>Feature sequence001 1126 245 gene locus_tag LOCUS_00010 1126 245 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_00010 1757 1317 gene locus_tag LOCUS_00020 1757 1317 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928467.1 protein_id gnl|my_center|LOCUS_00020 3796 1964 gene locus_tag LOCUS_00030 3796 1964 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_00030 4460 3873 gene locus_tag LOCUS_00040 4460 3873 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_00040 4945 5835 gene locus_tag LOCUS_00050 4945 5835 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_00050 5859 7031 gene locus_tag LOCUS_00060 gene megL 5859 7031 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_00060 7166 7639 gene locus_tag LOCUS_00070 7166 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9296 7629 gene locus_tag LOCUS_00080 gene pgi 9296 7629 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225136.1 protein_id gnl|my_center|LOCUS_00080 9453 10028 gene locus_tag LOCUS_00090 gene pgsA 9453 10028 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_00090 10120 10195 gene locus_tag LOCUS_t00010 10120 10195 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10269 10342 gene locus_tag LOCUS_t00020 10269 10342 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10412 10487 gene locus_tag LOCUS_t00030 10412 10487 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10715 12586 gene locus_tag LOCUS_00100 10715 12586 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625464.1 protein_id gnl|my_center|LOCUS_00100 13266 12583 gene locus_tag LOCUS_00110 13266 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13361 13660 gene locus_tag LOCUS_00120 13361 13660 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003282197.1 protein_id gnl|my_center|LOCUS_00120 13834 14919 gene locus_tag LOCUS_00130 13834 14919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14919 15815 gene locus_tag LOCUS_00140 14919 15815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15815 17101 gene locus_tag LOCUS_00150 15815 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036781.1 protein_id gnl|my_center|LOCUS_00150 17098 17574 gene locus_tag LOCUS_00160 17098 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17571 19604 gene locus_tag LOCUS_00170 17571 19604 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036780.1 protein_id gnl|my_center|LOCUS_00170 21542 19722 gene locus_tag LOCUS_00180 gene mobH 21542 19722 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_00180 21788 22210 gene locus_tag LOCUS_00190 21788 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22210 22668 gene locus_tag LOCUS_00200 22210 22668 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_00200 22698 23066 gene locus_tag LOCUS_00210 22698 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24598 23081 gene locus_tag LOCUS_00220 24598 23081 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 protein_id gnl|my_center|LOCUS_00220 24962 24612 gene locus_tag LOCUS_00230 24962 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26365 24959 gene locus_tag LOCUS_00240 26365 24959 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038856.1 protein_id gnl|my_center|LOCUS_00240 27326 26376 gene locus_tag LOCUS_00250 27326 26376 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_00250 27754 27323 gene locus_tag LOCUS_00260 27754 27323 CDS product TIGR03757 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267009.1 protein_id gnl|my_center|LOCUS_00260 28182 27907 gene locus_tag LOCUS_00270 28182 27907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28884 28231 gene locus_tag LOCUS_00280 28884 28231 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448014.1 protein_id gnl|my_center|LOCUS_00280 29129 28920 gene locus_tag LOCUS_00290 29129 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29507 29199 gene locus_tag LOCUS_00300 29507 29199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 30024 29725 gene locus_tag LOCUS_00310 30024 29725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30118 32172 gene locus_tag LOCUS_00320 30118 32172 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_00320 32202 32381 gene locus_tag LOCUS_00330 32202 32381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 32374 32982 gene locus_tag LOCUS_00340 32374 32982 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 protein_id gnl|my_center|LOCUS_00340 33926 32997 gene locus_tag LOCUS_00350 33926 32997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34046 36034 gene locus_tag LOCUS_00360 34046 36034 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044346855.1 protein_id gnl|my_center|LOCUS_00360 36049 37113 gene locus_tag LOCUS_00370 36049 37113 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065518.1 protein_id gnl|my_center|LOCUS_00370 37110 38324 gene locus_tag LOCUS_00380 37110 38324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38321 38785 gene locus_tag LOCUS_00390 38321 38785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39465 38965 gene locus_tag LOCUS_00400 39465 38965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42642 39664 gene locus_tag LOCUS_00410 42642 39664 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_00410 43037 44263 gene locus_tag LOCUS_00420 43037 44263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 44358 46961 gene locus_tag LOCUS_00430 44358 46961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 47549 47109 gene locus_tag LOCUS_00440 47549 47109 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_00440 48939 47530 gene locus_tag LOCUS_00450 48939 47530 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_00450 49819 48929 gene locus_tag LOCUS_00460 49819 48929 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_00460 50511 49816 gene locus_tag LOCUS_00470 50511 49816 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_00470 50930 50508 gene locus_tag LOCUS_00480 50930 50508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51303 50944 gene locus_tag LOCUS_00490 51303 50944 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_00490 51560 51327 gene locus_tag LOCUS_00500 51560 51327 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_00500 51892 51557 gene locus_tag LOCUS_00510 51892 51557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 52919 53272 gene locus_tag LOCUS_00520 52919 53272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 53269 54429 gene locus_tag LOCUS_00530 53269 54429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54612 55907 gene locus_tag LOCUS_00540 54612 55907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55904 56983 gene locus_tag LOCUS_00550 55904 56983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 56988 57692 gene locus_tag LOCUS_00560 gene queC 56988 57692 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_00560 57689 58801 gene locus_tag LOCUS_00570 57689 58801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58806 59447 gene locus_tag LOCUS_00580 gene queE 58806 59447 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_00580 60575 61771 gene locus_tag LOCUS_00590 60575 61771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64084 61838 gene locus_tag LOCUS_00600 64084 61838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 64601 64071 gene locus_tag LOCUS_00610 64601 64071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 69301 64598 gene locus_tag LOCUS_00620 69301 64598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70023 69292 gene locus_tag LOCUS_00630 70023 69292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73049 70020 gene locus_tag LOCUS_00640 73049 70020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 73945 73049 gene locus_tag LOCUS_00650 73945 73049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 76413 73942 gene locus_tag LOCUS_00660 76413 73942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 79751 76497 gene locus_tag LOCUS_00670 79751 76497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 80158 79775 gene locus_tag LOCUS_00680 80158 79775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 81608 80859 gene locus_tag LOCUS_00690 81608 80859 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_00690 83773 81605 gene locus_tag LOCUS_00700 gene traD 83773 81605 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_00700 84335 83784 gene locus_tag LOCUS_00710 84335 83784 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_00710 84880 84332 gene locus_tag LOCUS_00720 84880 84332 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_00720 85647 84895 gene locus_tag LOCUS_00730 85647 84895 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_00730 86309 85644 gene locus_tag LOCUS_00740 86309 85644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038884.1 protein_id gnl|my_center|LOCUS_00740 86746 86306 gene locus_tag LOCUS_00750 86746 86306 CDS product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024537152.1 protein_id gnl|my_center|LOCUS_00750 87486 87172 gene locus_tag LOCUS_00760 87486 87172 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_00760 89315 87552 gene locus_tag LOCUS_00770 89315 87552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626054.1 protein_id gnl|my_center|LOCUS_00770 91077 89299 gene locus_tag LOCUS_00780 91077 89299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388619.1 protein_id gnl|my_center|LOCUS_00780 91872 91087 gene locus_tag LOCUS_00790 91872 91087 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_00790 92096 93079 gene locus_tag LOCUS_00800 92096 93079 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216347.1 protein_id gnl|my_center|LOCUS_00800 93762 93127 gene locus_tag LOCUS_00810 93762 93127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 94819 93827 gene locus_tag LOCUS_00820 94819 93827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 97628 94821 gene locus_tag LOCUS_00830 97628 94821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 98731 97625 gene locus_tag LOCUS_00840 98731 97625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 105061 98741 gene locus_tag LOCUS_00850 105061 98741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 105847 105107 gene locus_tag LOCUS_00860 105847 105107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 107101 105860 gene locus_tag LOCUS_00870 107101 105860 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388621.1 protein_id gnl|my_center|LOCUS_00870 109226 107121 gene locus_tag LOCUS_00880 109226 107121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215916.1 protein_id gnl|my_center|LOCUS_00880 109544 110791 gene locus_tag LOCUS_00890 109544 110791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679773.1 protein_id gnl|my_center|LOCUS_00890 110814 113231 gene locus_tag LOCUS_00900 110814 113231 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_00900 113249 114265 gene locus_tag LOCUS_00910 gene dmeF 113249 114265 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389388.1 protein_id gnl|my_center|LOCUS_00910 114943 114365 gene locus_tag LOCUS_00920 114943 114365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 115135 116229 gene locus_tag LOCUS_00930 115135 116229 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777054.1 protein_id gnl|my_center|LOCUS_00930 116874 116278 gene locus_tag LOCUS_00940 116874 116278 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047143.1 protein_id gnl|my_center|LOCUS_00940 116986 117912 gene locus_tag LOCUS_00950 gene panE 116986 117912 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039051.1 protein_id gnl|my_center|LOCUS_00950 117909 118775 gene locus_tag LOCUS_00960 117909 118775 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970748.1 protein_id gnl|my_center|LOCUS_00960 119552 118842 gene locus_tag LOCUS_00970 gene abaR 119552 118842 CDS product LuxR family transcriptional regulator AbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208103.1 protein_id gnl|my_center|LOCUS_00970 119760 120197 gene locus_tag LOCUS_00980 119760 120197 CDS product DUF4902 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118068.1 protein_id gnl|my_center|LOCUS_00980 120281 120889 gene locus_tag LOCUS_00990 gene abaI 120281 120889 CDS product acyl-homoserine-lactone synthase AbaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208102.1 protein_id gnl|my_center|LOCUS_00990 121317 122033 gene locus_tag LOCUS_01000 121317 122033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 122024 122590 gene locus_tag LOCUS_01010 122024 122590 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209578.1 protein_id gnl|my_center|LOCUS_01010 122583 123284 gene locus_tag LOCUS_01020 122583 123284 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_01020 123722 124213 gene locus_tag LOCUS_01030 123722 124213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence002 281 1426 gene locus_tag LOCUS_01040 281 1426 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337703.1 protein_id gnl|my_center|LOCUS_01040 1440 1607 gene locus_tag LOCUS_01050 1440 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 1825 3081 gene locus_tag LOCUS_01060 1825 3081 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_01060 3074 3781 gene locus_tag LOCUS_01070 gene lolD 3074 3781 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_01070 3829 6315 gene locus_tag LOCUS_01080 3829 6315 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_01080 6424 7344 gene locus_tag LOCUS_01090 6424 7344 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_01090 8306 7362 gene locus_tag LOCUS_01100 gene rsgA 8306 7362 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_01100 9574 8303 gene locus_tag LOCUS_01110 9574 8303 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_01110 9742 10290 gene locus_tag LOCUS_01120 gene orn 9742 10290 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_01120 12082 10424 gene locus_tag LOCUS_01130 12082 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_01130 12495 12277 gene locus_tag LOCUS_01140 gene rpmE 12495 12277 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_01140 12671 13672 gene locus_tag LOCUS_01150 12671 13672 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_01150 13787 14461 gene locus_tag LOCUS_01160 13787 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 14562 15320 gene locus_tag LOCUS_01170 14562 15320 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_01170 15313 15642 gene locus_tag LOCUS_01180 15313 15642 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_01180 15769 16128 gene locus_tag LOCUS_01190 15769 16128 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705754.1 protein_id gnl|my_center|LOCUS_01190 16594 16178 gene locus_tag LOCUS_01200 16594 16178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 16768 17001 gene locus_tag LOCUS_01210 16768 17001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 17477 18478 gene locus_tag LOCUS_01220 17477 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 18696 18992 gene locus_tag LOCUS_01230 18696 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 18989 20398 gene locus_tag LOCUS_01240 18989 20398 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 protein_id gnl|my_center|LOCUS_01240 21325 20747 gene locus_tag LOCUS_01250 21325 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 23947 21767 gene locus_tag LOCUS_01260 23947 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 24807 23923 gene locus_tag LOCUS_01270 24807 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 27578 24810 gene locus_tag LOCUS_01280 gene mksF 27578 24810 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103377.1 protein_id gnl|my_center|LOCUS_01280 28177 27575 gene locus_tag LOCUS_01290 28177 27575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 29430 28174 gene locus_tag LOCUS_01300 gene mksB 29430 28174 CDS product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095037.1 protein_id gnl|my_center|LOCUS_01300 30601 29453 gene locus_tag LOCUS_01310 30601 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 32826 30601 gene locus_tag LOCUS_01320 32826 30601 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_01320 35830 32837 gene locus_tag LOCUS_01330 35830 32837 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263395.1 protein_id gnl|my_center|LOCUS_01330 36988 35834 gene locus_tag LOCUS_01340 36988 35834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 38516 36981 gene locus_tag LOCUS_01350 38516 36981 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263393.1 protein_id gnl|my_center|LOCUS_01350 40000 38504 gene locus_tag LOCUS_01360 40000 38504 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263391.1 protein_id gnl|my_center|LOCUS_01360 40252 41931 gene locus_tag LOCUS_01370 40252 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 41928 43415 gene locus_tag LOCUS_01380 41928 43415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence003 1736 591 gene locus_tag LOCUS_01390 gene wbpZ 1736 591 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_01390 2900 1740 gene locus_tag LOCUS_01400 2900 1740 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_01400 3786 2902 gene locus_tag LOCUS_01410 3786 2902 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266714.1 protein_id gnl|my_center|LOCUS_01410 4833 3796 gene locus_tag LOCUS_01420 gene gmd 4833 3796 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414986.1 protein_id gnl|my_center|LOCUS_01420 5035 5649 gene locus_tag LOCUS_01430 5035 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5646 7421 gene locus_tag LOCUS_01440 5646 7421 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_01440 7456 9201 gene locus_tag LOCUS_01450 7456 9201 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_01450 9262 10605 gene locus_tag LOCUS_01460 9262 10605 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_01460 10608 11960 gene locus_tag LOCUS_01470 10608 11960 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_01470 12071 14023 gene locus_tag LOCUS_01480 12071 14023 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975901.1 protein_id gnl|my_center|LOCUS_01480 14803 14009 gene locus_tag LOCUS_01490 14803 14009 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_01490 15020 15856 gene locus_tag LOCUS_01500 15020 15856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_01500 15858 17081 gene locus_tag LOCUS_01510 15858 17081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419151.1 protein_id gnl|my_center|LOCUS_01510 17078 18133 gene locus_tag LOCUS_01520 17078 18133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18165 19400 gene locus_tag LOCUS_01530 18165 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19397 20791 gene locus_tag LOCUS_01540 19397 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 20829 21824 gene locus_tag LOCUS_01550 20829 21824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_01550 21821 22159 gene locus_tag LOCUS_01560 21821 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 22187 23848 gene locus_tag LOCUS_01570 22187 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 23852 24862 gene locus_tag LOCUS_01580 23852 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 24940 26199 gene locus_tag LOCUS_01590 24940 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 26211 27533 gene locus_tag LOCUS_01600 26211 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 27798 30086 gene locus_tag LOCUS_01610 27798 30086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 30726 31925 gene locus_tag LOCUS_01620 gene ltrA 30726 31925 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_01620 31960 33597 gene locus_tag LOCUS_01630 31960 33597 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_01630 33954 35489 gene locus_tag LOCUS_01640 33954 35489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 35479 36165 gene locus_tag LOCUS_01650 35479 36165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 36162 38519 gene locus_tag LOCUS_01660 36162 38519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 38607 38777 gene locus_tag LOCUS_01670 38607 38777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 39430 38816 gene locus_tag LOCUS_01680 39430 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 40165 39692 gene locus_tag LOCUS_01690 40165 39692 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970310.1 protein_id gnl|my_center|LOCUS_01690 41086 40184 gene locus_tag LOCUS_01700 41086 40184 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084482.1 protein_id gnl|my_center|LOCUS_01700 41437 41090 gene locus_tag LOCUS_01710 41437 41090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668232.1 protein_id gnl|my_center|LOCUS_01710 41667 42920 gene locus_tag LOCUS_01720 41667 42920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 42923 43903 gene locus_tag LOCUS_01730 42923 43903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence004 2692 1598 gene locus_tag LOCUS_01740 2692 1598 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_01740 4694 2757 gene locus_tag LOCUS_01750 4694 2757 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 protein_id gnl|my_center|LOCUS_01750 4910 7021 gene locus_tag LOCUS_01760 4910 7021 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_01760 7177 7251 gene locus_tag LOCUS_t00040 7177 7251 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7357 7998 gene locus_tag LOCUS_01770 7357 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01770 8475 8065 gene locus_tag LOCUS_01780 gene arfB 8475 8065 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_01780 9342 8488 gene locus_tag LOCUS_01790 9342 8488 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_01790 9617 9339 gene locus_tag LOCUS_01800 9617 9339 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_01800 10980 9871 gene locus_tag LOCUS_01810 10980 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13202 10980 gene locus_tag LOCUS_01820 13202 10980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_01820 13348 13199 gene locus_tag LOCUS_01830 13348 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14209 13784 gene locus_tag LOCUS_01840 14209 13784 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_01840 14421 14209 gene locus_tag LOCUS_01850 14421 14209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 17003 14646 gene locus_tag LOCUS_01860 17003 14646 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_01860 17841 17176 gene locus_tag LOCUS_01870 17841 17176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 18115 18645 gene locus_tag LOCUS_01880 18115 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 20424 18853 gene locus_tag LOCUS_01890 20424 18853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 24647 21240 gene locus_tag LOCUS_01900 24647 21240 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_01900 26371 24644 gene locus_tag LOCUS_01910 26371 24644 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_01910 27489 26374 gene locus_tag LOCUS_01920 27489 26374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29024 27486 gene locus_tag LOCUS_01930 29024 27486 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_01930 29337 29951 gene locus_tag LOCUS_01940 29337 29951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 30262 30187 gene locus_tag LOCUS_t00050 30262 30187 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31466 30354 gene locus_tag LOCUS_01950 31466 30354 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_01950 32643 31477 gene locus_tag LOCUS_01960 32643 31477 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809527.1 protein_id gnl|my_center|LOCUS_01960 33145 32654 gene locus_tag LOCUS_01970 gene purE 33145 32654 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_01970 34047 33160 gene locus_tag LOCUS_01980 gene folD 34047 33160 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811948.1 protein_id gnl|my_center|LOCUS_01980 35885 34143 gene locus_tag LOCUS_01990 35885 34143 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951021.1 protein_id gnl|my_center|LOCUS_01990 36678 36025 gene locus_tag LOCUS_02000 gene fixJ 36678 36025 CDS product oxygen response regulator transcription factor FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 protein_id gnl|my_center|LOCUS_02000 39361 36653 gene locus_tag LOCUS_02010 39361 36653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 39563 40825 gene locus_tag LOCUS_02020 39563 40825 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence005 23 1705 gene locus_tag LOCUS_02030 23 1705 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259629.1 protein_id gnl|my_center|LOCUS_02030 1702 2217 gene locus_tag LOCUS_02040 1702 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2195 2605 gene locus_tag LOCUS_02050 2195 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 5457 2692 gene locus_tag LOCUS_02060 5457 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7398 5572 gene locus_tag LOCUS_02070 7398 5572 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_02070 8260 7445 gene locus_tag LOCUS_02080 8260 7445 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_02080 9439 8537 gene locus_tag LOCUS_02090 9439 8537 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808402.1 protein_id gnl|my_center|LOCUS_02090 10897 9587 gene locus_tag LOCUS_02100 gene cfa 10897 9587 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816380.1 protein_id gnl|my_center|LOCUS_02100 11039 13015 gene locus_tag LOCUS_02110 11039 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 13163 13489 gene locus_tag LOCUS_02120 13163 13489 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_02120 13504 14097 gene locus_tag LOCUS_02130 gene recR 13504 14097 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_02130 14298 14891 gene locus_tag LOCUS_02140 gene petA 14298 14891 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064798.1 protein_id gnl|my_center|LOCUS_02140 14895 16163 gene locus_tag LOCUS_02150 14895 16163 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_02150 16160 16915 gene locus_tag LOCUS_02160 16160 16915 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_02160 17023 17619 gene locus_tag LOCUS_02170 17023 17619 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_02170 17684 18127 gene locus_tag LOCUS_02180 17684 18127 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527881.1 protein_id gnl|my_center|LOCUS_02180 18138 18620 gene locus_tag LOCUS_02190 18138 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 19854 18592 gene locus_tag LOCUS_02200 19854 18592 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_02200 20110 21111 gene locus_tag LOCUS_02210 20110 21111 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_02210 21126 22880 gene locus_tag LOCUS_02220 21126 22880 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_02220 24331 22985 gene locus_tag LOCUS_02230 24331 22985 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_02230 24957 24328 gene locus_tag LOCUS_02240 24957 24328 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_02240 25120 25686 gene locus_tag LOCUS_02250 gene pyrR 25120 25686 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_02250 25799 26467 gene locus_tag LOCUS_02260 25799 26467 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_02260 26558 28147 gene locus_tag LOCUS_02270 gene groL 26558 28147 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808619.1 protein_id gnl|my_center|LOCUS_02270 28221 29996 gene locus_tag LOCUS_02280 gene acsA 28221 29996 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862102.1 protein_id gnl|my_center|LOCUS_02280 29993 31012 gene locus_tag LOCUS_02290 gene pdhA 29993 31012 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_02290 31009 31983 gene locus_tag LOCUS_02300 31009 31983 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_02300 31976 33184 gene locus_tag LOCUS_02310 31976 33184 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040687.1 protein_id gnl|my_center|LOCUS_02310 33181 33468 gene locus_tag LOCUS_02320 33181 33468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 33653 34762 gene locus_tag LOCUS_02330 33653 34762 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_02330 34759 35436 gene locus_tag LOCUS_02340 34759 35436 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_02340 37958 35457 gene locus_tag LOCUS_02350 37958 35457 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_02350 38841 38065 gene locus_tag LOCUS_02360 38841 38065 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389258.1 protein_id gnl|my_center|LOCUS_02360 <39656 38838 gene locus_tag LOCUS_02370 <39656 38838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389259.1:biotin-dependent carboxyltransferase family protein >Feature sequence006 1424 99 gene locus_tag LOCUS_02380 1424 99 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_02380 1945 1421 gene locus_tag LOCUS_02390 1945 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3045 2020 gene locus_tag LOCUS_02400 3045 2020 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_02400 4554 3532 gene locus_tag LOCUS_02410 4554 3532 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_02410 5698 4703 gene locus_tag LOCUS_02420 5698 4703 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815513.1 protein_id gnl|my_center|LOCUS_02420 6776 5817 gene locus_tag LOCUS_02430 gene iolG 6776 5817 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193713.1 protein_id gnl|my_center|LOCUS_02430 7630 6776 gene locus_tag LOCUS_02440 7630 6776 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_02440 8100 7633 gene locus_tag LOCUS_02450 8100 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 9017 8103 gene locus_tag LOCUS_02460 9017 8103 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_02460 9826 9137 gene locus_tag LOCUS_02470 9826 9137 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_02470 10866 9841 gene locus_tag LOCUS_02480 10866 9841 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_02480 11957 10863 gene locus_tag LOCUS_02490 11957 10863 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_02490 12161 13060 gene locus_tag LOCUS_02500 12161 13060 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625915.1 protein_id gnl|my_center|LOCUS_02500 13138 13953 gene locus_tag LOCUS_02510 13138 13953 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089202.1 protein_id gnl|my_center|LOCUS_02510 15360 14041 gene locus_tag LOCUS_02520 15360 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 15590 15369 gene locus_tag LOCUS_02530 15590 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 15827 15609 gene locus_tag LOCUS_02540 15827 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 16391 15999 gene locus_tag LOCUS_02550 16391 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 17420 16428 gene locus_tag LOCUS_02560 17420 16428 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392896.1 protein_id gnl|my_center|LOCUS_02560 18007 17540 gene locus_tag LOCUS_02570 18007 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18702 18007 gene locus_tag LOCUS_02580 18702 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 19151 18699 gene locus_tag LOCUS_02590 19151 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20024 19170 gene locus_tag LOCUS_02600 20024 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 22772 20133 gene locus_tag LOCUS_02610 22772 20133 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_02610 23654 22797 gene locus_tag LOCUS_02620 23654 22797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 24375 23665 gene locus_tag LOCUS_02630 24375 23665 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_02630 24811 25608 gene locus_tag LOCUS_02640 gene phnD 24811 25608 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_02640 25605 27056 gene locus_tag LOCUS_02650 25605 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 27040 28395 gene locus_tag LOCUS_02660 gene gnfM 27040 28395 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_02660 28646 29038 gene locus_tag LOCUS_02670 28646 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 29224 29586 gene locus_tag LOCUS_02680 29224 29586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 29583 29945 gene locus_tag LOCUS_02690 29583 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29957 30187 gene locus_tag LOCUS_02700 29957 30187 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_02700 30190 30612 gene locus_tag LOCUS_02710 30190 30612 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250967.1 protein_id gnl|my_center|LOCUS_02710 30737 31819 gene locus_tag LOCUS_02720 30737 31819 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 protein_id gnl|my_center|LOCUS_02720 32048 31972 gene locus_tag LOCUS_t00060 32048 31972 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33121 32096 gene locus_tag LOCUS_02730 gene ispB 33121 32096 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_02730 34244 33165 gene locus_tag LOCUS_02740 gene ugpB 34244 33165 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_02740 34128 34517 gene locus_tag LOCUS_02750 34128 34517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 35607 34555 gene locus_tag LOCUS_02760 35607 34555 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_02760 35808 36902 gene locus_tag LOCUS_02770 gene rlmM 35808 36902 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence007 60 144 gene locus_tag LOCUS_t00070 60 144 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 249 623 gene locus_tag LOCUS_02780 249 623 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_02780 627 1103 gene locus_tag LOCUS_02790 627 1103 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_02790 1118 1723 gene locus_tag LOCUS_02800 1118 1723 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_02800 1716 2969 gene locus_tag LOCUS_02810 1716 2969 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_02810 3068 3547 gene locus_tag LOCUS_02820 gene nuoE 3068 3547 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_02820 3559 4863 gene locus_tag LOCUS_02830 gene nuoF 3559 4863 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_02830 4857 7196 gene locus_tag LOCUS_02840 gene nuoG 4857 7196 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_02840 7196 8245 gene locus_tag LOCUS_02850 gene nuoH 7196 8245 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_02850 8253 8738 gene locus_tag LOCUS_02860 gene nuoI 8253 8738 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_02860 8769 9374 gene locus_tag LOCUS_02870 8769 9374 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_02870 9433 9738 gene locus_tag LOCUS_02880 gene nuoK 9433 9738 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_02880 9751 11772 gene locus_tag LOCUS_02890 gene nuoL 9751 11772 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208277753.1 protein_id gnl|my_center|LOCUS_02890 11858 13339 gene locus_tag LOCUS_02900 11858 13339 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_02900 13383 13697 gene locus_tag LOCUS_02910 13383 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02910 13725 14852 gene locus_tag LOCUS_02920 gene nuoN 13725 14852 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186468.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02920 14961 15524 gene locus_tag LOCUS_02930 14961 15524 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839581.1 protein_id gnl|my_center|LOCUS_02930 15603 17231 gene locus_tag LOCUS_02940 15603 17231 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_02940 17267 17605 gene locus_tag LOCUS_02950 17267 17605 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_02950 18871 17738 gene locus_tag LOCUS_02960 18871 17738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 19830 18880 gene locus_tag LOCUS_02970 gene trxB 19830 18880 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_02970 20624 19953 gene locus_tag LOCUS_02980 20624 19953 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_02980 20897 23185 gene locus_tag LOCUS_02990 20897 23185 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_02990 23182 23844 gene locus_tag LOCUS_03000 gene lolA 23182 23844 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_03000 24064 25431 gene locus_tag LOCUS_03010 24064 25431 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_03010 25666 25403 gene locus_tag LOCUS_03020 25666 25403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 25938 27230 gene locus_tag LOCUS_03030 gene serS 25938 27230 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_03030 28678 27296 gene locus_tag LOCUS_03040 gene mltF 28678 27296 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_03040 28697 29692 gene locus_tag LOCUS_03050 gene nadC 28697 29692 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_03050 29895 29811 gene locus_tag LOCUS_t00080 29895 29811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30176 31711 gene locus_tag LOCUS_03060 30176 31711 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_03060 33318 31768 gene locus_tag LOCUS_03070 33318 31768 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103184.1 protein_id gnl|my_center|LOCUS_03070 34583 33315 gene locus_tag LOCUS_03080 34583 33315 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443933.1 protein_id gnl|my_center|LOCUS_03080 36572 34650 gene locus_tag LOCUS_03090 36572 34650 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_03090 >Feature sequence008 848 84 gene locus_tag LOCUS_03100 848 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 1168 929 gene locus_tag LOCUS_03110 1168 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 1919 1224 gene locus_tag LOCUS_03120 1919 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3468 3046 gene locus_tag LOCUS_03130 3468 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4019 3759 gene locus_tag LOCUS_03140 4019 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4532 4077 gene locus_tag LOCUS_03150 gene merR 4532 4077 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_03150 4605 4955 gene locus_tag LOCUS_03160 4605 4955 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294663.1 protein_id gnl|my_center|LOCUS_03160 4969 5268 gene locus_tag LOCUS_03170 gene merP 4969 5268 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_03170 5272 5523 gene locus_tag LOCUS_03180 gene merF 5272 5523 CDS product mercury resistance system transport protein MerF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_03180 5603 7213 gene locus_tag LOCUS_03190 gene merA 5603 7213 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_03190 8225 7248 gene locus_tag LOCUS_03200 8225 7248 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014387.1 protein_id gnl|my_center|LOCUS_03200 8419 8979 gene locus_tag LOCUS_03210 8419 8979 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 protein_id gnl|my_center|LOCUS_03210 8982 11951 gene locus_tag LOCUS_03220 8982 11951 CDS product Tn3-like element TnAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138014.1 protein_id gnl|my_center|LOCUS_03220 12451 11984 gene locus_tag LOCUS_03230 12451 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 12587 12438 gene locus_tag LOCUS_03240 12587 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 13361 12588 gene locus_tag LOCUS_03250 13361 12588 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_03250 13670 14299 gene locus_tag LOCUS_03260 13670 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 18283 14354 gene locus_tag LOCUS_03270 18283 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18887 18399 gene locus_tag LOCUS_03280 18887 18399 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995946.1 protein_id gnl|my_center|LOCUS_03280 20325 18904 gene locus_tag LOCUS_03290 20325 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 20780 20343 gene locus_tag LOCUS_03300 20780 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 22251 21271 gene locus_tag LOCUS_03310 22251 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 22456 22253 gene locus_tag LOCUS_03320 22456 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 22982 22590 gene locus_tag LOCUS_03330 22982 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 23324 22986 gene locus_tag LOCUS_03340 23324 22986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 25964 23424 gene locus_tag LOCUS_03350 25964 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 26350 25964 gene locus_tag LOCUS_03360 26350 25964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 27355 26846 gene locus_tag LOCUS_03370 27355 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 28034 27360 gene locus_tag LOCUS_03380 28034 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28732 28031 gene locus_tag LOCUS_03390 28732 28031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 28920 28750 gene locus_tag LOCUS_03400 28920 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 29398 28934 gene locus_tag LOCUS_03410 29398 28934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 29762 29424 gene locus_tag LOCUS_03420 29762 29424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 30786 29875 gene locus_tag LOCUS_03430 30786 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 31610 30786 gene locus_tag LOCUS_03440 31610 30786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 31990 31607 gene locus_tag LOCUS_03450 31990 31607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 32669 32577 gene locus_tag LOCUS_t00090 32669 32577 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33958 32732 gene locus_tag LOCUS_03460 33958 32732 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_03460 34214 34510 gene locus_tag LOCUS_03470 34214 34510 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215072.1 protein_id gnl|my_center|LOCUS_03470 35404 34526 gene locus_tag LOCUS_03480 35404 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 35492 35935 gene locus_tag LOCUS_03490 gene queD 35492 35935 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence009 665 589 gene locus_tag LOCUS_t00100 665 589 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 977 735 gene locus_tag LOCUS_03500 977 735 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_03500 1844 1056 gene locus_tag LOCUS_03510 1844 1056 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_03510 2272 1844 gene locus_tag LOCUS_03520 2272 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2448 2269 gene locus_tag LOCUS_03530 2448 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4492 2474 gene locus_tag LOCUS_03540 4492 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5426 4536 gene locus_tag LOCUS_03550 gene cysM 5426 4536 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_03550 6652 5477 gene locus_tag LOCUS_03560 gene lapB 6652 5477 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_03560 6966 6658 gene locus_tag LOCUS_03570 6966 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7341 7054 gene locus_tag LOCUS_03580 7341 7054 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_03580 9056 7353 gene locus_tag LOCUS_03590 gene rpsA 9056 7353 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_03590 11097 9145 gene locus_tag LOCUS_03600 11097 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03600 12082 11195 gene locus_tag LOCUS_03610 12082 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03610 13193 12096 gene locus_tag LOCUS_03620 gene hisC 13193 12096 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_03620 14438 13371 gene locus_tag LOCUS_03630 gene pheA 14438 13371 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_03630 15606 14509 gene locus_tag LOCUS_03640 gene serC 15606 14509 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_03640 18251 15603 gene locus_tag LOCUS_03650 gene gyrA 18251 15603 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926826.1 protein_id gnl|my_center|LOCUS_03650 18482 19081 gene locus_tag LOCUS_03660 gene grpE 18482 19081 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_03660 19240 21156 gene locus_tag LOCUS_03670 gene dnaK 19240 21156 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_03670 21253 22377 gene locus_tag LOCUS_03680 gene dnaJ 21253 22377 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_03680 23031 22540 gene locus_tag LOCUS_03690 23031 22540 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_03690 24471 23086 gene locus_tag LOCUS_03700 gene cysS 24471 23086 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192752.1 protein_id gnl|my_center|LOCUS_03700 24742 25332 gene locus_tag LOCUS_03710 24742 25332 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_03710 25380 25874 gene locus_tag LOCUS_03720 25380 25874 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_03720 25915 26670 gene locus_tag LOCUS_03730 gene lpxH 25915 26670 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_03730 27970 26786 gene locus_tag LOCUS_03740 27970 26786 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_03740 29565 28018 gene locus_tag LOCUS_03750 gene purF 29565 28018 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_03750 