>Feature sequence01 777 565 gene locus_tag LOCUS_00010 777 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2271 1264 gene locus_tag LOCUS_00020 gene fgd 2271 1264 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_00020 3458 3228 gene locus_tag LOCUS_00030 3458 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4667 3591 gene locus_tag LOCUS_00040 gene amrS 4667 3591 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_00040 5320 4727 gene locus_tag LOCUS_00050 gene hisH 5320 4727 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_00050 5902 5321 gene locus_tag LOCUS_00060 gene hisB 5902 5321 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_00060 7074 5902 gene locus_tag LOCUS_00070 7074 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8359 7061 gene locus_tag LOCUS_00080 gene hisD 8359 7061 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_00080 9323 8322 gene locus_tag LOCUS_00090 gene hisG 9323 8322 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_00090 9548 9405 gene locus_tag LOCUS_00100 9548 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9715 11379 gene locus_tag LOCUS_00110 gene thsB 9715 11379 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_00110 11387 11632 gene locus_tag LOCUS_00120 11387 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11725 12828 gene locus_tag LOCUS_00130 11725 12828 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_00130 13136 12825 gene locus_tag LOCUS_00140 13136 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13213 14382 gene locus_tag LOCUS_00150 13213 14382 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174497.1 protein_id gnl|my_center|LOCUS_00150 15525 14386 gene locus_tag LOCUS_00160 15525 14386 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_00160 15646 17637 gene locus_tag LOCUS_00170 15646 17637 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_00170 17641 18627 gene locus_tag LOCUS_00180 17641 18627 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229044.1 protein_id gnl|my_center|LOCUS_00180 19322 18630 gene locus_tag LOCUS_00190 19322 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20772 19348 gene locus_tag LOCUS_00200 20772 19348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 protein_id gnl|my_center|LOCUS_00200 22390 20807 gene locus_tag LOCUS_00210 22390 20807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23100 22372 gene locus_tag LOCUS_00220 23100 22372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24401 23082 gene locus_tag LOCUS_00230 24401 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25369 24401 gene locus_tag LOCUS_00240 25369 24401 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_00240 25721 25362 gene locus_tag LOCUS_00250 25721 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26232 25762 gene locus_tag LOCUS_00260 26232 25762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 28481 26475 gene locus_tag LOCUS_00270 28481 26475 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986815.1 protein_id gnl|my_center|LOCUS_00270 29896 28763 gene locus_tag LOCUS_00280 29896 28763 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 protein_id gnl|my_center|LOCUS_00280 31536 30160 gene locus_tag LOCUS_00290 31536 30160 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763152.1 protein_id gnl|my_center|LOCUS_00290 32101 31550 gene locus_tag LOCUS_00300 32101 31550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32679 32116 gene locus_tag LOCUS_00310 32679 32116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33091 32699 gene locus_tag LOCUS_00320 33091 32699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33191 34435 gene locus_tag LOCUS_00330 33191 34435 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_00330 34977 34432 gene locus_tag LOCUS_00340 34977 34432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 35341 34970 gene locus_tag LOCUS_00350 35341 34970 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 protein_id gnl|my_center|LOCUS_00350 35481 37169 gene locus_tag LOCUS_00360 35481 37169 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_00360 39054 37222 gene locus_tag LOCUS_00370 39054 37222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39479 39132 gene locus_tag LOCUS_00380 39479 39132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40317 39514 gene locus_tag LOCUS_00390 40317 39514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41543 40410 gene locus_tag LOCUS_00400 41543 40410 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867808.1 protein_id gnl|my_center|LOCUS_00400 41658 42650 gene locus_tag LOCUS_00410 gene speB 41658 42650 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_00410 42787 43257 gene locus_tag LOCUS_00420 42787 43257 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_00420 44824 43247 gene locus_tag LOCUS_00430 gene pruA 44824 43247 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_00430 44925 46313 gene locus_tag LOCUS_00440 gene aglA 44925 46313 CDS product alpha-glucosidase AglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865414.1 protein_id gnl|my_center|LOCUS_00440 46881 46318 gene locus_tag LOCUS_00450 46881 46318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47052 47609 gene locus_tag LOCUS_00460 47052 47609 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258089.1 protein_id gnl|my_center|LOCUS_00460 48524 47586 gene locus_tag LOCUS_00470 gene cyoE 48524 47586 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762065.1 protein_id gnl|my_center|LOCUS_00470 48605 49741 gene locus_tag LOCUS_00480 48605 49741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 49812 50075 gene locus_tag LOCUS_00490 49812 50075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50448 50068 gene locus_tag LOCUS_00500 50448 50068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51475 50474 gene locus_tag LOCUS_00510 gene radA 51475 50474 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_00510 51809 51537 gene locus_tag LOCUS_00520 51809 51537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 51936 52118 gene locus_tag LOCUS_00530 51936 52118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 53384 52083 gene locus_tag LOCUS_00540 53384 52083 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_00540 53440 54543 gene locus_tag LOCUS_00550 gene hisC 53440 54543 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_00550 56007 54523 gene locus_tag LOCUS_00560 56007 54523 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_00560 56597 56070 gene locus_tag LOCUS_00570 56597 56070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56829 57446 gene locus_tag LOCUS_00580 56829 57446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57547 57960 gene locus_tag LOCUS_00590 57547 57960 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_00590 58861 57953 gene locus_tag LOCUS_00600 gene speE 58861 57953 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_00600 59300 58854 gene locus_tag LOCUS_00610 gene speD 59300 58854 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_00610 59408 61573 gene locus_tag LOCUS_00620 59408 61573 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_00620 61618 62277 gene locus_tag LOCUS_00630 61618 62277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 62274 62942 gene locus_tag LOCUS_00640 gene npdG 