COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..355196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(565..777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1264..2271) product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene fgd CDS complement(3228..3458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(3591..4667) product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene amrS CDS complement(4727..5320) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene hisH CDS complement(5321..5902) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene hisB CDS complement(5902..7074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(7061..8359) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene hisD CDS complement(8322..9323) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene hisG CDS complement(9405..9548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9715..11379 product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene thsB CDS 11387..11632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 11725..12828 product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(12825..13136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 13213..14382 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(14386..15525) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 15646..17637 product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 17641..18627 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(18630..19322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(19348..20772) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(20807..22390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22372..23100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23082..24401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(24401..25369) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(25362..25721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(25762..26232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(26475..28481) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS complement(28763..29896) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(30160..31536) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763152.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(31550..32101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(32116..32679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(32699..33091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 33191..34435 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(34432..34977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(34970..35341) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 35481..37169 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(37222..39054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(39132..39479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(39514..40317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(40410..41543) product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 41658..42650 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene speB CDS 42787..43257 product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(43247..44824) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pruA CDS 44925..46313 product alpha-glucosidase AglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene aglA CDS complement(46318..46881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 47052..47609 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(47586..48524) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene cyoE CDS 48605..49741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 49812..50075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(50068..50448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(50474..51475) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene radA CDS complement(51537..51809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 51936..52118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(52083..53384) product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 53440..54543 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene hisC CDS complement(54523..56007) product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(56070..56597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 56829..57446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 57547..57960 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(57953..58861) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene speE CDS complement(58854..59300) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene speD CDS 59408..61573 product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 61618..62277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 62274..62942 product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene npdG CDS 62974..64320 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 64313..65002 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 65029..66288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(66285..67094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(67091..67861) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(67858..68907) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 tRNA complement(68945..69019) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(69028..69774) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(69881..70621) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(70623..72035) product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 72636..72869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(72860..73783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(73799..74164) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 74209..75063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 75189..76436 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 76433..77755 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS 77806..79149 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762365.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 tRNA complement(79152..79225) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 79616..80035 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(80259..81212) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 81470..82738 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(82828..83841) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 84110..85288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(85340..86407) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761793.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(86490..87332) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene cofD CDS complement(87416..88048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(88077..88706) product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(88696..88956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 89406..89945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 89952..91301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 91436..91621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(91618..93006) product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(93068..95968) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene leuS CDS complement(96037..97023) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene thiL CDS complement(97010..97948) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(97945..98796) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene panB CDS complement(98793..99560) product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(99515..100240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 100196..100402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 100518..102818 product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene xdhA CDS complement(102828..103502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 103593..104705 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene carA CDS 104686..107955 product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979554.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene carB CDS 107990..108409 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ndk CDS complement(108410..108559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(108612..108815) product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(108863..109246) product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene rpl7ae CDS complement(109318..110718) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 110832..111188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 111185..112126 product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(112146..113105) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 113336..115993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 116124..116945 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(116914..118113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(118168..119028) product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(118998..119525) product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene endA CDS 119634..121163 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 121166..122827 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene pheT CDS complement(122844..123680) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene pheA CDS complement(123711..124661) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(124658..125431) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 125520..126059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 126056..127375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(127383..128789) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(128843..129748) product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(129705..130139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(130123..130317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 130349..131197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(131181..131354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 131589..132656 product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(132653..133606) product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(133626..134663) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(134717..135283) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene pyrH CDS 135167..135460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 135522..136751 product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene prf1 CDS 136846..137763 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene argF CDS complement(137756..138277) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene rplJ CDS 138371..139087 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 139092..139820 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(139810..140589) product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(140672..141526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(141538..141750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 142441..142740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 142808..143371 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene dcd CDS complement(143343..144125) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(144122..144568) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene moaC CDS complement(144618..145328) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene sdhB CDS complement(145333..145680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(145695..146183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 146313..147119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(147134..148030) product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(148308..148520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 148605..149222 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 149225..149431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 149418..149690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 149765..150118 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 150111..150545 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene rpl14p CDS 150639..150920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 150924..151640 product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 151622..152146 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 152223..154844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(154834..155262) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(155538..156125) product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 tRNA 156198..156272 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 156343..157308 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 157352..158545 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 158671..159720 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(159736..160035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(160119..160796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 160992..161324 product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene eif1A CDS 161390..162775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 162865..166320 product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 166301..166951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 166929..167495 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene scpB CDS 167555..168118 product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 168210..169781 product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 170258..170470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(170360..171043) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 171163..173064 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene nuoL CDS 173109..173282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 173282..173752 product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 tRNA 174096..174190 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(174286..174996) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(175020..175730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 175757..176656 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(176631..179411) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene alaS CDS complement(179466..179780) product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene rpl12p CDS 179926..180249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 180460..181293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(181296..181574) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 181611..182339 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 182336..183400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(183414..184580) product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene dnaG CDS 184688..185557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(185554..187443) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 187659..188207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 188263..188586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 188658..190283 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene pyrG CDS 190280..191011 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(190985..191905) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 191956..192456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 192505..194082 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 194072..195121 product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 195181..196218 product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene fen CDS complement(196226..196429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(196442..198631) product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762437.