30077 29577 gene locus_tag LOCUS_03760 30077 29577 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811815.1 protein_id gnl|my_center|LOCUS_03760 30749 30078 gene locus_tag LOCUS_03770 30749 30078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 32081 30759 gene locus_tag LOCUS_03780 gene folC 32081 30759 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence010 <1 649 gene locus_tag LOCUS_03790 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522936.1:alpha/beta hydrolase 707 1318 gene locus_tag LOCUS_03800 707 1318 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766681.1 protein_id gnl|my_center|LOCUS_03800 1507 1346 gene locus_tag LOCUS_03810 1507 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 1525 4437 gene locus_tag LOCUS_03820 1525 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4561 6186 gene locus_tag LOCUS_03830 4561 6186 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538238.1 protein_id gnl|my_center|LOCUS_03830 6925 6230 gene locus_tag LOCUS_03840 6925 6230 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160341.1 protein_id gnl|my_center|LOCUS_03840 7382 6978 gene locus_tag LOCUS_03850 7382 6978 CDS product flagellar protein FlhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367334.1 protein_id gnl|my_center|LOCUS_03850 7990 7379 gene locus_tag LOCUS_03860 7990 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10284 7993 gene locus_tag LOCUS_03870 10284 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12374 10287 gene locus_tag LOCUS_03880 gene flhA 12374 10287 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811905.1 protein_id gnl|my_center|LOCUS_03880 13555 12371 gene locus_tag LOCUS_03890 gene flhB 13555 12371 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 protein_id gnl|my_center|LOCUS_03890 14383 13712 gene locus_tag LOCUS_03900 gene cheZ 14383 13712 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164477.1 protein_id gnl|my_center|LOCUS_03900 14806 14417 gene locus_tag LOCUS_03910 gene cheY 14806 14417 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_03910 15910 14849 gene locus_tag LOCUS_03920 15910 14849 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811913.1 protein_id gnl|my_center|LOCUS_03920 16851 15907 gene locus_tag LOCUS_03930 16851 15907 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_03930 19079 16848 gene locus_tag LOCUS_03940 19079 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 19666 19169 gene locus_tag LOCUS_03950 gene cheW 19666 19169 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_03950 21825 19663 gene locus_tag LOCUS_03960 21825 19663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 22828 21884 gene locus_tag LOCUS_03970 22828 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 23697 22825 gene locus_tag LOCUS_03980 gene motA 23697 22825 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210888.1 protein_id gnl|my_center|LOCUS_03980 24439 23858 gene locus_tag LOCUS_03990 gene flhC 24439 23858 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_03990 24753 24436 gene locus_tag LOCUS_04000 gene flhD 24753 24436 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_04000 25148 24837 gene locus_tag LOCUS_04010 25148 24837 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_04010 26493 25138 gene locus_tag LOCUS_04020 26493 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 26903 26490 gene locus_tag LOCUS_04030 26903 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 27300 26896 gene locus_tag LOCUS_04040 gene fliS 27300 26896 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211149.1 protein_id gnl|my_center|LOCUS_04040 28804 27380 gene locus_tag LOCUS_04050 gene fliD 28804 27380 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211150.1 protein_id gnl|my_center|LOCUS_04050 30643 28958 gene locus_tag LOCUS_04060 30643 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence011 585 34 gene locus_tag LOCUS_04070 585 34 CDS product STY4534 family ICE replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267041.1 protein_id gnl|my_center|LOCUS_04070 1295 930 gene locus_tag LOCUS_04080 1295 930 CDS product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097141722.1 protein_id gnl|my_center|LOCUS_04080 2158 1361 gene locus_tag LOCUS_04090 2158 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054019012.1 protein_id gnl|my_center|LOCUS_04090 3716 2451 gene locus_tag LOCUS_04100 3716 2451 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073318.1 protein_id gnl|my_center|LOCUS_04100 5019 3787 gene locus_tag LOCUS_04110 5019 3787 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267620.1 protein_id gnl|my_center|LOCUS_04110 5824 5105 gene locus_tag LOCUS_04120 5824 5105 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195790.1 protein_id gnl|my_center|LOCUS_04120 6636 5821 gene locus_tag LOCUS_04130 6636 5821 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_04130 7877 6636 gene locus_tag LOCUS_04140 7877 6636 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388899.1 protein_id gnl|my_center|LOCUS_04140 7989 9476 gene locus_tag LOCUS_04150 7989 9476 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388898.1 protein_id gnl|my_center|LOCUS_04150 10283 9567 gene locus_tag LOCUS_04160 10283 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_04160 10806 10414 gene locus_tag LOCUS_04170 10806 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_04170 13622 11607 gene locus_tag LOCUS_04180 13622 11607 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_04180 14287 13904 gene locus_tag LOCUS_04190 14287 13904 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_04190 14844 14284 gene locus_tag LOCUS_04200 14844 14284 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_04200 15608 14841 gene locus_tag LOCUS_04210 15608 14841 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_04210 17105 15903 gene locus_tag LOCUS_04220 17105 15903 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_04220 17669 17109 gene locus_tag LOCUS_04230 17669 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 19355 17688 gene locus_tag LOCUS_04240 19355 17688 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_04240 19609 19352 gene locus_tag LOCUS_04250 19609 19352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 20456 19593 gene locus_tag LOCUS_04260 20456 19593 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_04260 20711 20496 gene locus_tag LOCUS_04270 20711 20496 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_04270 21125 21718 gene locus_tag LOCUS_04280 21125 21718 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968484.1 protein_id gnl|my_center|LOCUS_04280 21948 22748 gene locus_tag LOCUS_04290 gene cysE 21948 22748 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 protein_id gnl|my_center|LOCUS_04290 22967 23872 gene locus_tag LOCUS_04300 22967 23872 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 protein_id gnl|my_center|LOCUS_04300 24175 25362 gene locus_tag LOCUS_04310 24175 25362 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805048.1 protein_id gnl|my_center|LOCUS_04310 25571 25377 gene locus_tag LOCUS_04320 25571 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 26532 26909 gene locus_tag LOCUS_04330 26532 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 26913 28316 gene locus_tag LOCUS_04340 26913 28316 CDS product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042065.1 protein_id gnl|my_center|LOCUS_04340 30654 28549 gene locus_tag LOCUS_04350 30654 28549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence012 2192 396 gene locus_tag LOCUS_04360 2192 396 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_04360 2368 2943 gene locus_tag LOCUS_04370 2368 2943 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_04370 3723 2953 gene locus_tag LOCUS_04380 3723 2953 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_04380 4537 3737 gene locus_tag LOCUS_04390 4537 3737 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_04390 6291 4639 gene locus_tag LOCUS_04400 6291 4639 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_04400 6973 6335 gene locus_tag LOCUS_04410 6973 6335 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925722.1 protein_id gnl|my_center|LOCUS_04410 7949 7005 gene locus_tag LOCUS_04420 7949 7005 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_04420 8746 7952 gene locus_tag LOCUS_04430 8746 7952 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807131.1 protein_id gnl|my_center|LOCUS_04430 9861 8743 gene locus_tag LOCUS_04440 9861 8743 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_04440 11376 9877 gene locus_tag LOCUS_04450 gene ppx 11376 9877 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_04450 11611 13683 gene locus_tag LOCUS_04460 gene ppk1 11611 13683 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192053.1 protein_id gnl|my_center|LOCUS_04460 15963 13747 gene locus_tag LOCUS_04470 15963 13747 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_04470 16080 16859 gene locus_tag LOCUS_04480 16080 16859 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_04480 17064 17504 gene locus_tag LOCUS_04490 17064 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 18324 17767 gene locus_tag LOCUS_04500 gene thpR 18324 17767 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_04500 18830 18336 gene locus_tag LOCUS_04510 gene ispF 18830 18336 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813893.1 protein_id gnl|my_center|LOCUS_04510 19536 18835 gene locus_tag LOCUS_04520 gene ispD 19536 18835 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_04520 19749 20573 gene locus_tag LOCUS_04530 19749 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04530 20560 21126 gene locus_tag LOCUS_04540 20560 21126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 21183 22304 gene locus_tag LOCUS_04550 gene amrS 21183 22304 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_04550 22530 26072 gene locus_tag LOCUS_04560 gene mfd 22530 26072 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence013 <1 897 gene locus_tag LOCUS_04570 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101174.1:formyltetrahydrofolate deformylase 937 1284 gene locus_tag LOCUS_04580 937 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1272 2498 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttaatccctttgaattcagggcatcagtccggac 2946 2617 gene locus_tag LOCUS_04590 2946 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3743 2937 gene locus_tag LOCUS_04600 3743 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4729 3743 gene locus_tag LOCUS_04610 gene cas1 4729 3743 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546247.1 protein_id gnl|my_center|LOCUS_04610 5017 4733 gene locus_tag LOCUS_04620 gene cas2 5017 4733 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_04620 5633 5139 gene locus_tag LOCUS_04630 5633 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 6670 5726 gene locus_tag LOCUS_04640 gene cas6 6670 5726 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_04640 7827 6691 gene locus_tag LOCUS_04650 7827 6691 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 protein_id gnl|my_center|LOCUS_04650 8171 7875 gene locus_tag LOCUS_04660 gene csx16 8171 7875 CDS product CRISPR-associated protein Csx16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060823.1 protein_id gnl|my_center|LOCUS_04660 9142 8168 gene locus_tag LOCUS_04670 gene rhuM 9142 8168 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_04670 10353 9148 gene locus_tag LOCUS_04680 10353 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 10798 10364 gene locus_tag LOCUS_04690 10798 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11738 10812 gene locus_tag LOCUS_04700 gene cmr4 11738 10812 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_04700 11901 11758 gene locus_tag LOCUS_04710 11901 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13059 11911 gene locus_tag LOCUS_04720 13059 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 16061 13062 gene locus_tag LOCUS_04730 16061 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 17250 16081 gene locus_tag LOCUS_04740 17250 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 18513 17368 gene locus_tag LOCUS_04750 18513 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 19016 18726 gene locus_tag LOCUS_04760 19016 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18903 19223 gene locus_tag LOCUS_04770 18903 19223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 19263 19835 gene locus_tag LOCUS_04780 19263 19835 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705485.1 protein_id gnl|my_center|LOCUS_04780 19930 20871 gene locus_tag LOCUS_04790 19930 20871 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 protein_id gnl|my_center|LOCUS_04790 20888 22894 gene locus_tag LOCUS_04800 20888 22894 CDS product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_04800 24310 22967 gene locus_tag LOCUS_04810 24310 22967 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 protein_id gnl|my_center|LOCUS_04810 24662 24324 gene locus_tag LOCUS_04820 24662 24324 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_04820 25400 24690 gene locus_tag LOCUS_04830 25400 24690 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_04830 25674 25931 gene locus_tag LOCUS_04840 25674 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence014 1364 2725 gene locus_tag LOCUS_04850 1364 2725 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 protein_id gnl|my_center|LOCUS_04850 2910 3179 gene locus_tag LOCUS_04860 2910 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4547 3213 gene locus_tag LOCUS_04870 4547 3213 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_04870 4728 5402 gene locus_tag LOCUS_04880 4728 5402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812762.1 protein_id gnl|my_center|LOCUS_04880 5386 6825 gene locus_tag LOCUS_04890 5386 6825 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_04890 8478 6886 gene locus_tag LOCUS_04900 8478 6886 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_04900 8933 8625 gene locus_tag LOCUS_04910 8933 8625 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 protein_id gnl|my_center|LOCUS_04910 10134 9079 gene locus_tag LOCUS_04920 10134 9079 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_04920 11986 10295 gene locus_tag LOCUS_04930 gene ubiB 11986 10295 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04930 12303 13586 gene locus_tag LOCUS_04940 12303 13586 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853227.1 protein_id gnl|my_center|LOCUS_04940 13583 15388 gene locus_tag LOCUS_04950 13583 15388 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_04950 15385 16104 gene locus_tag LOCUS_04960 gene hoxU 15385 16104 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_04960 16101 16643 gene locus_tag LOCUS_04970 16101 16643 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_04970 16724 18196 gene locus_tag LOCUS_04980 16724 18196 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04980 18207 18725 gene locus_tag LOCUS_04990 18207 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 20775 18772 gene locus_tag LOCUS_05000 20775 18772 CDS product bifunctional anthranilate synthase component I family protein/class IV aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225844.1 protein_id gnl|my_center|LOCUS_05000 22301 20895 gene locus_tag LOCUS_05010 gene radA 22301 20895 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_05010 23197 22310 gene locus_tag LOCUS_05020 23197 22310 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_05020 23460 24713 gene locus_tag LOCUS_05030 gene lplT 23460 24713 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_05030 25759 24821 gene locus_tag LOCUS_05040 25759 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 26220 25756 gene locus_tag LOCUS_05050 gene rimI 26220 25756 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence015 9 1232 gene locus_tag LOCUS_05060 9 1232 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973796.1 protein_id gnl|my_center|LOCUS_05060 2956 1229 gene locus_tag LOCUS_05070 2956 1229 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388726.1 protein_id gnl|my_center|LOCUS_05070 3702 2953 gene locus_tag LOCUS_05080 3702 2953 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626068.1 protein_id gnl|my_center|LOCUS_05080 4787 3699 gene locus_tag LOCUS_05090 4787 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4975 5367 gene locus_tag LOCUS_05100 4975 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 7683 5371 gene locus_tag LOCUS_05110 7683 5371 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086220.1 protein_id gnl|my_center|LOCUS_05110 7918 7721 gene locus_tag LOCUS_05120 7918 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8403 7915 gene locus_tag LOCUS_05130 8403 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8855 8463 gene locus_tag LOCUS_05140 8855 8463 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_05140 10892 8922 gene locus_tag LOCUS_05150 10892 8922 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_05150 13056 11041 gene locus_tag LOCUS_05160 13056 11041 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_05160 15400 13181 gene locus_tag LOCUS_05170 gene recD 15400 13181 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103277.1 protein_id gnl|my_center|LOCUS_05170 19317 15397 gene locus_tag LOCUS_05180 gene recB 19317 15397 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115861.1 protein_id gnl|my_center|LOCUS_05180 23122 19307 gene locus_tag LOCUS_05190 gene recC 23122 19307 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_05190 23310 23846 gene locus_tag LOCUS_05200 23310 23846 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_05200 23878 24438 gene locus_tag LOCUS_05210 23878 24438 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_05210 24494 25072 gene locus_tag LOCUS_05220 24494 25072 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence016 2466 1003 gene locus_tag LOCUS_05230 gene guaB 2466 1003 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_05230 3030 2698 gene locus_tag LOCUS_05240 3030 2698 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_05240 3464 3027 gene locus_tag LOCUS_05250 3464 3027 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_05250 3596 4042 gene locus_tag LOCUS_05260 gene smpB 3596 4042 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_05260 4618 4046 gene locus_tag LOCUS_05270 4618 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4779 5186 gene locus_tag LOCUS_05280 4779 5186 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_05280 5957 5232 gene locus_tag LOCUS_05290 5957 5232 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192421.1 protein_id gnl|my_center|LOCUS_05290 7903 5954 gene locus_tag LOCUS_05300 7903 5954 CDS product type IV pili methyl-accepting chemotaxis transducer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 protein_id gnl|my_center|LOCUS_05300 8719 8015 gene locus_tag LOCUS_05310 gene narI 8719 8015 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096512.1 protein_id gnl|my_center|LOCUS_05310 9278 8730 gene locus_tag LOCUS_05320 9278 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10863 9295 gene locus_tag LOCUS_05330 gene narH 10863 9295 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524710.1 protein_id gnl|my_center|LOCUS_05330 14756 11001 gene locus_tag LOCUS_05340 14756 11001 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193149.1 protein_id gnl|my_center|LOCUS_05340 16489 14825 gene locus_tag LOCUS_05350 16489 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 17785 16523 gene locus_tag LOCUS_05360 17785 16523 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193983.1 protein_id gnl|my_center|LOCUS_05360 18805 18044 gene locus_tag LOCUS_05370 18805 18044 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_05370 20554 18965 gene locus_tag LOCUS_05380 20554 18965 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_05380 22190 20700 gene locus_tag LOCUS_05390 22190 20700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810154.1 protein_id gnl|my_center|LOCUS_05390 23176 22199 gene locus_tag LOCUS_05400 23176 22199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_05400 25419 23176 gene locus_tag LOCUS_05410 25419 23176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence017 262 1683 gene locus_tag LOCUS_05420 gene boxB 262 1683 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_05420 1793 3043 gene locus_tag LOCUS_05430 1793 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4792 3209 gene locus_tag LOCUS_05440 4792 3209 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_05440 5080 5991 gene locus_tag LOCUS_05450 5080 5991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083896.1 protein_id gnl|my_center|LOCUS_05450 6031 6639 gene locus_tag LOCUS_05460 6031 6639 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979815.1 protein_id gnl|my_center|LOCUS_05460 7432 6884 gene locus_tag LOCUS_05470 7432 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7723 8754 gene locus_tag LOCUS_05480 7723 8754 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_05480 8967 10295 gene locus_tag LOCUS_05490 8967 10295 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543370.1 protein_id gnl|my_center|LOCUS_05490 11503 10283 gene locus_tag LOCUS_05500 11503 10283 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111432.1 protein_id gnl|my_center|LOCUS_05500 13329 11569 gene locus_tag LOCUS_05510 gene ngg 13329 11569 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969277.1 protein_id gnl|my_center|LOCUS_05510 15112 13340 gene locus_tag LOCUS_05520 15112 13340 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389742.1 protein_id gnl|my_center|LOCUS_05520 17106 15298 gene locus_tag LOCUS_05530 17106 15298 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821527.1 protein_id gnl|my_center|LOCUS_05530 17903 17136 gene locus_tag LOCUS_05540 17903 17136 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_05540 19184 17925 gene locus_tag LOCUS_05550 19184 17925 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267920.1 protein_id gnl|my_center|LOCUS_05550 19957 19181 gene locus_tag LOCUS_05560 19957 19181 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312496.1 protein_id gnl|my_center|LOCUS_05560 21840 19975 gene locus_tag LOCUS_05570 21840 19975 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921377.1 protein_id gnl|my_center|LOCUS_05570 23015 21870 gene locus_tag LOCUS_05580 23015 21870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_05580 23341 24243 gene locus_tag LOCUS_05590 23341 24243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 25205 24240 gene locus_tag LOCUS_05600 25205 24240 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089137.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence018 1662 754 gene locus_tag LOCUS_05610 1662 754 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_05610 1919 1659 gene locus_tag LOCUS_05620 1919 1659 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221918.1 protein_id gnl|my_center|LOCUS_05620 2049 3176 gene locus_tag LOCUS_05630 2049 3176 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_05630 3536 3210 gene locus_tag LOCUS_05640 3536 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4600 3662 gene locus_tag LOCUS_05650 gene ispH 4600 3662 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_05650 5083 4655 gene locus_tag LOCUS_05660 5083 4655 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186190.1 protein_id gnl|my_center|LOCUS_05660 5626 5105 gene locus_tag LOCUS_05670 gene lspA 5626 5105 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_05670 8429 5619 gene locus_tag LOCUS_05680 gene ileS 8429 5619 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 protein_id gnl|my_center|LOCUS_05680 9413 8469 gene locus_tag LOCUS_05690 9413 8469 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_05690 10909 9542 gene locus_tag LOCUS_05700 10909 9542 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_05700 11379 10849 gene locus_tag LOCUS_05710 gene tsaE 11379 10849 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218833.1 protein_id gnl|my_center|LOCUS_05710 11395 12543 gene locus_tag LOCUS_05720 gene queG 11395 12543 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550792.1 protein_id gnl|my_center|LOCUS_05720 12574 12774 gene locus_tag LOCUS_05730 12574 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 12768 13328 gene locus_tag LOCUS_05740 12768 13328 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403541.1 protein_id gnl|my_center|LOCUS_05740 13490 14938 gene locus_tag LOCUS_05750 13490 14938 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_05750 15511 15215 gene locus_tag LOCUS_05760 15511 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 16013 15603 gene locus_tag LOCUS_05770 16013 15603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 16868 16107 gene locus_tag LOCUS_05780 16868 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 17498 16902 gene locus_tag LOCUS_05790 17498 16902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18819 18433 gene locus_tag LOCUS_05800 18819 18433 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814185.1 protein_id gnl|my_center|LOCUS_05800 20906 18933 gene locus_tag LOCUS_05810 20906 18933 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_05810 21302 20958 gene locus_tag LOCUS_05820 21302 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 21400 22551 gene locus_tag LOCUS_05830 21400 22551 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_05830 22622 22990 gene locus_tag LOCUS_05840 22622 22990 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808610.1 protein_id gnl|my_center|LOCUS_05840 23601 23026 gene locus_tag LOCUS_05850 23601 23026 CDS product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418984.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence019 2805 1954 gene locus_tag LOCUS_05860 2805 1954 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_05860 3533 2802 gene locus_tag LOCUS_05870 3533 2802 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_05870 4889 3696 gene locus_tag LOCUS_05880 4889 3696 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390308.1 protein_id gnl|my_center|LOCUS_05880 6051 5020 gene locus_tag LOCUS_05890 gene murB 6051 5020 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930965.1 protein_id gnl|my_center|LOCUS_05890 6521 6048 gene locus_tag LOCUS_05900 6521 6048 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061370.1 protein_id gnl|my_center|LOCUS_05900 8333 6711 gene locus_tag LOCUS_05910 8333 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8646 9968 gene locus_tag LOCUS_05920 8646 9968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_05920 10848 9907 gene locus_tag LOCUS_05930 10848 9907 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306982.1 protein_id gnl|my_center|LOCUS_05930 11039 11968 gene locus_tag LOCUS_05940 11039 11968 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_05940 15113 12027 gene locus_tag LOCUS_05950 15113 12027 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123023.1 protein_id gnl|my_center|LOCUS_05950 15356 16366 gene locus_tag LOCUS_05960 15356 16366 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244151.1 protein_id gnl|my_center|LOCUS_05960 16511 17389 gene locus_tag LOCUS_05970 gene cysT 16511 17389 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 protein_id gnl|my_center|LOCUS_05970 17391 18299 gene locus_tag LOCUS_05980 gene cysW 17391 18299 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_05980 18296 19432 gene locus_tag LOCUS_05990 18296 19432 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704575.1 protein_id gnl|my_center|LOCUS_05990 19429 20358 gene locus_tag LOCUS_06000 19429 20358 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118601.1 protein_id gnl|my_center|LOCUS_06000 21347 20280 gene locus_tag LOCUS_06010 21347 20280 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109658674.1 protein_id gnl|my_center|LOCUS_06010 21530 22381 gene locus_tag LOCUS_06020 21530 22381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407292.1 protein_id gnl|my_center|LOCUS_06020 23757 22447 gene locus_tag LOCUS_06030 23757 22447 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 protein_id gnl|my_center|LOCUS_06030 24189 23809 gene locus_tag LOCUS_06040 24189 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence020 299 117 gene locus_tag LOCUS_06050 299 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 573 1061 gene locus_tag LOCUS_06060 573 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1055 1228 gene locus_tag LOCUS_06070 1055 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1746 1324 gene locus_tag LOCUS_06080 1746 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2522 1749 gene locus_tag LOCUS_06090 2522 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2553 2765 gene locus_tag LOCUS_06100 2553 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4230 2944 gene locus_tag LOCUS_06110 4230 2944 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065159.1 protein_id gnl|my_center|LOCUS_06110 4518 4270 gene locus_tag LOCUS_06120 4518 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5231 4521 gene locus_tag LOCUS_06130 5231 4521 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_06130 7044 5251 gene locus_tag LOCUS_06140 gene sdhA 7044 5251 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_06140 7394 7047 gene locus_tag LOCUS_06150 gene sdhD 7394 7047 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_06150 7777 7388 gene locus_tag LOCUS_06160 gene sdhC 7777 7388 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_06160 8605 7877 gene locus_tag LOCUS_06170 8605 7877 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_06170 8834 9826 gene locus_tag LOCUS_06180 8834 9826 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_06180 9956 10963 gene locus_tag LOCUS_06190 9956 10963 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_06190 11307 11756 gene locus_tag LOCUS_06200 gene gspG 11307 11756 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 protein_id gnl|my_center|LOCUS_06200 11782 12996 gene locus_tag LOCUS_06210 11782 12996 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_06210 12993 14723 gene locus_tag LOCUS_06220 12993 14723 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_06220 14704 15501 gene locus_tag LOCUS_06230 14704 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 15515 16039 gene locus_tag LOCUS_06240 15515 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 16036 16587 gene locus_tag LOCUS_06250 16036 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 16584 17087 gene locus_tag LOCUS_06260 16584 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 17084 19069 gene locus_tag LOCUS_06270 17084 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 19066 19578 gene locus_tag LOCUS_06280 19066 19578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 19589 19972 gene locus_tag LOCUS_06290 19589 19972 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_06290 19978 20604 gene locus_tag LOCUS_06300 19978 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 20606 21364 gene locus_tag LOCUS_06310 20606 21364 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence021 1202 828 gene locus_tag LOCUS_06320 1202 828 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_06320 1327 2379 gene locus_tag LOCUS_06330 1327 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3750 2482 gene locus_tag LOCUS_06340 3750 2482 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_06340 3998 3756 gene locus_tag LOCUS_06350 3998 3756 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_06350 6094 4163 gene locus_tag LOCUS_06360 6094 4163 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_06360 7308 6277 gene locus_tag LOCUS_06370 7308 6277 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_06370 8249 7305 gene locus_tag LOCUS_06380 8249 7305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268560.1 protein_id gnl|my_center|LOCUS_06380 10203 8263 gene locus_tag LOCUS_06390 10203 8263 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975430.1 protein_id gnl|my_center|LOCUS_06390 10432 12177 gene locus_tag LOCUS_06400 10432 12177 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_06400 12180 12953 gene locus_tag LOCUS_06410 12180 12953 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776623.1 protein_id gnl|my_center|LOCUS_06410 13051 14481 gene locus_tag LOCUS_06420 13051 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 15135 14506 gene locus_tag LOCUS_06430 15135 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762975.1 protein_id gnl|my_center|LOCUS_06430 15243 17030 gene locus_tag LOCUS_06440 gene msbA 15243 17030 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_06440 17738 17058 gene locus_tag LOCUS_06450 17738 17058 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104989.1 protein_id gnl|my_center|LOCUS_06450 18433 17729 gene locus_tag LOCUS_06460 18433 17729 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405955.1 protein_id gnl|my_center|LOCUS_06460 19112 18618 gene locus_tag LOCUS_06470 19112 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 19283 19699 gene locus_tag LOCUS_06480 19283 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 19723 20214 gene locus_tag LOCUS_06490 19723 20214 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_06490 20226 21554 gene locus_tag LOCUS_06500 20226 21554 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence022 6837 454 gene locus_tag LOCUS_06510 6837 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 7586 6858 gene locus_tag LOCUS_06520 7586 6858 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626143.1 protein_id gnl|my_center|LOCUS_06520 7868 9469 gene locus_tag LOCUS_06530 7868 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9456 10931 gene locus_tag LOCUS_06540 gene scfB 9456 10931 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_06540 10928 11251 gene locus_tag LOCUS_06550 10928 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11266 12402 gene locus_tag LOCUS_06560 11266 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13031 12522 gene locus_tag LOCUS_06570 13031 12522 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311692.1 protein_id gnl|my_center|LOCUS_06570 13718 13311 gene locus_tag LOCUS_06580 13718 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 15869 13773 gene locus_tag LOCUS_06590 15869 13773 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792925.1 protein_id gnl|my_center|LOCUS_06590 17245 15911 gene locus_tag LOCUS_06600 gene paaF 17245 15911 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064014.1 protein_id gnl|my_center|LOCUS_06600 18590 17238 gene locus_tag LOCUS_06610 18590 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 19857 18601 gene locus_tag LOCUS_06620 19857 18601 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_06620 21118 19868 gene locus_tag LOCUS_06630 21118 19868 CDS product pyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391921.1 protein_id gnl|my_center|LOCUS_06630 21491 21189 gene locus_tag LOCUS_06640 21491 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence023 486 1781 gene locus_tag LOCUS_06650 gene hisS 486 1781 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_06650 1781 2431 gene locus_tag LOCUS_06660 1781 2431 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_06660 2435 3577 gene locus_tag LOCUS_06670 gene bamB 2435 3577 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_06670 3591 4919 gene locus_tag LOCUS_06680 gene der 3591 4919 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_06680 5031 5267 gene locus_tag LOCUS_06690 gene hfq 5031 5267 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_06690 5319 6464 gene locus_tag LOCUS_06700 gene hflX 5319 6464 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_06700 6479 7774 gene locus_tag LOCUS_06710 gene hflK 6479 7774 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_06710 7774 8655 gene locus_tag LOCUS_06720 gene hflC 7774 8655 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_06720 8663 8848 gene locus_tag LOCUS_06730 8663 8848 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_06730 8866 10023 gene locus_tag LOCUS_06740 8866 10023 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_06740 10028 11338 gene locus_tag LOCUS_06750 10028 11338 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193462.1 protein_id gnl|my_center|LOCUS_06750 11617 11533 gene locus_tag LOCUS_t00110 11617 11533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11873 11789 gene locus_tag LOCUS_t00120 11873 11789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11913 14909 gene locus_tag LOCUS_06760 11913 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 14902 15654 gene locus_tag LOCUS_06770 gene rlmB 14902 15654 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_06770 16040 16780 gene locus_tag LOCUS_06780 gene bluB 16040 16780 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_06780 17030 19528 gene locus_tag LOCUS_06790 gene nirB 17030 19528 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 protein_id gnl|my_center|LOCUS_06790 19539 19892 gene locus_tag LOCUS_06800 gene nirD 19539 19892 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_06800 20038 21252 gene locus_tag LOCUS_06810 20038 21252 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265576.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence024 568 296 gene locus_tag LOCUS_06820 568 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 754 1815 gene locus_tag LOCUS_06830 gene alr 754 1815 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 protein_id gnl|my_center|LOCUS_06830 3065 1845 gene locus_tag LOCUS_06840 3065 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3652 3062 gene locus_tag LOCUS_06850 3652 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4235 3642 gene locus_tag LOCUS_06860 4235 3642 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_06860 6238 4256 gene locus_tag LOCUS_06870 6238 4256 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_06870 6683 6240 gene locus_tag LOCUS_06880 gene ccmE 6683 6240 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_06880 6907 6680 gene locus_tag LOCUS_06890 6907 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7683 6907 gene locus_tag LOCUS_06900 gene ccmC 7683 6907 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_06900 8416 7748 gene locus_tag LOCUS_06910 gene ccmB 8416 7748 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982362.1 protein_id gnl|my_center|LOCUS_06910 9036 8410 gene locus_tag LOCUS_06920 gene ccmA 9036 8410 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_06920 9835 9215 gene locus_tag LOCUS_06930 gene napC 9835 9215 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_06930 10311 9859 gene locus_tag LOCUS_06940 10311 9859 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 protein_id gnl|my_center|LOCUS_06940 11243 10308 gene locus_tag LOCUS_06950 gene napH 11243 10308 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_06950 12115 11240 gene locus_tag LOCUS_06960 gene napG 12115 11240 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_06960 14729 12186 gene locus_tag LOCUS_06970 gene napA 14729 12186 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_06970 14985 14731 gene locus_tag LOCUS_06980 14985 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 15515 14982 gene locus_tag LOCUS_06990 gene napF 15515 14982 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 protein_id gnl|my_center|LOCUS_06990 16285 15641 gene locus_tag LOCUS_07000 gene narL 16285 15641 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_07000 18260 16362 gene locus_tag LOCUS_07010 gene narX 18260 16362 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_07010 18520 19209 gene locus_tag LOCUS_07020 18520 19209 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_07020 20659 19238 gene locus_tag LOCUS_07030 20659 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 20999 20811 gene locus_tag LOCUS_07040 20999 20811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence025 <1 1926 gene locus_tag LOCUS_07050 <1 1926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:retention module-containing protein 2056 2385 gene locus_tag LOCUS_07060 2056 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4326 2392 gene locus_tag LOCUS_07070 4326 2392 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 protein_id gnl|my_center|LOCUS_07070 5092 4376 gene locus_tag LOCUS_07080 5092 4376 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_07080 5311 6750 gene locus_tag LOCUS_07090 5311 6750 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_07090 7185 6808 gene locus_tag LOCUS_07100 7185 6808 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 protein_id gnl|my_center|LOCUS_07100 7367 8674 gene locus_tag LOCUS_07110 7367 8674 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706614.1 protein_id gnl|my_center|LOCUS_07110 9456 8710 gene locus_tag LOCUS_07120 9456 8710 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039419.1 protein_id gnl|my_center|LOCUS_07120 9643 11808 gene locus_tag LOCUS_07130 gene scpA 9643 11808 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_07130 11808 12791 gene locus_tag LOCUS_07140 gene meaB 11808 12791 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_07140 12847 14379 gene locus_tag LOCUS_07150 12847 14379 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_07150 14517 16508 gene locus_tag LOCUS_07160 14517 16508 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_07160 16973 18385 gene locus_tag LOCUS_07170 16973 18385 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_07170 18986 18510 gene locus_tag LOCUS_07180 18986 18510 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_07180 19204 19674 gene locus_tag LOCUS_07190 19204 19674 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087013.