62274 62942 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_00640 62974 64320 gene locus_tag LOCUS_00650 62974 64320 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_00650 64313 65002 gene locus_tag LOCUS_00660 64313 65002 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_00660 65029 66288 gene locus_tag LOCUS_00670 65029 66288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67094 66285 gene locus_tag LOCUS_00680 67094 66285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 67861 67091 gene locus_tag LOCUS_00690 67861 67091 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_00690 68907 67858 gene locus_tag LOCUS_00700 68907 67858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_00700 69019 68945 gene locus_tag LOCUS_t00010 69019 68945 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69774 69028 gene locus_tag LOCUS_00710 69774 69028 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_00710 70621 69881 gene locus_tag LOCUS_00720 70621 69881 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763646.1 protein_id gnl|my_center|LOCUS_00720 72035 70623 gene locus_tag LOCUS_00730 72035 70623 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_00730 72636 72869 gene locus_tag LOCUS_00740 72636 72869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 73783 72860 gene locus_tag LOCUS_00750 73783 72860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 74164 73799 gene locus_tag LOCUS_00760 74164 73799 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763726.1 protein_id gnl|my_center|LOCUS_00760 74209 75063 gene locus_tag LOCUS_00770 74209 75063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 75189 76436 gene locus_tag LOCUS_00780 75189 76436 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 protein_id gnl|my_center|LOCUS_00780 76433 77755 gene locus_tag LOCUS_00790 76433 77755 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_00790 77806 79149 gene locus_tag LOCUS_00800 77806 79149 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762365.1 protein_id gnl|my_center|LOCUS_00800 79225 79152 gene locus_tag LOCUS_t00020 79225 79152 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 79616 80035 gene locus_tag LOCUS_00810 79616 80035 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_00810 81212 80259 gene locus_tag LOCUS_00820 81212 80259 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989852.1 protein_id gnl|my_center|LOCUS_00820 81470 82738 gene locus_tag LOCUS_00830 81470 82738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968439.1 protein_id gnl|my_center|LOCUS_00830 83841 82828 gene locus_tag LOCUS_00840 83841 82828 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259025.1 protein_id gnl|my_center|LOCUS_00840 84110 85288 gene locus_tag LOCUS_00850 84110 85288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 86407 85340 gene locus_tag LOCUS_00860 86407 85340 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761793.1 protein_id gnl|my_center|LOCUS_00860 87332 86490 gene locus_tag LOCUS_00870 gene cofD 87332 86490 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_00870 88048 87416 gene locus_tag LOCUS_00880 88048 87416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 88706 88077 gene locus_tag LOCUS_00890 88706 88077 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870628.1 protein_id gnl|my_center|LOCUS_00890 88956 88696 gene locus_tag LOCUS_00900 88956 88696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 89406 89945 gene locus_tag LOCUS_00910 89406 89945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 89952 91301 gene locus_tag LOCUS_00920 89952 91301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 91436 91621 gene locus_tag LOCUS_00930 91436 91621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 93006 91618 gene locus_tag LOCUS_00940 93006 91618 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868807.1 protein_id gnl|my_center|LOCUS_00940 95968 93068 gene locus_tag LOCUS_00950 gene leuS 95968 93068 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867994.1 protein_id gnl|my_center|LOCUS_00950 97023 96037 gene locus_tag LOCUS_00960 gene thiL 97023 96037 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_00960 97948 97010 gene locus_tag LOCUS_00970 97948 97010 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_00970 98796 97945 gene locus_tag LOCUS_00980 gene panB 98796 97945 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_00980 99560 98793 gene locus_tag LOCUS_00990 99560 98793 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 protein_id gnl|my_center|LOCUS_00990 100240 99515 gene locus_tag LOCUS_01000 100240 99515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763101.1 protein_id gnl|my_center|LOCUS_01000 100196 100402 gene locus_tag LOCUS_01010 100196 100402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100518 102818 gene locus_tag LOCUS_01020 gene xdhA 100518 102818 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_01020 103502 102828 gene locus_tag LOCUS_01030 103502 102828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 103593 104705 gene locus_tag LOCUS_01040 gene carA 103593 104705 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_01040 104686 107955 gene locus_tag LOCUS_01050 gene carB 104686 107955 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979554.1 protein_id gnl|my_center|LOCUS_01050 107990 108409 gene locus_tag LOCUS_01060 gene ndk 107990 108409 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01060 108559 108410 gene locus_tag LOCUS_01070 108559 108410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 108815 108612 gene locus_tag LOCUS_01080 108815 108612 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 protein_id gnl|my_center|LOCUS_01080 109246 108863 gene locus_tag LOCUS_01090 gene rpl7ae 109246 108863 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_01090 110718 109318 gene locus_tag LOCUS_01100 110718 109318 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888650.1 protein_id gnl|my_center|LOCUS_01100 110832 111188 gene locus_tag LOCUS_01110 110832 111188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 111185 112126 gene locus_tag LOCUS_01120 111185 112126 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762591.1 protein_id gnl|my_center|LOCUS_01120 113105 112146 gene locus_tag LOCUS_01130 113105 112146 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_01130 113336 115993 gene locus_tag LOCUS_01140 113336 115993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116124 116945 gene locus_tag LOCUS_01150 116124 116945 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_01150 118113 116914 gene locus_tag LOCUS_01160 118113 116914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 119028 118168 gene locus_tag LOCUS_01170 119028 118168 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_01170 119525 118998 gene locus_tag LOCUS_01180 gene endA 119525 118998 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_01180 119634 121163 gene locus_tag LOCUS_01190 119634 121163 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_01190 121166 122827 gene locus_tag LOCUS_01200 gene pheT 121166 122827 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_01200 123680 122844 gene locus_tag LOCUS_01210 gene pheA 123680 122844 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_01210 124661 123711 gene