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(198710..199975) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 200180..201874 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 201890..202642 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 202644..203756 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385664.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 203764..204663 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 204666..205634 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 205647..206609 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867864.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(206617..207684) product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene pepQ CDS complement(207808..209565) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(209572..211659) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 211863..213083 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(213086..215482) product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 215704..217971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 218014..218622 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 218630..219103 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene rpmD CDS 219160..219594 product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 219599..221029 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene secY CDS 221032..221505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(221696..222271) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 222362..222643 product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 222652..222933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 note possible pseudo, frameshifted CDS 222990..223676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 note possible pseudo, frameshifted tRNA 223695..223782 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 224395..224739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 224869..226464 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 226451..227218 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391947.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(227211..227753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(227835..228986) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(229011..229640) product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(229656..230087) product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(230104..230694) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(230773..232671) product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rqcH CDS complement(232708..233355) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 233451..235484 product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 235665..236777 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 236774..238024 product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 238021..239289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 239319..239945 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene pdxT CDS 240007..240309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 240400..240741 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 240974..241258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 241368..241922 product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 241976..242428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 242429..243337 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene ftsY CDS complement(243329..244897) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene ppcA CDS complement(245089..247407) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene hypF CDS 247502..248668 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240243.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene hypD CDS 248670..248981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 248995..250020 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene hypE CDS 250262..251428 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 251438..251890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 tRNA complement(251870..251945) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 252106..253395 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene hisS CDS 253392..254213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(254185..255519) product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 255670..256320 product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(256486..256917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(256924..257415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(257528..259216) product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(259262..259663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(259669..260244) product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 260409..261188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 261330..262631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 note possible pseudo, frameshifted CDS 262637..263656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 note possible pseudo, frameshifted CDS 263721..265724 product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980280.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(265721..266215) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(266305..267396) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 tRNA complement(267487..267581) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 267769..268524 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 268548..269387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 269403..270029 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763732.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 270070..271194 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene sucC CDS complement(271186..271479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(271570..272046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 tRNA complement(272100..272174) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 272281..272565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 272745..274310 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene metG CDS complement(274315..275478) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene ftsZ CDS complement(275471..275617) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 275776..276147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 276144..278507 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 278786..279199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 279349..279747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(279744..280277) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115248746.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 280503..281537 product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene fgd CDS 281545..281892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 281889..283289 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene gndA CDS 283296..284306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(284303..285427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 285554..285844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(285837..286583) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 286748..288019 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 288072..288845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 tRNA 288899..288972 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(289138..289440) product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 289591..289917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 289992..290735 product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene cofE CDS 290759..291472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 291705..292160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(292174..292605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 292686..293525 product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 293506..294552 product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(294560..295279) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 295389..296294 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 296287..297234 product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene kdgK CDS 297282..298703 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene cca CDS 298703..299434 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 299536..300426 product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259326.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 300467..301174 product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(301190..301567) product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(301705..302253) product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(302426..303415) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(303462..303815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 303935..304549 product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(304550..305272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 305335..306123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 306157..306378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(306349..307377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 307817..309031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 309006..310109 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 310106..311806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 311846..312364 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 312333..313928 product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 313934..314671 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867250.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene nucS CDS complement(314681..315916) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(315993..316328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 316528..316788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(316793..320188) product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene polC CDS complement(320241..321053) product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(321063..321467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 tRNA complement(321495..321587) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(321615..322232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(322342..322632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 322556..323797 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene guaB CDS 323799..325049 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 325053..326432 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene truD CDS complement(326444..326659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 326559..327122 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(327132..327272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(327365..329146) product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762147.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 329219..329647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 329684..330070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(330076..331098) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076572118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene moaA CDS 331225..331953 product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene psmA CDS 332006..332704 product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 332701..333375 product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene rrp4 CDS 333362..334099 product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rrp41 CDS 334107..334943 product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rrp42 CDS 335015..335236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 335276..335665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 335735..336733 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 336730..337572 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 337569..338420 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 338417..339205 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(339189..340163) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(340160..340627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(340662..341009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(341120..341590) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene rplM CDS complement(341598..341939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(341920..342576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 342667..343155 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(343152..343574) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(343637..344494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(344510..345214) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene queC CDS complement(345177..345764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 345828..347003 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(346987..348129) product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(348172..349536) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(349868..350701) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(350943..351461) product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(351454..351603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(351649..352218) product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene rpoE CDS complement(352279..352656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(352662..353903) product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 354022..354540 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(354533..354991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03760 sequence02 source 1..238748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 705..899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 957..1205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(2429..3430) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene galT CDS complement(3427..4638) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene galK CDS 4757..5380 product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762274.