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence026 966 238 gene locus_tag LOCUS_07200 gene dnaQ 966 238 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_07200 1448 987 gene locus_tag LOCUS_07210 gene rnhA 1448 987 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_07210 2177 1449 gene locus_tag LOCUS_07220 2177 1449 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_07220 2205 2978 gene locus_tag LOCUS_07230 gene gloB 2205 2978 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526568.1 protein_id gnl|my_center|LOCUS_07230 2989 4377 gene locus_tag LOCUS_07240 2989 4377 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_07240 6657 4378 gene locus_tag LOCUS_07250 6657 4378 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_07250 7111 6626 gene locus_tag LOCUS_07260 7111 6626 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_07260 7583 7086 gene locus_tag LOCUS_07270 gene bcp 7583 7086 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_07270 7906 8514 gene locus_tag LOCUS_07280 gene lexA 7906 8514 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_07280 8519 9076 gene locus_tag LOCUS_07290 8519 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10919 9117 gene locus_tag LOCUS_07300 10919 9117 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_07300 11238 12107 gene locus_tag LOCUS_07310 11238 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12243 12632 gene locus_tag LOCUS_07320 12243 12632 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583114.1 protein_id gnl|my_center|LOCUS_07320 12647 13852 gene locus_tag LOCUS_07330 12647 13852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 13872 16448 gene locus_tag LOCUS_07340 13872 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 16668 17447 gene locus_tag LOCUS_07350 16668 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 17639 18067 gene locus_tag LOCUS_07360 17639 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 18254 18760 gene locus_tag LOCUS_07370 18254 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 18924 19496 gene locus_tag LOCUS_07380 18924 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 20015 19614 gene locus_tag LOCUS_07390 20015 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 20195 20734 gene locus_tag LOCUS_07400 20195 20734 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 protein_id gnl|my_center|LOCUS_07400 21194 20919 gene locus_tag LOCUS_07410 21194 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence027 328 630 gene locus_tag LOCUS_07420 328 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042066.1 protein_id gnl|my_center|LOCUS_07420 888 1508 gene locus_tag LOCUS_07430 888 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1592 1873 gene locus_tag LOCUS_07440 1592 1873 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 protein_id gnl|my_center|LOCUS_07440 1870 2391 gene locus_tag LOCUS_07450 1870 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_07450 2796 2485 gene locus_tag LOCUS_07460 2796 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3100 2774 gene locus_tag LOCUS_07470 3100 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4152 3112 gene locus_tag LOCUS_07480 4152 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4306 4139 gene locus_tag LOCUS_07490 4306 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4533 4306 gene locus_tag LOCUS_07500 4533 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5135 4533 gene locus_tag LOCUS_07510 5135 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5776 5252 gene locus_tag LOCUS_07520 5776 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8766 5773 gene locus_tag LOCUS_07530 8766 5773 CDS product DotA/TraY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491837.1 protein_id gnl|my_center|LOCUS_07530 9108 8770 gene locus_tag LOCUS_07540 9108 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 9603 12785 gene locus_tag LOCUS_07550 gene traA 9603 12785 CDS product Ti-type conjugative transfer relaxase TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726897.1 protein_id gnl|my_center|LOCUS_07550 12788 12982 gene locus_tag LOCUS_07560 12788 12982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 12979 13332 gene locus_tag LOCUS_07570 12979 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 13859 13341 gene locus_tag LOCUS_07580 13859 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 13945 14394 gene locus_tag LOCUS_07590 13945 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 14391 14687 gene locus_tag LOCUS_07600 14391 14687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 15266 14919 gene locus_tag LOCUS_07610 15266 14919 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217440.1 protein_id gnl|my_center|LOCUS_07610 15511 15266 gene locus_tag LOCUS_07620 15511 15266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 15768 15852 gene locus_tag LOCUS_t00130 15768 15852 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16243 15965 gene locus_tag LOCUS_07630 16243 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 16439 16218 gene locus_tag LOCUS_07640 16439 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 17704 16643 gene locus_tag LOCUS_07650 17704 16643 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_07650 17970 18800 gene locus_tag LOCUS_07660 17970 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 19163 18900 gene locus_tag LOCUS_07670 19163 18900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 19468 19274 gene locus_tag LOCUS_07680 19468 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence028 3 731 gene locus_tag LOCUS_07690 3 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 818 893 gene locus_tag LOCUS_t00140 818 893 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 955 1030 gene locus_tag LOCUS_t00150 955 1030 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1122 1970 gene locus_tag LOCUS_07700 gene fghA 1122 1970 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027907389.1 protein_id gnl|my_center|LOCUS_07700 2185 1943 gene locus_tag LOCUS_07710 2185 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2103 2327 gene locus_tag LOCUS_07720 2103 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2329 2946 gene locus_tag LOCUS_07730 2329 2946 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_07730 3155 4396 gene locus_tag LOCUS_07740 3155 4396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103683.1 protein_id gnl|my_center|LOCUS_07740 6899 4374 gene locus_tag LOCUS_07750 6899 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7790 7059 gene locus_tag LOCUS_07760 7790 7059 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083849.1 protein_id gnl|my_center|LOCUS_07760 8042 9001 gene locus_tag LOCUS_07770 8042 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 9196 9792 gene locus_tag LOCUS_07780 9196 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12248 9819 gene locus_tag LOCUS_07790 12248 9819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_07790 12452 13540 gene locus_tag LOCUS_07800 gene moaA 12452 13540 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064345.1 protein_id gnl|my_center|LOCUS_07800 13840 14997 gene locus_tag LOCUS_07810 gene ribA 13840 14997 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_07810 15328 15047 gene locus_tag LOCUS_07820 15328 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 16597 15404 gene locus_tag LOCUS_07830 16597 15404 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_07830 19182 16687 gene locus_tag LOCUS_07840 19182 16687 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_07840 <19989 19182 gene locus_tag LOCUS_07850 <19989 19182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390621.1:M20 aminoacylase family protein >Feature sequence029 <1 2139 gene locus_tag LOCUS_07860 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038150.1:glucosylglycerol-phosphate synthase 2183 3010 gene locus_tag LOCUS_07870 gene mscS 2183 3010 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_07870 5236 3032 gene locus_tag LOCUS_07880 5236 3032 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_07880 5560 11301 gene locus_tag LOCUS_07890 5560 11301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11450 12070 gene locus_tag LOCUS_07900 11450 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 12075 13295 gene locus_tag LOCUS_07910 12075 13295 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_07910 13336 14280 gene locus_tag LOCUS_07920 13336 14280 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_07920 14809 14291 gene locus_tag LOCUS_07930 14809 14291 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_07930 15804 14887 gene locus_tag LOCUS_07940 15804 14887 CDS product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001670736.1 protein_id gnl|my_center|LOCUS_07940 <19445 15818 gene locus_tag LOCUS_07950 <19445 15818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931556.1:methionine synthase >Feature sequence030 489 1556 gene locus_tag LOCUS_07960 gene ribD 489 1556 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186140.1 protein_id gnl|my_center|LOCUS_07960 2320 1565 gene locus_tag LOCUS_07970 gene moeB 2320 1565 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_07970 2776 2327 gene locus_tag LOCUS_07980 2776 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4178 2796 gene locus_tag LOCUS_07990 gene cptA 4178 2796 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_07990 5547 4225 gene locus_tag LOCUS_08000 5547 4225 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_08000 5841 6164 gene locus_tag LOCUS_08010 5841 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6229 6645 gene locus_tag LOCUS_08020 6229 6645 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_08020 6648 6917 gene locus_tag LOCUS_08030 gene grxC 6648 6917 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_08030 7043 7507 gene locus_tag LOCUS_08040 gene secB 7043 7507 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_08040 7518 7997 gene locus_tag LOCUS_08050 7518 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7994 8983 gene locus_tag LOCUS_08060 7994 8983 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_08060 9465 8995 gene locus_tag LOCUS_08070 gene trmL 9465 8995 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_08070 10324 9602 gene locus_tag LOCUS_08080 10324 9602 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526022.1 protein_id gnl|my_center|LOCUS_08080 10543 10358 gene locus_tag LOCUS_08090 10543 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 10463 11371 gene locus_tag LOCUS_08100 gene bioB 10463 11371 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200336.1 protein_id gnl|my_center|LOCUS_08100 11383 12327 gene locus_tag LOCUS_08110 11383 12327 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_08110 12452 13099 gene locus_tag LOCUS_08120 12452 13099 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_08120 14239 13223 gene locus_tag LOCUS_08130 gene hemB 14239 13223 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687809.1 protein_id gnl|my_center|LOCUS_08130 15213 14497 gene locus_tag LOCUS_08140 gene yihA 15213 14497 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_08140 15333 15962 gene locus_tag LOCUS_08150 15333 15962 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_08150 16030 17277 gene locus_tag LOCUS_08160 16030 17277 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930370.1 protein_id gnl|my_center|LOCUS_08160 17311 17982 gene locus_tag LOCUS_08170 gene rpiA 17311 17982 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_08170 18103 18810 gene locus_tag LOCUS_08180 gene phoU 18103 18810 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_08180 19191 18919 gene locus_tag LOCUS_08190 19191 18919 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence031 699 1025 gene locus_tag LOCUS_08200 699 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1119 3746 gene locus_tag LOCUS_08210 gene leuS 1119 3746 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_08210 3757 4347 gene locus_tag LOCUS_08220 gene lptE 3757 4347 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_08220 4370 5380 gene locus_tag LOCUS_08230 gene holA 4370 5380 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_08230 5424 6743 gene locus_tag LOCUS_08240 5424 6743 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_08240 6744 7256 gene locus_tag LOCUS_08250 6744 7256 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_08250 7253 8272 gene locus_tag LOCUS_08260 gene xerD 7253 8272 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535956.1 protein_id gnl|my_center|LOCUS_08260 8345 8833 gene locus_tag LOCUS_08270 gene ybaK 8345 8833 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_08270 9016 9375 gene locus_tag LOCUS_08280 9016 9375 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383915.1 protein_id gnl|my_center|LOCUS_08280 9830 9456 gene locus_tag LOCUS_08290 9830 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9982 10578 gene locus_tag LOCUS_08300 gene plsY 9982 10578 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_08300 11715 10681 gene locus_tag LOCUS_08310 gene tsaD 11715 10681 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_08310 11852 12064 gene locus_tag LOCUS_08320 gene rpsU 11852 12064 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_08320 12210 14072 gene locus_tag LOCUS_08330 gene dnaG 12210 14072 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063924.1 protein_id gnl|my_center|LOCUS_08330 14122 16119 gene locus_tag LOCUS_08340 gene rpoD 14122 16119 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_08340 16147 16225 gene locus_tag LOCUS_t00160 16147 16225 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16509 17591 gene locus_tag LOCUS_08350 gene fic 16509 17591 CDS product adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073937.1 protein_id gnl|my_center|LOCUS_08350 18187 17816 gene locus_tag LOCUS_08360 18187 17816 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_08360 <19125 18232 gene locus_tag LOCUS_08370 <19125 18232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194386.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence032 34 624 gene locus_tag LOCUS_08380 34 624 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389806.1 protein_id gnl|my_center|LOCUS_08380 786 1556 gene locus_tag LOCUS_08390 786 1556 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869088.1 protein_id gnl|my_center|LOCUS_08390 1619 2830 gene locus_tag LOCUS_08400 1619 2830 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_08400 2976 4511 gene locus_tag LOCUS_08410 2976 4511 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088826.1 protein_id gnl|my_center|LOCUS_08410 4508 6634 gene locus_tag LOCUS_08420 4508 6634 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_08420 6631 8337 gene locus_tag LOCUS_08430 6631 8337 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_08430 8340 9473 gene locus_tag LOCUS_08440 8340 9473 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_08440 9470 9886 gene locus_tag LOCUS_08450 9470 9886 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_08450 9883 11496 gene locus_tag LOCUS_08460 9883 11496 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_08460 11506 12375 gene locus_tag LOCUS_08470 gene xdhB 11506 12375 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_08470 12359 12841 gene locus_tag LOCUS_08480 12359 12841 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_08480 12855 15239 gene locus_tag LOCUS_08490 12855 15239 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_08490 15236 16426 gene locus_tag LOCUS_08500 15236 16426 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839729.1 protein_id gnl|my_center|LOCUS_08500 16489 17643 gene locus_tag LOCUS_08510 16489 17643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813867.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence033 17 2884 gene locus_tag LOCUS_08520 17 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2888 3310 gene locus_tag LOCUS_08530 gene rbfA 2888 3310 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_08530 3348 4277 gene locus_tag LOCUS_08540 gene truB 3348 4277 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_08540 4368 4637 gene locus_tag LOCUS_08550 gene rpsO 4368 4637 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_08550 4834 6930 gene locus_tag LOCUS_08560 gene pnp 4834 6930 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_08560 7499 7074 gene locus_tag LOCUS_08570 gene dksA 7499 7074 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_08570 8195 7914 gene locus_tag LOCUS_08580 8195 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8575 8500 gene locus_tag LOCUS_t00170 8575 8500 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8692 8616 gene locus_tag LOCUS_t00180 8692 8616 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8796 8720 gene locus_tag LOCUS_t00190 8796 8720 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10212 8890 gene locus_tag LOCUS_08590 10212 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536312.1 protein_id gnl|my_center|LOCUS_08590 10427 10209 gene locus_tag LOCUS_08600 10427 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 10882 10424 gene locus_tag LOCUS_08610 10882 10424 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_08610 11034 12305 gene locus_tag LOCUS_08620 11034 12305 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178900.1 protein_id gnl|my_center|LOCUS_08620 12546 16259 gene locus_tag LOCUS_08630 12546 16259 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187804.1 protein_id gnl|my_center|LOCUS_08630 16827 16306 gene locus_tag LOCUS_08640 16827 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 17551 16985 gene locus_tag LOCUS_08650 gene sufT 17551 16985 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence034 3127 596 gene locus_tag LOCUS_08660 3127 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3974 3168 gene locus_tag LOCUS_08670 gene dapB 3974 3168 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_08670 4452 4042 gene locus_tag LOCUS_08680 4452 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4607 5065 gene locus_tag LOCUS_08690 gene fur 4607 5065 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_08690 6796 5126 gene locus_tag LOCUS_08700 gene recN 6796 5126 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_08700 7823 6939 gene locus_tag LOCUS_08710 7823 6939 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_08710 7954 8982 gene locus_tag LOCUS_08720 gene hrcA 7954 8982 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_08720 9030 10127 gene locus_tag LOCUS_08730 gene hemH 9030 10127 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 protein_id gnl|my_center|LOCUS_08730 11564 10203 gene locus_tag LOCUS_08740 11564 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 11781 13100 gene locus_tag LOCUS_08750 11781 13100 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_08750 13126 13911 gene locus_tag LOCUS_08760 13126 13911 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_08760 14032 14739 gene locus_tag LOCUS_08770 14032 14739 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_08770 15460 14774 gene locus_tag LOCUS_08780 15460 14774 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804114.1 protein_id gnl|my_center|LOCUS_08780 16376 15618 gene locus_tag LOCUS_08790 16376 15618 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_08790 16825 17478 gene locus_tag LOCUS_08800 16825 17478 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence035 1226 231 gene locus_tag LOCUS_08810 1226 231 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_08810 1313 1510 gene locus_tag LOCUS_08820 1313 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2395 1544 gene locus_tag LOCUS_08830 2395 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2767 2498 gene locus_tag LOCUS_08840 2767 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3623 2778 gene locus_tag LOCUS_08850 3623 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4185 3694 gene locus_tag LOCUS_08860 4185 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4581 4252 gene locus_tag LOCUS_08870 4581 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 7352 4578 gene locus_tag LOCUS_08880 7352 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 7436 8086 gene locus_tag LOCUS_08890 7436 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8088 8408 gene locus_tag LOCUS_08900 8088 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 9573 9070 gene locus_tag LOCUS_08910 9573 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 12254 9570 gene locus_tag LOCUS_08920 12254 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 12685 12251 gene locus_tag LOCUS_08930 12685 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 12888 12682 gene locus_tag LOCUS_08940 12888 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13236 13009 gene locus_tag LOCUS_08950 13236 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13695 14459 gene locus_tag LOCUS_08960 gene xth 13695 14459 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_08960 14538 15209 gene locus_tag LOCUS_08970 14538 15209 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_08970 15324 15515 gene locus_tag LOCUS_08980 15324 15515 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_08980 16823 15564 gene locus_tag LOCUS_08990 gene ubiH 16823 15564 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 protein_id gnl|my_center|LOCUS_08990 <17782 16816 gene locus_tag LOCUS_09000 <17782 16816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065042.1:aminopeptidase P N-terminal domain-containing protein >Feature sequence036 2 529 gene locus_tag LOCUS_09010 2 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 573 1628 gene locus_tag LOCUS_09020 573 1628 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527101.1 protein_id gnl|my_center|LOCUS_09020 1648 2283 gene locus_tag LOCUS_09030 1648 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2280 3173 gene locus_tag LOCUS_09040 2280 3173 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_09040 3253 3870 gene locus_tag LOCUS_09050 3253 3870 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_09050 3954 4220 gene locus_tag LOCUS_09060 3954 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4217 4651 gene locus_tag LOCUS_09070 4217 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5493 4801 gene locus_tag LOCUS_09080 5493 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 5762 7693 gene locus_tag LOCUS_09090 5762 7693 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_09090 8356 7718 gene locus_tag LOCUS_09100 8356 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 8546 9151 gene locus_tag LOCUS_09110 8546 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 9328 11106 gene locus_tag LOCUS_09120 9328 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 11108 12496 gene locus_tag LOCUS_09130 gene atoC 11108 12496 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_09130 12628 13947 gene locus_tag LOCUS_09140 12628 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 14006 14335 gene locus_tag LOCUS_09150 14006 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 14362 16344 gene locus_tag LOCUS_09160 14362 16344 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_09160 17147 16635 gene locus_tag LOCUS_09170 17147 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence037 3092 72 gene locus_tag LOCUS_09180 3092 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3936 3142 gene locus_tag LOCUS_09190 3936 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6890 4380 gene locus_tag LOCUS_09200 6890 4380 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974842.1 protein_id gnl|my_center|LOCUS_09200 8181 6931 gene locus_tag LOCUS_09210 8181 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031224.1 protein_id gnl|my_center|LOCUS_09210 10328 8181 gene locus_tag LOCUS_09220 10328 8181 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031225.1 protein_id gnl|my_center|LOCUS_09220 10578 10357 gene locus_tag LOCUS_09230 10578 10357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10979 16138 gene locus_tag LOCUS_09240 10979 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 17252 16344 gene locus_tag LOCUS_09250 17252 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence038 1357 854 gene locus_tag LOCUS_09260 1357 854 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_09260 3637 1469 gene locus_tag LOCUS_09270 gene pilQ 3637 1469 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_09270 4152 3634 gene locus_tag LOCUS_09280 4152 3634 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_09280 4865 4149 gene locus_tag LOCUS_09290 gene pilO 4865 4149 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_09290 5452 4862 gene locus_tag LOCUS_09300 5452 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6525 5449 gene locus_tag LOCUS_09310 6525 5449 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_09310 6701 9139 gene locus_tag LOCUS_09320 6701 9139 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110255951.1 protein_id gnl|my_center|LOCUS_09320 9486 9160 gene locus_tag LOCUS_09330 gene cyaY 9486 9160 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225851.1 protein_id gnl|my_center|LOCUS_09330 9517 9705 gene locus_tag LOCUS_09340 9517 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 9702 10997 gene locus_tag LOCUS_09350 gene lysA 9702 10997 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_09350 11343 11573 gene locus_tag LOCUS_09360 11343 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11585 12826 gene locus_tag LOCUS_09370 11585 12826 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388141.1 protein_id gnl|my_center|LOCUS_09370 12858 13154 gene locus_tag LOCUS_09380 gene xanC 12858 13154 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_09380 13264 13956 gene locus_tag LOCUS_09390 13264 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 14018 15355 gene locus_tag LOCUS_09400 gene xanA2 14018 15355 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_09400 15352 15660 gene locus_tag LOCUS_09410 15352 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 15803 16753 gene locus_tag LOCUS_09420 15803 16753 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence039 732 394 gene locus_tag LOCUS_09430 732 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 713 3721 gene locus_tag LOCUS_09440 713 3721 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_09440 3718 4584 gene locus_tag LOCUS_09450 3718 4584 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809159.1 protein_id gnl|my_center|LOCUS_09450 4600 5013 gene locus_tag LOCUS_09460 4600 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 5034 5378 gene locus_tag LOCUS_09470 5034 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5409 6290 gene locus_tag LOCUS_09480 5409 6290 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057750223.1 protein_id gnl|my_center|LOCUS_09480 6393 7646 gene locus_tag LOCUS_09490 6393 7646 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_09490 7749 8714 gene locus_tag LOCUS_09500 7749 8714 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_09500 8786 9277 gene locus_tag LOCUS_09510 8786 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9282 10553 gene locus_tag LOCUS_09520 9282 10553 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_09520 11708 10674 gene locus_tag LOCUS_09530 11708 10674 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_09530 12561 11848 gene locus_tag LOCUS_09540 12561 11848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 protein_id gnl|my_center|LOCUS_09540 12969 15119 gene locus_tag LOCUS_09550 12969 15119 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_09550 15184 16587 gene locus_tag LOCUS_09560 gene lpdA 15184 16587 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence040 633 1088 gene locus_tag LOCUS_09570 633 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3664 1229 gene locus_tag LOCUS_09580 3664 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5065 3680 gene locus_tag LOCUS_09590 5065 3680 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_09590 8937 5062 gene locus_tag LOCUS_09600 8937 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 10634 8940 gene locus_tag LOCUS_09610 10634 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12628 10634 gene locus_tag LOCUS_09620 12628 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 13413 12634 gene locus_tag LOCUS_09630 13413 12634 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_09630 14079 13537 gene locus_tag LOCUS_09640 14079 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 14086 14331 gene locus_tag LOCUS_09650 14086 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 16411 14432 gene locus_tag LOCUS_09660 gene uvrD 16411 14432 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence041 734 1693 gene locus_tag LOCUS_09670 gene cbiB 734 1693 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103680.1 protein_id gnl|my_center|LOCUS_09670 1686 2783 gene locus_tag LOCUS_09680 gene cobD 1686 2783 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_09680 2773 3708 gene locus_tag LOCUS_09690 2773 3708 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_09690 4801 3677 gene locus_tag LOCUS_09700 4801 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5102 6679 gene locus_tag LOCUS_09710 5102 6679 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448947.1 protein_id gnl|my_center|LOCUS_09710 8309 6747 gene locus_tag LOCUS_09720 8309 6747 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367342.1 protein_id gnl|my_center|LOCUS_09720 9421 8567 gene locus_tag LOCUS_09730 gene asd 9421 8567 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_09730 9754 11199 gene locus_tag LOCUS_09740 gene ahcY 9754 11199 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807196.1 protein_id gnl|my_center|LOCUS_09740 11248 12105 gene locus_tag LOCUS_09750 11248 12105 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327569.1 protein_id gnl|my_center|LOCUS_09750 12102 12935 gene locus_tag LOCUS_09760 gene metF 12102 12935 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_09760 13153 13755 gene locus_tag LOCUS_09770 13153 13755 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192970.1 protein_id gnl|my_center|LOCUS_09770 13808 14584 gene locus_tag LOCUS_09780 13808 14584 CDS product DUF2182 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192322.1 protein_id gnl|my_center|LOCUS_09780 16112 14607 gene locus_tag LOCUS_09790 16112 14607 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298776.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence042 419 1690 gene locus_tag LOCUS_09800 419 1690 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927204.1 protein_id gnl|my_center|LOCUS_09800 1702 2871 gene locus_tag LOCUS_09810 1702 2871 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064841.1 protein_id gnl|my_center|LOCUS_09810 4163 2949 gene locus_tag LOCUS_09820 4163 2949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_09820 4531 6465 gene locus_tag LOCUS_09830 gene mnmG 4531 6465 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_09830 6545 7201 gene locus_tag LOCUS_09840 gene rsmG 6545 7201 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202905.1 protein_id gnl|my_center|LOCUS_09840 7316 8086 gene locus_tag LOCUS_09850 7316 8086 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_09850 8101 8952 gene locus_tag LOCUS_09860 8101 8952 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_09860 10277 8970 gene locus_tag LOCUS_09870 10277 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10545 10886 gene locus_tag LOCUS_09880 10545 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 10889 11734 gene locus_tag LOCUS_09890 gene atpB 10889 11734 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815364.1 protein_id gnl|my_center|LOCUS_09890 11800 12045 gene locus_tag LOCUS_09900 gene atpE 11800 12045 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815363.1 protein_id gnl|my_center|LOCUS_09900 12129 12566 gene locus_tag LOCUS_09910 12129 12566 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687152.1 protein_id gnl|my_center|LOCUS_09910 12570 13103 gene locus_tag LOCUS_09920 12570 13103 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524508.1 protein_id gnl|my_center|LOCUS_09920 13116 14654 gene locus_tag LOCUS_09930 gene atpA 13116 14654 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_09930 14676 15545 gene locus_tag LOCUS_09940 gene atpG 14676 15545 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence043 870 88 gene locus_tag LOCUS_09950 870 88 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_09950 1156 2820 gene locus_tag LOCUS_09960 1156 2820 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_09960 2817 4502 gene locus_tag LOCUS_09970 2817 4502 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_09970 4528 5727 gene locus_tag LOCUS_09980 4528 5727 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_09980 5731 7146 gene locus_tag LOCUS_09990 5731 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7143 8462 gene locus_tag LOCUS_10000 7143 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 8450 9178 gene locus_tag LOCUS_10010 8450 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 9238 9882 gene locus_tag LOCUS_10020 9238 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 10138 11127 gene locus_tag LOCUS_10030 10138 11127 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815171.1 protein_id gnl|my_center|LOCUS_10030 11128 11703 gene locus_tag LOCUS_10040 11128 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 11700 12245 gene locus_tag LOCUS_10050 11700 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 12278 13054 gene locus_tag LOCUS_10060 12278 13054 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_10060 13232 13798 gene locus_tag LOCUS_10070 13232 13798 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_10070 14624 13863 gene locus_tag LOCUS_10080 14624 13863 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_10080 15252 14719 gene locus_tag LOCUS_10090 gene gmhB 15252 14719 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence044 214 498 gene locus_tag LOCUS_10100 214 498 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554071.1 protein_id gnl|my_center|LOCUS_10100 495 851 gene locus_tag LOCUS_10110 gene mnhG 495 851 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 protein_id gnl|my_center|LOCUS_10110 1791 853 gene locus_tag LOCUS_10120 1791 853 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706425.1 protein_id gnl|my_center|LOCUS_10120 2451 3785 gene locus_tag LOCUS_10130 2451 3785 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_10130 4480 3971 gene locus_tag LOCUS_10140 4480 3971 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199982.1 protein_id gnl|my_center|LOCUS_10140 5285 4575 gene locus_tag LOCUS_10150 5285 4575 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_10150 5513 7321 gene locus_tag LOCUS_10160 5513 7321 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_10160 7434 8591 gene locus_tag LOCUS_10170 7434 8591 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_10170 8588 11284 gene locus_tag LOCUS_10180 8588 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 11463 11281 gene locus_tag LOCUS_10190 11463 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 11432 13630 gene locus_tag LOCUS_10200 11432 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 14133 13648 gene locus_tag LOCUS_10210 14133 13648 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192378.1 protein_id gnl|my_center|LOCUS_10210 14441 14250 gene locus_tag LOCUS_10220 14441 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 <15063 14454 gene locus_tag LOCUS_10230 <15063 14454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808489.1:FAD-dependent oxidoreductase >Feature sequence045 626 1315 gene locus_tag LOCUS_10240 626 1315 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532242.1 protein_id gnl|my_center|LOCUS_10240 1501 2907 gene locus_tag LOCUS_10250 gene yegQ 1501 2907 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_10250 2977 3645 gene locus_tag LOCUS_10260 2977 3645 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971856.1 protein_id gnl|my_center|LOCUS_10260 3782 4582 gene locus_tag LOCUS_10270 3782 4582 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189681.1 protein_id gnl|my_center|LOCUS_10270 5901 4630 gene locus_tag LOCUS_10280 5901 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 6534 5968 gene locus_tag LOCUS_10290 6534 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7793 6531 gene locus_tag LOCUS_10300 7793 6531 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_10300 9969 7837 gene locus_tag LOCUS_10310 9969 7837 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_10310 10519 10142 gene locus_tag LOCUS_10320 10519 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 11453 10587 gene locus_tag LOCUS_10330 11453 10587 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_10330 11516 12487 gene locus_tag LOCUS_10340 11516 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 12592 13311 gene locus_tag LOCUS_10350 gene rph 12592 13311 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_10350 13370 13975 gene locus_tag LOCUS_10360 gene rdgB 13370 13975 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186211.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence046 <1 1095 gene locus_tag LOCUS_10370 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037134.1:GNAT family N-acetyltransferase 1231 2016 gene locus_tag LOCUS_10380 gene yaaA 1231 2016 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186203.1 protein_id gnl|my_center|LOCUS_10380 2022 3188 gene locus_tag LOCUS_10390 2022 3188 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526471.1 protein_id gnl|my_center|LOCUS_10390 4687 3359 gene locus_tag LOCUS_10400 gene hpnE 4687 3359 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_10400 5630 4797 gene locus_tag LOCUS_10410 gene hpnD 5630 4797 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_10410 6502 5627 gene locus_tag LOCUS_10420 gene hpnC 6502 5627 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 protein_id gnl|my_center|LOCUS_10420 6757 7440 gene locus_tag LOCUS_10430 6757 7440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_10430 7437 9983 gene locus_tag LOCUS_10440 7437 9983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942827.1 protein_id gnl|my_center|LOCUS_10440 9997 11247 gene locus_tag LOCUS_10450 9997 11247 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 protein_id gnl|my_center|LOCUS_10450 11361 12431 gene locus_tag LOCUS_10460 gene rfbB 11361 12431 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_10460 12428 13348 gene locus_tag LOCUS_10470 gene rfbD 12428 13348 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_10470 13491 13575 gene locus_tag LOCUS_t00200 13491 13575 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14049 13708 gene locus_tag LOCUS_10480 14049 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 14273 14046 gene locus_tag LOCUS_10490 14273 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence047 751 1095 gene locus_tag LOCUS_10500 751 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1144 1806 gene locus_tag LOCUS_10510 1144 1806 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_10510 1794 3203 gene locus_tag LOCUS_10520 1794 3203 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_10520 4266 3274 gene locus_tag LOCUS_10530 4266 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4757 4263 gene locus_tag LOCUS_10540 4757 4263 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10540 5035 5739 gene locus_tag LOCUS_10550 5035 5739 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_10550 5723 7213 gene locus_tag LOCUS_10560 5723 7213 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_10560 7210 7863 gene locus_tag LOCUS_10570 7210 7863 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_10570 7874 8695 gene locus_tag LOCUS_10580 7874 8695 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_10580 8708 9358 gene locus_tag LOCUS_10590 8708 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_10590 9479 10138 gene locus_tag LOCUS_10600 9479 10138 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103755.1 protein_id gnl|my_center|LOCUS_10600 10138 11637 gene locus_tag LOCUS_10610 10138 11637 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103754.1 protein_id gnl|my_center|LOCUS_10610 11808 12410 gene locus_tag LOCUS_10620 11808 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12407 13606 gene locus_tag LOCUS_10630 12407 13606 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence048 94 2025 gene locus_tag LOCUS_10640 94 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3354 2110 gene locus_tag LOCUS_10650 3354 2110 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_10650 3676 3359 gene locus_tag LOCUS_10660 3676 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4073 5167 gene locus_tag LOCUS_10670 4073 5167 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_10670 5178 8252 gene locus_tag LOCUS_10680 5178 8252 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_10680 8866 8321 gene locus_tag LOCUS_10690 8866 8321 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 protein_id gnl|my_center|LOCUS_10690 9906 8911 gene locus_tag LOCUS_10700 gene miaA 9906 8911 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527674.1 protein_id gnl|my_center|LOCUS_10700 10560 9994 gene locus_tag LOCUS_10710 10560 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 11256 10564 gene locus_tag LOCUS_10720 11256 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11803 11600 gene locus_tag LOCUS_10730 11803 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11697 12197 gene locus_tag LOCUS_10740 11697 12197 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_10740 14148 12217 gene locus_tag LOCUS_10750 gene mutL 14148 12217 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence049 2 442 gene locus_tag LOCUS_10760 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 522 1226 gene locus_tag LOCUS_10770 gene queC 522 1226 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_10770 1303 1378 gene locus_tag LOCUS_t00210 1303 1378 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1855 2127 gene locus_tag LOCUS_10780 1855 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2159 3049 gene locus_tag LOCUS_10790 2159 3049 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099243.1 protein_id gnl|my_center|LOCUS_10790 3846 3298 gene locus_tag LOCUS_10800 3846 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4216 3827 gene locus_tag LOCUS_10810 4216 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5112 4213 gene locus_tag LOCUS_10820 gene rapZ 5112 4213 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_10820 6638 5184 gene locus_tag LOCUS_10830 6638 5184 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072961.1 protein_id gnl|my_center|LOCUS_10830 6969 9116 gene locus_tag LOCUS_10840 6969 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10840 9106 10488 gene locus_tag LOCUS_10850 9106 10488 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462141.1 protein_id gnl|my_center|LOCUS_10850 10750 11052 gene locus_tag LOCUS_10860 10750 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11053 11649 gene locus_tag LOCUS_10870 11053 11649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11696 13246 gene locus_tag LOCUS_10880 11696 13246 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence050 944 1321 gene locus_tag LOCUS_10890 944 1321 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925839.1 protein_id gnl|my_center|LOCUS_10890 1327 2109 gene locus_tag LOCUS_10900 1327 2109 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626396.1 protein_id gnl|my_center|LOCUS_10900 3629 2190 gene locus_tag LOCUS_10910 3629 2190 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_10910 3857 4573 gene locus_tag LOCUS_10920 3857 4573 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_10920 4623 6557 gene locus_tag LOCUS_10930 4623 6557 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 protein_id gnl|my_center|LOCUS_10930 6894 6565 gene locus_tag LOCUS_10940 6894 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 10390 7019 gene locus_tag LOCUS_10950 10390 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 11178 10549 gene locus_tag LOCUS_10960 11178 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 12593 11175 gene locus_tag LOCUS_10970 12593 11175 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_10970 14395 12593 gene locus_tag LOCUS_10980 14395 12593 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence051 171 1268 gene locus_tag LOCUS_10990 gene mnmA 171 1268 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039549.1 protein_id gnl|my_center|LOCUS_10990 2230 1289 gene locus_tag LOCUS_11000 2230 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2917 2342 gene locus_tag LOCUS_11010 2917 2342 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_11010 3596 3093 gene locus_tag LOCUS_11020 gene sixA 3596 3093 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_11020 5181 3652 gene locus_tag LOCUS_11030 5181 3652 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_11030 7984 5282 gene locus_tag LOCUS_11040 gene glnE 7984 5282 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196324.1 protein_id gnl|my_center|LOCUS_11040 8259 12143 gene locus_tag LOCUS_11050 8259 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12227 13072 gene locus_tag LOCUS_11060 12227 13072 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence052 141 66 gene locus_tag LOCUS_t00220 141 66 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1673 231 gene locus_tag LOCUS_11070 1673 231 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_11070 2671 1691 gene locus_tag LOCUS_11080 gene rssA 2671 1691 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096264.1 protein_id gnl|my_center|LOCUS_11080 4043 2712 gene locus_tag LOCUS_11090 gene rimO 4043 2712 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521351.1 protein_id gnl|my_center|LOCUS_11090 4698 4108 gene locus_tag LOCUS_11100 gene phaR 4698 4108 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_11100 5557 4817 gene locus_tag LOCUS_11110 5557 4817 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_11110 6803 6063 gene locus_tag LOCUS_11120 6803 6063 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525015.1 protein_id gnl|my_center|LOCUS_11120 8661 6916 gene locus_tag LOCUS_11130 gene phaC 8661 6916 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086513.1 protein_id gnl|my_center|LOCUS_11130 8748 8963 gene locus_tag LOCUS_11140 8748 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9789 9037 gene locus_tag LOCUS_11150 gene pgeF 9789 9037 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_11150 10817 9798 gene locus_tag LOCUS_11160 10817 9798 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_11160 10771 11580 gene locus_tag LOCUS_11170 10771 11580 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937181.1 protein_id gnl|my_center|LOCUS_11170 11843 11529 gene locus_tag LOCUS_11180 11843 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11746 13290 gene locus_tag LOCUS_11190 11746 13290 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_11190 <14201 13364 gene locus_tag LOCUS_11200 <14201 13364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038670.1:malate synthase G >Feature sequence053 981 169 gene locus_tag LOCUS_11210 gene minD 981 169 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_11210 1803 1015 gene locus_tag LOCUS_11220 gene minC 1803 1015 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_11220 2807 1944 gene locus_tag LOCUS_11230 gene hslO 2807 1944 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065143.1 protein_id gnl|my_center|LOCUS_11230 3178 2804 gene locus_tag LOCUS_11240 3178 2804 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102247109.1 protein_id gnl|my_center|LOCUS_11240 5609 3195 gene locus_tag LOCUS_11250 5609 3195 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_11250 6621 5773 gene locus_tag LOCUS_11260 6621 5773 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 protein_id gnl|my_center|LOCUS_11260 9357 6625 gene locus_tag LOCUS_11270 9357 6625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_11270 9540 10091 gene locus_tag LOCUS_11280 9540 10091 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_11280 11177 10095 gene locus_tag LOCUS_11290 gene mnmH 11177 10095 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_11290 11200 12240 gene locus_tag LOCUS_11300 gene selD 11200 12240 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_11300 12925 12287 gene locus_tag LOCUS_11310 12925 12287 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_11310 12912 13622 gene locus_tag LOCUS_11320 12912 13622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence054 293 778 gene locus_tag LOCUS_11330 293 778 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_11330 1047 1226 gene locus_tag LOCUS_11340 1047 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1683 1294 gene locus_tag LOCUS_11350 1683 1294 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_11350 3329 1779 gene locus_tag LOCUS_11360 3329 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4670 3354 gene locus_tag LOCUS_11370 4670 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5377 4754 gene locus_tag LOCUS_11380 5377 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 5940 5371 gene locus_tag LOCUS_11390 5940 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6265 6948 gene locus_tag LOCUS_11400 6265 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 7027 7956 gene locus_tag LOCUS_11410 7027 7956 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_11410 7985 9166 gene locus_tag LOCUS_11420 7985 9166 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905810.1 protein_id gnl|my_center|LOCUS_11420 9676 9266 gene locus_tag LOCUS_11430 gene msrB 9676 9266 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943090.1 protein_id gnl|my_center|LOCUS_11430 10849 9680 gene locus_tag LOCUS_11440 10849 9680 CDS product DUF2863 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_11440 11832 10999 gene locus_tag LOCUS_11450 11832 10999 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192738.