locus_tag LOCUS_01220 124661 123711 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_01220 125431 124658 gene locus_tag LOCUS_01230 125431 124658 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_01230 125520 126059 gene locus_tag LOCUS_01240 125520 126059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 126056 127375 gene locus_tag LOCUS_01250 126056 127375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128789 127383 gene locus_tag LOCUS_01260 128789 127383 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258986.1 protein_id gnl|my_center|LOCUS_01260 129748 128843 gene locus_tag LOCUS_01270 129748 128843 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762717.1 protein_id gnl|my_center|LOCUS_01270 130139 129705 gene locus_tag LOCUS_01280 130139 129705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 130317 130123 gene locus_tag LOCUS_01290 130317 130123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 130349 131197 gene locus_tag LOCUS_01300 130349 131197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 131354 131181 gene locus_tag LOCUS_01310 131354 131181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 131589 132656 gene locus_tag LOCUS_01320 131589 132656 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_01320 133606 132653 gene locus_tag LOCUS_01330 133606 132653 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01330 134663 133626 gene locus_tag LOCUS_01340 134663 133626 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_01340 135283 134717 gene locus_tag LOCUS_01350 gene pyrH 135283 134717 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_01350 135167 135460 gene locus_tag LOCUS_01360 135167 135460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 135522 136751 gene locus_tag LOCUS_01370 gene prf1 135522 136751 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_01370 136846 137763 gene locus_tag LOCUS_01380 gene argF 136846 137763 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_01380 138277 137756 gene locus_tag LOCUS_01390 gene rplJ 138277 137756 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_01390 138371 139087 gene locus_tag LOCUS_01400 138371 139087 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_01400 139092 139820 gene locus_tag LOCUS_01410 139092 139820 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867275.1 protein_id gnl|my_center|LOCUS_01410 140589 139810 gene locus_tag LOCUS_01420 140589 139810 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_01420 141526 140672 gene locus_tag LOCUS_01430 141526 140672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 141750 141538 gene locus_tag LOCUS_01440 141750 141538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 142441 142740 gene locus_tag LOCUS_01450 142441 142740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 142808 143371 gene locus_tag LOCUS_01460 gene dcd 142808 143371 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_01460 144125 143343 gene locus_tag LOCUS_01470 144125 143343 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_01470 144568 144122 gene locus_tag LOCUS_01480 gene moaC 144568 144122 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_01480 145328 144618 gene locus_tag LOCUS_01490 gene sdhB 145328 144618 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_01490 145680 145333 gene locus_tag LOCUS_01500 145680 145333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 146183 145695 gene locus_tag LOCUS_01510 146183 145695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 146313 147119 gene locus_tag LOCUS_01520 146313 147119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 148030 147134 gene locus_tag LOCUS_01530 148030 147134 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_01530 148520 148308 gene locus_tag LOCUS_01540 148520 148308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 148605 149222 gene locus_tag LOCUS_01550 148605 149222 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 protein_id gnl|my_center|LOCUS_01550 149225 149431 gene locus_tag LOCUS_01560 149225 149431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 149418 149690 gene locus_tag LOCUS_01570 149418 149690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 149765 150118 gene locus_tag LOCUS_01580 149765 150118 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_01580 150111 150545 gene locus_tag LOCUS_01590 gene rpl14p 150111 150545 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_01590 150639 150920 gene locus_tag LOCUS_01600 150639 150920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 150924 151640 gene locus_tag LOCUS_01610 150924 151640 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 protein_id gnl|my_center|LOCUS_01610 151622 152146 gene locus_tag LOCUS_01620 151622 152146 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_01620 152223 154844 gene locus_tag LOCUS_01630 152223 154844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 155262 154834 gene locus_tag LOCUS_01640 155262 154834 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_01640 156125 155538 gene locus_tag LOCUS_01650 156125 155538 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_01650 156198 156272 gene locus_tag LOCUS_t00030 156198 156272 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 156343 157308 gene locus_tag LOCUS_01660 156343 157308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086447.1 protein_id gnl|my_center|LOCUS_01660 157352 158545 gene locus_tag LOCUS_01670 157352 158545 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_01670 158671 159720 gene locus_tag LOCUS_01680 158671 159720 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_01680 160035 159736 gene locus_tag LOCUS_01690 160035 159736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 160796 160119 gene locus_tag LOCUS_01700 160796 160119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_01700 160992 161324 gene locus_tag LOCUS_01710 gene eif1A 160992 161324 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_01710 161390 162775 gene locus_tag LOCUS_01720 161390 162775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 162865 166320 gene locus_tag LOCUS_01730 162865 166320 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974749.1 protein_id gnl|my_center|LOCUS_01730 166301 166951 gene locus_tag LOCUS_01740 166301 166951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 166929 167495 gene locus_tag LOCUS_01750 gene scpB 166929 167495 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867410.1 protein_id gnl|my_center|LOCUS_01750 167555 168118 gene locus_tag LOCUS_01760 167555 168118 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_01760 168210 169781 gene locus_tag LOCUS_01770 168210 169781 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240542.1 protein_id gnl|my_center|LOCUS_01770 170258 170470 gene locus_tag LOCUS_01780 170258 170470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 171043 170360 gene locus_tag LOCUS_01790 171043 170360 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_01790 171163 173064 gene locus_tag LOCUS_01800 gene nuoL 171163 173064 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_01800 173109 173282 gene locus_tag LOCUS_01810 173109 173282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 173282 173752 gene locus_tag LOCUS_01820 173282 173752 