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 5450..6415 product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 6406..7068 product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(7074..7640) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 7736..8905 product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 8902..9588 product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 9599..10252 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene rnhB CDS 10301..10960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 10988..11545 product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene endA CDS complement(11549..12082) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(12069..12455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(12463..13086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(13175..13510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(13646..14755) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 14855..15310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(15303..15995) product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene psmB CDS complement(16084..16497) product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(16504..17658) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(17666..18808) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 18874..19341 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 19445..20548 product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene cdvC CDS 20588..21571 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 21561..22376 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 22373..23197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(23194..23622) product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 23716..24432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(24451..25068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 25206..25508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 25601..26227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 26360..27394 product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene dph2 CDS 27391..28227 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(28255..29598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(29588..31255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(31252..32238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(32242..33003) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(33069..34976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 35155..37197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 37240..37875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(37867..39420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 39720..42662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(42664..43638) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(43676..44509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(44506..45105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(45115..45465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 45607..47010 product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(47261..48046) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene iolB CDS complement(48030..49040) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(49040..49753) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(49750..50520) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(50552..52015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 52088..53002 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762072.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 52999..54063 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 54130..54375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 54422..55513 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene fni CDS complement(55503..56375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 56580..57686 product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 57702..57941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(57971..59191) product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 59380..59712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(59720..61444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 tRNA 61545..61618 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(61722..62270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 62521..64677 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(64674..65855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(65852..67144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(67162..67659) product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 67979..68347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(68344..69198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 69312..70058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 70134..71645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 71679..72221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 72211..73413 product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 73441..73791 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(73799..74437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(74447..75052) product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(75264..75872) product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene psmB CDS 75979..76467 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(76470..77558) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(77591..78523) product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 78649..80109 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 80106..80381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 80423..81043 product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(81046..81414) product DUF2095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(81493..82161) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(82142..82843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(82845..83711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 83771..84334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(84348..86063) product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(86166..86765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(87069..87209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(87214..87522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 tRNA 87570..87641 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 87809..88753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(88740..89954) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(89941..91857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(91850..92554) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(92599..93756) product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250018.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 93941..95176 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene thiI CDS 95336..96844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 96875..97870 product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(97835..97972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(98016..101546) product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene rgy CDS 101696..102142 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(102119..102808) product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(102805..103830) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene leuB CDS complement(103837..105531) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762493.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene ilvD CDS 105635..107092 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(107067..107993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 108077..110404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 110550..113120 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 113120..114166 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 114217..114819 product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 114869..115900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 115934..116683 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263872.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene hisA CDS 116673..117440 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene hisF CDS 117437..117787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 117835..118260 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(118320..118748) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(118781..119725) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 119808..120122 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(120119..120289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS complement(120326..121297) product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene mvaD CDS 121400..121780 product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(122013..122933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(123009..123449) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene trxA CDS 123561..124484 product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 124515..125075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(125062..125220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(125250..126452) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene hflX CDS complement(126628..126999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(127057..128262) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(128263..128874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(128884..129135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 129258..130505 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(130502..131428) product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene map CDS complement(131435..133102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 133202..134167 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene pdxS CDS 134229..134972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(134943..135338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(135335..135622) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(135685..136914) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene thrC CDS 137128..137565 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 137623..140364 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene acnA CDS complement(140562..140813) product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 140955..141908 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene ala CDS complement(141909..142544) product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250821.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(142551..143399) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene pstB CDS complement(143396..144247) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene pstA CDS complement(144268..145191) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene pstC CDS complement(145222..146397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 146526..147557 product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 147588..149042 product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(149050..149700) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene rrmJ CDS complement(149765..150229) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(150658..151749) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(151815..152381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(152389..153492) product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 153682..153960 product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 153957..154178 product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(154183..155169) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene ilvC CDS complement(155170..155427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(155445..155627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(155641..157374) product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene ilvB CDS complement(157371..158888) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 159132..159389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(159438..159932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 160076..161470 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene sufB CDS complement(161472..161813) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(161827..163047) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(163221..165977) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 166126..167172 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 167169..168593 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 168595..169557 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 169550..170563 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(170560..171129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 171196..171963 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene fabG CDS 172009..173472 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 173561..174652 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 174688..175500 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 175523..175795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(175838..177304) product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene bgaS CDS 177400..177699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 177770..178921 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(178872..180185) product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(180190..181086) product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 181294..181962 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 181976..182440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(182428..183348) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene rnz CDS complement(183401..184765) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761902.