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence055 <1 622 gene locus_tag LOCUS_11460 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194277.1:RNB domain-containing ribonuclease 629 1564 gene locus_tag LOCUS_11470 629 1564 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_11470 1575 2408 gene locus_tag LOCUS_11480 gene aroE 1575 2408 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_11480 2398 3141 gene locus_tag LOCUS_11490 gene mtgA 2398 3141 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040553.1 protein_id gnl|my_center|LOCUS_11490 3248 4690 gene locus_tag LOCUS_11500 gene mgtE 3248 4690 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_11500 6024 4741 gene locus_tag LOCUS_11510 gene hemL 6024 4741 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_11510 6748 6119 gene locus_tag LOCUS_11520 gene thiE 6748 6119 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 protein_id gnl|my_center|LOCUS_11520 7640 6741 gene locus_tag LOCUS_11530 7640 6741 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929734.1 protein_id gnl|my_center|LOCUS_11530 7741 7920 gene locus_tag LOCUS_11540 7741 7920 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_11540 9261 7963 gene locus_tag LOCUS_11550 9261 7963 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_11550 10753 9281 gene locus_tag LOCUS_11560 10753 9281 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_11560 10905 11471 gene locus_tag LOCUS_11570 10905 11471 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_11570 11464 11955 gene locus_tag LOCUS_11580 gene ruvX 11464 11955 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706124.1 protein_id gnl|my_center|LOCUS_11580 11942 12448 gene locus_tag LOCUS_11590 gene pyrR 11942 12448 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_11590 12465 13424 gene locus_tag LOCUS_11600 12465 13424 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence056 1151 228 gene locus_tag LOCUS_11610 gene argF 1151 228 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_11610 2336 1161 gene locus_tag LOCUS_11620 2336 1161 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_11620 2707 2997 gene locus_tag LOCUS_11630 2707 2997 CDS product DUF3579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812933.1 protein_id gnl|my_center|LOCUS_11630 3453 3187 gene locus_tag LOCUS_11640 gene rpsT 3453 3187 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_11640 3590 5128 gene locus_tag LOCUS_11650 gene murJ 3590 5128 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_11650 6170 5244 gene locus_tag LOCUS_11660 6170 5244 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736179.1 protein_id gnl|my_center|LOCUS_11660 6270 7046 gene locus_tag LOCUS_11670 gene fpr 6270 7046 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_11670 7226 8890 gene locus_tag LOCUS_11680 gene ettA 7226 8890 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243991.1 protein_id gnl|my_center|LOCUS_11680 8908 10515 gene locus_tag LOCUS_11690 8908 10515 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_11690 10530 11174 gene locus_tag LOCUS_11700 10530 11174 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268467.1 protein_id gnl|my_center|LOCUS_11700 12480 11320 gene locus_tag LOCUS_11710 12480 11320 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence057 780 1 gene locus_tag LOCUS_11720 gene fabI 780 1 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390974.1 protein_id gnl|my_center|LOCUS_11720 962 1468 gene locus_tag LOCUS_11730 962 1468 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204886.1 protein_id gnl|my_center|LOCUS_11730 1540 2943 gene locus_tag LOCUS_11740 1540 2943 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 protein_id gnl|my_center|LOCUS_11740 2940 4145 gene locus_tag LOCUS_11750 2940 4145 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_11750 4251 5990 gene locus_tag LOCUS_11760 gene ggt 4251 5990 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224631.1 protein_id gnl|my_center|LOCUS_11760 7952 6027 gene locus_tag LOCUS_11770 7952 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8531 8094 gene locus_tag LOCUS_11780 gene aroQ 8531 8094 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194379.1 protein_id gnl|my_center|LOCUS_11780 9586 8624 gene locus_tag LOCUS_11790 9586 8624 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207577.1 protein_id gnl|my_center|LOCUS_11790 11270 9807 gene locus_tag LOCUS_11800 11270 9807 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_11800 <13425 11271 gene locus_tag LOCUS_11810 <13425 11271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196742.1:glutamate synthase-related protein >Feature sequence058 198 806 gene locus_tag LOCUS_11820 gene paaY 198 806 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123453.1 protein_id gnl|my_center|LOCUS_11820 1793 843 gene locus_tag LOCUS_11830 1793 843 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_11830 2003 3439 gene locus_tag LOCUS_11840 gene pqsA 2003 3439 CDS product anthranilate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112552.1 protein_id gnl|my_center|LOCUS_11840 3805 3503 gene locus_tag LOCUS_11850 3805 3503 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_11850 4859 3960 gene locus_tag LOCUS_11860 4859 3960 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095545.1 protein_id gnl|my_center|LOCUS_11860 5037 6062 gene locus_tag LOCUS_11870 5037 6062 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_11870 6214 6702 gene locus_tag LOCUS_11880 6214 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6692 7993 gene locus_tag LOCUS_11890 6692 7993 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_11890 8931 8020 gene locus_tag LOCUS_11900 8931 8020 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532449.1 protein_id gnl|my_center|LOCUS_11900 9051 11222 gene locus_tag LOCUS_11910 9051 11222 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086195.1 protein_id gnl|my_center|LOCUS_11910 11227 12870 gene locus_tag LOCUS_11920 11227 12870 CDS product indolepyruvate oxidoreductase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence059 2219 1188 gene locus_tag LOCUS_11930 2219 1188 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257722.1 protein_id gnl|my_center|LOCUS_11930 3004 2216 gene locus_tag LOCUS_11940 gene pilW 3004 2216 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688950.1 protein_id gnl|my_center|LOCUS_11940 4158 3001 gene locus_tag LOCUS_11950 gene rlmN 4158 3001 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_11950 4699 4274 gene locus_tag LOCUS_11960 gene ndk 4699 4274 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_11960 6205 4919 gene locus_tag LOCUS_11970 6205 4919 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_11970 6940 6221 gene locus_tag LOCUS_11980 6940 6221 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391424.1 protein_id gnl|my_center|LOCUS_11980 8020 7016 gene locus_tag LOCUS_11990 8020 7016 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_11990 8195 10177 gene locus_tag LOCUS_12000 8195 10177 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_12000 10174 10779 gene locus_tag LOCUS_12010 10174 10779 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_12010 12188 10824 gene locus_tag LOCUS_12020 gene tilS 12188 10824 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 protein_id gnl|my_center|LOCUS_12020 13214 12249 gene locus_tag LOCUS_12030 13214 12249 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence060 <1 817 gene locus_tag LOCUS_12040 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194407.1:carbon-nitrogen hydrolase family protein 896 2341 gene locus_tag LOCUS_12050 gene tldD 896 2341 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_12050 2617 2432 gene locus_tag LOCUS_12060 2617 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4022 2640 gene locus_tag LOCUS_12070 gene glrR 4022 2640 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_12070 4660 5097 gene locus_tag LOCUS_12080 4660 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5859 5197 gene locus_tag LOCUS_12090 5859 5197 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_12090 7615 5867 gene locus_tag LOCUS_12100 7615 5867 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814636.1 protein_id gnl|my_center|LOCUS_12100 7808 8371 gene locus_tag LOCUS_12110 7808 8371 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_12110 8498 8917 gene locus_tag LOCUS_12120 8498 8917 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_12120 9000 10355 gene locus_tag LOCUS_12130 9000 10355 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_12130 10352 10936 gene locus_tag LOCUS_12140 10352 10936 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_12140 10954 11460 gene locus_tag LOCUS_12150 10954 11460 CDS product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195111.1 protein_id gnl|my_center|LOCUS_12150 11460 12080 gene locus_tag LOCUS_12160 gene coq7 11460 12080 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064484.1 protein_id gnl|my_center|LOCUS_12160 12555 12136 gene locus_tag LOCUS_12170 12555 12136 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence061 115 1932 gene locus_tag LOCUS_12180 gene typA 115 1932 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_12180 2995 2087 gene locus_tag LOCUS_12190 gene galU 2995 2087 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522195.1 protein_id gnl|my_center|LOCUS_12190 5180 3066 gene locus_tag LOCUS_12200 gene ligA 5180 3066 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_12200 6279 5194 gene locus_tag LOCUS_12210 6279 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9940 6314 gene locus_tag LOCUS_12220 gene smc 9940 6314 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813877.1 protein_id gnl|my_center|LOCUS_12220 10238 11431 gene locus_tag LOCUS_12230 gene dapC 10238 11431 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_12230 11452 12273 gene locus_tag LOCUS_12240 gene dapD 11452 12273 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence062 <1 834 gene locus_tag LOCUS_12250 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026080084.1:DEAD/DEAH box helicase 1005 4133 gene locus_tag LOCUS_12260 1005 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4688 4122 gene locus_tag LOCUS_12270 4688 4122 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_12270 5485 4688 gene locus_tag LOCUS_12280 5485 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5594 6226 gene locus_tag LOCUS_12290 5594 6226 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528547.1 protein_id gnl|my_center|LOCUS_12290 6575 6237 gene locus_tag LOCUS_12300 6575 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8190 6610 gene locus_tag LOCUS_12310 8190 6610 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_12310 9140 8295 gene locus_tag LOCUS_12320 gene rlmJ 9140 8295 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063881.1 protein_id gnl|my_center|LOCUS_12320 9314 9868 gene locus_tag LOCUS_12330 9314 9868 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_12330 9873 10622 gene locus_tag LOCUS_12340 9873 10622 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207320.1 protein_id gnl|my_center|LOCUS_12340 10744 11304 gene locus_tag LOCUS_12350 10744 11304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 11641 11369 gene locus_tag LOCUS_12360 11641 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 13073 11790 gene locus_tag LOCUS_12370 gene eno 13073 11790 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence063 583 3444 gene locus_tag LOCUS_12380 583 3444 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338646.1 protein_id gnl|my_center|LOCUS_12380 3445 3840 gene locus_tag LOCUS_12390 3445 3840 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721306.1 protein_id gnl|my_center|LOCUS_12390 3837 5357 gene locus_tag LOCUS_12400 3837 5357 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 protein_id gnl|my_center|LOCUS_12400 5357 5884 gene locus_tag LOCUS_12410 5357 5884 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_12410 5881 6150 gene locus_tag LOCUS_12420 5881 6150 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721312.1 protein_id gnl|my_center|LOCUS_12420 6158 6559 gene locus_tag LOCUS_12430 6158 6559 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721315.1 protein_id gnl|my_center|LOCUS_12430 6777 7952 gene locus_tag LOCUS_12440 6777 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8409 8041 gene locus_tag LOCUS_12450 8409 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8825 8406 gene locus_tag LOCUS_12460 8825 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 9364 8822 gene locus_tag LOCUS_12470 9364 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 10860 9367 gene locus_tag LOCUS_12480 10860 9367 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_12480 11258 10857 gene locus_tag LOCUS_12490 11258 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 <13102 11261 gene locus_tag LOCUS_12500 <13102 11261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942980.1:putative monovalent cation/H+ antiporter subunit A >Feature sequence064 544 909 gene locus_tag LOCUS_12510 544 909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_12510 1037 1753 gene locus_tag LOCUS_12520 1037 1753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_12520 1758 2513 gene locus_tag LOCUS_12530 1758 2513 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_12530 2546 4273 gene locus_tag LOCUS_12540 2546 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 4270 4644 gene locus_tag LOCUS_12550 4270 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4641 7388 gene locus_tag LOCUS_12560 4641 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7976 7488 gene locus_tag LOCUS_12570 gene moaC 7976 7488 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_12570 8098 9525 gene locus_tag LOCUS_12580 8098 9525 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_12580 9612 9842 gene locus_tag LOCUS_12590 9612 9842 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_12590 <12941 9960 gene locus_tag LOCUS_12600 <12941 9960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113794.1:valine--tRNA ligase >Feature sequence065 <1 1728 gene locus_tag LOCUS_12610 <1 1728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814429.1:LPS-assembly protein LptD 1754 3082 gene locus_tag LOCUS_12620 1754 3082 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_12620 3079 4089 gene locus_tag LOCUS_12630 gene pdxA 3079 4089 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221872.1 protein_id gnl|my_center|LOCUS_12630 4109 4912 gene locus_tag LOCUS_12640 gene rsmA 4109 4912 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189099.1 protein_id gnl|my_center|LOCUS_12640 8474 4938 gene locus_tag LOCUS_12650 gene dnaE 8474 4938 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813231.1 protein_id gnl|my_center|LOCUS_12650 9503 8529 gene locus_tag LOCUS_12660 9503 8529 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_12660 10723 9548 gene locus_tag LOCUS_12670 10723 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 <12937 10853 gene locus_tag LOCUS_12680 <12937 10853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033446507.1:NADP-dependent malic enzyme >Feature sequence066 822 175 gene locus_tag LOCUS_12690 822 175 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266243.1 protein_id gnl|my_center|LOCUS_12690 1826 993 gene locus_tag LOCUS_12700 gene dapF 1826 993 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_12700 2736 1864 gene locus_tag LOCUS_12710 2736 1864 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245818.1 protein_id gnl|my_center|LOCUS_12710 3620 2733 gene locus_tag LOCUS_12720 3620 2733 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_12720 3854 5017 gene locus_tag LOCUS_12730 gene metK 3854 5017 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 protein_id gnl|my_center|LOCUS_12730 5116 6189 gene locus_tag LOCUS_12740 5116 6189 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_12740 6744 7382 gene locus_tag LOCUS_12750 6744 7382 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086058.1 protein_id gnl|my_center|LOCUS_12750 7382 8206 gene locus_tag LOCUS_12760 gene cobM 7382 8206 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_12760 8203 9153 gene locus_tag LOCUS_12770 8203 9153 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034944231.1 protein_id gnl|my_center|LOCUS_12770 9172 9867 gene locus_tag LOCUS_12780 9172 9867 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174544.1 protein_id gnl|my_center|LOCUS_12780 9927 11087 gene locus_tag LOCUS_12790 9927 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence067 1559 324 gene locus_tag LOCUS_12800 gene ftsW 1559 324 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814574.1 protein_id gnl|my_center|LOCUS_12800 2953 1556 gene locus_tag LOCUS_12810 gene murD 2953 1556 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705695.1 protein_id gnl|my_center|LOCUS_12810 4038 2950 gene locus_tag LOCUS_12820 gene mraY 4038 2950 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_12820 5458 4058 gene locus_tag LOCUS_12830 gene murF 5458 4058 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194098.1 protein_id gnl|my_center|LOCUS_12830 6960 5455 gene locus_tag LOCUS_12840 6960 5455 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549955.1 protein_id gnl|my_center|LOCUS_12840 8723 6957 gene locus_tag LOCUS_12850 8723 6957 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_12850 8983 8720 gene locus_tag LOCUS_12860 gene ftsL 8983 8720 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_12860 9921 8983 gene locus_tag LOCUS_12870 gene rsmH 9921 8983 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 protein_id gnl|my_center|LOCUS_12870 10361 9918 gene locus_tag LOCUS_12880 gene mraZ 10361 9918 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931263.1 protein_id gnl|my_center|LOCUS_12880 12620 11130 gene locus_tag LOCUS_12890 12620 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence068 1828 1490 gene locus_tag LOCUS_12900 1828 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2550 1975 gene locus_tag LOCUS_12910 2550 1975 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_12910 3362 2547 gene locus_tag LOCUS_12920 gene proC 3362 2547 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_12920 4098 3355 gene locus_tag LOCUS_12930 4098 3355 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_12930 4146 5189 gene locus_tag LOCUS_12940 4146 5189 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_12940 5212 6345 gene locus_tag LOCUS_12950 5212 6345 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_12950 7605 6436 gene locus_tag LOCUS_12960 7605 6436 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_12960 8796 7780 gene locus_tag LOCUS_12970 8796 7780 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_12970 9043 8807 gene locus_tag LOCUS_12980 9043 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 9666 9040 gene locus_tag LOCUS_12990 gene fdh3B 9666 9040 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_12990 12604 9683 gene locus_tag LOCUS_13000 12604 9683 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence069 1509 469 gene locus_tag LOCUS_13010 1509 469 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_13010 3916 1523 gene locus_tag LOCUS_13020 3916 1523 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_13020 5739 3997 gene locus_tag LOCUS_13030 5739 3997 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_13030 7195 5828 gene locus_tag LOCUS_13040 7195 5828 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_13040 7932 7480 gene locus_tag LOCUS_13050 7932 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8378 7992 gene locus_tag LOCUS_13060 8378 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9904 8378 gene locus_tag LOCUS_13070 9904 8378 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_13070 11170 10199 gene locus_tag LOCUS_13080 11170 10199 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_13080 12248 11211 gene locus_tag LOCUS_13090 gene dctP 12248 11211 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965687.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence070 2220 568 gene locus_tag LOCUS_13100 2220 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3830 2418 gene locus_tag LOCUS_13110 gene gltX 3830 2418 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814917.1 protein_id gnl|my_center|LOCUS_13110 4159 8619 gene locus_tag LOCUS_13120 4159 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8634 9839 gene locus_tag LOCUS_13130 8634 9839 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_13130 9914 10270 gene locus_tag LOCUS_13140 9914 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 10329 11489 gene locus_tag LOCUS_13150 10329 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 <12385 11551 gene locus_tag LOCUS_13160 <12385 11551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199062.1:class I SAM-dependent rRNA methyltransferase >Feature sequence071 1274 1200 gene locus_tag LOCUS_t00230 1274 1200 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1365 1292 gene locus_tag LOCUS_t00240 1365 1292 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1533 1449 gene locus_tag LOCUS_t00250 1533 1449 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1664 3070 gene locus_tag LOCUS_13170 1664 3070 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522137.1 protein_id gnl|my_center|LOCUS_13170 3742 3113 gene locus_tag LOCUS_13180 3742 3113 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_13180 3984 5957 gene locus_tag LOCUS_13190 3984 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5985 6437 gene locus_tag LOCUS_13200 5985 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7961 6567 gene locus_tag LOCUS_13210 7961 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 8919 7978 gene locus_tag LOCUS_13220 8919 7978 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_13220 9936 8953 gene locus_tag LOCUS_13230 9936 8953 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_13230 11296 9944 gene locus_tag LOCUS_13240 11296 9944 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537977.1 protein_id gnl|my_center|LOCUS_13240 <12247 11332 gene locus_tag LOCUS_13250 <12247 11332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523366.1:AAA family ATPase >Feature sequence072 1656 1006 gene locus_tag LOCUS_13260 1656 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_13260 1993 1733 gene locus_tag LOCUS_13270 1993 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2417 2010 gene locus_tag LOCUS_13280 2417 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2862 2524 gene locus_tag LOCUS_13290 2862 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3646 2957 gene locus_tag LOCUS_13300 3646 2957 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_13300 4568 3741 gene locus_tag LOCUS_13310 4568 3741 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234445.1 protein_id gnl|my_center|LOCUS_13310 5618 4713 gene locus_tag LOCUS_13320 5618 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6383 5847 gene locus_tag LOCUS_13330 6383 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 6887 6534 gene locus_tag LOCUS_13340 6887 6534 CDS product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097141722.1 protein_id gnl|my_center|LOCUS_13340 7836 7012 gene locus_tag LOCUS_13350 7836 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054019012.1 protein_id gnl|my_center|LOCUS_13350 8403 8125 gene locus_tag LOCUS_13360 8403 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9231 8500 gene locus_tag LOCUS_13370 9231 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_13370 10001 9315 gene locus_tag LOCUS_13380 10001 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 10574 10182 gene locus_tag LOCUS_13390 10574 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_13390 10817 10596 gene locus_tag LOCUS_13400 10817 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_13400 11708 11151 gene locus_tag LOCUS_13410 11708 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence073 247 1662 gene locus_tag LOCUS_13420 247 1662 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992237.1 protein_id gnl|my_center|LOCUS_13420 1801 2562 gene locus_tag LOCUS_13430 1801 2562 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085178.1 protein_id gnl|my_center|LOCUS_13430 2652 3701 gene locus_tag LOCUS_13440 2652 3701 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112296.1 protein_id gnl|my_center|LOCUS_13440 3789 4754 gene locus_tag LOCUS_13450 3789 4754 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 protein_id gnl|my_center|LOCUS_13450 6821 4890 gene locus_tag LOCUS_13460 gene htpG 6821 4890 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_13460 7479 6925 gene locus_tag LOCUS_13470 gene greB 7479 6925 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_13470 7680 7895 gene locus_tag LOCUS_13480 7680 7895 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_13480 7951 8769 gene locus_tag LOCUS_13490 7951 8769 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_13490 8835 9677 gene locus_tag LOCUS_13500 8835 9677 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_13500 10582 9713 gene locus_tag LOCUS_13510 10582 9713 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence074 284 4219 gene locus_tag LOCUS_13520 gene purL 284 4219 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100278782.1 protein_id gnl|my_center|LOCUS_13520 4343 4756 gene locus_tag LOCUS_13530 4343 4756 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926122.1 protein_id gnl|my_center|LOCUS_13530 4966 5421 gene locus_tag LOCUS_13540 4966 5421 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 protein_id gnl|my_center|LOCUS_13540 5600 7597 gene locus_tag LOCUS_13550 5600 7597 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546785.1 protein_id gnl|my_center|LOCUS_13550 9498 7708 gene locus_tag LOCUS_13560 gene lpdA 9498 7708 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225155.1 protein_id gnl|my_center|LOCUS_13560 11184 9511 gene locus_tag LOCUS_13570 gene aceF 11184 9511 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_13570 <12165 11205 gene locus_tag LOCUS_13580 <12165 11205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199569.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type >Feature sequence075 2772 1318 gene locus_tag LOCUS_13590 gene rng 2772 1318 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_13590 3479 2841 gene locus_tag LOCUS_13600 3479 2841 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185695.1 protein_id gnl|my_center|LOCUS_13600 3960 3490 gene locus_tag LOCUS_13610 gene rlmH 3960 3490 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813199.1 protein_id gnl|my_center|LOCUS_13610 4315 3962 gene locus_tag LOCUS_13620 4315 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 5124 4432 gene locus_tag LOCUS_13630 gene nadD 5124 4432 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_13630 5917 5114 gene locus_tag LOCUS_13640 5917 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 6729 5926 gene locus_tag LOCUS_13650 6729 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 7604 6726 gene locus_tag LOCUS_13660 7604 6726 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_13660 8319 7711 gene locus_tag LOCUS_13670 8319 7711 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_13670 8639 8316 gene locus_tag LOCUS_13680 8639 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 9470 8745 gene locus_tag LOCUS_13690 9470 8745 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence076 1451 165 gene locus_tag LOCUS_13700 1451 165 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_13700 2758 1448 gene locus_tag LOCUS_13710 gene sufD 2758 1448 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_13710 3540 2755 gene locus_tag LOCUS_13720 gene sufC 3540 2755 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_13720 5027 3561 gene locus_tag LOCUS_13730 gene sufB 5027 3561 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_13730 5529 5032 gene locus_tag LOCUS_13740 5529 5032 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_13740 5785 5991 gene locus_tag LOCUS_13750 5785 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6163 6804 gene locus_tag LOCUS_13760 6163 6804 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_13760 6801 8813 gene locus_tag LOCUS_13770 6801 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9479 8874 gene locus_tag LOCUS_13780 gene gstA 9479 8874 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_13780 10241 9513 gene locus_tag LOCUS_13790 10241 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13790 10784 10350 gene locus_tag LOCUS_13800 10784 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 10970 11245 gene locus_tag LOCUS_13810 10970 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11246 11749 gene locus_tag LOCUS_13820 11246 11749 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence077 <1 843 gene locus_tag LOCUS_13830 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189256.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 916 2178 gene locus_tag LOCUS_13840 916 2178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957570.1 protein_id gnl|my_center|LOCUS_13840 2357 3130 gene locus_tag LOCUS_13850 2357 3130 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_13850 3277 5385 gene locus_tag LOCUS_13860 3277 5385 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_13860 7593 5407 gene locus_tag LOCUS_13870 7593 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 8681 7590 gene locus_tag LOCUS_13880 8681 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 9108 10352 gene locus_tag LOCUS_13890 9108 10352 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105434.1 protein_id gnl|my_center|LOCUS_13890 11323 10370 gene locus_tag LOCUS_13900 11323 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 11645 11415 gene locus_tag LOCUS_13910 11645 11415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence078 1293 2804 gene locus_tag LOCUS_13920 1293 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2804 4303 gene locus_tag LOCUS_13930 2804 4303 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188253.1 protein_id gnl|my_center|LOCUS_13930 4310 4963 gene locus_tag LOCUS_13940 4310 4963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_13940 5015 7240 gene locus_tag LOCUS_13950 5015 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7337 8116 gene locus_tag LOCUS_13960 gene hyi 7337 8116 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085951.1 protein_id gnl|my_center|LOCUS_13960 10959 8230 gene locus_tag LOCUS_13970 10959 8230 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence079 3156 1609 gene locus_tag LOCUS_13980 3156 1609 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_13980 4226 3153 gene locus_tag LOCUS_13990 gene cheB 4226 3153 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_13990 5905 4223 gene locus_tag LOCUS_14000 5905 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8820 6016 gene locus_tag LOCUS_14010 8820 6016 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_14010 10612 8930 gene locus_tag LOCUS_14020 10612 8930 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_14020 <11569 10620 gene locus_tag LOCUS_14030 <11569 10620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103940.1:nitrate/nitrite transporter >Feature sequence080 <1 1566 gene locus_tag LOCUS_14040 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetate--CoA ligase 1603 2841 gene locus_tag LOCUS_14050 1603 2841 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539814.1 protein_id gnl|my_center|LOCUS_14050 2838 3329 gene locus_tag LOCUS_14060 2838 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3326 4708 gene locus_tag LOCUS_14070 gene accC 3326 4708 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064215.1 protein_id gnl|my_center|LOCUS_14070 4710 6197 gene locus_tag LOCUS_14080 4710 6197 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_14080 6190 7071 gene locus_tag LOCUS_14090 6190 7071 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 protein_id gnl|my_center|LOCUS_14090 7199 8734 gene locus_tag LOCUS_14100 7199 8734 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390860.1 protein_id gnl|my_center|LOCUS_14100 8757 9560 gene locus_tag LOCUS_14110 8757 9560 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_14110 9602 10348 gene locus_tag LOCUS_14120 9602 10348 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence081 2029 1046 gene locus_tag LOCUS_14130 2029 1046 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_14130 3193 2096 gene locus_tag LOCUS_14140 gene pdhA 3193 2096 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213838.1 protein_id gnl|my_center|LOCUS_14140 4190 3519 gene locus_tag LOCUS_14150 4190 3519 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768999.1 protein_id gnl|my_center|LOCUS_14150 6271 4556 gene locus_tag LOCUS_14160 gene recJ 6271 4556 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_14160 7368 6268 gene locus_tag LOCUS_14170 7368 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 7565 7960 gene locus_tag LOCUS_14180 7565 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8088 10361 gene locus_tag LOCUS_14190 8088 10361 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence082 <1 1123 gene locus_tag LOCUS_14200 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192700.1:ATP-dependent DNA helicase 1181 1675 gene locus_tag LOCUS_14210 gene mobB 1181 1675 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_14210 1672 2877 gene locus_tag LOCUS_14220 1672 2877 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192374.1 protein_id gnl|my_center|LOCUS_14220 2920 3180 gene locus_tag LOCUS_14230 gene moaD 2920 3180 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_14230 3184 3750 gene locus_tag LOCUS_14240 gene moaE 3184 3750 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736458.1 protein_id gnl|my_center|LOCUS_14240 4458 3946 gene locus_tag LOCUS_14250 4458 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4699 5070 gene locus_tag LOCUS_14260 4699 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5276 5067 gene locus_tag LOCUS_14270 5276 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6652 5312 gene locus_tag LOCUS_14280 gene gorA 6652 5312 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 protein_id gnl|my_center|LOCUS_14280 6878 8689 gene locus_tag LOCUS_14290 6878 8689 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_14290 9315 8713 gene locus_tag LOCUS_14300 9315 8713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 9539 10489 gene locus_tag LOCUS_14310 9539 10489 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_14310 10649 11113 gene locus_tag LOCUS_14320 gene tadA 10649 11113 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence083 196 348 gene locus_tag LOCUS_14330 196 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 366 680 gene locus_tag LOCUS_14340 366 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 677 937 gene locus_tag LOCUS_14350 677 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1059 1346 gene locus_tag LOCUS_14360 1059 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1343 1573 gene locus_tag LOCUS_14370 1343 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1713 1946 gene locus_tag LOCUS_14380 1713 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1957 2160 gene locus_tag LOCUS_14390 1957 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2711 2424 gene locus_tag LOCUS_14400 2711 2424 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_14400 3000 2722 gene locus_tag LOCUS_14410 3000 2722 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_14410 4073 3036 gene locus_tag LOCUS_14420 4073 3036 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_14420 4733 6070 gene locus_tag LOCUS_14430 4733 6070 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057723.1 protein_id gnl|my_center|LOCUS_14430 8963 6267 gene locus_tag LOCUS_14440 8963 6267 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939279.1 protein_id gnl|my_center|LOCUS_14440 9218 9012 gene locus_tag LOCUS_14450 9218 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 9710 9231 gene locus_tag LOCUS_14460 9710 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 10905 9721 gene locus_tag LOCUS_14470 10905 9721 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence084 1588 113 gene locus_tag LOCUS_14480 gene nusA 1588 113 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810546.1 protein_id gnl|my_center|LOCUS_14480 2092 1616 gene locus_tag LOCUS_14490 gene rimP 2092 1616 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_14490 3498 2359 gene locus_tag LOCUS_14500 3498 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 4072 3470 gene locus_tag LOCUS_14510 4072 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 4880 4050 gene locus_tag LOCUS_14520 4880 4050 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_14520 6120 4918 gene locus_tag LOCUS_14530 6120 4918 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_14530 6789 6130 gene locus_tag LOCUS_14540 6789 6130 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_14540 7522 6815 gene locus_tag LOCUS_14550 7522 6815 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_14550 8417 7554 gene locus_tag LOCUS_14560 8417 7554 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_14560 9424 8528 gene locus_tag LOCUS_14570 gene ylqF 9424 8528 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_14570 9713 9922 gene locus_tag LOCUS_14580 9713 9922 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196837.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence085 616 353 gene locus_tag LOCUS_14590 616 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1505 609 gene locus_tag LOCUS_14600 1505 609 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_14600 2397 1516 gene locus_tag LOCUS_14610 2397 1516 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970417.1 protein_id gnl|my_center|LOCUS_14610 2475 3392 gene locus_tag LOCUS_14620 gene ybiB 2475 3392 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210242.1 protein_id gnl|my_center|LOCUS_14620 4343 3450 gene locus_tag LOCUS_14630 4343 3450 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_14630 5061 4462 gene locus_tag LOCUS_14640 5061 4462 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_14640 5158 6054 gene locus_tag LOCUS_14650 5158 6054 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 protein_id gnl|my_center|LOCUS_14650 6205 6708 gene locus_tag LOCUS_14660 6205 6708 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_14660 7003 6782 gene locus_tag LOCUS_14670 7003 6782 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_14670 10275 7000 gene locus_tag LOCUS_14680 10275 7000 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_14680 <11238 10290 gene locus_tag LOCUS_14690 <11238 10290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000646058.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence086 6 137 gene locus_tag LOCUS_14700 6 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 225 536 gene locus_tag LOCUS_14710 gene rpsJ 225 536 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_14710 649 1287 gene locus_tag LOCUS_14720 gene rplC 649 1287 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_14720 1298 1918 gene locus_tag LOCUS_14730 gene rplD 1298 1918 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806905.1 protein_id gnl|my_center|LOCUS_14730 1915 2220 gene locus_tag LOCUS_14740 gene rplW 1915 2220 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199275.1 protein_id gnl|my_center|LOCUS_14740 2227 3054 gene locus_tag LOCUS_14750 gene rplB 2227 3054 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_14750 3065 3340 gene locus_tag LOCUS_14760 gene rpsS 3065 3340 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690082.1 protein_id gnl|my_center|LOCUS_14760 3355 3684 gene locus_tag LOCUS_14770 gene rplV 3355 3684 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_14770 3694 4464 gene locus_tag LOCUS_14780 gene rpsC 3694 4464 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 protein_id gnl|my_center|LOCUS_14780 4464 4880 gene locus_tag LOCUS_14790 gene rplP 4464 4880 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_14790 4883 5077 gene locus_tag LOCUS_14800 gene rpmC 4883 5077 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806912.1 protein_id gnl|my_center|LOCUS_14800 5074 5343 gene locus_tag LOCUS_14810 gene rpsQ 5074 5343 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201274.1 protein_id gnl|my_center|LOCUS_14810 5497 5865 gene locus_tag LOCUS_14820 gene rplN 5497 5865 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_14820 5877 6194 gene locus_tag LOCUS_14830 gene rplX 5877 6194 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806917.1 protein_id gnl|my_center|LOCUS_14830 6204 6743 gene locus_tag LOCUS_14840 gene rplE 6204 6743 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202757.1 protein_id gnl|my_center|LOCUS_14840 6751 7056 gene locus_tag LOCUS_14850 gene rpsN 6751 7056 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_14850 7070 7465 gene locus_tag LOCUS_14860 gene rpsH 7070 7465 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_14860 7476 8009 gene locus_tag LOCUS_14870 gene rplF 7476 8009 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_14870 8021 8374 gene locus_tag LOCUS_14880 gene rplR 8021 8374 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_14880 8387 8911 gene locus_tag LOCUS_14890 gene rpsE 8387 8911 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_14890 8915 9097 gene locus_tag LOCUS_14900 gene rpmD 8915 9097 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_14900 9099 9536 gene locus_tag LOCUS_14910 gene rplO 9099 9536 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_14910 9552 10877 gene locus_tag LOCUS_14920 gene secY 9552 10877 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_14920 10881 11099 gene locus_tag LOCUS_14930 gene infA 10881 11099 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence087 192 1658 gene locus_tag LOCUS_14940 192 1658 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_14940 3143 1764 gene locus_tag LOCUS_14950 3143 1764 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_14950 3445 3140 gene locus_tag LOCUS_14960 3445 3140 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_14960 4584 3460 gene locus_tag LOCUS_14970 4584 3460 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_14970 5628 4849 gene locus_tag LOCUS_14980 5628 4849 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_14980 6922 5678 gene locus_tag LOCUS_14990 gene glcF 6922 5678 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_14990 7995 6925 gene locus_tag LOCUS_15000 gene glcE 7995 6925 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_15000 8295 8143 gene locus_tag LOCUS_15010 8295 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 9821 8310 gene locus_tag LOCUS_15020 9821 8310 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_15020 10960 10079 gene locus_tag LOCUS_15030 10960 10079 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530154.