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 protein_id gnl|my_center|LOCUS_01820 174096 174190 gene locus_tag LOCUS_t00040 174096 174190 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 174996 174286 gene locus_tag LOCUS_01830 174996 174286 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_01830 175730 175020 gene locus_tag LOCUS_01840 175730 175020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545105.1 protein_id gnl|my_center|LOCUS_01840 175757 176656 gene locus_tag LOCUS_01850 175757 176656 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 protein_id gnl|my_center|LOCUS_01850 179411 176631 gene locus_tag LOCUS_01860 gene alaS 179411 176631 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868790.1 protein_id gnl|my_center|LOCUS_01860 179780 179466 gene locus_tag LOCUS_01870 gene rpl12p 179780 179466 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_01870 179926 180249 gene locus_tag LOCUS_01880 179926 180249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 180460 181293 gene locus_tag LOCUS_01890 180460 181293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 181574 181296 gene locus_tag LOCUS_01900 181574 181296 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_01900 181611 182339 gene locus_tag LOCUS_01910 181611 182339 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 protein_id gnl|my_center|LOCUS_01910 182336 183400 gene locus_tag LOCUS_01920 182336 183400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 184580 183414 gene locus_tag LOCUS_01930 gene dnaG 184580 183414 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762711.1 protein_id gnl|my_center|LOCUS_01930 184688 185557 gene locus_tag LOCUS_01940 184688 185557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 187443 185554 gene locus_tag LOCUS_01950 187443 185554 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_01950 187659 188207 gene locus_tag LOCUS_01960 187659 188207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 188263 188586 gene locus_tag LOCUS_01970 188263 188586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 188658 190283 gene locus_tag LOCUS_01980 gene pyrG 188658 190283 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_01980 190280 191011 gene locus_tag LOCUS_01990 190280 191011 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763546.1 protein_id gnl|my_center|LOCUS_01990 191905 190985 gene locus_tag LOCUS_02000 191905 190985 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_02000 191956 192456 gene locus_tag LOCUS_02010 191956 192456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 192505 194082 gene locus_tag LOCUS_02020 192505 194082 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064281.1 protein_id gnl|my_center|LOCUS_02020 194072 195121 gene locus_tag LOCUS_02030 194072 195121 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_02030 195181 196218 gene locus_tag LOCUS_02040 gene fen 195181 196218 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_02040 196429 196226 gene locus_tag LOCUS_02050 196429 196226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 198631 196442 gene locus_tag LOCUS_02060 198631 196442 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762437.1 protein_id gnl|my_center|LOCUS_02060 199975 198710 gene locus_tag LOCUS_02070 199975 198710 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_02070 200180 201874 gene locus_tag LOCUS_02080 200180 201874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 protein_id gnl|my_center|LOCUS_02080 201890 202642 gene locus_tag LOCUS_02090 201890 202642 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 protein_id gnl|my_center|LOCUS_02090 202644 203756 gene locus_tag LOCUS_02100 202644 203756 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385664.1 protein_id gnl|my_center|LOCUS_02100 203764 204663 gene locus_tag LOCUS_02110 203764 204663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_02110 204666 205634 gene locus_tag LOCUS_02120 204666 205634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_02120 205647 206609 gene locus_tag LOCUS_02130 205647 206609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867864.1 protein_id gnl|my_center|LOCUS_02130 207684 206617 gene locus_tag LOCUS_02140 gene pepQ 207684 206617 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_02140 209565 207808 gene locus_tag LOCUS_02150 209565 207808 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_02150 211659 209572 gene locus_tag LOCUS_02160 211659 209572 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_02160 211863 213083 gene locus_tag LOCUS_02170 211863 213083 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_02170 215482 213086 gene locus_tag LOCUS_02180 215482 213086 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 protein_id gnl|my_center|LOCUS_02180 215704 217971 gene locus_tag LOCUS_02190 215704 217971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 218014 218622 gene locus_tag LOCUS_02200 218014 218622 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_02200 218630 219103 gene locus_tag LOCUS_02210 gene rpmD 218630 219103 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_02210 219160 219594 gene locus_tag LOCUS_02220 219160 219594 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_02220 219599 221029 gene locus_tag LOCUS_02230 gene secY 219599 221029 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 protein_id gnl|my_center|LOCUS_02230 221032 221505 gene locus_tag LOCUS_02240 221032 221505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 222271 221696 gene locus_tag LOCUS_02250 222271 221696 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_02250 222362 222643 gene locus_tag LOCUS_02260 222362 222643 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762873.1 protein_id gnl|my_center|LOCUS_02260 222652 222933 gene locus_tag LOCUS_02270 222652 222933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02270 222990 223676 gene locus_tag LOCUS_02280 222990 223676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02280 223695 223782 gene locus_tag LOCUS_t00050 223695 223782 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 224395 224739 gene locus_tag LOCUS_02290 224395 224739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 224869 226464 gene locus_tag LOCUS_02300 224869 226464 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 protein_id gnl|my_center|LOCUS_02300 226451 227218 gene locus_tag LOCUS_02310 226451 227218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391947.1 protein_id gnl|my_center|LOCUS_02310 227753 227211 gene locus_tag LOCUS_02320 227753 227211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 228986 227835 gene locus_tag LOCUS_02330 228986 227835 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066094.1 protein_id gnl|my_center|LOCUS_02330 229640 229011 gene locus_tag LOCUS_02340 229640 229011 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_02340 230087 229656 gene locus_tag LOCUS_02350 230087 229656 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_02350 230694 230104 gene locus_tag LOCUS_02360 230694 230104 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_02360 232671 230773 gene locus_tag LOCUS_02370 gene rqcH 232671 230773 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_02370 233355 232708 gene locus_tag LOCUS_02380 233355 232708 