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(184794..185834) product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(185971..187002) product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(186999..187892) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 187975..188487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 188584..188868 product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 188936..189895 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene htpX CDS complement(189919..190338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 190412..191710 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(191712..193133) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(193227..194528) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(194485..195648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(195649..196578) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 196663..197106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(197103..197372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(197369..197653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(197650..198054) product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(198081..198911) product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(198908..199717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 199830..200987 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(201000..201539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 201612..202370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 202367..202756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 202760..203278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 203361..203624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 203693..204133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 204154..205170 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 205219..206961 product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 207014..207277 product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene albA CDS 207288..208646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 208690..209757 product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rtcA CDS 209857..210306 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 210303..211298 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 211295..212167 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(212168..212968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(212940..213686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(213713..214663) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(214686..215177) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 215283..217469 product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763679.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 217738..220905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(221086..221607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(221702..222772) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 222868..223314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(223265..226402) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(226452..227192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 227243..227884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(227881..228267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(228307..229014) product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 tRNA complement(229121..229209) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 229484..230461 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 231597..232454 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 232694..235252 product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 236046..236432 product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 236429..236794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 tRNA complement(237053..237128) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 237301..238248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 sequence03 source 1..171223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..1121 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaacctcacaaagaggattgaaag CDS complement(1240..1509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 1409..1921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(1928..2137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 2320..5016 product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(5013..5498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(5558..6742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 6829..7086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 7197..7691 product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 7702..7935 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 7932..9134 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 9131..9469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 tRNA 9606..9692 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(9706..9861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(9849..10337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(10756..10956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 tRNA 11622..11697 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 11759..12736 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 12809..13993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 14078..15322 product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene rifK CDS 15336..16424 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene ugpC CDS complement(16421..17284) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(17281..18126) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(18215..19531) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 19902..20330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 20379..22415 product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229021.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(22405..22797) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 22956..23657 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 23943..25490 product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene crtI CDS 25491..26375 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 26366..27235 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(27336..27770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 28226..28540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 29272..31011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 31008..31733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 31737..32381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(32374..35229) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 35480..36820 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 36860..37678 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229133.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(37692..37952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(38007..38627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(38750..40270) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene xylB CDS 40549..43044 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(43147..43359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(43929..45446) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene glnA CDS 45882..48059 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(48350..49087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(49148..49930) product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 50052..50849 product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 50862..51698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 52091..52462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(52492..53472) product dihydroorotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(53472..53948) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene pyrI CDS complement(53945..54961) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene pyrB CDS complement(55013..55318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(55430..57190) product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496860.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 57345..57920 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(57934..58938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(58935..59402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 59364..59534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 59573..60016 product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(60037..60513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 61055..61411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(61440..64094) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene ppdK CDS complement(64213..65295) product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 65424..65963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 66023..66655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(66652..67206) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 67277..68590 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene glyA CDS complement(68599..69279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 69436..70500 product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene priL CDS 70541..70942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 70991..72376 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(72395..73384) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(73397..74473) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 74612..79282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 79296..80315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 80308..81198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 tRNA 81263..81334 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(81522..82205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 82295..83788 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene proS CDS complement(83805..84578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 84733..84912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 85269..85826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 85856..86632 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene fabG CDS 86690..87316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 87324..87767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(87743..87982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 88136..88585 product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene lysM CDS complement(88569..89105) product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900858.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(89130..89657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(90121..90930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 91198..91722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 92396..93175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 93102..93524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(93539..94012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(94092..95003) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 95184..95777 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(95810..96136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(96148..96612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 96672..97691 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene trxB CDS complement(97645..98298) product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(98351..99565) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965738.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(99562..100617) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453864.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(100626..101873) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(101889..102110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 102239..102925 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene rpiA CDS 103120..103908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 103987..104874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 104944..106383 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene argH CDS complement(106364..107431) product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(107431..108594) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(108602..109453) product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene lysX CDS complement(109458..109640) product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene lysW/argW CDS complement(109749..110546) product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(110568..111623) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene argC CDS complement(111620..112465) product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene lysX CDS complement(112612..113295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 113468..115267 product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(115275..115709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(115732..116496) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(116493..117161) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763543.