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence088 866 228 gene locus_tag LOCUS_15040 gene leuD 866 228 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_15040 994 866 gene locus_tag LOCUS_15050 994 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2433 1024 gene locus_tag LOCUS_15060 gene leuC 2433 1024 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219221.1 protein_id gnl|my_center|LOCUS_15060 3331 2513 gene locus_tag LOCUS_15070 3331 2513 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_15070 4504 3344 gene locus_tag LOCUS_15080 4504 3344 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_15080 5798 4668 gene locus_tag LOCUS_15090 gene aroC 5798 4668 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534774.1 protein_id gnl|my_center|LOCUS_15090 6257 5940 gene locus_tag LOCUS_15100 gene ilvN 6257 5940 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211026.1 protein_id gnl|my_center|LOCUS_15100 7924 6257 gene locus_tag LOCUS_15110 gene ilvB 7924 6257 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298157.1 protein_id gnl|my_center|LOCUS_15110 9926 8217 gene locus_tag LOCUS_15120 9926 8217 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_15120 10464 10003 gene locus_tag LOCUS_15130 10464 10003 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_15130 10889 10566 gene locus_tag LOCUS_15140 10889 10566 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence089 <1 963 gene locus_tag LOCUS_15150 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092351.1:S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase 1227 2837 gene locus_tag LOCUS_15160 1227 2837 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_15160 2926 4803 gene locus_tag LOCUS_15170 2926 4803 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_15170 4814 5578 gene locus_tag LOCUS_15180 4814 5578 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477841.1 protein_id gnl|my_center|LOCUS_15180 6691 5636 gene locus_tag LOCUS_15190 6691 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7383 6955 gene locus_tag LOCUS_15200 7383 6955 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_15200 8035 7472 gene locus_tag LOCUS_15210 8035 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9385 8063 gene locus_tag LOCUS_15220 9385 8063 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543738.1 protein_id gnl|my_center|LOCUS_15220 10489 9929 gene locus_tag LOCUS_15230 10489 9929 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence090 <1 822 gene locus_tag LOCUS_15240 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523004.1:nitronate monooxygenase family protein 2713 827 gene locus_tag LOCUS_15250 2713 827 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_15250 2977 4491 gene locus_tag LOCUS_15260 2977 4491 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969871.1 protein_id gnl|my_center|LOCUS_15260 4630 5781 gene locus_tag LOCUS_15270 gene yiaY 4630 5781 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388685.1 protein_id gnl|my_center|LOCUS_15270 6062 6286 gene locus_tag LOCUS_15280 6062 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7395 6307 gene locus_tag LOCUS_15290 gene mutY 7395 6307 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522857.1 protein_id gnl|my_center|LOCUS_15290 7545 8042 gene locus_tag LOCUS_15300 7545 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9213 8011 gene locus_tag LOCUS_15310 9213 8011 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_15310 9540 9815 gene locus_tag LOCUS_15320 gene hupB 9540 9815 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence091 1347 637 gene locus_tag LOCUS_15330 gene fabG 1347 637 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_15330 1971 1426 gene locus_tag LOCUS_15340 1971 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2475 2008 gene locus_tag LOCUS_15350 2475 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2778 2533 gene locus_tag LOCUS_15360 2778 2533 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_15360 3652 2804 gene locus_tag LOCUS_15370 3652 2804 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_15370 4971 3655 gene locus_tag LOCUS_15380 4971 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 6280 4982 gene locus_tag LOCUS_15390 6280 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7443 6283 gene locus_tag LOCUS_15400 gene hadC 7443 6283 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_15400 8222 7446 gene locus_tag LOCUS_15410 8222 7446 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 protein_id gnl|my_center|LOCUS_15410 9355 8222 gene locus_tag LOCUS_15420 9355 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10473 9406 gene locus_tag LOCUS_15430 10473 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence092 444 1640 gene locus_tag LOCUS_15440 gene coaBC 444 1640 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 protein_id gnl|my_center|LOCUS_15440 1725 2174 gene locus_tag LOCUS_15450 gene dut 1725 2174 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_15450 2174 2599 gene locus_tag LOCUS_15460 2174 2599 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816000.1 protein_id gnl|my_center|LOCUS_15460 3210 5447 gene locus_tag LOCUS_15470 3210 5447 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_15470 5766 6020 gene locus_tag LOCUS_15480 5766 6020 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_15480 6033 7838 gene locus_tag LOCUS_15490 6033 7838 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_15490 8016 8405 gene locus_tag LOCUS_15500 8016 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8769 8464 gene locus_tag LOCUS_15510 8769 8464 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256445.1 protein_id gnl|my_center|LOCUS_15510 10893 8824 gene locus_tag LOCUS_15520 gene fusA 10893 8824 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence093 2632 2432 gene locus_tag LOCUS_15530 2632 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4790 2826 gene locus_tag LOCUS_15540 gene acs 4790 2826 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_15540 5067 6599 gene locus_tag LOCUS_15550 5067 6599 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_15550 9757 6662 gene locus_tag LOCUS_15560 9757 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 <10784 9950 gene locus_tag LOCUS_15570 <10784 9950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803576.1:phosphoenolpyruvate synthase >Feature sequence094 2780 1398 gene locus_tag LOCUS_15580 2780 1398 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483346.1 protein_id gnl|my_center|LOCUS_15580 4077 3556 gene locus_tag LOCUS_15590 4077 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5213 4092 gene locus_tag LOCUS_15600 5213 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5602 6801 gene locus_tag LOCUS_15610 5602 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6812 6736 gene locus_tag LOCUS_t00260 6812 6736 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6959 7420 gene locus_tag LOCUS_15620 6959 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9563 7566 gene locus_tag LOCUS_15630 9563 7566 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_15630 9866 10513 gene locus_tag LOCUS_15640 9866 10513 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence095 1678 377 gene locus_tag LOCUS_15650 gene macA 1678 377 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526928.1 protein_id gnl|my_center|LOCUS_15650 1960 2490 gene locus_tag LOCUS_15660 1960 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3016 2600 gene locus_tag LOCUS_15670 3016 2600 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205242.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15670 3774 2947 gene locus_tag LOCUS_15680 3774 2947 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 protein_id gnl|my_center|LOCUS_15680 4508 3777 gene locus_tag LOCUS_15690 4508 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 5111 4632 gene locus_tag LOCUS_15700 gene bfr 5111 4632 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_15700 5347 5108 gene locus_tag LOCUS_15710 5347 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5595 5389 gene locus_tag LOCUS_15720 5595 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6239 5781 gene locus_tag LOCUS_15730 6239 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 7419 6226 gene locus_tag LOCUS_15740 7419 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_15740 9863 7416 gene locus_tag LOCUS_15750 9863 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 <10717 9961 gene locus_tag LOCUS_15760 <10717 9961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010928183.1:malonyl-CoA decarboxylase family protein >Feature sequence096 <1 2691 gene locus_tag LOCUS_15770 <1 2691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074281.1:efflux RND transporter permease subunit 2693 4168 gene locus_tag LOCUS_15780 gene oprM 2693 4168 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_15780 4241 5038 gene locus_tag LOCUS_15790 4241 5038 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072112.1 protein_id gnl|my_center|LOCUS_15790 5098 6132 gene locus_tag LOCUS_15800 5098 6132 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_15800 6700 6227 gene locus_tag LOCUS_15810 6700 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6939 9398 gene locus_tag LOCUS_15820 6939 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence097 <1 1993 gene locus_tag LOCUS_15830 <1 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000098688.1:transketolase 2119 3147 gene locus_tag LOCUS_15840 gene gap 2119 3147 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002236620.1 protein_id gnl|my_center|LOCUS_15840 3227 4411 gene locus_tag LOCUS_15850 3227 4411 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064312.1 protein_id gnl|my_center|LOCUS_15850 4531 5985 gene locus_tag LOCUS_15860 gene pyk 4531 5985 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_15860 6093 7157 gene locus_tag LOCUS_15870 gene fba 6093 7157 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_15870 7198 9606 gene locus_tag LOCUS_15880 7198 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10277 9627 gene locus_tag LOCUS_15890 10277 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence098 771 2162 gene locus_tag LOCUS_15900 771 2162 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_15900 2307 2504 gene locus_tag LOCUS_15910 2307 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5243 2610 gene locus_tag LOCUS_15920 gene alaS 5243 2610 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_15920 5392 5943 gene locus_tag LOCUS_15930 5392 5943 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_15930 7017 5944 gene locus_tag LOCUS_15940 gene dinB 7017 5944 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191702.1 protein_id gnl|my_center|LOCUS_15940 8241 7168 gene locus_tag LOCUS_15950 gene aroG 8241 7168 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_15950 8483 9415 gene locus_tag LOCUS_15960 gene msrP 8483 9415 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_15960 9533 10195 gene locus_tag LOCUS_15970 gene msrQ 9533 10195 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065084.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence099 1107 460 gene locus_tag LOCUS_15980 1107 460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_15980 1889 1104 gene locus_tag LOCUS_15990 1889 1104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_15990 2830 1886 gene locus_tag LOCUS_16000 2830 1886 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_16000 3729 2830 gene locus_tag LOCUS_16010 3729 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5154 3841 gene locus_tag LOCUS_16020 5154 3841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_16020 6511 5186 gene locus_tag LOCUS_16030 6511 5186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 protein_id gnl|my_center|LOCUS_16030 8107 6737 gene locus_tag LOCUS_16040 gene atoC 8107 6737 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_16040 9723 8104 gene locus_tag LOCUS_16050 9723 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 <10550 10005 gene locus_tag LOCUS_16060 <10550 10005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189890.1:FAD-binding protein >Feature sequence100 1592 255 gene locus_tag LOCUS_16070 1592 255 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706263.1 protein_id gnl|my_center|LOCUS_16070 2889 1633 gene locus_tag LOCUS_16080 2889 1633 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 protein_id gnl|my_center|LOCUS_16080 3694 3041 gene locus_tag LOCUS_16090 gene adk 3694 3041 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_16090 4595 3786 gene locus_tag LOCUS_16100 gene kdsB 4595 3786 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367464.1 protein_id gnl|my_center|LOCUS_16100 4792 4601 gene locus_tag LOCUS_16110 4792 4601 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_16110 5765 4773 gene locus_tag LOCUS_16120 gene lpxK 5765 4773 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_16120 6207 5776 gene locus_tag LOCUS_16130 6207 5776 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_16130 6830 6222 gene locus_tag LOCUS_16140 6830 6222 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_16140 7177 8562 gene locus_tag LOCUS_16150 gene xseA 7177 8562 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_16150 8741 9325 gene locus_tag LOCUS_16160 gene sodB 8741 9325 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064087.1 protein_id gnl|my_center|LOCUS_16160 9364 10209 gene locus_tag LOCUS_16170 gene truC 9364 10209 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071776.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence101 80 613 gene locus_tag LOCUS_16180 80 613 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_16180 625 2058 gene locus_tag LOCUS_16190 gene rsxC 625 2058 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_16190 2058 3140 gene locus_tag LOCUS_16200 2058 3140 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_16200 3137 3811 gene locus_tag LOCUS_16210 gene rsxG 3137 3811 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_16210 3808 4485 gene locus_tag LOCUS_16220 3808 4485 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561393.1 protein_id gnl|my_center|LOCUS_16220 4512 4808 gene locus_tag LOCUS_16230 4512 4808 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723777.1 protein_id gnl|my_center|LOCUS_16230 5316 4834 gene locus_tag LOCUS_16240 5316 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6873 5671 gene locus_tag LOCUS_16250 gene pcaF 6873 5671 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039581.1 protein_id gnl|my_center|LOCUS_16250 7569 6931 gene locus_tag LOCUS_16260 7569 6931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810741.1 protein_id gnl|my_center|LOCUS_16260 8726 7659 gene locus_tag LOCUS_16270 gene paaK 8726 7659 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551026.1 protein_id gnl|my_center|LOCUS_16270 9254 8763 gene locus_tag LOCUS_16280 gene paaJ 9254 8763 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551025.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16280 10046 9294 gene locus_tag LOCUS_16290 gene paaC 10046 9294 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199193.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence102 3447 2464 gene locus_tag LOCUS_16300 3447 2464 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_16300 3964 3458 gene locus_tag LOCUS_16310 3964 3458 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269200.1 protein_id gnl|my_center|LOCUS_16310 4364 4738 gene locus_tag LOCUS_16320 4364 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 6993 4876 gene locus_tag LOCUS_16330 6993 4876 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_16330 8657 7206 gene locus_tag LOCUS_16340 gene ompQ 8657 7206 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_16340 <10394 8654 gene locus_tag LOCUS_16350 <10394 8654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037397097.1:MacB family efflux pump subunit >Feature sequence103 <1 2416 gene locus_tag LOCUS_16360 <1 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193113.1:phenylalanine--tRNA ligase subunit beta 2418 2723 gene locus_tag LOCUS_16370 2418 2723 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_16370 2704 3084 gene locus_tag LOCUS_16380 2704 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3145 3221 gene locus_tag LOCUS_t00270 3145 3221 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3353 4096 gene locus_tag LOCUS_16390 gene surE 3353 4096 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527164.1 protein_id gnl|my_center|LOCUS_16390 4093 4746 gene locus_tag LOCUS_16400 4093 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4761 5600 gene locus_tag LOCUS_16410 4761 5600 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192107.1 protein_id gnl|my_center|LOCUS_16410 5612 6547 gene locus_tag LOCUS_16420 gene rpoS 5612 6547 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193640.1 protein_id gnl|my_center|LOCUS_16420 7448 6645 gene locus_tag LOCUS_16430 7448 6645 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_16430 8638 7595 gene locus_tag LOCUS_16440 8638 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 8947 9873 gene locus_tag LOCUS_16450 8947 9873 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence104 <1 1185 gene locus_tag LOCUS_16460 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057696.1:GGDEF domain-containing phosphodiesterase 1212 2177 gene locus_tag LOCUS_16470 gene corA 1212 2177 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521393.1 protein_id gnl|my_center|LOCUS_16470 2477 3250 gene locus_tag LOCUS_16480 2477 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3329 4105 gene locus_tag LOCUS_16490 3329 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4214 4630 gene locus_tag LOCUS_16500 4214 4630 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_16500 5191 4625 gene locus_tag LOCUS_16510 5191 4625 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_16510 6620 5232 gene locus_tag LOCUS_16520 6620 5232 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_16520 7505 6711 gene locus_tag LOCUS_16530 7505 6711 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195510.1 protein_id gnl|my_center|LOCUS_16530 8314 7505 gene locus_tag LOCUS_16540 8314 7505 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704666.1 protein_id gnl|my_center|LOCUS_16540 9150 8320 gene locus_tag LOCUS_16550 9150 8320 CDS product molybdenum cofactor biosynthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113031.1 protein_id gnl|my_center|LOCUS_16550 9245 9961 gene locus_tag LOCUS_16560 9245 9961 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275352.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence105 1745 837 gene locus_tag LOCUS_16570 1745 837 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926441.1 protein_id gnl|my_center|LOCUS_16570 2484 1927 gene locus_tag LOCUS_16580 2484 1927 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_16580 2946 2596 gene locus_tag LOCUS_16590 2946 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3398 3012 gene locus_tag LOCUS_16600 3398 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6558 3439 gene locus_tag LOCUS_16610 6558 3439 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_16610 7686 6574 gene locus_tag LOCUS_16620 7686 6574 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_16620 8246 7683 gene locus_tag LOCUS_16630 8246 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 9529 8264 gene locus_tag LOCUS_16640 9529 8264 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201245837.1 protein_id gnl|my_center|LOCUS_16640 10008 9661 gene locus_tag LOCUS_16650 10008 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence106 <1 1087 gene locus_tag LOCUS_16660 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199566.1:peptide chain release factor 2 1189 2511 gene locus_tag LOCUS_16670 1189 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2539 3249 gene locus_tag LOCUS_16680 2539 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3254 4342 gene locus_tag LOCUS_16690 gene trmA 3254 4342 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105105.1 protein_id gnl|my_center|LOCUS_16690 4364 7156 gene locus_tag LOCUS_16700 4364 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7276 8775 gene locus_tag LOCUS_16710 gene lysS 7276 8775 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039707.1 protein_id gnl|my_center|LOCUS_16710 9624 8830 gene locus_tag LOCUS_16720 9624 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence107 1256 864 gene locus_tag LOCUS_16730 1256 864 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_16730 1543 2349 gene locus_tag LOCUS_16740 1543 2349 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_16740 3376 2381 gene locus_tag LOCUS_16750 3376 2381 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391451.1 protein_id gnl|my_center|LOCUS_16750 4307 3441 gene locus_tag LOCUS_16760 4307 3441 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_16760 5212 4346 gene locus_tag LOCUS_16770 5212 4346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_16770 5398 5234 gene locus_tag LOCUS_16780 5398 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5865 5395 gene locus_tag LOCUS_16790 5865 5395 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16790 5991 6596 gene locus_tag LOCUS_16800 5991 6596 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_16800 6658 7392 gene locus_tag LOCUS_16810 6658 7392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769006.1 protein_id gnl|my_center|LOCUS_16810 7436 8722 gene locus_tag LOCUS_16820 7436 8722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_16820 8737 9354 gene locus_tag LOCUS_16830 8737 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence108 <1 1011 gene locus_tag LOCUS_16840 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112650.1:aerotaxis transducer Aer2 1385 3238 gene locus_tag LOCUS_16850 1385 3238 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925920.1 protein_id gnl|my_center|LOCUS_16850 3235 3864 gene locus_tag LOCUS_16860 3235 3864 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970482.1 protein_id gnl|my_center|LOCUS_16860 7123 4028 gene locus_tag LOCUS_16870 7123 4028 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064356.1 protein_id gnl|my_center|LOCUS_16870 8246 7149 gene locus_tag LOCUS_16880 gene nrfD 8246 7149 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707058.1 protein_id gnl|my_center|LOCUS_16880 9021 8269 gene locus_tag LOCUS_16890 9021 8269 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707059.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence109 551 1201 gene locus_tag LOCUS_16900 551 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1321 2088 gene locus_tag LOCUS_16910 1321 2088 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_16910 2135 4501 gene locus_tag LOCUS_16920 2135 4501 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943246.1 protein_id gnl|my_center|LOCUS_16920 4564 5259 gene locus_tag LOCUS_16930 gene rpe 4564 5259 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_16930 5256 5939 gene locus_tag LOCUS_16940 5256 5939 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_16940 6232 7704 gene locus_tag LOCUS_16950 gene trpE 6232 7704 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_16950 7809 8396 gene locus_tag LOCUS_16960 7809 8396 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 protein_id gnl|my_center|LOCUS_16960 8415 9455 gene locus_tag LOCUS_16970 gene trpD 8415 9455 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence110 641 2005 gene locus_tag LOCUS_16980 641 2005 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_16980 2170 3306 gene locus_tag LOCUS_16990 2170 3306 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_16990 3306 5702 gene locus_tag LOCUS_17000 3306 5702 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_17000 5721 6191 gene locus_tag LOCUS_17010 5721 6191 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_17010 6313 7395 gene locus_tag LOCUS_17020 6313 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9262 7433 gene locus_tag LOCUS_17030 9262 7433 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267928.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence111 1503 1162 gene locus_tag LOCUS_17040 1503 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2742 1543 gene locus_tag LOCUS_17050 2742 1543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_17050 3956 2748 gene locus_tag LOCUS_17060 3956 2748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_17060 4764 4072 gene locus_tag LOCUS_17070 4764 4072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_17070 5949 4798 gene locus_tag LOCUS_17080 5949 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6112 5963 gene locus_tag LOCUS_17090 6112 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 7879 6137 gene locus_tag LOCUS_17100 7879 6137 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_17100 8061 8444 gene locus_tag LOCUS_17110 gene crcB 8061 8444 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208262.1 protein_id gnl|my_center|LOCUS_17110 8581 9246 gene locus_tag LOCUS_17120 8581 9246 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927036.1 protein_id gnl|my_center|LOCUS_17120 <9999 9328 gene locus_tag LOCUS_17130 <9999 9328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118645.1:DEAD/DEAH box helicase >Feature sequence112 248 3784 gene locus_tag LOCUS_17140 248 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3917 5674 gene locus_tag LOCUS_17150 3917 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6575 5688 gene locus_tag LOCUS_17160 6575 5688 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 protein_id gnl|my_center|LOCUS_17160 6744 7706 gene locus_tag LOCUS_17170 6744 7706 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 protein_id gnl|my_center|LOCUS_17170 7823 9505 gene locus_tag LOCUS_17180 7823 9505 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 protein_id gnl|my_center|LOCUS_17180 9517 9741 gene locus_tag LOCUS_17190 9517 9741 CDS product DUF2783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808487.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence113 694 371 gene locus_tag LOCUS_17200 gene fliE 694 371 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534368.1 protein_id gnl|my_center|LOCUS_17200 917 2587 gene locus_tag LOCUS_17210 gene fliF 917 2587 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704955.1 protein_id gnl|my_center|LOCUS_17210 2580 3593 gene locus_tag LOCUS_17220 gene fliG 2580 3593 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367292.1 protein_id gnl|my_center|LOCUS_17220 3586 4365 gene locus_tag LOCUS_17230 3586 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4358 5776 gene locus_tag LOCUS_17240 gene fliI 4358 5776 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097732.1 protein_id gnl|my_center|LOCUS_17240 5773 6231 gene locus_tag LOCUS_17250 5773 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 6331 7659 gene locus_tag LOCUS_17260 6331 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17260 7786 8259 gene locus_tag LOCUS_17270 7786 8259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 8275 9309 gene locus_tag LOCUS_17280 gene fliM 8275 9309 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043526237.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence114 <1 2195 gene locus_tag LOCUS_17290 <1 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095207.1:carbamoyl-phosphate synthase large subunit 2192 2668 gene locus_tag LOCUS_17300 gene greA 2192 2668 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_17300 3286 2831 gene locus_tag LOCUS_17310 3286 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3376 3999 gene locus_tag LOCUS_17320 3376 3999 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698155.1 protein_id gnl|my_center|LOCUS_17320 4127 6019 gene locus_tag LOCUS_17330 gene ftsH 4127 6019 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_17330 6200 7030 gene locus_tag LOCUS_17340 gene folP 6200 7030 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193216.1 protein_id gnl|my_center|LOCUS_17340 7063 8415 gene locus_tag LOCUS_17350 gene glmM 7063 8415 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_17350 8533 9531 gene locus_tag LOCUS_17360 8533 9531 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence115 1186 719 gene locus_tag LOCUS_17370 gene rpsG 1186 719 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_17370 1597 1220 gene locus_tag LOCUS_17380 gene rpsL 1597 1220 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005017264.1 protein_id gnl|my_center|LOCUS_17380 5946 1732 gene locus_tag LOCUS_17390 gene rpoC 5946 1732 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818292.1 protein_id gnl|my_center|LOCUS_17390 <9550 6022 gene locus_tag LOCUS_17400 <9550 6022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198365.1:DNA-directed RNA polymerase subunit beta >Feature sequence116 <1 643 gene locus_tag LOCUS_17410 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548106.1:acyl-CoA ligase (AMP-forming), exosortase A system-associated 716 1969 gene locus_tag LOCUS_17420 716 1969 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_17420 2477 2037 gene locus_tag LOCUS_17430 2477 2037 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_17430 3016 2633 gene locus_tag LOCUS_17440 3016 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3378 3013 gene locus_tag LOCUS_17450 3378 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3523 3852 gene locus_tag LOCUS_17460 gene grxD 3523 3852 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929959.1 protein_id gnl|my_center|LOCUS_17460 5483 4035 gene locus_tag LOCUS_17470 gene argH 5483 4035 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812010.1 protein_id gnl|my_center|LOCUS_17470 8476 5708 gene locus_tag LOCUS_17480 gene ppc 8476 5708 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence117 <1 530 gene locus_tag LOCUS_17490 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208331.1:glutamate-5-semialdehyde dehydrogenase 594 1043 gene locus_tag LOCUS_17500 594 1043 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_17500 1040 2059 gene locus_tag LOCUS_17510 gene xerD 1040 2059 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_17510 2132 2620 gene locus_tag LOCUS_17520 gene ybaK 2132 2620 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_17520 2801 3160 gene locus_tag LOCUS_17530 2801 3160 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383915.1 protein_id gnl|my_center|LOCUS_17530 3614 3240 gene locus_tag LOCUS_17540 3614 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3780 4373 gene locus_tag LOCUS_17550 gene plsY 3780 4373 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_17550 5495 4461 gene locus_tag LOCUS_17560 gene tsaD 5495 4461 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_17560 5633 5845 gene locus_tag LOCUS_17570 gene rpsU 5633 5845 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006218592.1 protein_id gnl|my_center|LOCUS_17570 5997 7853 gene locus_tag LOCUS_17580 5997 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence118 2 1162 gene locus_tag LOCUS_17590 2 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1560 1177 gene locus_tag LOCUS_17600 1560 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1805 1554 gene locus_tag LOCUS_17610 1805 1554 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_17610 1993 2484 gene locus_tag LOCUS_17620 1993 2484 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_17620 2675 2520 gene locus_tag LOCUS_17630 2675 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2950 3153 gene locus_tag LOCUS_17640 2950 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3254 3598 gene locus_tag LOCUS_17650 3254 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3595 3855 gene locus_tag LOCUS_17660 3595 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4461 4027 gene locus_tag LOCUS_17670 4461 4027 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704258.1 protein_id gnl|my_center|LOCUS_17670 7327 4682 gene locus_tag LOCUS_17680 7327 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 8655 7738 gene locus_tag LOCUS_17690 8655 7738 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969642.1 protein_id gnl|my_center|LOCUS_17690 8793 9344 gene locus_tag LOCUS_17700 8793 9344 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence119 1112 1696 gene locus_tag LOCUS_17710 1112 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1704 2216 gene locus_tag LOCUS_17720 1704 2216 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_17720 2213 2710 gene locus_tag LOCUS_17730 2213 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3936 2728 gene locus_tag LOCUS_17740 3936 2728 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_17740 5192 3999 gene locus_tag LOCUS_17750 5192 3999 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087191.1 protein_id gnl|my_center|LOCUS_17750 5474 6517 gene locus_tag LOCUS_17760 5474 6517 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815946.1 protein_id gnl|my_center|LOCUS_17760 6572 8395 gene locus_tag LOCUS_17770 gene phaC 6572 8395 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_17770 8472 8975 gene locus_tag LOCUS_17780 8472 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence120 38 1114 gene locus_tag LOCUS_17790 gene tal 38 1114 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689551.1 protein_id gnl|my_center|LOCUS_17790 1140 1688 gene locus_tag LOCUS_17800 1140 1688 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_17800 1801 2385 gene locus_tag LOCUS_17810 gene rsxA 1801 2385 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072471.1 protein_id gnl|my_center|LOCUS_17810 2489 3040 gene locus_tag LOCUS_17820 gene rsxB 2489 3040 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_17820 3037 4764 gene locus_tag LOCUS_17830 3037 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 4772 5791 gene locus_tag LOCUS_17840 gene rsxD 4772 5791 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210599.1 protein_id gnl|my_center|LOCUS_17840 5788 6459 gene locus_tag LOCUS_17850 gene rsxG 5788 6459 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_17850 6459 7163 gene locus_tag LOCUS_17860 6459 7163 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_17860 7178 7810 gene locus_tag LOCUS_17870 gene nth 7178 7810 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_17870 7917 8351 gene locus_tag LOCUS_17880 7917 8351 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence121 322 789 gene locus_tag LOCUS_17890 322 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 783 1769 gene locus_tag LOCUS_17900 783 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3121 1721 gene locus_tag LOCUS_17910 3121 1721 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_17910 3966 3118 gene locus_tag LOCUS_17920 3966 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4577 3969 gene locus_tag LOCUS_17930 gene cobO 4577 3969 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_17930 5459 4656 gene locus_tag LOCUS_17940 5459 4656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_17940 6472 5456 gene locus_tag LOCUS_17950 6472 5456 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_17950 8308 6479 gene locus_tag LOCUS_17960 gene btuB 8308 6479 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_17960 8814 9362 gene locus_tag LOCUS_17970 gene cobU 8814 9362 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence122 1175 198 gene locus_tag LOCUS_17980 gene cysK 1175 198 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 protein_id gnl|my_center|LOCUS_17980 1374 3893 gene locus_tag LOCUS_17990 1374 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 6738 3922 gene locus_tag LOCUS_18000 6738 3922 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_18000 7023 8267 gene locus_tag LOCUS_18010 7023 8267 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611273.1 protein_id gnl|my_center|LOCUS_18010 8330 9091 gene locus_tag LOCUS_18020 8330 9091 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117975.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence123 156 1409 gene locus_tag LOCUS_18030 156 1409 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_18030 1876 1535 gene locus_tag LOCUS_18040 1876 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2449 1892 gene locus_tag LOCUS_18050 2449 1892 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_18050 5845 2561 gene locus_tag LOCUS_18060 5845 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8728 6110 gene locus_tag LOCUS_18070 8728 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 <9283 8765 gene locus_tag LOCUS_18080 <9283 8765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225717.1:exodeoxyribonuclease III >Feature sequence124 544 251 gene locus_tag LOCUS_18090 544 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 543 1148 gene locus_tag LOCUS_18100 543 1148 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536930.1 protein_id gnl|my_center|LOCUS_18100 1359 1694 gene locus_tag LOCUS_18110 1359 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1862 2398 gene locus_tag LOCUS_18120 1862 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2402 3901 gene locus_tag LOCUS_18130 2402 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3898 4512 gene locus_tag LOCUS_18140 3898 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 4509 5150 gene locus_tag LOCUS_18150 4509 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6596 5208 gene locus_tag LOCUS_18160 6596 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 6810 7646 gene locus_tag LOCUS_18170 6810 7646 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_18170 7768 8490 gene locus_tag LOCUS_18180 7768 8490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966372.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence125 1616 471 gene locus_tag LOCUS_18190 gene ftsZ 1616 471 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_18190 2969 1740 gene locus_tag LOCUS_18200 gene ftsA 2969 1740 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_18200 3823 2966 gene locus_tag LOCUS_18210 3823 2966 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_18210 4730 3816 gene locus_tag LOCUS_18220 4730 3816 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_18220 6142 4727 gene locus_tag LOCUS_18230 gene murC 6142 4727 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_18230 7191 6139 gene locus_tag LOCUS_18240 gene murG 7191 6139 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_18240 8435 7206 gene locus_tag LOCUS_18250 gene ftsW 8435 7206 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814574.1 protein_id gnl|my_center|LOCUS_18250 <9236 8432 gene locus_tag LOCUS_18260 <9236 8432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002224926.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence126 <1 853 gene locus_tag LOCUS_18270 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524502.1:uroporphyrinogen decarboxylase 1257 3434 gene locus_tag LOCUS_18280 1257 3434 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247688.1 protein_id gnl|my_center|LOCUS_18280 4870 3464 gene locus_tag LOCUS_18290 gene mapR 4870 3464 CDS product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201419982.1 protein_id gnl|my_center|LOCUS_18290 4992 5609 gene locus_tag LOCUS_18300 4992 5609 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_18300 5613 5924 gene locus_tag LOCUS_18310 5613 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 6608 5961 gene locus_tag LOCUS_18320 gene can 6608 5961 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_18320 7252 6746 gene locus_tag LOCUS_18330 7252 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 8450 7323 gene locus_tag LOCUS_18340 8450 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <9158 8447 gene locus_tag LOCUS_18350 <9158 8447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189255.1:response regulator >Feature sequence127 <1 1034 gene locus_tag LOCUS_18360 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193856.1:homoserine dehydrogenase 1161 1823 gene locus_tag LOCUS_18370 1161 1823 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113716.1 protein_id gnl|my_center|LOCUS_18370 1851 1994 gene locus_tag LOCUS_18380 1851 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2017 2229 gene locus_tag LOCUS_18390 2017 2229 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898900.1 protein_id gnl|my_center|LOCUS_18390 2281 3783 gene locus_tag LOCUS_18400 gene thrC 2281 3783 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_18400 4095 3835 gene locus_tag LOCUS_18410 gene minE 4095 3835 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186076.1 protein_id gnl|my_center|LOCUS_18410 4909 4097 gene locus_tag LOCUS_18420 gene minD 4909 4097 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_18420 5875 4943 gene locus_tag LOCUS_18430 gene minC 5875 4943 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_18430 6735 5872 gene locus_tag LOCUS_18440 6735 5872 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 protein_id gnl|my_center|LOCUS_18440 7106 6732 gene locus_tag LOCUS_18450 7106 6732 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102247109.1 protein_id gnl|my_center|LOCUS_18450 <9140 7123 gene locus_tag LOCUS_18460 <9140 7123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100071.1:Tex family protein >Feature sequence128 74 472 gene locus_tag LOCUS_18470 gene rplQ 74 472 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_18470 812 588 gene locus_tag LOCUS_18480 812 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 750 1418 gene locus_tag LOCUS_18490 750 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18490 1422 1616 gene locus_tag LOCUS_18500 1422 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18500 4462 1577 gene locus_tag LOCUS_18510 gene uvrA 4462 1577 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_18510 4632 5840 gene locus_tag LOCUS_18520 4632 5840 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 protein_id gnl|my_center|LOCUS_18520 5898 6401 gene locus_tag LOCUS_18530 5898 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 6509 7471 gene locus_tag LOCUS_18540 6509 7471 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_18540 7479 8282 gene locus_tag LOCUS_18550 gene tcdA 7479 8282 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_18550 8362 8748 gene locus_tag LOCUS_18560 8362 8748 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence129 531 3863 gene locus_tag LOCUS_18570 gene mscK 531 3863 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103675.1 protein_id gnl|my_center|LOCUS_18570 4241 3879 gene locus_tag LOCUS_18580 4241 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 5442 4507 gene locus_tag LOCUS_18590 5442 4507 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 protein_id gnl|my_center|LOCUS_18590 5740 7122 gene locus_tag LOCUS_18600 5740 7122 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766716.1 protein_id gnl|my_center|LOCUS_18600 7136 7552 gene locus_tag LOCUS_18610 7136 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7877 7647 gene locus_tag LOCUS_18620 7877 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8697 8026 gene locus_tag LOCUS_18630 8697 8026 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence130 955 365 gene locus_tag LOCUS_18640 gene metW 955 365 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545692.1 protein_id gnl|my_center|LOCUS_18640 2265 1138 gene locus_tag LOCUS_18650 2265 1138 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_18650 2464 2667 gene locus_tag LOCUS_18660 gene thiS 2464 2667 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_18660 2776 3561 gene locus_tag LOCUS_18670 2776 3561 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_18670 3558 4307 gene locus_tag LOCUS_18680 gene trmB 3558 4307 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931594.1 protein_id gnl|my_center|LOCUS_18680 4348 6195 gene locus_tag LOCUS_18690 gene sppA 4348 6195 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 protein_id gnl|my_center|LOCUS_18690 6297 6926 gene locus_tag LOCUS_18700 6297 6926 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_18700 8175 6994 gene locus_tag LOCUS_18710 gene ppk2 8175 6994 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819675.