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_02380 233451 235484 gene locus_tag LOCUS_02390 233451 235484 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_02390 235665 236777 gene locus_tag LOCUS_02400 235665 236777 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_02400 236774 238024 gene locus_tag LOCUS_02410 236774 238024 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_02410 238021 239289 gene locus_tag LOCUS_02420 238021 239289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 239319 239945 gene locus_tag LOCUS_02430 gene pdxT 239319 239945 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979489.1 protein_id gnl|my_center|LOCUS_02430 240007 240309 gene locus_tag LOCUS_02440 240007 240309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 240400 240741 gene locus_tag LOCUS_02450 240400 240741 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_02450 240974 241258 gene locus_tag LOCUS_02460 240974 241258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 241368 241922 gene locus_tag LOCUS_02470 241368 241922 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250272.1 protein_id gnl|my_center|LOCUS_02470 241976 242428 gene locus_tag LOCUS_02480 241976 242428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 242429 243337 gene locus_tag LOCUS_02490 gene ftsY 242429 243337 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_02490 244897 243329 gene locus_tag LOCUS_02500 gene ppcA 244897 243329 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_02500 247407 245089 gene locus_tag LOCUS_02510 gene hypF 247407 245089 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 protein_id gnl|my_center|LOCUS_02510 247502 248668 gene locus_tag LOCUS_02520 gene hypD 247502 248668 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240243.1 protein_id gnl|my_center|LOCUS_02520 248670 248981 gene locus_tag LOCUS_02530 248670 248981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 248995 250020 gene locus_tag LOCUS_02540 gene hypE 248995 250020 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761962.1 protein_id gnl|my_center|LOCUS_02540 250262 251428 gene locus_tag LOCUS_02550 250262 251428 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_02550 251438 251890 gene locus_tag LOCUS_02560 251438 251890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 251945 251870 gene locus_tag LOCUS_t00060 251945 251870 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 252106 253395 gene locus_tag LOCUS_02570 gene hisS 252106 253395 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_02570 253392 254213 gene locus_tag LOCUS_02580 253392 254213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 255519 254185 gene locus_tag LOCUS_02590 255519 254185 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_02590 255670 256320 gene locus_tag LOCUS_02600 255670 256320 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870120.1 protein_id gnl|my_center|LOCUS_02600 256917 256486 gene locus_tag LOCUS_02610 256917 256486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 257415 256924 gene locus_tag LOCUS_02620 257415 256924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 259216 257528 gene locus_tag LOCUS_02630 259216 257528 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_02630 259663 259262 gene locus_tag LOCUS_02640 259663 259262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 260244 259669 gene locus_tag LOCUS_02650 260244 259669 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763290.1 protein_id gnl|my_center|LOCUS_02650 260409 261188 gene locus_tag LOCUS_02660 260409 261188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 261330 262631 gene locus_tag LOCUS_02670 261330 262631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 262637 263656 gene locus_tag LOCUS_02680 262637 263656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 263721 265724 gene locus_tag LOCUS_02690 263721 265724 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980280.1 protein_id gnl|my_center|LOCUS_02690 266215 265721 gene locus_tag LOCUS_02700 266215 265721 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_02700 267396 266305 gene locus_tag LOCUS_02710 267396 266305 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_02710 267581 267487 gene locus_tag LOCUS_t00070 267581 267487 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 267769 268524 gene locus_tag LOCUS_02720 267769 268524 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226750.1 protein_id gnl|my_center|LOCUS_02720 268548 269387 gene locus_tag LOCUS_02730 268548 269387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 269403 270029 gene locus_tag LOCUS_02740 269403 270029 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763732.1 protein_id gnl|my_center|LOCUS_02740 270070 271194 gene locus_tag LOCUS_02750 gene sucC 270070 271194 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_02750 271479 271186 gene locus_tag LOCUS_02760 271479 271186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 272046 271570 gene locus_tag LOCUS_02770 272046 271570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 272174 272100 gene locus_tag LOCUS_t00080 272174 272100 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 272281 272565 gene locus_tag LOCUS_02780 272281 272565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 272745 274310 gene locus_tag LOCUS_02790 gene metG 272745 274310 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_02790 275478 274315 gene locus_tag LOCUS_02800 gene ftsZ 275478 274315 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869869.1 protein_id gnl|my_center|LOCUS_02800 275617 275471 gene locus_tag LOCUS_02810 275617 275471 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868406.1 protein_id gnl|my_center|LOCUS_02810 275776 276147 gene locus_tag LOCUS_02820 275776 276147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 276144 278507 gene locus_tag LOCUS_02830 276144 278507 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_02830 278786 279199 gene locus_tag LOCUS_02840 278786 279199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 279349 279747 gene locus_tag LOCUS_02850 279349 279747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 280277 279744 gene locus_tag LOCUS_02860 280277 279744 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115248746.1 protein_id gnl|my_center|LOCUS_02860 280503 281537 gene locus_tag LOCUS_02870 gene fgd 280503 281537 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_02870 281545 281892 gene locus_tag LOCUS_02880 281545 281892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 281889 283289 gene locus_tag LOCUS_02890 gene gndA 281889 283289 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081528.1 protein_id gnl|my_center|LOCUS_02890 283296 284306 gene locus_tag LOCUS_02900 283296 284306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 285427 284303 gene locus_tag LOCUS_02910 285427 284303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 285554 285844 gene locus_tag LOCUS_02920 285554 285844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 286583 285837 gene locus_tag LOCUS_02930 286583 285837 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_02930 286748 288019 gene locus_tag LOCUS_02940 286748 288019 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_02940 288072 288845 gene locus_tag LOCUS_02950 288072 