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(117176..118006) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 118189..118527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(118598..118855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 119008..119790 product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene lsrF CDS 119886..120851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 120930..121559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 121671..122804 product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene trm14 CDS complement(122801..123445) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene rpsB CDS complement(123542..124789) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene eno CDS complement(124790..125005) product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 125096..125908 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(125860..127185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 127336..127746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(127803..129752) product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 129845..130570 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene tpiA CDS complement(130560..131231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 131355..132290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 132287..133033 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene phnC CDS 133142..133879 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene phnE CDS 134499..135353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 136161..137837 product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021875.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene glgP CDS complement(137886..138689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(138689..139630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(139720..140475) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 tRNA 140626..140701 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 140866..141633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(141889..142320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(142311..142553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 tRNA complement(143214..143289) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(143343..144587) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene pgk CDS complement(144571..145608) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene gap CDS 145963..147339 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene cimA CDS complement(147366..148175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 tRNA complement(148263..148337) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(148385..148720) product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762194.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(148794..148979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(149057..149668) product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 149732..150328 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene tmk CDS complement(150332..150709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(150780..152075) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(152072..152842) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(152842..153702) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(153699..154181) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(154178..155320) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(155497..155844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(155867..156268) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979628.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(156377..157150) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(157131..157565) product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582498.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene hypA tRNA complement(157593..157670) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(157980..159416) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene xylB CDS complement(159684..160682) product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene akrN CDS complement(160854..161657) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene deoC CDS 161979..162962 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 163022..164320 product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 164419..165276 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(165311..166720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(166893..167612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 169411..170064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(170114..170518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 sequence04 source 1..129784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(330..406) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 516..1259 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 1256..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 2898..4820 product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(4810..6585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 6709..7110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 7215..8117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(8170..8529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 8688..10007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(10024..11292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 11364..11498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 11661..11864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(11842..13566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(13568..14698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(15341..15529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 15649..16602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(16631..17197) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 17322..18215 product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene cutB CDS 18208..18768 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 18869..19717 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene cyoE CDS complement(19733..22501) product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 tRNA complement(22615..22689) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(22883..24505) product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 gene thsB CDS 24649..25497 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 25490..26002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(25941..26384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 26449..27372 product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 27467..29242 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 29360..31507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(31546..32145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 32574..33077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762862.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 33161..35953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 36043..36492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(36449..37066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 37213..37356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 37540..37842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 38404..39030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 39027..39461 product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(40376..40795) product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(40792..41541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 41971..43320 product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene gatD CDS 43317..45194 product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene gatE CDS complement(45283..46353) product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(46520..46705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(46721..48436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(48578..49462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 rRNA complement(49515..49625) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 49783..50334 product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 50454..51119 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene sfsA CDS complement(51137..51514) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(51607..52431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(52448..53986) product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 54233..55126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 55251..56399 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(56461..57513) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(57576..58529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 58740..59003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(59000..59209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(59249..59497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(59528..60337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 60519..61304 product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(61301..62086) product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(62098..63015) product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene mptA CDS complement(63102..64409) product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene asnS CDS complement(64900..65559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(65625..66197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(66240..67070) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(67067..67360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(67367..67516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 67634..68008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 68049..68357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(68344..68943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(68940..69224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(69221..70414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 70468..70758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 70755..72224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 72252..73043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 73055..74011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 74071..74895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 74892..75263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 75271..75549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 75528..76412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 76437..77354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 77365..77706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 77703..77867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 77881..78312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 78309..80615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 80832..82556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 82553..83620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 83623..84078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 84218..84784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 85223..85429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 85633..85854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 85793..87139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(87123..89627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 89921..90328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(90291..90716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 91248..91571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(91564..92031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(92132..92965) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(92962..93285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(93387..93929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 94229..94876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 94873..95376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 95384..95899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS 95896..96615 product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 96617..99427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 99399..100889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 100886..101350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(101330..101818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 101899..102213 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(102194..103240) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870059.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 103350..104123 product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(104115..105131) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(105247..106017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(106185..106568) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(106607..106765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(106857..107048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(107108..108361) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene purB CDS 108457..109107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(109175..109720) product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(109832..110584) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 110739..111116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 tRNA complement(111195..111273) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(111390..111866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(111951..112178) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 112804..114075 product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 114059..115492 product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(115766..115945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(115933..116112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(116072..116329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(116391..116699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 116895..117062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 117663..119549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(119570..119842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(119959..121287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(121284..121949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(121946..122323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(122320..122757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(122747..123178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 123621..124505 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 124659..125000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 note possible pseudo, internal stop codon, frameshifted CDS 125139..125888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 note possible pseudo, internal stop codon CDS 125925..126359 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(126360..127412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(127477..128571) product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene araD sequence05 source 1..92225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(378..1265) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1298..2311) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082581.