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence131 <1 562 gene locus_tag LOCUS_18720 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033448020.1:TatD family hydrolase 591 1265 gene locus_tag LOCUS_18730 591 1265 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_18730 1407 3113 gene locus_tag LOCUS_18740 gene sulP 1407 3113 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_18740 3978 3184 gene locus_tag LOCUS_18750 3978 3184 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086778.1 protein_id gnl|my_center|LOCUS_18750 4080 5306 gene locus_tag LOCUS_18760 4080 5306 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097065.1 protein_id gnl|my_center|LOCUS_18760 6304 5330 gene locus_tag LOCUS_18770 6304 5330 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_18770 8610 6301 gene locus_tag LOCUS_18780 gene xdhA 8610 6301 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence132 1198 266 gene locus_tag LOCUS_18790 gene era 1198 266 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_18790 1866 1195 gene locus_tag LOCUS_18800 1866 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2233 1871 gene locus_tag LOCUS_18810 2233 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 3088 2300 gene locus_tag LOCUS_18820 gene lepB 3088 2300 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040222.1 protein_id gnl|my_center|LOCUS_18820 4933 3137 gene locus_tag LOCUS_18830 gene lepA 4933 3137 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_18830 5276 5001 gene locus_tag LOCUS_18840 5276 5001 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_18840 6709 5273 gene locus_tag LOCUS_18850 gene mucD 6709 5273 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_18850 7173 6706 gene locus_tag LOCUS_18860 7173 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8144 7173 gene locus_tag LOCUS_18870 8144 7173 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_18870 8689 8141 gene locus_tag LOCUS_18880 8689 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence133 81 1394 gene locus_tag LOCUS_18890 gene aceA 81 1394 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_18890 2220 1681 gene locus_tag LOCUS_18900 2220 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2418 3182 gene locus_tag LOCUS_18910 2418 3182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252794.1 protein_id gnl|my_center|LOCUS_18910 3179 4516 gene locus_tag LOCUS_18920 3179 4516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969540.1 protein_id gnl|my_center|LOCUS_18920 4607 5467 gene locus_tag LOCUS_18930 4607 5467 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_18930 5552 5920 gene locus_tag LOCUS_18940 5552 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 5917 6771 gene locus_tag LOCUS_18950 5917 6771 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_18950 7626 6832 gene locus_tag LOCUS_18960 gene murI 7626 6832 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 protein_id gnl|my_center|LOCUS_18960 <8773 7694 gene locus_tag LOCUS_18970 <8773 7694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071526.1:tyrosine--tRNA ligase >Feature sequence134 <1 768 gene locus_tag LOCUS_18980 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975921.1:methylenetetrahydrofolate reductase 805 1485 gene locus_tag LOCUS_18990 805 1485 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_18990 1482 2750 gene locus_tag LOCUS_19000 1482 2750 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_19000 2752 3447 gene locus_tag LOCUS_19010 2752 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3444 5540 gene locus_tag LOCUS_19020 3444 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5537 6439 gene locus_tag LOCUS_19030 5537 6439 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944231.1 protein_id gnl|my_center|LOCUS_19030 6442 7656 gene locus_tag LOCUS_19040 6442 7656 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392000.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence135 521 2152 gene locus_tag LOCUS_19050 521 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 3007 2198 gene locus_tag LOCUS_19060 gene siaD 3007 2198 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_19060 3384 3004 gene locus_tag LOCUS_19070 gene siaC 3384 3004 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_19070 3964 3422 gene locus_tag LOCUS_19080 gene siaB 3964 3422 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_19080 5998 4007 gene locus_tag LOCUS_19090 gene siaA 5998 4007 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_19090 6084 6302 gene locus_tag LOCUS_19100 6084 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6451 6834 gene locus_tag LOCUS_19110 6451 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 7854 6928 gene locus_tag LOCUS_19120 7854 6928 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395910.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence136 2 637 gene locus_tag LOCUS_19130 2 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 697 1941 gene locus_tag LOCUS_19140 697 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1968 2768 gene locus_tag LOCUS_19150 gene kdpE 1968 2768 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814052.1 protein_id gnl|my_center|LOCUS_19150 2858 3532 gene locus_tag LOCUS_19160 2858 3532 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_19160 3759 5237 gene locus_tag LOCUS_19170 3759 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5427 6209 gene locus_tag LOCUS_19180 5427 6209 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_19180 8276 6318 gene locus_tag LOCUS_19190 8276 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence137 1814 456 gene locus_tag LOCUS_19200 1814 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2242 1895 gene locus_tag LOCUS_19210 2242 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2845 2345 gene locus_tag LOCUS_19220 2845 2345 CDS product cupredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040632.1 protein_id gnl|my_center|LOCUS_19220 3298 2912 gene locus_tag LOCUS_19230 3298 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3487 4167 gene locus_tag LOCUS_19240 3487 4167 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_19240 4170 5603 gene locus_tag LOCUS_19250 4170 5603 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 protein_id gnl|my_center|LOCUS_19250 5751 6296 gene locus_tag LOCUS_19260 5751 6296 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813582.1 protein_id gnl|my_center|LOCUS_19260 6298 7788 gene locus_tag LOCUS_19270 6298 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 7882 8220 gene locus_tag LOCUS_19280 7882 8220 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence138 2306 1059 gene locus_tag LOCUS_19290 2306 1059 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690124.1 protein_id gnl|my_center|LOCUS_19290 4430 2310 gene locus_tag LOCUS_19300 4430 2310 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_19300 5038 4427 gene locus_tag LOCUS_19310 5038 4427 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_19310 6221 4989 gene locus_tag LOCUS_19320 gene rsmB 6221 4989 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038748.1 protein_id gnl|my_center|LOCUS_19320 7266 6382 gene locus_tag LOCUS_19330 gene speE 7266 6382 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194193.1 protein_id gnl|my_center|LOCUS_19330 7683 7270 gene locus_tag LOCUS_19340 gene speD 7683 7270 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_19340 <8439 7767 gene locus_tag LOCUS_19350 <8439 7767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994212.1:TSUP family transporter >Feature sequence139 1475 831 gene locus_tag LOCUS_19360 1475 831 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_19360 3051 1624 gene locus_tag LOCUS_19370 gene gdhA 3051 1624 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905419.1 protein_id gnl|my_center|LOCUS_19370 3253 3681 gene locus_tag LOCUS_19380 3253 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3850 5085 gene locus_tag LOCUS_19390 3850 5085 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064382.1 protein_id gnl|my_center|LOCUS_19390 6431 5187 gene locus_tag LOCUS_19400 6431 5187 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_19400 6534 7433 gene locus_tag LOCUS_19410 6534 7433 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_19410 <8370 7456 gene locus_tag LOCUS_19420 <8370 7456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207506.1:ammonium transporter >Feature sequence140 188 1351 gene locus_tag LOCUS_19430 188 1351 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_19430 1367 2101 gene locus_tag LOCUS_19440 1367 2101 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_19440 3269 2205 gene locus_tag LOCUS_19450 3269 2205 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19450 3635 4525 gene locus_tag LOCUS_19460 3635 4525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_19460 4522 5469 gene locus_tag LOCUS_19470 4522 5469 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_19470 5695 5480 gene locus_tag LOCUS_19480 5695 5480 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195120.1 protein_id gnl|my_center|LOCUS_19480 6515 5760 gene locus_tag LOCUS_19490 gene zapD 6515 5760 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_19490 7263 6595 gene locus_tag LOCUS_19500 gene coaE 7263 6595 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_19500 8024 7233 gene locus_tag LOCUS_19510 8024 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence141 1812 793 gene locus_tag LOCUS_19520 1812 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2941 1925 gene locus_tag LOCUS_19530 2941 1925 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072427.1 protein_id gnl|my_center|LOCUS_19530 2628 2704 gene locus_tag LOCUS_t00280 2628 2704 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2978 3709 gene locus_tag LOCUS_19540 2978 3709 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970538.1 protein_id gnl|my_center|LOCUS_19540 3720 4898 gene locus_tag LOCUS_19550 3720 4898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064468.1 protein_id gnl|my_center|LOCUS_19550 4997 6001 gene locus_tag LOCUS_19560 4997 6001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_19560 7790 6138 gene locus_tag LOCUS_19570 gene gpmI 7790 6138 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence142 4479 301 gene locus_tag LOCUS_19580 gene hrpA 4479 301 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202033.1 protein_id gnl|my_center|LOCUS_19580 4570 5091 gene locus_tag LOCUS_19590 4570 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5237 6061 gene locus_tag LOCUS_19600 5237 6061 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113476.1 protein_id gnl|my_center|LOCUS_19600 6073 6663 gene locus_tag LOCUS_19610 6073 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194143.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence143 471 674 gene locus_tag LOCUS_19620 471 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 972 685 gene locus_tag LOCUS_19630 972 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2094 1087 gene locus_tag LOCUS_19640 2094 1087 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 protein_id gnl|my_center|LOCUS_19640 2344 3474 gene locus_tag LOCUS_19650 gene ald 2344 3474 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704256.1 protein_id gnl|my_center|LOCUS_19650 3673 5238 gene locus_tag LOCUS_19660 3673 5238 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_19660 5240 5884 gene locus_tag LOCUS_19670 5240 5884 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_19670 5989 6453 gene locus_tag LOCUS_19680 5989 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6655 6476 gene locus_tag LOCUS_19690 6655 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6750 6825 gene locus_tag LOCUS_t00290 6750 6825 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6898 6974 gene locus_tag LOCUS_t00300 6898 6974 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7073 7933 gene locus_tag LOCUS_19700 7073 7933 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537097.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence144 338 712 gene locus_tag LOCUS_19710 338 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 814 1851 gene locus_tag LOCUS_19720 814 1851 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_19720 2392 1946 gene locus_tag LOCUS_19730 2392 1946 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_19730 2577 2389 gene locus_tag LOCUS_19740 2577 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2960 3274 gene locus_tag LOCUS_19750 2960 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528019.1 protein_id gnl|my_center|LOCUS_19750 3730 3383 gene locus_tag LOCUS_19760 3730 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3951 4505 gene locus_tag LOCUS_19770 3951 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5405 4530 gene locus_tag LOCUS_19780 5405 4530 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_19780 6839 5502 gene locus_tag LOCUS_19790 gene hslU 6839 5502 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_19790 7386 6850 gene locus_tag LOCUS_19800 gene hslV 7386 6850 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203414.1 protein_id gnl|my_center|LOCUS_19800 7628 8086 gene locus_tag LOCUS_19810 gene ybgC 7628 8086 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence145 55 285 gene locus_tag LOCUS_19820 55 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1087 254 gene locus_tag LOCUS_19830 1087 254 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074122.1 protein_id gnl|my_center|LOCUS_19830 1277 1756 gene locus_tag LOCUS_19840 1277 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1836 2390 gene locus_tag LOCUS_19850 1836 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2491 4659 gene locus_tag LOCUS_19860 2491 4659 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930373.1 protein_id gnl|my_center|LOCUS_19860 4656 5288 gene locus_tag LOCUS_19870 4656 5288 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930374.1 protein_id gnl|my_center|LOCUS_19870 5420 5626 gene locus_tag LOCUS_19880 5420 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence146 286 1485 gene locus_tag LOCUS_19890 286 1485 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_19890 1692 2531 gene locus_tag LOCUS_19900 1692 2531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_19900 2531 3235 gene locus_tag LOCUS_19910 2531 3235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_19910 3250 4119 gene locus_tag LOCUS_19920 3250 4119 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_19920 4119 5066 gene locus_tag LOCUS_19930 4119 5066 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_19930 5124 6329 gene locus_tag LOCUS_19940 5124 6329 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_19940 6509 7000 gene locus_tag LOCUS_19950 6509 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7014 7661 gene locus_tag LOCUS_19960 7014 7661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence147 1 126 gene locus_tag LOCUS_19970 1 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 153 1553 gene locus_tag LOCUS_19980 gene atpD 153 1553 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815343.1 protein_id gnl|my_center|LOCUS_19980 1608 2033 gene locus_tag LOCUS_19990 1608 2033 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_19990 2805 2224 gene locus_tag LOCUS_20000 2805 2224 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853232.1 protein_id gnl|my_center|LOCUS_20000 3735 2860 gene locus_tag LOCUS_20010 3735 2860 CDS product TIM44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189141.1 protein_id gnl|my_center|LOCUS_20010 4492 3755 gene locus_tag LOCUS_20020 gene ubiE 4492 3755 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_20020 4922 4500 gene locus_tag LOCUS_20030 4922 4500 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_20030 5159 5869 gene locus_tag LOCUS_20040 gene phoB 5159 5869 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_20040 5898 7232 gene locus_tag LOCUS_20050 gene phoR 5898 7232 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_20050 7737 7309 gene locus_tag LOCUS_20060 7737 7309 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence148 351 1547 gene locus_tag LOCUS_20070 351 1547 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_20070 1567 2778 gene locus_tag LOCUS_20080 1567 2778 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_20080 2859 3242 gene locus_tag LOCUS_20090 gene iscU 2859 3242 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192918.1 protein_id gnl|my_center|LOCUS_20090 3281 3604 gene locus_tag LOCUS_20100 gene iscA 3281 3604 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_20100 3615 4148 gene locus_tag LOCUS_20110 gene hscB 3615 4148 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_20110 4166 6034 gene locus_tag LOCUS_20120 gene hscA 4166 6034 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_20120 6031 6372 gene locus_tag LOCUS_20130 gene fdx 6031 6372 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_20130 6374 6568 gene locus_tag LOCUS_20140 gene iscX 6374 6568 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_20140 7540 6602 gene locus_tag LOCUS_20150 gene prmB 7540 6602 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence149 1613 2032 gene locus_tag LOCUS_20160 1613 2032 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_20160 2090 2635 gene locus_tag LOCUS_20170 2090 2635 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_20170 2799 7646 gene locus_tag LOCUS_20180 2799 7646 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence150 <1 883 gene locus_tag LOCUS_20190 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118792797.1:cytochrome-c oxidase, cbb3-type subunit III 981 2396 gene locus_tag LOCUS_20200 gene ccoG 981 2396 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_20200 2410 2907 gene locus_tag LOCUS_20210 2410 2907 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706148.1 protein_id gnl|my_center|LOCUS_20210 2960 3196 gene locus_tag LOCUS_20220 2960 3196 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810392.1 protein_id gnl|my_center|LOCUS_20220 3717 3274 gene locus_tag LOCUS_20230 3717 3274 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_20230 3847 5289 gene locus_tag LOCUS_20240 3847 5289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_20240 6072 5389 gene locus_tag LOCUS_20250 6072 5389 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_20250 6165 6545 gene locus_tag LOCUS_20260 6165 6545 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_20260 7325 6579 gene locus_tag LOCUS_20270 gene fnr 7325 6579 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence151 525 103 gene locus_tag LOCUS_20280 525 103 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_20280 761 1471 gene locus_tag LOCUS_20290 gene phoB 761 1471 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_20290 1515 2828 gene locus_tag LOCUS_20300 gene phoR 1515 2828 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_20300 3332 2904 gene locus_tag LOCUS_20310 3332 2904 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_20310 4235 3393 gene locus_tag LOCUS_20320 4235 3393 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_20320 5850 4378 gene locus_tag LOCUS_20330 gene gatB 5850 4378 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_20330 7356 5881 gene locus_tag LOCUS_20340 gene gatA 7356 5881 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_20340 7771 7484 gene locus_tag LOCUS_20350 gene gatC 7771 7484 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence152 165 401 gene locus_tag LOCUS_20360 165 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 433 1557 gene locus_tag LOCUS_20370 433 1557 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071693.1 protein_id gnl|my_center|LOCUS_20370 2353 2631 gene locus_tag LOCUS_20380 2353 2631 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928947.1 protein_id gnl|my_center|LOCUS_20380 2628 3134 gene locus_tag LOCUS_20390 2628 3134 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_20390 3285 4487 gene locus_tag LOCUS_20400 3285 4487 CDS product Calx-beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019895278.1 protein_id gnl|my_center|LOCUS_20400 4497 4808 gene locus_tag LOCUS_20410 4497 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 4805 6235 gene locus_tag LOCUS_20420 gene cpsB 4805 6235 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 protein_id gnl|my_center|LOCUS_20420 6626 6300 gene locus_tag LOCUS_20430 6626 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6888 6607 gene locus_tag LOCUS_20440 6888 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence153 1319 312 gene locus_tag LOCUS_20450 1319 312 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 protein_id gnl|my_center|LOCUS_20450 2372 1455 gene locus_tag LOCUS_20460 2372 1455 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665750.1 protein_id gnl|my_center|LOCUS_20460 3758 2463 gene locus_tag LOCUS_20470 3758 2463 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_20470 4338 3790 gene locus_tag LOCUS_20480 4338 3790 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_20480 6558 4351 gene locus_tag LOCUS_20490 6558 4351 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_20490 7690 6626 gene locus_tag LOCUS_20500 7690 6626 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529351.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence154 869 300 gene locus_tag LOCUS_20510 869 300 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 protein_id gnl|my_center|LOCUS_20510 2934 889 gene locus_tag LOCUS_20520 2934 889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038709.1 protein_id gnl|my_center|LOCUS_20520 3519 3055 gene locus_tag LOCUS_20530 3519 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3794 3973 gene locus_tag LOCUS_20540 3794 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4196 5068 gene locus_tag LOCUS_20550 4196 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810430.1 protein_id gnl|my_center|LOCUS_20550 5083 5916 gene locus_tag LOCUS_20560 5083 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6170 6439 gene locus_tag LOCUS_20570 6170 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 6789 6526 gene locus_tag LOCUS_20580 6789 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7028 6786 gene locus_tag LOCUS_20590 7028 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence155 <1 548 gene locus_tag LOCUS_20600 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814571.1:D-alanine--D-alanine ligase 541 1398 gene locus_tag LOCUS_20610 541 1398 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_20610 1395 2624 gene locus_tag LOCUS_20620 gene ftsA 1395 2624 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_20620 2748 3893 gene locus_tag LOCUS_20630 gene ftsZ 2748 3893 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_20630 4115 5038 gene locus_tag LOCUS_20640 gene lpxC 4115 5038 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 protein_id gnl|my_center|LOCUS_20640 5148 5336 gene locus_tag LOCUS_20650 5148 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 5807 5376 gene locus_tag LOCUS_20660 5807 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence156 928 32 gene locus_tag LOCUS_20670 928 32 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_20670 2057 1011 gene locus_tag LOCUS_20680 2057 1011 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 protein_id gnl|my_center|LOCUS_20680 3623 2163 gene locus_tag LOCUS_20690 3623 2163 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_20690 5828 3798 gene locus_tag LOCUS_20700 5828 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 7623 6076 gene locus_tag LOCUS_20710 gene ubiB 7623 6076 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815105.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence157 <1 1173 gene locus_tag LOCUS_20720 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193305.1:translation elongation factor 4 1220 2008 gene locus_tag LOCUS_20730 gene lepB 1220 2008 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_20730 2154 2516 gene locus_tag LOCUS_20740 2154 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2521 3192 gene locus_tag LOCUS_20750 2521 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3189 4121 gene locus_tag LOCUS_20760 gene era 3189 4121 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_20760 4137 4889 gene locus_tag LOCUS_20770 gene recO 4137 4889 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 protein_id gnl|my_center|LOCUS_20770 4889 5644 gene locus_tag LOCUS_20780 gene pdxJ 4889 5644 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_20780 5673 6053 gene locus_tag LOCUS_20790 gene acpS 5673 6053 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_20790 6050 7195 gene locus_tag LOCUS_20800 gene nagZ 6050 7195 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence158 1281 898 gene locus_tag LOCUS_20810 1281 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1724 1398 gene locus_tag LOCUS_20820 1724 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2725 1850 gene locus_tag LOCUS_20830 2725 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3382 2771 gene locus_tag LOCUS_20840 3382 2771 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_20840 5142 3451 gene locus_tag LOCUS_20850 gene nirS 5142 3451 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_20850 5378 6274 gene locus_tag LOCUS_20860 5378 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 7201 6311 gene locus_tag LOCUS_20870 7201 6311 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929456.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20870 >Feature sequence159 71 307 gene locus_tag LOCUS_20880 gene tatA 71 307 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_20880 405 896 gene locus_tag LOCUS_20890 gene tatB 405 896 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448907.1 protein_id gnl|my_center|LOCUS_20890 893 1717 gene locus_tag LOCUS_20900 gene tatC 893 1717 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_20900 2887 1730 gene locus_tag LOCUS_20910 2887 1730 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_20910 2977 3729 gene locus_tag LOCUS_20920 2977 3729 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_20920 4861 3749 gene locus_tag LOCUS_20930 4861 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 5066 5620 gene locus_tag LOCUS_20940 5066 5620 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_20940 5849 7009 gene locus_tag LOCUS_20950 gene sucC 5849 7009 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence160 275 1078 gene locus_tag LOCUS_20960 275 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20960 1088 2509 gene locus_tag LOCUS_20970 1088 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20970 2520 3710 gene locus_tag LOCUS_20980 2520 3710 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193604.1 protein_id gnl|my_center|LOCUS_20980 4665 3754 gene locus_tag LOCUS_20990 gene hemF 4665 3754 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526433.1 protein_id gnl|my_center|LOCUS_20990 5004 4672 gene locus_tag LOCUS_21000 5004 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6399 5122 gene locus_tag LOCUS_21010 gene purD 6399 5122 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186246.1 protein_id gnl|my_center|LOCUS_21010 <7488 6481 gene locus_tag LOCUS_21020 <7488 6481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194285.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence161 <1 1155 gene locus_tag LOCUS_21030 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766682.1:cobyric acid synthase 1152 1997 gene locus_tag LOCUS_21040 gene queF 1152 1997 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819527.1 protein_id gnl|my_center|LOCUS_21040 2271 2585 gene locus_tag LOCUS_21050 2271 2585 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929235.1 protein_id gnl|my_center|LOCUS_21050 3820 2684 gene locus_tag LOCUS_21060 3820 2684 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_21060 4862 3840 gene locus_tag LOCUS_21070 4862 3840 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_21070 4884 5807 gene locus_tag LOCUS_21080 4884 5807 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_21080 5795 6205 gene locus_tag LOCUS_21090 5795 6205 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_21090 6339 6830 gene locus_tag LOCUS_21100 gene mobB 6339 6830 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_21100 <7487 6815 gene locus_tag LOCUS_21110 <7487 6815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192903.1:molybdenum cofactor guanylyltransferase MobA >Feature sequence162 281 799 gene locus_tag LOCUS_21120 gene rimM 281 799 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063944.1 protein_id gnl|my_center|LOCUS_21120 807 1655 gene locus_tag LOCUS_21130 gene trmD 807 1655 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_21130 1753 2166 gene locus_tag LOCUS_21140 gene rplS 1753 2166 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_21140 3345 2269 gene locus_tag LOCUS_21150 gene lptG 3345 2269 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_21150 4591 3509 gene locus_tag LOCUS_21160 gene lptF 4591 3509 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_21160 4711 6216 gene locus_tag LOCUS_21170 4711 6216 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_21170 6234 6674 gene locus_tag LOCUS_21180 6234 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 6671 7159 gene locus_tag LOCUS_21190 6671 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence163 26 1126 gene locus_tag LOCUS_21200 gene nadA 26 1126 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_21200 1154 1903 gene locus_tag LOCUS_21210 1154 1903 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_21210 1903 3057 gene locus_tag LOCUS_21220 gene clsB 1903 3057 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_21220 3488 3063 gene locus_tag LOCUS_21230 3488 3063 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078677.1 protein_id gnl|my_center|LOCUS_21230 4471 3557 gene locus_tag LOCUS_21240 gene gluQRS 4471 3557 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_21240 4612 5025 gene locus_tag LOCUS_21250 4612 5025 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 protein_id gnl|my_center|LOCUS_21250 5751 5137 gene locus_tag LOCUS_21260 5751 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6137 5766 gene locus_tag LOCUS_21270 6137 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539929.1 protein_id gnl|my_center|LOCUS_21270 6406 6134 gene locus_tag LOCUS_21280 6406 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193682.1 protein_id gnl|my_center|LOCUS_21280 6951 6412 gene locus_tag LOCUS_21290 6951 6412 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192269.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence164 2 442 gene locus_tag LOCUS_21300 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 579 1058 gene locus_tag LOCUS_21310 579 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1113 2174 gene locus_tag LOCUS_21320 gene glnL 1113 2174 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_21320 2242 3666 gene locus_tag LOCUS_21330 gene ntrC 2242 3666 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_21330 3863 4699 gene locus_tag LOCUS_21340 gene birA 3863 4699 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_21340 4696 5427 gene locus_tag LOCUS_21350 4696 5427 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_21350 5460 6833 gene locus_tag LOCUS_21360 5460 6833 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943015.1 protein_id gnl|my_center|LOCUS_21360 7413 6850 gene locus_tag LOCUS_21370 7413 6850 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence165 <1 783 gene locus_tag LOCUS_21380 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975180.1:TAXI family TRAP transporter solute-binding subunit 892 3513 gene locus_tag LOCUS_21390 892 3513 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067553987.1 protein_id gnl|my_center|LOCUS_21390 4266 3634 gene locus_tag LOCUS_21400 4266 3634 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_21400 4941 4336 gene locus_tag LOCUS_21410 4941 4336 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_21410 6721 4958 gene locus_tag LOCUS_21420 gene argS 6721 4958 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence166 175 1188 gene locus_tag LOCUS_21430 175 1188 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_21430 1391 2095 gene locus_tag LOCUS_21440 1391 2095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199255.1 protein_id gnl|my_center|LOCUS_21440 2456 2380 gene locus_tag LOCUS_t00310 2456 2380 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3530 2505 gene locus_tag LOCUS_21450 gene ispB 3530 2505 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807467.1 protein_id gnl|my_center|LOCUS_21450 4818 3571 gene locus_tag LOCUS_21460 gene ugpB 4818 3571 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028113.1 protein_id gnl|my_center|LOCUS_21460 6011 4959 gene locus_tag LOCUS_21470 6011 4959 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 protein_id gnl|my_center|LOCUS_21470 6212 7306 gene locus_tag LOCUS_21480 gene rlmM 6212 7306 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence167 1497 775 gene locus_tag LOCUS_21490 1497 775 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_21490 2237 1530 gene locus_tag LOCUS_21500 gene aat 2237 1530 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_21500 3358 2234 gene locus_tag LOCUS_21510 3358 2234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_21510 3494 5158 gene locus_tag LOCUS_21520 3494 5158 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_21520 6435 5425 gene locus_tag LOCUS_21530 6435 5425 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_21530 6567 6893 gene locus_tag LOCUS_21540 6567 6893 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930920.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence168 4280 2181 gene locus_tag LOCUS_21550 4280 2181 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 protein_id gnl|my_center|LOCUS_21550 6489 4261 gene locus_tag LOCUS_21560 6489 4261 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338328.1 protein_id gnl|my_center|LOCUS_21560 6861 6493 gene locus_tag LOCUS_21570 6861 6493 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720740.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence169 1502 630 gene locus_tag LOCUS_21580 1502 630 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110402348.1 protein_id gnl|my_center|LOCUS_21580 3390 1672 gene locus_tag LOCUS_21590 gene leuA 3390 1672 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406457.1 protein_id gnl|my_center|LOCUS_21590 3549 4031 gene locus_tag LOCUS_21600 3549 4031 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_21600 4868 4038 gene locus_tag LOCUS_21610 4868 4038 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_21610 5157 6119 gene locus_tag LOCUS_21620 gene paaX 5157 6119 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence170 167 2152 gene locus_tag LOCUS_21630 167 2152 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_21630 2226 3341 gene locus_tag LOCUS_21640 2226 3341 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_21640 3432 4058 gene locus_tag LOCUS_21650 3432 4058 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_21650 4145 4600 gene locus_tag LOCUS_21660 4145 4600 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_21660 5703 4651 gene locus_tag LOCUS_21670 5703 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 6281 5706 gene locus_tag LOCUS_21680 6281 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 <7151 6402 gene locus_tag LOCUS_21690 <7151 6402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003088017.1:RNA methyltransferase >Feature sequence171 2268 787 gene locus_tag LOCUS_21700 gene pap 2268 787 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_21700 3010 2336 gene locus_tag LOCUS_21710 3010 2336 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_21710 3110 3919 gene locus_tag LOCUS_21720 3110 3919 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_21720 4017 4886 gene locus_tag LOCUS_21730 4017 4886 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_21730 6219 4894 gene locus_tag LOCUS_21740 6219 4894 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529892.1 protein_id gnl|my_center|LOCUS_21740 <7136 6344 gene locus_tag LOCUS_21750 <7136 6344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930218.1:FTR1 family protein >Feature sequence172 775 2088 gene locus_tag LOCUS_21760 775 2088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_21760 2085 2624 gene locus_tag LOCUS_21770 2085 2624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_21770 4687 2642 gene locus_tag LOCUS_21780 4687 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6125 5034 gene locus_tag LOCUS_21790 gene ychF 6125 5034 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_21790 6805 6122 gene locus_tag LOCUS_21800 gene pth 6805 6122 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185241.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence173 89 1480 gene locus_tag LOCUS_21810 gene hemN 89 1480 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_21810 1568 2275 gene locus_tag LOCUS_21820 1568 2275 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 protein_id gnl|my_center|LOCUS_21820 2383 3552 gene locus_tag LOCUS_21830 2383 3552 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_21830 4016 3591 gene locus_tag LOCUS_21840 4016 3591 CDS product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 protein_id gnl|my_center|LOCUS_21840 4089 6434 gene locus_tag LOCUS_21850 4089 6434 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_21850 6506 6718 gene locus_tag LOCUS_21860 6506 6718 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689029.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence174 2 487 gene locus_tag LOCUS_21870 gene ptsN 2 487 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_21870 456 1403 gene locus_tag LOCUS_21880 gene hprK 456 1403 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_21880 1554 3083 gene locus_tag LOCUS_21890 gene ilvA 1554 3083 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_21890 3778 3158 gene locus_tag LOCUS_21900 3778 3158 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525893.1 protein_id gnl|my_center|LOCUS_21900 3821 5764 gene locus_tag LOCUS_21910 3821 5764 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995440.1 protein_id gnl|my_center|LOCUS_21910 5858 6814 gene locus_tag LOCUS_21920 5858 6814 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence175 <1 2284 gene locus_tag LOCUS_21930 <1 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase 2609 2394 gene locus_tag LOCUS_21940 2609 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 4109 2718 gene locus_tag LOCUS_21950 4109 2718 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_21950 4314 5198 gene locus_tag LOCUS_21960 gene rfbA 4314 5198 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_21960 5198 5743 gene locus_tag LOCUS_21970 gene rfbC 5198 5743 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_21970 6028 5828 gene locus_tag LOCUS_21980 6028 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6969 6055 gene locus_tag LOCUS_21990 6969 6055 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence176 <1 887 gene locus_tag LOCUS_22000 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040777.1:carboxyl transferase domain-containing protein 962 1747 gene locus_tag LOCUS_22010 962 1747 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063886.1 protein_id gnl|my_center|LOCUS_22010 1843 4041 gene locus_tag LOCUS_22020 1843 4041 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_22020 4092 5063 gene locus_tag LOCUS_22030 4092 5063 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_22030 6140 5112 gene locus_tag LOCUS_22040 6140 5112 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_22040 <7034 6329 gene locus_tag LOCUS_22050 <7034 6329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135174843.1:acyl-CoA dehydrogenase family protein >Feature sequence177 776 219 gene locus_tag LOCUS_22060 gene efp 776 219 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_22060 2033 843 gene locus_tag LOCUS_22070 gene earP 2033 843 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203004.1 protein_id gnl|my_center|LOCUS_22070 2416 3411 gene locus_tag LOCUS_22080 2416 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 4158 3421 gene locus_tag LOCUS_22090 4158 3421 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_22090 4304 4777 gene locus_tag LOCUS_22100 4304 4777 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_22100 4892 5860 gene locus_tag LOCUS_22110 4892 5860 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_22110 6223 6678 gene locus_tag LOCUS_22120 6223 6678 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207517.