288845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 288899 288972 gene locus_tag LOCUS_t00090 288899 288972 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 289440 289138 gene locus_tag LOCUS_02960 289440 289138 CDS product GYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546546.1 protein_id gnl|my_center|LOCUS_02960 289591 289917 gene locus_tag LOCUS_02970 289591 289917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 289992 290735 gene locus_tag LOCUS_02980 gene cofE 289992 290735 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_02980 290759 291472 gene locus_tag LOCUS_02990 290759 291472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 291705 292160 gene locus_tag LOCUS_03000 291705 292160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 292605 292174 gene locus_tag LOCUS_03010 292605 292174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 292686 293525 gene locus_tag LOCUS_03020 292686 293525 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_03020 293506 294552 gene locus_tag LOCUS_03030 293506 294552 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_03030 295279 294560 gene locus_tag LOCUS_03040 295279 294560 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 protein_id gnl|my_center|LOCUS_03040 295389 296294 gene locus_tag LOCUS_03050 295389 296294 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_03050 296287 297234 gene locus_tag LOCUS_03060 gene kdgK 296287 297234 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980563.1 protein_id gnl|my_center|LOCUS_03060 297282 298703 gene locus_tag LOCUS_03070 gene cca 297282 298703 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_03070 298703 299434 gene locus_tag LOCUS_03080 298703 299434 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867963.1 protein_id gnl|my_center|LOCUS_03080 299536 300426 gene locus_tag LOCUS_03090 299536 300426 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259326.1 protein_id gnl|my_center|LOCUS_03090 300467 301174 gene locus_tag LOCUS_03100 300467 301174 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_03100 301567 301190 gene locus_tag LOCUS_03110 301567 301190 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_03110 302253 301705 gene locus_tag LOCUS_03120 302253 301705 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_03120 303415 302426 gene locus_tag LOCUS_03130 303415 302426 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_03130 303815 303462 gene locus_tag LOCUS_03140 303815 303462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 303935 304549 gene locus_tag LOCUS_03150 303935 304549 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 protein_id gnl|my_center|LOCUS_03150 305272 304550 gene locus_tag LOCUS_03160 305272 304550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 305335 306123 gene locus_tag LOCUS_03170 305335 306123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 306157 306378 gene locus_tag LOCUS_03180 306157 306378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 307377 306349 gene locus_tag LOCUS_03190 307377 306349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 307817 309031 gene locus_tag LOCUS_03200 307817 309031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 309006 310109 gene locus_tag LOCUS_03210 309006 310109 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_03210 310106 311806 gene locus_tag LOCUS_03220 310106 311806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 311846 312364 gene locus_tag LOCUS_03230 311846 312364 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_03230 312333 313928 gene locus_tag LOCUS_03240 312333 313928 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_03240 313934 314671 gene locus_tag LOCUS_03250 gene nucS 313934 314671 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867250.1 protein_id gnl|my_center|LOCUS_03250 315916 314681 gene locus_tag LOCUS_03260 315916 314681 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762445.1 protein_id gnl|my_center|LOCUS_03260 316328 315993 gene locus_tag LOCUS_03270 316328 315993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 316528 316788 gene locus_tag LOCUS_03280 316528 316788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 320188 316793 gene locus_tag LOCUS_03290 gene polC 320188 316793 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_03290 321053 320241 gene locus_tag LOCUS_03300 321053 320241 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_03300 321467 321063 gene locus_tag LOCUS_03310 321467 321063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 321587 321495 gene locus_tag LOCUS_t00100 321587 321495 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 322232 321615 gene locus_tag LOCUS_03320 322232 321615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 322632 322342 gene locus_tag LOCUS_03330 322632 322342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 322556 323797 gene locus_tag LOCUS_03340 gene guaB 322556 323797 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227931.1 protein_id gnl|my_center|LOCUS_03340 323799 325049 gene locus_tag LOCUS_03350 323799 325049 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_03350 325053 326432 gene locus_tag LOCUS_03360 gene truD 325053 326432 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251252.1 protein_id gnl|my_center|LOCUS_03360 326659 326444 gene locus_tag LOCUS_03370 326659 326444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 326559 327122 gene locus_tag LOCUS_03380 326559 327122 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_03380 327272 327132 gene locus_tag LOCUS_03390 327272 327132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 329146 327365 gene locus_tag LOCUS_03400 329146 327365 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762147.1 protein_id gnl|my_center|LOCUS_03400 329219 329647 gene locus_tag LOCUS_03410 329219 329647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 329684 330070 gene locus_tag LOCUS_03420 329684 330070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 331098 330076 gene locus_tag LOCUS_03430 gene moaA 331098 330076 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076572118.1 protein_id gnl|my_center|LOCUS_03430 331225 331953 gene locus_tag LOCUS_03440 gene psmA 331225 331953 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870095.1 protein_id gnl|my_center|LOCUS_03440 332006 332704 gene locus_tag LOCUS_03450 332006 332704 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762590.1 protein_id gnl|my_center|LOCUS_03450 332701 333375 gene locus_tag LOCUS_03460 gene rrp4 332701 333375 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_03460 333362 334099 gene locus_tag LOCUS_03470 gene rrp41 333362 334099 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_03470 334107 334943 gene locus_tag LOCUS_03480 gene rrp42 334107 334943 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_03480 335015 335236 gene locus_tag LOCUS_03490 335015 335236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 335276 335665 gene locus_tag LOCUS_03500 335276 335665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 335735 336733 gene locus_tag LOCUS_03510 335735 336733 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228112.1 protein_id gnl|my_center|LOCUS_03510 336730 337572 gene locus_tag LOCUS_03520 336730 337572 