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 2489..3448 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978692.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 3445..4440 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 4527..5465 product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(5483..6505) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(6519..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(7623..8537) product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene iolN CDS 8663..9841 product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene iolM CDS 9838..10164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 10161..11333 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(11443..13581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(13751..15700) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(15794..16921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(16918..18108) product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(18247..18816) product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(18842..20941) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(20934..21515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 21615..22556 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 22573..23712 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(23724..24437) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(24428..25141) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(25131..26081) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(26078..26947) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(26952..28268) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 28351..29442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 29439..29957 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 30067..30351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 30335..30874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(30887..31333) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 31438..32535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(32551..33636) product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 33735..34769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(34771..36021) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(36048..36236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(36307..36807) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(36804..37448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(37518..38534) product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(38589..40694) product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 40788..41750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 tRNA 41794..41870 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(41889..42332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(42348..42614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 42708..43139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 43232..43867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 43918..46197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 46207..46482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(46594..48549) product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(48693..48992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(48985..49704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(49742..50767) product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene radA CDS complement(50833..51267) product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(51264..51560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(51560..55363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(55360..58755) product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(58752..58943) product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 59225..59566 product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene erpA CDS 59576..60037 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene bcp CDS complement(60030..60281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(60524..61417) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 61335..61535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 61645..62973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(62978..64054) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(64088..64870) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(64967..65854) product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(65851..69048) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene ileS CDS 69176..69976 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 69987..71279 product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(71293..71730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 71797..72516 product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979052.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 72525..73205 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene tenA CDS 73255..74559 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 74607..75365 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 75491..76972 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067266.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene leuC CDS 76977..77606 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene leuD CDS 77744..78895 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(78944..80080) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(80117..80662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 80782..81960 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 81957..83135 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(83089..83511) product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(83702..83983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 83967..85118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 85329..86720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(86731..87576) product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene amrB CDS complement(87569..87805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 87924..88058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 88051..88545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 88795..90201 product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene lysS sequence06 source 1..85494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(779..2229) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 2521..3432 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(3458..4072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(4173..4568) product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 4755..6188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 6293..6847 product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(6885..8543) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 8903..10069 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene trpE note possible pseudo, internal stop codon, frameshifted CDS 10077..10661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 10705..11952 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene coaBC CDS 12125..13066 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(13081..13404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 13566..13964 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980139.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(13968..15479) product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene bgaS CDS 15623..17848 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 17942..18949 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 18959..19879 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582576.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 19888..20871 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041426669.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 20874..21857 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(21862..22938) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(23068..23262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(23262..23498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 23467..24054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(24056..25753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(25761..26222) product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(26268..26813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(26877..27521) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 27662..28093 product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 28090..28281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(28287..29516) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 29642..30115 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(30112..31671) product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene gapN CDS 31791..32855 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 32852..33310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 33363..33671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 33674..33829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(33832..34305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 34388..35287 product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763345.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene tatC CDS complement(35294..35593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(35568..36293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(36294..36659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(36703..37221) product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 37379..38917 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene glpK CDS complement(38914..40458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 40532..40951 product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 40948..41376 product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 41380..41955 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 41975..42355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 42434..42688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 42685..42945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 42948..43262 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene nuoK CDS complement(43252..43554) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147008.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(43640..44671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS complement(44725..45876) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 45979..47862 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(47873..48646) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(48672..49148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(49145..50449) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902768.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(50460..50915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(50915..51850) product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(51847..52503) product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(52527..53975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(53959..54906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 55029..55481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(55468..55962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(56017..56601) product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 56709..56882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(56893..57330) product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 57421..58719 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240285.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene ahcY CDS complement(58732..59448) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(59461..59706) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(59699..60535) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene rpl4p CDS complement(60532..61533) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 61699..62961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(62921..63967) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene mtnA CDS complement(64000..64998) product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(64991..66082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(66075..66314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(66302..67297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 67364..68413 product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(68396..70000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 70087..70659 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 70693..71808 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 71883..72647 product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(72648..73916) product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(73988..74782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 75002..75223 product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene hpkB CDS 75264..75860 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(75869..76741) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 76901..77863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 77905..78219 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene rpsJ CDS complement(78216..79514) product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene tuf CDS complement(79580..80137) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(80169..80801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 80880..82598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(82595..83872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(83859..85346) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence07 source 1..79837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 608..808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1129..1524) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene rpsS CDS complement(1603..2106) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978465.