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence178 866 327 gene locus_tag LOCUS_22130 gene rsmD 866 327 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_22130 2284 863 gene locus_tag LOCUS_22140 2284 863 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_22140 3689 2316 gene locus_tag LOCUS_22150 3689 2316 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_22150 3863 5158 gene locus_tag LOCUS_22160 3863 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 5155 5850 gene locus_tag LOCUS_22170 gene ftsE 5155 5850 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_22170 5847 6743 gene locus_tag LOCUS_22180 gene ftsX 5847 6743 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence179 1453 2970 gene locus_tag LOCUS_22190 1453 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3143 3610 gene locus_tag LOCUS_22200 3143 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3777 5375 gene locus_tag LOCUS_22210 3777 5375 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_22210 5510 6712 gene locus_tag LOCUS_22220 5510 6712 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence180 <1 864 gene locus_tag LOCUS_22230 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807207.1:lytic transglycosylase domain-containing protein 954 1910 gene locus_tag LOCUS_22240 954 1910 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_22240 1958 2602 gene locus_tag LOCUS_22250 1958 2602 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_22250 2602 3900 gene locus_tag LOCUS_22260 2602 3900 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_22260 4013 4633 gene locus_tag LOCUS_22270 4013 4633 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 protein_id gnl|my_center|LOCUS_22270 4630 5433 gene locus_tag LOCUS_22280 4630 5433 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence181 150 746 gene locus_tag LOCUS_22290 150 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1234 785 gene locus_tag LOCUS_22300 1234 785 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390712.1 protein_id gnl|my_center|LOCUS_22300 1606 2967 gene locus_tag LOCUS_22310 gene glmU 1606 2967 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_22310 3071 4909 gene locus_tag LOCUS_22320 gene glmS 3071 4909 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 protein_id gnl|my_center|LOCUS_22320 5006 6520 gene locus_tag LOCUS_22330 5006 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence182 <1 1153 gene locus_tag LOCUS_22340 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065178.1:PepSY-associated TM helix domain-containing protein 1233 1556 gene locus_tag LOCUS_22350 1233 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1647 2075 gene locus_tag LOCUS_22360 1647 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940589.1 protein_id gnl|my_center|LOCUS_22360 4251 2137 gene locus_tag LOCUS_22370 4251 2137 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035914.1 protein_id gnl|my_center|LOCUS_22370 6647 4515 gene locus_tag LOCUS_22380 6647 4515 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence183 290 21 gene locus_tag LOCUS_22390 290 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 468 250 gene locus_tag LOCUS_22400 468 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1350 643 gene locus_tag LOCUS_22410 1350 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1708 3444 gene locus_tag LOCUS_22420 1708 3444 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 protein_id gnl|my_center|LOCUS_22420 3618 6731 gene locus_tag LOCUS_22430 3618 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence184 696 1343 gene locus_tag LOCUS_22440 696 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1743 2030 gene locus_tag LOCUS_22450 1743 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2027 2698 gene locus_tag LOCUS_22460 2027 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2865 3383 gene locus_tag LOCUS_22470 2865 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 4052 3582 gene locus_tag LOCUS_22480 4052 3582 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532263.1 protein_id gnl|my_center|LOCUS_22480 5550 4213 gene locus_tag LOCUS_22490 5550 4213 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815118.1 protein_id gnl|my_center|LOCUS_22490 6239 5553 gene locus_tag LOCUS_22500 6239 5553 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_22500 6408 6743 gene locus_tag LOCUS_22510 6408 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence185 37 534 gene locus_tag LOCUS_22520 37 534 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_22520 1705 503 gene locus_tag LOCUS_22530 1705 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1949 2224 gene locus_tag LOCUS_22540 gene hupB 1949 2224 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_22540 2723 4036 gene locus_tag LOCUS_22550 2723 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 5497 4109 gene locus_tag LOCUS_22560 gene cbpB 5497 4109 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_22560 5685 5494 gene locus_tag LOCUS_22570 5685 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence186 1696 908 gene locus_tag LOCUS_22580 1696 908 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014905911.1 protein_id gnl|my_center|LOCUS_22580 1919 2497 gene locus_tag LOCUS_22590 gene idi 1919 2497 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_22590 3953 2628 gene locus_tag LOCUS_22600 3953 2628 CDS product IS4-like element ISLpn6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946384.1 protein_id gnl|my_center|LOCUS_22600 3994 4968 gene locus_tag LOCUS_22610 gene aroC 3994 4968 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_22610 4975 5115 gene locus_tag LOCUS_22620 4975 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5233 5490 gene locus_tag LOCUS_22630 5233 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6540 5593 gene locus_tag LOCUS_22640 6540 5593 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence187 1747 527 gene locus_tag LOCUS_22650 gene flgL 1747 527 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_22650 3416 1767 gene locus_tag LOCUS_22660 gene flgK 3416 1767 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_22660 4722 3511 gene locus_tag LOCUS_22670 4722 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5873 4722 gene locus_tag LOCUS_22680 5873 4722 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367323.1 protein_id gnl|my_center|LOCUS_22680 6549 5857 gene locus_tag LOCUS_22690 gene flgH 6549 5857 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence188 1486 236 gene locus_tag LOCUS_22700 1486 236 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_22700 3277 1598 gene locus_tag LOCUS_22710 3277 1598 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 protein_id gnl|my_center|LOCUS_22710 3882 3274 gene locus_tag LOCUS_22720 3882 3274 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 protein_id gnl|my_center|LOCUS_22720 5106 4024 gene locus_tag LOCUS_22730 5106 4024 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812637.1 protein_id gnl|my_center|LOCUS_22730 5874 5224 gene locus_tag LOCUS_22740 5874 5224 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_22740 <6658 6004 gene locus_tag LOCUS_22750 <6658 6004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227769.1:TRAP transporter substrate-binding protein >Feature sequence189 375 1403 gene locus_tag LOCUS_22760 375 1403 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188361.1 protein_id gnl|my_center|LOCUS_22760 2317 1607 gene locus_tag LOCUS_22770 2317 1607 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249123.1 protein_id gnl|my_center|LOCUS_22770 3554 2325 gene locus_tag LOCUS_22780 3554 2325 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189027735.1 protein_id gnl|my_center|LOCUS_22780 3840 4034 gene locus_tag LOCUS_22790 3840 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 4031 4228 gene locus_tag LOCUS_22800 4031 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4225 5145 gene locus_tag LOCUS_22810 4225 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence190 1474 266 gene locus_tag LOCUS_22820 gene nirJ 1474 266 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_22820 2135 1497 gene locus_tag LOCUS_22830 2135 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2638 2135 gene locus_tag LOCUS_22840 2638 2135 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_22840 3689 2631 gene locus_tag LOCUS_22850 3689 2631 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_22850 4897 3689 gene locus_tag LOCUS_22860 gene nirF 4897 3689 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_22860 5357 4974 gene locus_tag LOCUS_22870 5357 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 5800 5474 gene locus_tag LOCUS_22880 5800 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence191 1235 3385 gene locus_tag LOCUS_22890 1235 3385 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064349.1 protein_id gnl|my_center|LOCUS_22890 3452 4852 gene locus_tag LOCUS_22900 gene lpdA 3452 4852 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389631.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence192 412 1998 gene locus_tag LOCUS_22910 412 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2000 5239 gene locus_tag LOCUS_22920 2000 5239 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_22920 5554 5736 gene locus_tag LOCUS_22930 5554 5736 CDS product DUF2933 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843494.1 protein_id gnl|my_center|LOCUS_22930 5738 6136 gene locus_tag LOCUS_22940 5738 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence193 1642 437 gene locus_tag LOCUS_22950 1642 437 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_22950 1771 2661 gene locus_tag LOCUS_22960 1771 2661 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_22960 3481 2765 gene locus_tag LOCUS_22970 3481 2765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446410.1 protein_id gnl|my_center|LOCUS_22970 4227 3478 gene locus_tag LOCUS_22980 4227 3478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815010.1 protein_id gnl|my_center|LOCUS_22980 5302 4268 gene locus_tag LOCUS_22990 5302 4268 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 protein_id gnl|my_center|LOCUS_22990 6270 5317 gene locus_tag LOCUS_23000 6270 5317 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence194 968 66 gene locus_tag LOCUS_23010 gene prmA 968 66 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_23010 2330 972 gene locus_tag LOCUS_23020 gene accC 2330 972 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194420.1 protein_id gnl|my_center|LOCUS_23020 2790 2338 gene locus_tag LOCUS_23030 gene accB 2790 2338 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_23030 2686 3063 gene locus_tag LOCUS_23040 2686 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3704 3153 gene locus_tag LOCUS_23050 3704 3153 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814954.1 protein_id gnl|my_center|LOCUS_23050 4321 3701 gene locus_tag LOCUS_23060 4321 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 4403 5776 gene locus_tag LOCUS_23070 gene mpl 4403 5776 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_23070 <6476 5897 gene locus_tag LOCUS_23080 <6476 5897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815190.1:BON domain-containing protein >Feature sequence195 1022 282 gene locus_tag LOCUS_23090 1022 282 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_23090 1594 1019 gene locus_tag LOCUS_23100 1594 1019 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_23100 1771 2268 gene locus_tag LOCUS_23110 1771 2268 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_23110 2299 2478 gene locus_tag LOCUS_23120 gene rpmF 2299 2478 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_23120 2566 3588 gene locus_tag LOCUS_23130 gene plsX 2566 3588 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_23130 3585 4550 gene locus_tag LOCUS_23140 3585 4550 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191537.1 protein_id gnl|my_center|LOCUS_23140 4587 5516 gene locus_tag LOCUS_23150 gene fabD 4587 5516 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_23150 5520 6269 gene locus_tag LOCUS_23160 gene fabG 5520 6269 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence196 846 1835 gene locus_tag LOCUS_23170 846 1835 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_23170 1990 2853 gene locus_tag LOCUS_23180 1990 2853 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047059.1 protein_id gnl|my_center|LOCUS_23180 2873 3715 gene locus_tag LOCUS_23190 2873 3715 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_23190 3717 4559 gene locus_tag LOCUS_23200 3717 4559 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403550.1 protein_id gnl|my_center|LOCUS_23200 4556 5365 gene locus_tag LOCUS_23210 gene phnE 4556 5365 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_23210 5385 5690 gene locus_tag LOCUS_23220 5385 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 6173 5802 gene locus_tag LOCUS_23230 6173 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence197 1202 171 gene locus_tag LOCUS_23240 gene pheS 1202 171 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926359.1 protein_id gnl|my_center|LOCUS_23240 1652 1293 gene locus_tag LOCUS_23250 gene rplT 1652 1293 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_23250 1862 1665 gene locus_tag LOCUS_23260 gene rpmI 1862 1665 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_23260 2438 2007 gene locus_tag LOCUS_23270 gene infC 2438 2007 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_23270 4471 2555 gene locus_tag LOCUS_23280 gene thrS 4471 2555 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_23280 4724 4648 gene locus_tag LOCUS_t00320 4724 4648 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5036 4794 gene locus_tag LOCUS_23290 5036 4794 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_23290 5892 5104 gene locus_tag LOCUS_23300 5892 5104 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_23300 6320 5892 gene locus_tag LOCUS_23310 6320 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence198 675 94 gene locus_tag LOCUS_23320 gene rsxA 675 94 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723764.1 protein_id gnl|my_center|LOCUS_23320 885 1484 gene locus_tag LOCUS_23330 885 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3914 1596 gene locus_tag LOCUS_23340 3914 1596 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_23340 5113 4070 gene locus_tag LOCUS_23350 5113 4070 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459270.1 protein_id gnl|my_center|LOCUS_23350 6132 5110 gene locus_tag LOCUS_23360 6132 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 6382 6134 gene locus_tag LOCUS_23370 6382 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence199 <1 1061 gene locus_tag LOCUS_23380 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931641.1:histidinol dehydrogenase 2151 1078 gene locus_tag LOCUS_23390 gene hisC 2151 1078 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040076.1 protein_id gnl|my_center|LOCUS_23390 2299 2886 gene locus_tag LOCUS_23400 gene hisB 2299 2886 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_23400 2975 3613 gene locus_tag LOCUS_23410 gene hisH 2975 3613 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_23410 3661 4410 gene locus_tag LOCUS_23420 gene hisA 3661 4410 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_23420 4436 5203 gene locus_tag LOCUS_23430 gene hisF 4436 5203 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_23430 5200 5595 gene locus_tag LOCUS_23440 gene hisI 5200 5595 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_23440 5592 5933 gene locus_tag LOCUS_23450 5592 5933 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687491.1 protein_id gnl|my_center|LOCUS_23450 5930 6277 gene locus_tag LOCUS_23460 5930 6277 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence200 916 158 gene locus_tag LOCUS_23470 916 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3793 941 gene locus_tag LOCUS_23480 3793 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 4203 3877 gene locus_tag LOCUS_23490 4203 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4484 4227 gene locus_tag LOCUS_23500 4484 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 5862 4573 gene locus_tag LOCUS_23510 5862 4573 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence201 3 134 gene locus_tag LOCUS_23520 3 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 158 649 gene locus_tag LOCUS_23530 158 649 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390931.1 protein_id gnl|my_center|LOCUS_23530 662 1990 gene locus_tag LOCUS_23540 662 1990 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_23540 3490 2042 gene locus_tag LOCUS_23550 3490 2042 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_23550 4311 3487 gene locus_tag LOCUS_23560 gene rfaP 4311 3487 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_23560 5465 4326 gene locus_tag LOCUS_23570 5465 4326 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_23570 <6350 5465 gene locus_tag LOCUS_23580 <6350 5465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095779.1:lipopolysaccharide heptosyltransferase I >Feature sequence202 538 4305 gene locus_tag LOCUS_23590 gene putA 538 4305 CDS product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064076.1 protein_id gnl|my_center|LOCUS_23590 2670 2575 gene locus_tag LOCUS_t00330 2670 2575 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4440 5351 gene locus_tag LOCUS_23600 gene rlmA 4440 5351 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_23600 5454 5903 gene locus_tag LOCUS_23610 gene cynS 5454 5903 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072180.1 protein_id gnl|my_center|LOCUS_23610 6268 6044 gene locus_tag LOCUS_23620 6268 6044 CDS product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111981.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence203 312 3284 gene locus_tag LOCUS_23630 312 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3281 3937 gene locus_tag LOCUS_23640 3281 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 3934 4731 gene locus_tag LOCUS_23650 gene truA 3934 4731 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_23650 4732 5355 gene locus_tag LOCUS_23660 4732 5355 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence204 392 1732 gene locus_tag LOCUS_23670 gene bioA 392 1732 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_23670 1754 2956 gene locus_tag LOCUS_23680 gene bioF 1754 2956 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_23680 3036 3854 gene locus_tag LOCUS_23690 gene bioH 3036 3854 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060080.1 protein_id gnl|my_center|LOCUS_23690 3851 4750 gene locus_tag LOCUS_23700 gene bioC 3851 4750 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705389.1 protein_id gnl|my_center|LOCUS_23700 4765 5451 gene locus_tag LOCUS_23710 gene bioD 4765 5451 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 protein_id gnl|my_center|LOCUS_23710 <6208 5625 gene locus_tag LOCUS_23720 <6208 5625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222468.1:RNA methyltransferase >Feature sequence205 1179 343 gene locus_tag LOCUS_23730 1179 343 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222289.1 protein_id gnl|my_center|LOCUS_23730 1466 2374 gene locus_tag LOCUS_23740 1466 2374 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_23740 3656 2472 gene locus_tag LOCUS_23750 3656 2472 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040173.1 protein_id gnl|my_center|LOCUS_23750 4649 3849 gene locus_tag LOCUS_23760 gene ugpQ 4649 3849 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073603.1 protein_id gnl|my_center|LOCUS_23760 6127 4646 gene locus_tag LOCUS_23770 6127 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence206 1017 265 gene locus_tag LOCUS_23780 gene rpsB 1017 265 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_23780 1340 2161 gene locus_tag LOCUS_23790 gene map 1340 2161 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_23790 2191 4767 gene locus_tag LOCUS_23800 2191 4767 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197089.1 protein_id gnl|my_center|LOCUS_23800 5281 4775 gene locus_tag LOCUS_23810 5281 4775 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_23810 6027 5290 gene locus_tag LOCUS_23820 6027 5290 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence207 251 748 gene locus_tag LOCUS_23830 251 748 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_23830 826 3618 gene locus_tag LOCUS_23840 826 3618 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_23840 3618 5324 gene locus_tag LOCUS_23850 3618 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence208 <1 2252 gene locus_tag LOCUS_23860 <1 2252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522336.1:aminopeptidase N 2809 2363 gene locus_tag LOCUS_23870 2809 2363 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_23870 3802 2975 gene locus_tag LOCUS_23880 gene panC 3802 2975 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_23880 4651 3836 gene locus_tag LOCUS_23890 gene panB 4651 3836 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_23890 5106 4723 gene locus_tag LOCUS_23900 5106 4723 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_23900 5632 5138 gene locus_tag LOCUS_23910 5632 5138 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence209 55 522 gene locus_tag LOCUS_23920 55 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 559 1104 gene locus_tag LOCUS_23930 559 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 1182 1892 gene locus_tag LOCUS_23940 gene fabG 1182 1892 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_23940 2539 3687 gene locus_tag LOCUS_23950 2539 3687 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480157.1 protein_id gnl|my_center|LOCUS_23950 3778 4833 gene locus_tag LOCUS_23960 3778 4833 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813866.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence210 278 760 gene locus_tag LOCUS_23970 278 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 762 1406 gene locus_tag LOCUS_23980 762 1406 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_23980 1609 1974 gene locus_tag LOCUS_23990 1609 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2158 2000 gene locus_tag LOCUS_24000 2158 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2273 2348 gene locus_tag LOCUS_t00340 2273 2348 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2420 2496 gene locus_tag LOCUS_t00350 2420 2496 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2597 3457 gene locus_tag LOCUS_24010 2597 3457 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537097.1 protein_id gnl|my_center|LOCUS_24010 4713 3526 gene locus_tag LOCUS_24020 gene pobA 4713 3526 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268471.1 protein_id gnl|my_center|LOCUS_24020 4872 5762 gene locus_tag LOCUS_24030 4872 5762 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence211 1177 380 gene locus_tag LOCUS_24040 1177 380 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_24040 2227 1196 gene locus_tag LOCUS_24050 2227 1196 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_24050 2475 3476 gene locus_tag LOCUS_24060 gene mltG 2475 3476 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_24060 3473 4177 gene locus_tag LOCUS_24070 gene tmk 3473 4177 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527198.1 protein_id gnl|my_center|LOCUS_24070 4398 4060 gene locus_tag LOCUS_24080 4398 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 4402 5232 gene locus_tag LOCUS_24090 4402 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5229 5591 gene locus_tag LOCUS_24100 5229 5591 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409617.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence212 2058 1675 gene locus_tag LOCUS_24110 2058 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2276 2950 gene locus_tag LOCUS_24120 2276 2950 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_24120 5657 2958 gene locus_tag LOCUS_24130 gene acnA 5657 2958 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence213 <1 929 gene locus_tag LOCUS_24140 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920055.1:TonB-dependent hemoglobin/transferrin/lactoferrin family receptor 1121 2080 gene locus_tag LOCUS_24150 1121 2080 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_24150 2077 2868 gene locus_tag LOCUS_24160 2077 2868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_24160 2865 3782 gene locus_tag LOCUS_24170 2865 3782 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 protein_id gnl|my_center|LOCUS_24170 3797 5185 gene locus_tag LOCUS_24180 3797 5185 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 protein_id gnl|my_center|LOCUS_24180 <6031 5198 gene locus_tag LOCUS_24190 <6031 5198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903808.1:MFS transporter >Feature sequence214 273 64 gene locus_tag LOCUS_24200 gene yidD 273 64 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_24200 518 270 gene locus_tag LOCUS_24210 518 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24210 1032 2585 gene locus_tag LOCUS_24220 gene dnaA 1032 2585 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204805.1 protein_id gnl|my_center|LOCUS_24220 2630 3751 gene locus_tag LOCUS_24230 gene dnaN 2630 3751 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence215 224 36 gene locus_tag LOCUS_24240 224 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 871 236 gene locus_tag LOCUS_24250 gene ccoO 871 236 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_24250 2317 887 gene locus_tag LOCUS_24260 gene ccoN 2317 887 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 protein_id gnl|my_center|LOCUS_24260 3155 2946 gene locus_tag LOCUS_24270 gene ccoS 3155 2946 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688317.1 protein_id gnl|my_center|LOCUS_24270 5664 3160 gene locus_tag LOCUS_24280 5664 3160 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951108.1 protein_id gnl|my_center|LOCUS_24280 5928 5853 gene locus_tag LOCUS_t00360 5928 5853 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence216 596 126 gene locus_tag LOCUS_24290 596 126 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_24290 2578 605 gene locus_tag LOCUS_24300 2578 605 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811412.1 protein_id gnl|my_center|LOCUS_24300 3536 2925 gene locus_tag LOCUS_24310 3536 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 4101 3586 gene locus_tag LOCUS_24320 gene lspA 4101 3586 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004863699.1 protein_id gnl|my_center|LOCUS_24320 <5909 4098 gene locus_tag LOCUS_24330 <5909 4098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895660.1:heavy metal translocating P-type ATPase >Feature sequence217 254 2617 gene locus_tag LOCUS_24340 254 2617 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_24340 2621 3445 gene locus_tag LOCUS_24350 2621 3445 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_24350 3442 4215 gene locus_tag LOCUS_24360 3442 4215 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_24360 4221 5438 gene locus_tag LOCUS_24370 4221 5438 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence218 1200 208 gene locus_tag LOCUS_24380 gene paaA 1200 208 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523130.1 protein_id gnl|my_center|LOCUS_24380 2619 1270 gene locus_tag LOCUS_24390 gene paaF 2619 1270 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038746825.1 protein_id gnl|my_center|LOCUS_24390 3107 2616 gene locus_tag LOCUS_24400 gene paaI 3107 2616 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_24400 4019 3213 gene locus_tag LOCUS_24410 gene paaG 4019 3213 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence219 857 414 gene locus_tag LOCUS_24420 857 414 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552238.1 protein_id gnl|my_center|LOCUS_24420 1303 854 gene locus_tag LOCUS_24430 1303 854 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205743.1 protein_id gnl|my_center|LOCUS_24430 2631 1315 gene locus_tag LOCUS_24440 2631 1315 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532599.1 protein_id gnl|my_center|LOCUS_24440 2945 2664 gene locus_tag LOCUS_24450 2945 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4671 2956 gene locus_tag LOCUS_24460 4671 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5532 4693 gene locus_tag LOCUS_24470 gene cpaB 5532 4693 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence220 464 850 gene locus_tag LOCUS_24480 464 850 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_24480 847 1200 gene locus_tag LOCUS_24490 847 1200 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918351.1 protein_id gnl|my_center|LOCUS_24490 1609 1268 gene locus_tag LOCUS_24500 1609 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1829 3289 gene locus_tag LOCUS_24510 gene guaB 1829 3289 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_24510 3326 4036 gene locus_tag LOCUS_24520 3326 4036 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_24520 4055 5617 gene locus_tag LOCUS_24530 gene guaA 4055 5617 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193192.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence221 80 613 gene locus_tag LOCUS_24540 80 613 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339116.1 protein_id gnl|my_center|LOCUS_24540 625 2061 gene locus_tag LOCUS_24550 gene rsxC 625 2061 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339117.1 protein_id gnl|my_center|LOCUS_24550 2058 3140 gene locus_tag LOCUS_24560 2058 3140 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339118.1 protein_id gnl|my_center|LOCUS_24560 3137 3796 gene locus_tag LOCUS_24570 gene rsxG 3137 3796 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339119.1 protein_id gnl|my_center|LOCUS_24570 3793 4467 gene locus_tag LOCUS_24580 3793 4467 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119632344.1 protein_id gnl|my_center|LOCUS_24580 4494 4796 gene locus_tag LOCUS_24590 4494 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 5311 4841 gene locus_tag LOCUS_24600 5311 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 5256 5471 gene locus_tag LOCUS_24610 5256 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence222 983 378 gene locus_tag LOCUS_24620 983 378 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525148.1 protein_id gnl|my_center|LOCUS_24620 1141 1758 gene locus_tag LOCUS_24630 1141 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_24630 3665 1788 gene locus_tag LOCUS_24640 3665 1788 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 protein_id gnl|my_center|LOCUS_24640 5462 3894 gene locus_tag LOCUS_24650 gene ahpF 5462 3894 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence223 682 1773 gene locus_tag LOCUS_24660 gene gcvT 682 1773 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808404.1 protein_id gnl|my_center|LOCUS_24660 1854 2240 gene locus_tag LOCUS_24670 gene gcvH 1854 2240 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_24670 2388 5282 gene locus_tag LOCUS_24680 gene gcvP 2388 5282 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114051.1 protein_id gnl|my_center|LOCUS_24680 >Feature sequence224 <1 1836 gene locus_tag LOCUS_24690 <1 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838383.1:efflux RND transporter permease subunit 1908 4595 gene locus_tag LOCUS_24700 1908 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 4592 5167 gene locus_tag LOCUS_24710 4592 5167 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189913.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence225 2122 1232 gene locus_tag LOCUS_24720 gene thiD 2122 1232 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815096.1 protein_id gnl|my_center|LOCUS_24720 2360 3013 gene locus_tag LOCUS_24730 2360 3013 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_24730 3029 3352 gene locus_tag LOCUS_24740 3029 3352 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_24740 3381 4706 gene locus_tag LOCUS_24750 3381 4706 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_24750 5661 4762 gene locus_tag LOCUS_24760 5661 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence226 1504 554 gene locus_tag LOCUS_24770 1504 554 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_24770 1671 1595 gene locus_tag LOCUS_t00370 1671 1595 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2594 1716 gene locus_tag LOCUS_24780 gene ispE 2594 1716 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_24780 3154 2576 gene locus_tag LOCUS_24790 3154 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4869 3151 gene locus_tag LOCUS_24800 4869 3151 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808496.1 protein_id gnl|my_center|LOCUS_24800 4826 5140 gene locus_tag LOCUS_24810 4826 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence227 <1 1595 gene locus_tag LOCUS_24820 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187052.1:cytochrome P450/oxidoreductase 1638 2672 gene locus_tag LOCUS_24830 1638 2672 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532439.1 protein_id gnl|my_center|LOCUS_24830 2771 3259 gene locus_tag LOCUS_24840 2771 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 3252 4553 gene locus_tag LOCUS_24850 3252 4553 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_24850 4605 5156 gene locus_tag LOCUS_24860 4605 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5631 5182 gene locus_tag LOCUS_24870 5631 5182 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089256.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence228 465 2255 gene locus_tag LOCUS_24880 gene arsA 465 2255 CDS product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 protein_id gnl|my_center|LOCUS_24880 2313 3395 gene locus_tag LOCUS_24890 gene arsB 2313 3395 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_24890 3473 4873 gene locus_tag LOCUS_24900 3473 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 5038 5274 gene locus_tag LOCUS_24910 5038 5274 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence229 1715 438 gene locus_tag LOCUS_24920 gene flgE 1715 438 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367327.1 protein_id gnl|my_center|LOCUS_24920 2487 1801 gene locus_tag LOCUS_24930 gene flgD 2487 1801 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211112.1 protein_id gnl|my_center|LOCUS_24930 2897 2493 gene locus_tag LOCUS_24940 gene flgC 2897 2493 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_24940 3327 2923 gene locus_tag LOCUS_24950 gene flgB 3327 2923 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_24950 3545 3324 gene locus_tag LOCUS_24960 3545 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3561 4316 gene locus_tag LOCUS_24970 gene flgA 3561 4316 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_24970 4434 4730 gene locus_tag LOCUS_24980 4434 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 4727 5176 gene locus_tag LOCUS_24990 4727 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 >Feature sequence230 2668 1799 gene locus_tag LOCUS_25000 2668 1799 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925213.1 protein_id gnl|my_center|LOCUS_25000 4295 3075 gene locus_tag LOCUS_25010 4295 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25010 5494 4292 gene locus_tag LOCUS_25020 5494 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25020 >Feature sequence231 376 1146 gene locus_tag LOCUS_25030 376 1146 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_25030 1465 2400 gene locus_tag LOCUS_25040 1465 2400 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812137.1 protein_id gnl|my_center|LOCUS_25040 2554 3009 gene locus_tag LOCUS_25050 2554 3009 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence232 362 817 gene locus_tag LOCUS_25060 362 817 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_25060 868 2331 gene locus_tag LOCUS_25070 868 2331 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_25070 2328 4244 gene locus_tag LOCUS_25080 2328 4244 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763703.1 protein_id gnl|my_center|LOCUS_25080 4241 4882 gene locus_tag LOCUS_25090 4241 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence233 433 669 gene locus_tag LOCUS_25100 433 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 731 2026 gene locus_tag LOCUS_25110 gene gltA 731 2026 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_25110 2179 5040 gene locus_tag LOCUS_25120 2179 5040 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence234 <5376 4290 gene locus_tag LOCUS_25130 <5376 4290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521919.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence235 312 1007 gene locus_tag LOCUS_25140 312 1007 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_25140 1138 1326 gene locus_tag LOCUS_25150 1138 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1507 2130 gene locus_tag LOCUS_25160 1507 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2127 2942 gene locus_tag LOCUS_25170 2127 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017274729.1 protein_id gnl|my_center|LOCUS_25170 2939 3550 gene locus_tag LOCUS_25180 2939 3550 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_25180 3547 3738 gene locus_tag LOCUS_25190 3547 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3766 4881 gene locus_tag LOCUS_25200 3766 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 <5334 4797 gene locus_tag LOCUS_25210 <5334 4797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:arsenosugar biosynthesis radical SAM protein ArsS >Feature sequence236 448 1155 gene locus_tag LOCUS_25220 448 1155 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_25220 1202 2026 gene locus_tag LOCUS_25230 gene proC 1202 2026 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194039.1 protein_id gnl|my_center|LOCUS_25230 2030 2611 gene locus_tag LOCUS_25240 2030 2611 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377215.1 protein_id gnl|my_center|LOCUS_25240 3199 2618 gene locus_tag LOCUS_25250 3199 2618 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754228.1 protein_id gnl|my_center|LOCUS_25250 4540 3263 gene locus_tag LOCUS_25260 4540 3263 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_25260 <5333 4572 gene locus_tag LOCUS_25270 <5333 4572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534003.1:aspartate carbamoyltransferase catalytic subunit >Feature sequence237 915 583 gene locus_tag LOCUS_25280 915 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 833 1018 gene locus_tag LOCUS_25290 833 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1229 1999 gene locus_tag LOCUS_25300 gene ompR 1229 1999 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_25300 2007 3407 gene locus_tag LOCUS_25310 2007 3407 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813884.1 protein_id gnl|my_center|LOCUS_25310 3404 4012 gene locus_tag LOCUS_25320 3404 4012 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_25320 4012 4311 gene locus_tag LOCUS_25330 4012 4311 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_25330 4308 4598 gene locus_tag LOCUS_25340 4308 4598 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence238 790 329 gene locus_tag LOCUS_25350 790 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1976 777 gene locus_tag LOCUS_25360 1976 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 protein_id gnl|my_center|LOCUS_25360 4420 1973 gene locus_tag LOCUS_25370 4420 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <5295 4524 gene locus_tag LOCUS_25380 <5295 4524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440399.1:malonyl-CoA decarboxylase >Feature sequence239 493 404 gene locus_tag LOCUS_t00380 493 404 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2021 711 gene locus_tag LOCUS_25390 gene rlmD 2021 711 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_25390 2382 2720 gene locus_tag LOCUS_25400 2382 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3923 2781 gene locus_tag LOCUS_25410 gene bamC 3923 2781 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_25410 4828 3950 gene locus_tag LOCUS_25420 gene dapA 4828 3950 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence240 2701 1025 gene locus_tag LOCUS_25430 gene hutU 2701 1025 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207979.1 protein_id gnl|my_center|LOCUS_25430 3704 2757 gene locus_tag LOCUS_25440 gene hutG 3704 2757 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704354.1 protein_id gnl|my_center|LOCUS_25440 4921 3701 gene locus_tag LOCUS_25450 gene hutI 4921 3701 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence241 263 4303 gene locus_tag LOCUS_25460 263 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 4327 4893 gene locus_tag LOCUS_25470 gene msrA 4327 4893 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814600.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence242 <1 1446 gene locus_tag LOCUS_25480 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085901.1:thymidine phosphorylase family protein 1523 2422 gene locus_tag LOCUS_25490 1523 2422 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_25490 2616 3509 gene locus_tag LOCUS_25500 2616 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 3499 4560 gene locus_tag LOCUS_25510 3499 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence243 907 407 gene locus_tag LOCUS_25520 907 407 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965241.1 protein_id gnl|my_center|LOCUS_25520 1161 2159 gene locus_tag LOCUS_25530 gene cobS 1161 2159 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_25530 2165 4018 gene locus_tag LOCUS_25540 gene cobT 2165 4018 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_25540 4060 4413 gene locus_tag LOCUS_25550 4060 4413 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944048.1 protein_id gnl|my_center|LOCUS_25550 4763 4539 gene locus_tag LOCUS_25560 4763 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence244 2 1321 gene locus_tag LOCUS_25570 gene norB 2 1321 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_25570 1537 2634 gene locus_tag LOCUS_25580 gene epd 1537 2634 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_25580 2710 3306 gene locus_tag LOCUS_25590 2710 3306 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_25590 3318 3599 gene locus_tag LOCUS_25600 3318 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3596 4396 gene locus_tag LOCUS_25610 gene nirQ 3596 4396 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_25610 4456 4866 gene locus_tag LOCUS_25620 4456 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence245 600 516 gene locus_tag LOCUS_t00390 600 516 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 712 1776 gene locus_tag LOCUS_25630 gene queA 712 1776 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200515.1 protein_id gnl|my_center|LOCUS_25630 1766 2926 gene locus_tag LOCUS_25640 gene tgt 1766 2926 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064322.1 protein_id gnl|my_center|LOCUS_25640 3019 3345 gene locus_tag LOCUS_25650 gene yajC 3019 3345 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence246 1089 376 gene locus_tag LOCUS_25660 gene ybgF 1089 376 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004418664.1 protein_id gnl|my_center|LOCUS_25660 1603 1091 gene locus_tag LOCUS_25670 gene pal 1603 1091 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 protein_id gnl|my_center|LOCUS_25670 2946 1669 gene locus_tag LOCUS_25680 gene tolB 2946 1669 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533572.1 protein_id gnl|my_center|LOCUS_25680 3919 2987 gene locus_tag LOCUS_25690 3919 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4329 3916 gene locus_tag LOCUS_25700 gene tolR 4329 3916 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_25700 <5034 4352 gene locus_tag LOCUS_25710 <5034 4352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186467.1:protein TolQ >Feature sequence247 <1 687 gene locus_tag LOCUS_25720 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029443774.1:cytochrome c oxidase subunit II 735 2312 gene locus_tag LOCUS_25730 gene ctaD 735 2312 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064812.1 protein_id gnl|my_center|LOCUS_25730 2434 3054 gene locus_tag LOCUS_25740 2434 3054 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_25740 3108 3275 gene locus_tag LOCUS_25750 3108 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3341 4216 gene locus_tag LOCUS_25760 3341 4216 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence248 366 25 gene locus_tag LOCUS_25770 366 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 697 359 gene locus_tag LOCUS_25780 697 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1050 694 gene locus_tag LOCUS_25790 1050 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 1529 1188 gene locus_tag LOCUS_25800 1529 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1899 3410 gene locus_tag LOCUS_25810 1899 3410 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205436.1 protein_id gnl|my_center|LOCUS_25810 3407 4168 gene locus_tag LOCUS_25820 3407 4168 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_25820 <4988 4182 gene locus_tag LOCUS_25830 <4988 4182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063658.1:tellurite resistance/C4-dicarboxylate transporter family protein >Feature sequence249 1 1008 gene locus_tag LOCUS_25840 1 1008 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200388.1 protein_id gnl|my_center|LOCUS_25840 1083 1706 gene locus_tag LOCUS_25850 1083 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1706 3055 gene locus_tag LOCUS_25860 1706 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3349 3699 gene locus_tag LOCUS_25870 3349 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 4553 3795 gene locus_tag LOCUS_25880 4553 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence250 24 590 gene locus_tag LOCUS_25890 gene dcd 24 590 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_25890 742 2985 gene locus_tag LOCUS_25900 742 2985 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_25900 3603 3118 gene locus_tag LOCUS_25910 3603 3118 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_25910 4403 3609 gene locus_tag LOCUS_25920 4403 3609 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence251 3794 2031 gene locus_tag LOCUS_25930 3794 2031 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_25930 4825 3914 gene locus_tag LOCUS_25940 4825 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence252 1451 165 gene locus_tag LOCUS_25950 1451 165 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_25950 2770 1448 gene locus_tag LOCUS_25960 gene sufD 2770 1448 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_25960 3567 2767 gene locus_tag LOCUS_25970 gene sufC 3567 2767 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_25970 <4823 3588 gene locus_tag LOCUS_25980 <4823 3588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141370.1:Fe-S cluster assembly protein SufB >Feature sequence253 2519 666 gene locus_tag LOCUS_25990 2519 666 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_25990 3181 2528 gene locus_tag LOCUS_26000 3181 2528 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence254 1231 329 gene locus_tag LOCUS_26010 gene argB 1231 329 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_26010 1344 1709 gene locus_tag LOCUS_26020 1344 1709 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_26020 1813 2928 gene locus_tag LOCUS_26030 1813 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_26030 3043 3855 gene locus_tag LOCUS_26040 3043 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 <4732 3890 gene locus_tag LOCUS_26050 <4732 3890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042594919.1:sigma-54 dependent transcriptional regulator >Feature sequence255 498 1805 gene locus_tag LOCUS_26060 gene tig 498 1805 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521257.1 protein_id gnl|my_center|LOCUS_26060 1826 2464 gene locus_tag LOCUS_26070 gene clpP 1826 2464 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_26070 2482 3750 gene locus_tag LOCUS_26080 gene clpX 2482 3750 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence256 <1 1227 gene locus_tag LOCUS_26090 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810115.1:acyl-CoA dehydrogenase 1261 1731 gene locus_tag LOCUS_26100 1261 1731 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_26100 1763 4174 gene locus_tag LOCUS_26110 1763 4174 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064157.