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_03520 337569 338420 gene locus_tag LOCUS_03530 337569 338420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_03530 338417 339205 gene locus_tag LOCUS_03540 338417 339205 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_03540 340163 339189 gene locus_tag LOCUS_03550 340163 339189 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_03550 340627 340160 gene locus_tag LOCUS_03560 340627 340160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 341009 340662 gene locus_tag LOCUS_03570 341009 340662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 341590 341120 gene locus_tag LOCUS_03580 gene rplM 341590 341120 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_03580 341939 341598 gene locus_tag LOCUS_03590 341939 341598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 342576 341920 gene locus_tag LOCUS_03600 342576 341920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 342667 343155 gene locus_tag LOCUS_03610 342667 343155 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_03610 343574 343152 gene locus_tag LOCUS_03620 343574 343152 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_03620 344494 343637 gene locus_tag LOCUS_03630 344494 343637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 345214 344510 gene locus_tag LOCUS_03640 gene queC 345214 344510 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 protein_id gnl|my_center|LOCUS_03640 345764 345177 gene locus_tag LOCUS_03650 345764 345177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 345828 347003 gene locus_tag LOCUS_03660 345828 347003 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_03660 348129 346987 gene locus_tag LOCUS_03670 348129 346987 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_03670 349536 348172 gene locus_tag LOCUS_03680 349536 348172 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_03680 350701 349868 gene locus_tag LOCUS_03690 350701 349868 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_03690 351461 350943 gene locus_tag LOCUS_03700 351461 350943 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_03700 351603 351454 gene locus_tag LOCUS_03710 351603 351454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 352218 351649 gene locus_tag LOCUS_03720 gene rpoE 352218 351649 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_03720 352656 352279 gene locus_tag LOCUS_03730 352656 352279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 353903 352662 gene locus_tag LOCUS_03740 353903 352662 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_03740 354022 354540 gene locus_tag LOCUS_03750 354022 354540 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024397.1 protein_id gnl|my_center|LOCUS_03750 354991 354533 gene locus_tag LOCUS_03760 354991 354533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence02 705 899 gene locus_tag LOCUS_03770 705 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 957 1205 gene locus_tag LOCUS_03780 957 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3430 2429 gene locus_tag LOCUS_03790 gene galT 3430 2429 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250779.1 protein_id gnl|my_center|LOCUS_03790 4638 3427 gene locus_tag LOCUS_03800 gene galK 4638 3427 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_03800 4757 5380 gene locus_tag LOCUS_03810 4757 5380 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762274.1 protein_id gnl|my_center|LOCUS_03810 5450 6415 gene locus_tag LOCUS_03820 5450 6415 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 protein_id gnl|my_center|LOCUS_03820 6406 7068 gene locus_tag LOCUS_03830 6406 7068 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_03830 7640 7074 gene locus_tag LOCUS_03840 7640 7074 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_03840 7736 8905 gene locus_tag LOCUS_03850 7736 8905 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_03850 8902 9588 gene locus_tag LOCUS_03860 8902 9588 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_03860 9599 10252 gene locus_tag LOCUS_03870 gene rnhB 9599 10252 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_03870 10301 10960 gene locus_tag LOCUS_03880 10301 10960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10988 11545 gene locus_tag LOCUS_03890 gene endA 10988 11545 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_03890 12082 11549 gene locus_tag LOCUS_03900 12082 11549 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881202.1 protein_id gnl|my_center|LOCUS_03900 12455 12069 gene locus_tag LOCUS_03910 12455 12069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13086 12463 gene locus_tag LOCUS_03920 13086 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 13510 13175 gene locus_tag LOCUS_03930 13510 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 14755 13646 gene locus_tag LOCUS_03940 14755 13646 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_03940 14855 15310 gene locus_tag LOCUS_03950 14855 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 15995 15303 gene locus_tag LOCUS_03960 gene psmB 15995 15303 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_03960 16497 16084 gene locus_tag LOCUS_03970 16497 16084 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_03970 17658 16504 gene locus_tag LOCUS_03980 17658 16504 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_03980 18808 17666 gene locus_tag LOCUS_03990 18808 17666 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868484.1 protein_id gnl|my_center|LOCUS_03990 18874 19341 gene locus_tag LOCUS_04000 18874 19341 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 protein_id gnl|my_center|LOCUS_04000 19445 20548 gene locus_tag LOCUS_04010 gene cdvC 19445 20548 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_04010 20588 21571 gene locus_tag LOCUS_04020 20588 21571 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_04020 21561 22376 gene locus_tag LOCUS_04030 21561 22376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_04030 22373 23197 gene locus_tag LOCUS_04040 22373 23197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 23622 23194 gene locus_tag LOCUS_04050 23622 23194 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_04050 23716 24432 gene locus_tag LOCUS_04060 23716 24432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 25068 24451 gene locus_tag LOCUS_04070 25068 24451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 25206 25508 gene locus_tag LOCUS_04080 25206 25508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 25601 26227 gene locus_tag LOCUS_04090 25601 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 26360 27394 gene locus_tag LOCUS_04100 gene dph2 26360 27394 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_04100 27391 28227 gene locus_tag LOCUS_04110 27391 28227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_04110 29598 28255 gene locus_tag LOCUS_04120 29598 28255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 31255 29588 gene locus_tag LOCUS_04130 31255 29588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 32238 31252 gene locus_tag LOCUS_04140 32238 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 33003 32242 gene locus_tag LOCUS_04150 33003 32242 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_04150 34976 33069 gene locus_tag LOCUS_04160 34976 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 