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(2199..3044) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 3145..4068 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 4065..4673 product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(4645..5688) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 5802..6833 product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene dph5 CDS 6827..7330 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(7293..8588) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 8641..10065 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 10159..10335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(10494..10847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 10943..12193 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 12320..13096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 13081..13506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(13496..14461) product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene mer CDS complement(14458..14730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(14789..15904) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene dnaJ CDS complement(15965..16300) product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene metG CDS complement(16374..16952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(17061..17267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 17351..18403 product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(18387..19121) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(19118..19741) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(19785..20657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(20659..21681) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 21800..22978 product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762924.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene fbp CDS complement(23033..23800) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 24043..24903 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 24953..25828 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847022.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 25983..26117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 26260..27156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(27146..27907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(28036..28665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 28872..29315 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 29354..29731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(29718..30110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(30111..31901) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene dnaK CDS complement(31958..32533) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(32540..32929) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(33041..33835) product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240518.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(33874..34305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 34541..35473 product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 35525..35884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(35881..36189) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene yciH CDS complement(36254..36949) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 37142..38236 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(38233..39018) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene uppS CDS complement(39011..40159) product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 40358..40699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(40722..41612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(41622..42383) product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(42439..44043) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene guaA CDS 44234..45091 product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763234.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 45107..46483 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 tRNA 46544..46616 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(46620..47462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 47594..48364 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 48451..48723 product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869708.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene albA CDS 49016..49285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 49353..50675 product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene aspS CDS 50672..50902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 50982..51374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 51371..52429 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene nuoH CDS complement(52434..52784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(52851..54482) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(54578..55669) product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene fgd CDS complement(55730..56653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 56745..57443 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene nth CDS 57503..58354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(58335..59057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 59126..59467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 59443..60891 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 61004..62329 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(62467..64056) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene lysS CDS complement(64125..65252) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(65325..66563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(66560..67492) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(67562..70309) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 70423..71001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 71046..72551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 72606..73493 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene ilvE CDS 73542..73985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 74045..74536 product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(74542..75876) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 75970..77595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(77598..78623) product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(78649..79458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 79381..79563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 sequence08 source 1..44367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1291..2739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 2812..3774 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(3761..4885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(4973..5992) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 6056..7462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(7481..7753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(7756..7938) product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981301.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(8039..9388) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 9518..11092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 11079..12197 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970677.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 12194..13180 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(13183..14349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(14424..14771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 15404..16165 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(16158..16631) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 16763..17059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(17730..18383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(18386..18724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 18953..19438 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(19435..19626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 19707..20375 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 20422..20799 product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(20780..21358) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene thpR CDS complement(21394..22083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 22198..22587 product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(22565..23008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(23051..23350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(23360..23968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 24050..24394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(24384..26903) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 26978..27727 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene sufC CDS complement(27732..28334) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 28487..29056 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(29434..30378) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(30718..30981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 31606..33330 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(33323..33784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 33948..34577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(34578..34952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS 35079..37223 product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(37220..37996) product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 38121..38966 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 38992..39666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 39711..40868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(40858..42051) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 rRNA complement(42177..44334) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 66 percent of the 23S ribosomal RNA locus_tag LOCUS_r00030 sequence09 source 1..39281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 880..1887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879358.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 tRNA 2303..2378 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2418..2732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(2790..3038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 tRNA 3697..3771 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(3827..4168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 4272..5480 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(5484..6452) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 6584..7726 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene dinB CDS complement(7682..8278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(8288..8575) product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 8958..9956 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene ilvA CDS complement(9972..11141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(11138..11641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(11644..11880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 12165..12776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 12769..13545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 13648..15549 product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(15574..16869) product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(16936..19599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 19862..20632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 20724..21221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 21225..23222 product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 23229..25376 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(25365..26300) product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(26297..27214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 27288..28022 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 28076..28561 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(28566..29624) product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene twy1 CDS 29737..31131 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(31149..32375) product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene priS CDS complement(32430..33053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 33177..33461 product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 33553..34695 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene moeB CDS complement(34857..36596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(36682..37650) product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 37867..38874 product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 sequence10 source 1..31226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1256..1420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1423..2160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(2157..2306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 2348..3058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(3753..4310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(4467..4721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 note possible pseudo, internal stop codon, frameshifted CDS complement(5260..5577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 5708..7015 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 7053..7913 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 8285..8770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(8883..9926) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 10036..11580 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 11628..12494 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 12502..13323 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 13414..14211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(14232..14684) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 15038..15976 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene argE CDS 16190..16459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 16713..17417 product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 17419..17973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 18135..18737 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762237.