locus_tag LOCUS_23380 gene mscS 1099 272 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_23380 <3429 1143 gene locus_tag LOCUS_23390 <3429 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038150.1:glucosylglycerol-phosphate synthase >Feature sequence205 462 1517 gene locus_tag LOCUS_23400 462 1517 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_23400 2072 2710 gene locus_tag LOCUS_23410 2072 2710 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence206 <1 850 gene locus_tag LOCUS_23420 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:TRAP transporter large permease 902 1453 gene locus_tag LOCUS_23430 902 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2027 1479 gene locus_tag LOCUS_23440 2027 1479 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089256.1 protein_id gnl|my_center|LOCUS_23440 2743 2024 gene locus_tag LOCUS_23450 2743 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence207 1070 1900 gene locus_tag LOCUS_23460 1070 1900 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_23460 2389 1907 gene locus_tag LOCUS_23470 2389 1907 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence208 498 686 gene locus_tag LOCUS_23480 498 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1157 726 gene locus_tag LOCUS_23490 1157 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence209 328 1200 gene locus_tag LOCUS_23500 328 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810430.1 protein_id gnl|my_center|LOCUS_23500 1215 2048 gene locus_tag LOCUS_23510 1215 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2302 2571 gene locus_tag LOCUS_23520 2302 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2921 2658 gene locus_tag LOCUS_23530 2921 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 3160 2918 gene locus_tag LOCUS_23540 3160 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence210 <1 1545 gene locus_tag LOCUS_23550 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205031.1:TAT-dependent nitrous-oxide reductase >Feature sequence211 1167 7 gene locus_tag LOCUS_23560 gene hadC 1167 7 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_23560 1946 1170 gene locus_tag LOCUS_23570 1946 1170 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 protein_id gnl|my_center|LOCUS_23570 3079 1946 gene locus_tag LOCUS_23580 3079 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence212 2 1477 gene locus_tag LOCUS_23590 2 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence213 36 1748 gene locus_tag LOCUS_23600 36 1748 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_23600 1784 2275 gene locus_tag LOCUS_23610 gene ilvN 1784 2275 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence214 2353 1910 gene locus_tag LOCUS_23620 gene ccmE 2353 1910 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_23620 2577 2350 gene locus_tag LOCUS_23630 2577 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3173 2577 gene locus_tag LOCUS_23640 3173 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence215 382 807 gene locus_tag LOCUS_23650 382 807 CDS product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_23650 2015 846 gene locus_tag LOCUS_23660 2015 846 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_23660 2830 2123 gene locus_tag LOCUS_23670 2830 2123 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence216 405 890 gene locus_tag LOCUS_23680 gene dut 405 890 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_23680 890 1315 gene locus_tag LOCUS_23690 890 1315 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816000.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence217 2670 2575 gene locus_tag LOCUS_t00270 2670 2575 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence218 2101 149 gene locus_tag LOCUS_23700 2101 149 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_23700 2618 2166 gene locus_tag LOCUS_23710 2618 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence219 1733 1035 gene locus_tag LOCUS_23720 1733 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2637 1699 gene locus_tag LOCUS_23730 2637 1699 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence220 294 1250 gene locus_tag LOCUS_23740 294 1250 CDS product Chemotaxis protein methyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102222.1 protein_id gnl|my_center|LOCUS_23740 1259 1837 gene locus_tag LOCUS_23750 gene cheD 1259 1837 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence221 939 547 gene locus_tag LOCUS_23760 939 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1977 1078 gene locus_tag LOCUS_23770 1977 1078 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_23770 <3045 2111 gene locus_tag LOCUS_23780 <3045 2111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730611.1:FUSC family protein >Feature sequence222 1828 1424 gene locus_tag LOCUS_23790 1828 1424 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence223 255 971 gene locus_tag LOCUS_23800 255 971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_23800 1965 1075 gene locus_tag LOCUS_23810 1965 1075 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence224 308 234 gene locus_tag LOCUS_t00280 308 234 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2117 387 gene locus_tag LOCUS_23820 gene ptsP 2117 387 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_23820 2388 2119 gene locus_tag LOCUS_23830 2388 2119 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence225 57 2225 gene locus_tag LOCUS_23840 57 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2297 2509 gene locus_tag LOCUS_23850 2297 2509 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689029.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence226 <1 2075 gene locus_tag LOCUS_23860 <1 2075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064493.1:translocation/assembly module TamB domain-containing protein 2099 2665 gene locus_tag LOCUS_23870 gene msrA 2099 2665 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814600.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence227 368 1258 gene locus_tag LOCUS_23880 368 1258 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 2191 1295 gene locus_tag LOCUS_23890 2191 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence228 <1 679 gene locus_tag LOCUS_23900 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000715695.1:precorrin-3B C(17)-methyltransferase 2031 631 gene locus_tag LOCUS_23910 2031 631 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_23910 <2759 2028 gene locus_tag LOCUS_23920 <2759 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405073.1:siroheme synthase CysG >Feature sequence229 309 848 gene locus_tag LOCUS_23930 gene ruvC 309 848 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_23930 945 1020 gene locus_tag LOCUS_t00290 945 1020 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1270 2370 gene locus_tag LOCUS_23940 1270 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2418 2741 gene locus_tag LOCUS_23950 2418 2741 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence230 >Feature sequence231 <1 1860 gene locus_tag LOCUS_23960 <1 1860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112649.1:biofilm regulation protein phosphatase SiaA 1903 2445 gene locus_tag LOCUS_23970 gene siaB 1903 2445 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence232 493 1707 gene locus_tag LOCUS_23980 493 1707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_23980 <2658 1785 gene locus_tag LOCUS_23990 <2658 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815676.1:acyl-CoA dehydrogenase >Feature sequence233 2142 1075 gene locus_tag LOCUS_24000 gene adhP 2142 1075 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438761.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence234 286 1458 gene locus_tag LOCUS_24010 gene megL 286 1458 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_24010 1593 2066 gene locus_tag LOCUS_24020 1593 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 <2628 2056 gene locus_tag LOCUS_24030 <2628 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225136.1:glucose-6-phosphate isomerase >Feature sequence235 2045 900 gene locus_tag LOCUS_24040 gene ftsZ 2045 900 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence236 <1 843 gene locus_tag LOCUS_24050 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193564.1:U32 family peptidase 915 1448 gene locus_tag LOCUS_24060 915 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1646 2602 gene locus_tag LOCUS_24070 gene thiL 1646 2602 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039076.1 protein_id gnl|my_center|LOCUS_24070