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence257 <1 1530 gene locus_tag LOCUS_26120 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064331.1:apolipoprotein N-acyltransferase 1607 2569 gene locus_tag LOCUS_26130 gene glyQ 1607 2569 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence258 <1 1717 gene locus_tag LOCUS_26140 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193454.1:endopeptidase La 1933 2205 gene locus_tag LOCUS_26150 1933 2205 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_26150 2252 2327 gene locus_tag LOCUS_t00400 2252 2327 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2503 3726 gene locus_tag LOCUS_26160 2503 3726 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088899.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence259 <1 732 gene locus_tag LOCUS_26170 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000170147.1:3-hydroxybenzoate 6-monooxygenase 747 1385 gene locus_tag LOCUS_26180 gene maiA 747 1385 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_26180 1438 2421 gene locus_tag LOCUS_26190 1438 2421 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_26190 2601 3098 gene locus_tag LOCUS_26200 2601 3098 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813272.1 protein_id gnl|my_center|LOCUS_26200 3095 4372 gene locus_tag LOCUS_26210 3095 4372 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence260 <1 961 gene locus_tag LOCUS_26220 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004199569.1:pyruvate dehydrogenase (acetyl-transferring), homodimeric type 982 2664 gene locus_tag LOCUS_26230 gene aceF 982 2664 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_26230 2755 4371 gene locus_tag LOCUS_26240 gene lpdA 2755 4371 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459591.1 protein_id gnl|my_center|LOCUS_26240 >Feature sequence261 <1 1989 gene locus_tag LOCUS_26250 <1 1989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529996.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase 2091 2330 gene locus_tag LOCUS_26260 2091 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2966 2388 gene locus_tag LOCUS_26270 2966 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3577 2963 gene locus_tag LOCUS_26280 3577 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 <4595 3574 gene locus_tag LOCUS_26290 <4595 3574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980127.1:cbb3-type cytochrome c oxidase subunit I >Feature sequence262 <1 1465 gene locus_tag LOCUS_26300 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087383.1:beta-1,6-glucan synthase 1789 1397 gene locus_tag LOCUS_26310 1789 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence263 240 1475 gene locus_tag LOCUS_26320 gene fabF 240 1475 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_26320 1503 2030 gene locus_tag LOCUS_26330 1503 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3715 2114 gene locus_tag LOCUS_26340 gene nadB 3715 2114 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_26340 3938 4537 gene locus_tag LOCUS_26350 gene rpoE 3938 4537 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence264 <1 1809 gene locus_tag LOCUS_26360 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480358.1:NEW3 domain-containing protein 3360 1924 gene locus_tag LOCUS_26370 3360 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 <4516 3889 gene locus_tag LOCUS_26380 <4516 3889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030860.1:response regulator transcription factor >Feature sequence265 <1 551 gene locus_tag LOCUS_26390 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216723.1:YebC/PmpR family DNA-binding transcriptional regulator 720 1571 gene locus_tag LOCUS_26400 720 1571 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387897.1 protein_id gnl|my_center|LOCUS_26400 1601 1918 gene locus_tag LOCUS_26410 1601 1918 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_26410 1926 2465 gene locus_tag LOCUS_26420 gene ruvC 1926 2465 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_26420 2562 2637 gene locus_tag LOCUS_t00410 2562 2637 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2887 3987 gene locus_tag LOCUS_26430 2887 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 4035 4358 gene locus_tag LOCUS_26440 4035 4358 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence266 <1 1995 gene locus_tag LOCUS_26450 <1 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224369.1:methylmalonyl-CoA mutase family protein 2079 2483 gene locus_tag LOCUS_26460 2079 2483 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_26460 3647 2541 gene locus_tag LOCUS_26470 3647 2541 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence267 966 106 gene locus_tag LOCUS_26480 966 106 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_26480 3172 1085 gene locus_tag LOCUS_26490 3172 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090272275.1 protein_id gnl|my_center|LOCUS_26490 3528 3989 gene locus_tag LOCUS_26500 3528 3989 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence268 757 284 gene locus_tag LOCUS_26510 757 284 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314430.1 protein_id gnl|my_center|LOCUS_26510 1686 751 gene locus_tag LOCUS_26520 1686 751 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_26520 1865 2644 gene locus_tag LOCUS_26530 1865 2644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_26530 2698 3618 gene locus_tag LOCUS_26540 2698 3618 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_26540 3641 3898 gene locus_tag LOCUS_26550 3641 3898 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_26550 3888 4166 gene locus_tag LOCUS_26560 3888 4166 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence269 1032 193 gene locus_tag LOCUS_26570 1032 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1298 1038 gene locus_tag LOCUS_26580 1298 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1608 2222 gene locus_tag LOCUS_26590 1608 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 2293 2383 gene locus_tag LOCUS_t00420 2293 2383 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3068 3631 gene locus_tag LOCUS_26600 3068 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 <4495 3802 gene locus_tag LOCUS_26610 <4495 3802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986802.1:L,D-transpeptidase family protein >Feature sequence270 1605 148 gene locus_tag LOCUS_26620 1605 148 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_26620 4153 1706 gene locus_tag LOCUS_26630 4153 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence271 175 1722 gene locus_tag LOCUS_26640 175 1722 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_26640 1728 3887 gene locus_tag LOCUS_26650 1728 3887 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_26650 3912 4277 gene locus_tag LOCUS_26660 3912 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 >Feature sequence272 <1 1409 gene locus_tag LOCUS_26670 <1 1409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064751.1:protein-disulfide reductase DsbD 1465 2079 gene locus_tag LOCUS_26680 1465 2079 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_26680 2125 3216 gene locus_tag LOCUS_26690 gene ribBA 2125 3216 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 protein_id gnl|my_center|LOCUS_26690 3242 3745 gene locus_tag LOCUS_26700 gene ribH 3242 3745 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_26700 3742 4245 gene locus_tag LOCUS_26710 gene nusB 3742 4245 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence273 446 1672 gene locus_tag LOCUS_26720 446 1672 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_26720 2147 1797 gene locus_tag LOCUS_26730 gene erpA 2147 1797 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_26730 3277 2240 gene locus_tag LOCUS_26740 gene argC 3277 2240 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_26740 3861 3469 gene locus_tag LOCUS_26750 gene rpsI 3861 3469 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_26750 4302 3874 gene locus_tag LOCUS_26760 gene rplM 4302 3874 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence274 199 927 gene locus_tag LOCUS_26770 199 927 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_26770 2482 935 gene locus_tag LOCUS_26780 gene hutH 2482 935 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114461.1 protein_id gnl|my_center|LOCUS_26780 3369 2449 gene locus_tag LOCUS_26790 3369 2449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_26790 4172 3363 gene locus_tag LOCUS_26800 4172 3363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726986.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence275 <1 550 gene locus_tag LOCUS_26810 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004540200.1:DNA polymerase I 1264 647 gene locus_tag LOCUS_26820 1264 647 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_26820 1430 2608 gene locus_tag LOCUS_26830 1430 2608 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence276 840 508 gene locus_tag LOCUS_26840 840 508 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_26840 1090 2406 gene locus_tag LOCUS_26850 gene guaD 1090 2406 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_26850 3561 2422 gene locus_tag LOCUS_26860 3561 2422 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_26860 4097 3561 gene locus_tag LOCUS_26870 gene cheD 4097 3561 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence277 2166 1204 gene locus_tag LOCUS_26880 gene glyQ 2166 1204 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929585.1 protein_id gnl|my_center|LOCUS_26880 3800 2241 gene locus_tag LOCUS_26890 gene lnt 3800 2241 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064331.1 protein_id gnl|my_center|LOCUS_26890 <4306 3800 gene locus_tag LOCUS_26900 <4306 3800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189366.1:transporter associated domain-containing protein >Feature sequence278 300 2135 gene locus_tag LOCUS_26910 300 2135 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975718.1 protein_id gnl|my_center|LOCUS_26910 2132 3493 gene locus_tag LOCUS_26920 2132 3493 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060859.1 protein_id gnl|my_center|LOCUS_26920 3655 4110 gene locus_tag LOCUS_26930 3655 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence279 <1 775 gene locus_tag LOCUS_26940 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931145.1:iron-containing alcohol dehydrogenase 2170 896 gene locus_tag LOCUS_26950 2170 896 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_26950 3452 2343 gene locus_tag LOCUS_26960 3452 2343 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence280 <1 1997 gene locus_tag LOCUS_26970 <1 1997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535491.1:FAD/FMN-binding oxidoreductase 2827 2045 gene locus_tag LOCUS_26980 2827 2045 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766661.1 protein_id gnl|my_center|LOCUS_26980 3576 2908 gene locus_tag LOCUS_26990 3576 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 <4258 3557 gene locus_tag LOCUS_27000 <4258 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002217982.1:orotate phosphoribosyltransferase >Feature sequence281 319 1674 gene locus_tag LOCUS_27010 319 1674 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_27010 1736 2512 gene locus_tag LOCUS_27020 1736 2512 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_27020 3013 2615 gene locus_tag LOCUS_27030 3013 2615 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_27030 3246 3010 gene locus_tag LOCUS_27040 3246 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4021 3284 gene locus_tag LOCUS_27050 4021 3284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence282 911 177 gene locus_tag LOCUS_27060 911 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 2990 1170 gene locus_tag LOCUS_27070 2990 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 <4250 3400 gene locus_tag LOCUS_27080 <4250 3400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037033.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase >Feature sequence283 1885 1223 gene locus_tag LOCUS_27090 1885 1223 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_27090 2594 1902 gene locus_tag LOCUS_27100 gene hda 2594 1902 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_27100 3727 2591 gene locus_tag LOCUS_27110 3727 2591 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence284 1697 1209 gene locus_tag LOCUS_27120 gene pncC 1697 1209 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132240.1 protein_id gnl|my_center|LOCUS_27120 2232 1750 gene locus_tag LOCUS_27130 2232 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3300 2344 gene locus_tag LOCUS_27140 gene thiL 3300 2344 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039076.1 protein_id gnl|my_center|LOCUS_27140 4031 3498 gene locus_tag LOCUS_27150 4031 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence285 1573 512 gene locus_tag LOCUS_27160 1573 512 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 protein_id gnl|my_center|LOCUS_27160 3437 1683 gene locus_tag LOCUS_27170 3437 1683 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_27170 3831 3586 gene locus_tag LOCUS_27180 3831 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence286 511 424 gene locus_tag LOCUS_t00430 511 424 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2118 760 gene locus_tag LOCUS_27190 gene rlmD 2118 760 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_27190 2479 2817 gene locus_tag LOCUS_27200 2479 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4011 2881 gene locus_tag LOCUS_27210 gene bamC 4011 2881 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence287 2201 1089 gene locus_tag LOCUS_27220 gene zapE 2201 1089 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550551.1 protein_id gnl|my_center|LOCUS_27220 3793 2363 gene locus_tag LOCUS_27230 gene lpdA 3793 2363 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534933.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence288 30 1073 gene locus_tag LOCUS_27240 30 1073 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_27240 1142 2014 gene locus_tag LOCUS_27250 gene mreC 1142 2014 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_27250 2018 2539 gene locus_tag LOCUS_27260 gene mreD 2018 2539 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence289 854 66 gene locus_tag LOCUS_27270 854 66 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_27270 1282 854 gene locus_tag LOCUS_27280 1282 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1458 1279 gene locus_tag LOCUS_27290 1458 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3586 1484 gene locus_tag LOCUS_27300 3586 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 <4059 3540 gene locus_tag LOCUS_27310 <4059 3540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532363.1:cysteine synthase CysM >Feature sequence290 2295 235 gene locus_tag LOCUS_27320 gene recG 2295 235 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27320 2768 2307 gene locus_tag LOCUS_27330 2768 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3621 2821 gene locus_tag LOCUS_27340 3621 2821 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence291 866 1747 gene locus_tag LOCUS_27350 866 1747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_27350 1744 2946 gene locus_tag LOCUS_27360 1744 2946 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_27360 3019 3633 gene locus_tag LOCUS_27370 gene gmk 3019 3633 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_27370 3636 3851 gene locus_tag LOCUS_27380 gene rpoZ 3636 3851 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence292 <1 1087 gene locus_tag LOCUS_27390 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807716.1:dihydroxy-acid dehydratase 1124 1318 gene locus_tag LOCUS_27400 1124 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1323 1625 gene locus_tag LOCUS_27410 1323 1625 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_27410 2096 3553 gene locus_tag LOCUS_27420 2096 3553 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence293 532 1647 gene locus_tag LOCUS_27430 532 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_27430 1730 2341 gene locus_tag LOCUS_27440 1730 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3865 2447 gene locus_tag LOCUS_27450 3865 2447 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence294 <1 1334 gene locus_tag LOCUS_27460 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004535538.1:isovaleryl-CoA dehydrogenase 1395 2525 gene locus_tag LOCUS_27470 1395 2525 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence295 310 849 gene locus_tag LOCUS_27480 310 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1705 1046 gene locus_tag LOCUS_27490 1705 1046 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence296 111 1328 gene locus_tag LOCUS_27500 111 1328 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_27500 1376 2446 gene locus_tag LOCUS_27510 gene mtnA 1376 2446 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337453.1 protein_id gnl|my_center|LOCUS_27510 2443 3159 gene locus_tag LOCUS_27520 2443 3159 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_27520 3304 3513 gene locus_tag LOCUS_27530 3304 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3513 3791 gene locus_tag LOCUS_27540 3513 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence297 110 604 gene locus_tag LOCUS_27550 110 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1983 805 gene locus_tag LOCUS_27560 1983 805 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_27560 2873 2022 gene locus_tag LOCUS_27570 2873 2022 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186676.1 protein_id gnl|my_center|LOCUS_27570 3032 3352 gene locus_tag LOCUS_27580 3032 3352 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185759.1 protein_id gnl|my_center|LOCUS_27580 3365 3703 gene locus_tag LOCUS_27590 3365 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence298 146 1075 gene locus_tag LOCUS_27600 gene pstA 146 1075 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_27600 1120 1902 gene locus_tag LOCUS_27610 gene pstB 1120 1902 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_27610 2904 1963 gene locus_tag LOCUS_27620 2904 1963 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_27620 3302 3066 gene locus_tag LOCUS_27630 3302 3066 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 protein_id gnl|my_center|LOCUS_27630 >Feature sequence299 1872 1531 gene locus_tag LOCUS_27640 1872 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2263 1883 gene locus_tag LOCUS_27650 2263 1883 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_27650 3414 2263 gene locus_tag LOCUS_27660 3414 2263 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence300 65 862 gene locus_tag LOCUS_27670 gene fabI 65 862 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191586.1 protein_id gnl|my_center|LOCUS_27670 2895 1000 gene locus_tag LOCUS_27680 gene ppiD 2895 1000 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969331.1 protein_id gnl|my_center|LOCUS_27680 <3888 3099 gene locus_tag LOCUS_27690 <3888 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192725.1:ATP-dependent chaperone ClpB >Feature sequence301 <1 1738 gene locus_tag LOCUS_27700 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192715.1:Rne/Rng family ribonuclease note possible pseudo, internal stop codon, frameshifted 2299 1826 gene locus_tag LOCUS_27710 2299 1826 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_27710 3868 2315 gene locus_tag LOCUS_27720 3868 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 >Feature sequence302 336 1433 gene locus_tag LOCUS_27730 gene epd 336 1433 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_27730 1509 2105 gene locus_tag LOCUS_27740 1509 2105 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_27740 2117 2398 gene locus_tag LOCUS_27750 2117 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 2395 3195 gene locus_tag LOCUS_27760 gene nirQ 2395 3195 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_27760 3254 3664 gene locus_tag LOCUS_27770 3254 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence303 425 979 gene locus_tag LOCUS_27780 425 979 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_27780 976 1746 gene locus_tag LOCUS_27790 976 1746 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_27790 1749 1901 gene locus_tag LOCUS_27800 1749 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 1909 2823 gene locus_tag LOCUS_27810 gene cysD 1909 2823 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence304 467 1399 gene locus_tag LOCUS_27820 gene secF 467 1399 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_27820 2071 1697 gene locus_tag LOCUS_27830 2071 1697 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_27830 3478 2102 gene locus_tag LOCUS_27840 gene purB 3478 2102 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence305 1194 439 gene locus_tag LOCUS_27850 gene cysE 1194 439 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_27850 2080 1340 gene locus_tag LOCUS_27860 gene trmJ 2080 1340 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_27860 2214 3026 gene locus_tag LOCUS_27870 2214 3026 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence306 1007 771 gene locus_tag LOCUS_27880 1007 771 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_27880 2026 1004 gene locus_tag LOCUS_27890 gene dusB 2026 1004 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_27890 <3733 2155 gene locus_tag LOCUS_27900 <3733 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926914.1:sulfate permease >Feature sequence307 921 352 gene locus_tag LOCUS_27910 921 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1086 3074 gene locus_tag LOCUS_27920 1086 3074 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951242.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence308 <1 1545 gene locus_tag LOCUS_27930 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011854083.1:TAT-dependent nitrous-oxide reductase >Feature sequence309 3267 2875 gene locus_tag LOCUS_27940 3267 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence310 497 1531 gene locus_tag LOCUS_27950 gene lpxD 497 1531 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521195.1 protein_id gnl|my_center|LOCUS_27950 1540 1974 gene locus_tag LOCUS_27960 gene fabZ 1540 1974 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_27960 1971 2741 gene locus_tag LOCUS_27970 gene lpxA 1971 2741 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence311 2045 1311 gene locus_tag LOCUS_27980 2045 1311 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258956.1 protein_id gnl|my_center|LOCUS_27980 2401 2042 gene locus_tag LOCUS_27990 2401 2042 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_27990 3188 2406 gene locus_tag LOCUS_28000 3188 2406 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258719.1 protein_id gnl|my_center|LOCUS_28000 3578 3653 gene locus_tag LOCUS_t00440 3578 3653 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence312 1448 522 gene locus_tag LOCUS_28010 1448 522 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 protein_id gnl|my_center|LOCUS_28010 1579 1851 gene locus_tag LOCUS_28020 1579 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1848 2231 gene locus_tag LOCUS_28030 1848 2231 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_28030 2294 2767 gene locus_tag LOCUS_28040 2294 2767 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_28040 3449 2796 gene locus_tag LOCUS_28050 3449 2796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence313 <1 868 gene locus_tag LOCUS_28060 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015706105.1:gentisate 1,2-dioxygenase 916 1626 gene locus_tag LOCUS_28070 916 1626 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930981.1 protein_id gnl|my_center|LOCUS_28070 1653 2861 gene locus_tag LOCUS_28080 1653 2861 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 protein_id gnl|my_center|LOCUS_28080 2875 3513 gene locus_tag LOCUS_28090 gene maiA 2875 3513 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence314 1971 856 gene locus_tag LOCUS_28100 1971 856 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_28100 3138 1996 gene locus_tag LOCUS_28110 gene rodA 3138 1996 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815198.1 protein_id gnl|my_center|LOCUS_28110 <3696 3135 gene locus_tag LOCUS_28120 <3696 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189575.1:penicillin-binding protein 2 note possible pseudo, frameshifted >Feature sequence315 <1 1606 gene locus_tag LOCUS_28130 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198453.1:ATP-dependent helicase 1603 1896 gene locus_tag LOCUS_28140 1603 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1918 2289 gene locus_tag LOCUS_28150 1918 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 <3694 2331 gene locus_tag LOCUS_28160 <3694 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112966.1:GTPase/DUF3482 domain-containing protein >Feature sequence316 >Feature sequence317 2055 1534 gene locus_tag LOCUS_28170 gene mreD 2055 1534 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_28170 2927 2058 gene locus_tag LOCUS_28180 gene mreC 2927 2058 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_28180 <3638 2996 gene locus_tag LOCUS_28190 <3638 2996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189550.1:rod shape-determining protein >Feature sequence318 1133 2020 gene locus_tag LOCUS_28200 1133 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2042 2848 gene locus_tag LOCUS_28210 2042 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 2919 3284 gene locus_tag LOCUS_28220 2919 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28220 >Feature sequence319 <1 850 gene locus_tag LOCUS_28230 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994052.1:methyl-accepting chemotaxis protein 958 1827 gene locus_tag LOCUS_28240 958 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1992 2957 gene locus_tag LOCUS_28250 1992 2957 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404105.1 protein_id gnl|my_center|LOCUS_28250 3026 3625 gene locus_tag LOCUS_28260 gene ruvA 3026 3625 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence320 233 415 gene locus_tag LOCUS_28270 gene rpmD 233 415 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_28270 417 854 gene locus_tag LOCUS_28280 gene rplO 417 854 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_28280 870 2195 gene locus_tag LOCUS_28290 gene secY 870 2195 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_28290 2200 2418 gene locus_tag LOCUS_28300 gene infA 2200 2418 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806927.1 protein_id gnl|my_center|LOCUS_28300 2611 2973 gene locus_tag LOCUS_28310 gene rpsM 2611 2973 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_28310 2986 3375 gene locus_tag LOCUS_28320 gene rpsK 2986 3375 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence321 665 264 gene locus_tag LOCUS_28330 gene vapC 665 264 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170069.1 protein_id gnl|my_center|LOCUS_28330 923 672 gene locus_tag LOCUS_28340 923 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1215 3203 gene locus_tag LOCUS_28350 1215 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence322 1912 2913 gene locus_tag LOCUS_28360 1912 2913 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence323 <1 1137 gene locus_tag LOCUS_28370 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368417.1:TrbI/VirB10 family protein 1414 3330 gene locus_tag LOCUS_28380 1414 3330 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence324 1697 2167 gene locus_tag LOCUS_28390 gene cadR 1697 2167 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence325 319 1335 gene locus_tag LOCUS_28400 gene ilvC 319 1335 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_28400 1494 2345 gene locus_tag LOCUS_28410 gene pssA 1494 2345 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814004.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence326 184 1224 gene locus_tag LOCUS_28420 184 1224 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927133.1 protein_id gnl|my_center|LOCUS_28420 1916 1323 gene locus_tag LOCUS_28430 1916 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 2498 2085 gene locus_tag LOCUS_28440 2498 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 3217 2804 gene locus_tag LOCUS_28450 3217 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence327 1596 802 gene locus_tag LOCUS_28460 gene lgt 1596 802 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_28460 2456 1743 gene locus_tag LOCUS_28470 2456 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence328 2469 556 gene locus_tag LOCUS_28480 2469 556 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_28480 <3434 2473 gene locus_tag LOCUS_28490 <3434 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073459.1:cytochrome c oxidase accessory protein CcoG >Feature sequence329 <1 550 gene locus_tag LOCUS_28500 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521865.1:phosphomethylpyrimidine synthase ThiC >Feature sequence330 1714 464 gene locus_tag LOCUS_28510 gene murA 1714 464 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527889.1 protein_id gnl|my_center|LOCUS_28510 1979 1722 gene locus_tag LOCUS_28520 1979 1722 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_28520 2809 1991 gene locus_tag LOCUS_28530 2809 1991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_28530 <3369 2802 gene locus_tag LOCUS_28540 <3369 2802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521934.1:ABC transporter ATP-binding protein >Feature sequence331 2332 671 gene locus_tag LOCUS_28550 2332 671 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence332 850 524 gene locus_tag LOCUS_28560 850 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1054 1130 gene locus_tag LOCUS_t00450 1054 1130 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1829 1422 gene locus_tag LOCUS_28570 1829 1422 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_28570 2050 1829 gene locus_tag LOCUS_28580 2050 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2158 2313 gene locus_tag LOCUS_28590 2158 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 <3358 2482 gene locus_tag LOCUS_28600 <3358 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940070.1:MBL fold metallo-hydrolase >Feature sequence333 965 2005 gene locus_tag LOCUS_28610 965 2005 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689901.1 protein_id gnl|my_center|LOCUS_28610 2062 2754 gene locus_tag LOCUS_28620 2062 2754 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence334 <1 1026 gene locus_tag LOCUS_28630 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920255.1:benzaldehyde dehydrogenase 1107 2282 gene locus_tag LOCUS_28640 1107 2282 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence335 <1 540 gene locus_tag LOCUS_28650 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039070.1:beta-ketoacyl synthase chain length factor 537 1016 gene locus_tag LOCUS_28660 537 1016 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_28660 1013 1732 gene locus_tag LOCUS_28670 gene fabG 1013 1732 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_28670 2507 1755 gene locus_tag LOCUS_28680 2507 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3312 2524 gene locus_tag LOCUS_28690 3312 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence336 1398 88 gene locus_tag LOCUS_28700 1398 88 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_28700 2284 1484 gene locus_tag LOCUS_28710 2284 1484 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence337 362 1696 gene locus_tag LOCUS_28720 362 1696 CDS product IS4-like element ISLpn6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946384.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence338 397 2640 gene locus_tag LOCUS_28730 397 2640 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence339 1596 802 gene locus_tag LOCUS_28740 gene lgt 1596 802 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_28740 2447 1740 gene locus_tag LOCUS_28750 2447 1740 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence340 1104 334 gene locus_tag LOCUS_28760 1104 334 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185567.1 protein_id gnl|my_center|LOCUS_28760 1459 1124 gene locus_tag LOCUS_28770 1459 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28770 <3202 1541 gene locus_tag LOCUS_28780 <3202 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193335.1:DNA mismatch repair protein MutS note possible pseudo, internal stop codon >Feature sequence341 819 1478 gene locus_tag LOCUS_28790 819 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 1539 2858 gene locus_tag LOCUS_28800 1539 2858 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence342 1655 2605 gene locus_tag LOCUS_28810 gene egtD 1655 2605 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence343 474 779 gene locus_tag LOCUS_28820 474 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1214 1450 gene locus_tag LOCUS_28830 1214 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 1459 3078 gene locus_tag LOCUS_28840 1459 3078 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence344 1320 565 gene locus_tag LOCUS_28850 1320 565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_28850 2284 1313 gene locus_tag LOCUS_28860 2284 1313 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_28860 <3086 2288 gene locus_tag LOCUS_28870 <3086 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083884.1:branched-chain amino acid ABC transporter permease >Feature sequence345 <1 1695 gene locus_tag LOCUS_28880 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930726.1:excinuclease ABC subunit UvrC >Feature sequence346 618 46 gene locus_tag LOCUS_28890 618 46 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_28890 1587 706 gene locus_tag LOCUS_28900 1587 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 2234 1587 gene locus_tag LOCUS_28910 2234 1587 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence347 473 859 gene locus_tag LOCUS_28920 gene rpsF 473 859 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688967.1 protein_id gnl|my_center|LOCUS_28920 876 1175 gene locus_tag LOCUS_28930 gene priB 876 1175 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_28930 1178 1453 gene locus_tag LOCUS_28940 gene rpsR 1178 1453 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 protein_id gnl|my_center|LOCUS_28940 1469 1918 gene locus_tag LOCUS_28950 gene rplI 1469 1918 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence348 267 82 gene locus_tag LOCUS_28960 267 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1113 547 gene locus_tag LOCUS_28970 gene ribA 1113 547 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004412070.1 protein_id gnl|my_center|LOCUS_28970 2110 1235 gene locus_tag LOCUS_28980 gene nadC 2110 1235 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_28980 2764 2135 gene locus_tag LOCUS_28990 2764 2135 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence349 452 2263 gene locus_tag LOCUS_29000 452 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence350 1411 47 gene locus_tag LOCUS_29010 gene rseP 1411 47 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205137.1 protein_id gnl|my_center|LOCUS_29010 2538 1408 gene locus_tag LOCUS_29020 gene ispC 2538 1408 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence351 2210 1011 gene locus_tag LOCUS_29030 gene obgE 2210 1011 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_29030 2584 2321 gene locus_tag LOCUS_29040 gene rpmA 2584 2321 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence352 603 1187 gene locus_tag LOCUS_29050 603 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017274729.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 1184 1795 gene locus_tag LOCUS_29060 1184 1795 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_29060 1792 1983 gene locus_tag LOCUS_29070 1792 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 <2967 2056 gene locus_tag LOCUS_29080 <2967 2056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000184001.1:chromate efflux transporter >Feature sequence353 445 1137 gene locus_tag LOCUS_29090 445 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_29090 1209 2252 gene locus_tag LOCUS_29100 1209 2252 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence354 234 683 gene locus_tag LOCUS_29110 234 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 670 1395 gene locus_tag LOCUS_29120 gene lptB 670 1395 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_29120 1418 2842 gene locus_tag LOCUS_29130 1418 2842 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence355 1995 535 gene locus_tag LOCUS_29140 1995 535 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387895.1 protein_id gnl|my_center|LOCUS_29140 2939 2085 gene locus_tag LOCUS_29150 2939 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence356 >Feature sequence357 1346 213 gene locus_tag LOCUS_29160 1346 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2464 1397 gene locus_tag LOCUS_29170 gene adhP 2464 1397 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438761.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence358 206 1162 gene locus_tag LOCUS_29180 206 1162 CDS product Chemotaxis protein methyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102222.1 protein_id gnl|my_center|LOCUS_29180 1171 1749 gene locus_tag LOCUS_29190 gene cheD 1171 1749 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence359 2210 2500 gene locus_tag LOCUS_29200 gene groES 2210 2500 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235240.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence360 67 1281 gene locus_tag LOCUS_29210 67 1281 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_29210 1271 2062 gene locus_tag LOCUS_29220 1271 2062 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_29220 2065 2733 gene locus_tag LOCUS_29230 gene nqrD 2065 2733 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence361 759 2462 gene locus_tag LOCUS_29240 759 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence362 634 2415 gene locus_tag LOCUS_29250 634 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence363 508 1221 gene locus_tag LOCUS_29260 gene pyrH 508 1221 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_29260 1240 1797 gene locus_tag LOCUS_29270 gene frr 1240 1797 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_29270 1847 2632 gene locus_tag LOCUS_29280 gene uppS 1847 2632 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence364 826 1977 gene locus_tag LOCUS_29290 826 1977 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110589.1 protein_id gnl|my_center|LOCUS_29290 >Feature sequence365 596 1621 gene locus_tag LOCUS_29300 596 1621 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 protein_id gnl|my_center|LOCUS_29300 <2807 1731 gene locus_tag LOCUS_29310 <2807 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:TRAP transporter large permease >Feature sequence366 1116 1871 gene locus_tag LOCUS_29320 1116 1871 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence367 1070 417 gene locus_tag LOCUS_29330 1070 417 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_29330 >Feature sequence368 252 497 gene locus_tag LOCUS_29340 252 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301252.1 protein_id gnl|my_center|LOCUS_29340 708 1535 gene locus_tag LOCUS_29350 gene pyrF 708 1535 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_29350 >Feature sequence369 380 973 gene locus_tag LOCUS_29360 380 973 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_29360 973 1641 gene locus_tag LOCUS_29370 973 1641 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815190.1 protein_id gnl|my_center|LOCUS_29370 2725 1664 gene locus_tag LOCUS_29380 2725 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence370 2255 1623 gene locus_tag LOCUS_29390 2255 1623 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_29390 >Feature sequence371 385 1146 gene locus_tag LOCUS_29400 385 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1158 2456 gene locus_tag LOCUS_29410 1158 2456 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_29410 >Feature sequence372 <1 1012 gene locus_tag LOCUS_29420 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926191.1:aldehyde dehydrogenase family protein 1770 1045 gene locus_tag LOCUS_29430 1770 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 2121 1831 gene locus_tag LOCUS_29440 2121 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence373 2102 981 gene locus_tag LOCUS_29450 gene dnaN 2102 981 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_29450 <2674 2168 gene locus_tag LOCUS_29460 <2674 2168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204805.1:chromosomal replication initiator protein DnaA >Feature sequence374 1433 483 gene locus_tag LOCUS_29470 1433 483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_29470 <2669 1405 gene locus_tag LOCUS_29480 <2669 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192948.1:nitrous oxide reductase family maturation protein NosD >Feature sequence375 2554 194 gene locus_tag LOCUS_29490 gene bamA 2554 194 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197083.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence376 1696 1259 gene locus_tag LOCUS_29500 1696 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29500 <2650 1725 gene locus_tag LOCUS_29510 <2650 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391503.1:ATP-binding protein >Feature sequence377 1659 352 gene locus_tag LOCUS_29520 1659 352 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_29520 <2641 1726 gene locus_tag LOCUS_29530 <2641 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527177.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence378 1805 1044 gene locus_tag LOCUS_29540 1805 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2086 1802 gene locus_tag LOCUS_29550 2086 1802 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_29550 <2631 2076 gene locus_tag LOCUS_29560 <2631 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189800.1:D-amino acid aminotransferase >Feature sequence379 82 1 gene locus_tag LOCUS_t00460 82 1 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 511 149 gene locus_tag LOCUS_29570 gene secG 511 149 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_29570 1285 548 gene locus_tag LOCUS_29580 gene tpiA 1285 548 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_29580 1460 1840 gene locus_tag LOCUS_29590 1460 1840 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049049137.1 protein_id gnl|my_center|LOCUS_29590 1837 2322 gene locus_tag LOCUS_29600 1837 2322 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence380 <1 594 gene locus_tag LOCUS_29610 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:Trk system potassium transporter TrkA 609 2066 gene locus_tag LOCUS_29620 609 2066 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929886.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence381 2514 1642 gene locus_tag LOCUS_29630 gene ubiA 2514 1642 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence382 <1 2243 gene locus_tag LOCUS_29640 <1 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522336.1:aminopeptidase N >Feature sequence383 <1 825 gene locus_tag LOCUS_29650 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195713.1:GTP cyclohydrolase FolE2 962 1312 gene locus_tag LOCUS_29660 962 1312 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_29660 1417 1504 gene locus_tag LOCUS_t00470 1417 1504 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1568 1644 gene locus_tag LOCUS_t00480 1568 1644 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1687 1763 gene locus_tag LOCUS_t00490 1687 1763 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence384 >Feature sequence385 515 1297 gene locus_tag LOCUS_29670 gene flgG 515 1297 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192166.1 protein_id gnl|my_center|LOCUS_29670 1297 1992 gene locus_tag LOCUS_29680 gene flgH 1297 1992 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160434.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence386 261 1112 gene locus_tag LOCUS_29690 gene rpoH 261 1112 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 protein_id gnl|my_center|LOCUS_29690 1798 1169 gene locus_tag LOCUS_29700 1798 1169 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_29700 <2513 1974 gene locus_tag LOCUS_29710 <2513 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522902.1:heme o synthase