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(18763..19830) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(19878..20597) product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene alaXM CDS 20697..21104 product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250901.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 21186..21599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(21560..22606) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220209699.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 22768..23703 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970360.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 23703..24455 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 24458..25291 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 25332..25784 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(25799..26719) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(26768..28570) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene infB CDS 28657..29442 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 sequence11 source 1..19233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..1077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1130..1567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1642..2457 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860293.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(2439..3338) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 3401..4330 product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene mdh CDS complement(4221..5738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(5856..6773) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 6959..8038 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(8040..8930) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene sucD CDS complement(8960..9664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(9661..10602) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 10685..11191 product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene tfe CDS 11197..11751 product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870902.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 tRNA 11774..11846 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 11897..12349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(12344..12901) product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 13019..13294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 13255..13677 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 13747..14085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(14112..15260) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(15329..16204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(16738..17592) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 17766..19127 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 sequence12 source 1..15137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1083 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250726.1:ABC transporter ATP-binding protein locus_tag LOCUS_13450 CDS complement(1088..2473) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene aspC CDS complement(2483..3586) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene aroC CDS complement(3583..4854) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene aroA CDS complement(4851..5690) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(5669..6382) product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene aroD CDS complement(6372..7370) product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(7367..8164) product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(8170..9222) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene asd CDS 9427..10287 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 10284..10664 product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene pth2 CDS 10751..12775 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene acs CDS complement(12783..13916) product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene pepQ repeat_region 14057..15081 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctctttgtgaggttc sequence13 source 1..12998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 1119..2216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 2250..3623 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 3693..4805 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311004.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 4947..5393 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene gcvH CDS 5400..5735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 5759..5908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(5895..7622) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(7609..8826) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 8996..10018 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082485.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 10022..10876 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 10878..11864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082481.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 11866..12657 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582632.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 12664..12870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 sequence14 source 1..12343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 504..896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 901..1647 product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene csx7 CDS 1644..2591 product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene csx7 CDS 2641..3588 product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 3581..6295 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 6292..6924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 6905..7966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 7969..8910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 8900..9118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 9085..10092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(10556..11233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(11562..12065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 sequence15 source 1..10665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..1565 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaacctcacaaagaggattgaaag CDS complement(1749..2882) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(2879..4453) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 tRNA 4651..4729 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 4917..6146 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 6361..7713 product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 7688..9019 product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 9098..9394 product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 9404..9778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 9771..10373 product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 sequence16 source 1..9273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(519..1799) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene serS CDS complement(1855..2376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(2529..3314) product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(3552..3707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(3850..5451) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 5588..6091 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rimI CDS complement(6088..6411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(6459..7172) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(7217..8686) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene cysS sequence17 source 1..7865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..957 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249665.1:ferrous iron transport protein B note possible pseudo, frameshifted locus_tag LOCUS_14010 CDS 966..1952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 note possible pseudo, frameshifted CDS 2180..3073 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870499.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 3179..4015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 4038..4979 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980522.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 4966..5808 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 5873..6832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(6837..7865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 sequence18 source 1..6836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..1367 product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1386..1931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1986..2315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(2304..3020) product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(3011..4282) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene gdhA CDS complement(4310..5422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 5506..6120 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 sequence19 source 1..6605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(471..2054) product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(2054..3145) product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 3376..4743 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084659.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene codB CDS 4750..5148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 5333..5890 product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 misc_feature complement(5892..>6605) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024146.1:isocitrate/isopropylmalate dehydrogenase family protein locus_tag LOCUS_14210 sequence20 source 1..5617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..539 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546835.1:anthranilate phosphoribosyltransferase locus_tag LOCUS_14220 CDS 520..1311 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene trpC CDS 1311..1943 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1936..3138 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene trpB CDS 3135..3941 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene trpA CDS complement(3944..4429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 4468..5391 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 sequence21 source 1..4031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868848.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase locus_tag LOCUS_14290 CDS 926..1945 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1956..2972 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(3205..3735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence22 source 1..3938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..618 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023106.1:Glu/Leu/Phe/Val dehydrogenase locus_tag LOCUS_14330 tRNA 851..928 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(1059..2228) product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 2361..3632 product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 sequence23 source 1..3779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 960..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(1342..1545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1595..1882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1872..2144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 2234..2620 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173512.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(2631..2948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(2984..3475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 sequence24 source 1..3489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1276..1950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1967..2854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(2978..3478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 sequence25 source 1..3479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 445..519 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(754..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1004..1855) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1946..2944 product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene fgd sequence26 source 1..3217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(293..1306) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene iolG sequence27 source 1..3145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(1015..2151) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 sequence28 source 1..2932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..1227) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1224..2405) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(2398..2646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 sequence29 source 1..2320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1121..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 sequence30 source 1..2224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..1113 product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1123..1635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 misc_feature complement(1642..>2224) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003692227.1:SCO family protein locus_tag LOCUS_14580 sequence31 source 1..2047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(628..1584) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(1589..1744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 sequence32 source 1..1653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..1216) product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240229.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 sequence33 source 1..1608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..606 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250187.1:ATP-binding protein locus_tag LOCUS_14630 CDS complement(709..987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 sequence34 source 1..1415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(613..1209) product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022833.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 sequence35 source 1..1231 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@