35155 37197 gene locus_tag LOCUS_04170 35155 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 37240 37875 gene locus_tag LOCUS_04180 37240 37875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 39420 37867 gene locus_tag LOCUS_04190 39420 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 39720 42662 gene locus_tag LOCUS_04200 39720 42662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 43638 42664 gene locus_tag LOCUS_04210 43638 42664 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_04210 44509 43676 gene locus_tag LOCUS_04220 44509 43676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 45105 44506 gene locus_tag LOCUS_04230 45105 44506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 45465 45115 gene locus_tag LOCUS_04240 45465 45115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 45607 47010 gene locus_tag LOCUS_04250 45607 47010 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_04250 48046 47261 gene locus_tag LOCUS_04260 gene iolB 48046 47261 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_04260 49040 48030 gene locus_tag LOCUS_04270 49040 48030 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_04270 49753 49040 gene locus_tag LOCUS_04280 49753 49040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762069.1 protein_id gnl|my_center|LOCUS_04280 50520 49750 gene locus_tag LOCUS_04290 50520 49750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_04290 52015 50552 gene locus_tag LOCUS_04300 52015 50552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 52088 53002 gene locus_tag LOCUS_04310 52088 53002 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762072.1 protein_id gnl|my_center|LOCUS_04310 52999 54063 gene locus_tag LOCUS_04320 52999 54063 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_04320 54130 54375 gene locus_tag LOCUS_04330 54130 54375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 54422 55513 gene locus_tag LOCUS_04340 gene fni 54422 55513 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_04340 56375 55503 gene locus_tag LOCUS_04350 56375 55503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 56580 57686 gene locus_tag LOCUS_04360 56580 57686 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_04360 57702 57941 gene locus_tag LOCUS_04370 57702 57941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 59191 57971 gene locus_tag LOCUS_04380 59191 57971 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978812.1 protein_id gnl|my_center|LOCUS_04380 59380 59712 gene locus_tag LOCUS_04390 59380 59712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 61444 59720 gene locus_tag LOCUS_04400 61444 59720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 61545 61618 gene locus_tag LOCUS_t00110 61545 61618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 62270 61722 gene locus_tag LOCUS_04410 62270 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 62521 64677 gene locus_tag LOCUS_04420 62521 64677 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_04420 65855 64674 gene locus_tag LOCUS_04430 65855 64674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 67144 65852 gene locus_tag LOCUS_04440 67144 65852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 67659 67162 gene locus_tag LOCUS_04450 67659 67162 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_04450 67979 68347 gene locus_tag LOCUS_04460 67979 68347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 69198 68344 gene locus_tag LOCUS_04470 69198 68344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 69312 70058 gene locus_tag LOCUS_04480 69312 70058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 70134 71645 gene locus_tag LOCUS_04490 70134 71645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 71679 72221 gene locus_tag LOCUS_04500 71679 72221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 72211 73413 gene locus_tag LOCUS_04510 72211 73413 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880509.1 protein_id gnl|my_center|LOCUS_04510 73441 73791 gene locus_tag LOCUS_04520 73441 73791 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660653.1 protein_id gnl|my_center|LOCUS_04520 74437 73799 gene locus_tag LOCUS_04530 74437 73799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 75052 74447 gene locus_tag LOCUS_04540 75052 74447 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_04540 75872 75264 gene locus_tag LOCUS_04550 gene psmB 75872 75264 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_04550 75979 76467 gene locus_tag LOCUS_04560 75979 76467 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867651.1 protein_id gnl|my_center|LOCUS_04560 77558 76470 gene locus_tag LOCUS_04570 77558 76470 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_04570 78523 77591 gene locus_tag LOCUS_04580 78523 77591 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_04580 78649 80109 gene locus_tag LOCUS_04590 78649 80109 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_04590 80106 80381 gene locus_tag LOCUS_04600 80106 80381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 80423 81043 gene locus_tag LOCUS_04610 80423 81043 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_04610 81414 81046 gene locus_tag LOCUS_04620 81414 81046 CDS product DUF2095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249981.1 protein_id gnl|my_center|LOCUS_04620 82161 81493 gene locus_tag LOCUS_04630 82161 81493 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761818.1 protein_id gnl|my_center|LOCUS_04630 82843 82142 gene locus_tag LOCUS_04640 82843 82142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 83711 82845 gene locus_tag LOCUS_04650 83711 82845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 83771 84334 gene locus_tag LOCUS_04660 83771 84334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 86063 84348 gene locus_tag LOCUS_04670 86063 84348 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_04670 86765 86166 gene locus_tag LOCUS_04680 86765 86166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 87209 87069 gene locus_tag LOCUS_04690 87209 87069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 87522 87214 gene locus_tag LOCUS_04700 87522 87214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 87570 87641 gene locus_tag LOCUS_t00120 87570 87641 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 87809 88753 gene locus_tag LOCUS_04710 87809 88753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 89954 88740 gene locus_tag LOCUS_04720 89954 88740 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_04720 91857 89941 gene locus_tag LOCUS_04730 91857 89941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 92554 91850 gene locus_tag LOCUS_04740 92554 91850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_04740 93756 92599 gene locus_tag LOCUS_04750 93756 92599 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250018.1 protein_id gnl|my_center|LOCUS_04750 93941 95176 gene locus_tag LOCUS_04760 gene thiI 93941 95176 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_04760 95336 96844 gene locus_tag LOCUS_04770 95336 96844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 96875 97870 gene locus_tag LOCUS_04780 96875 97870 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 protein_id gnl|my_center|LOCUS_04780 97972 97835 gene locus_tag LOCUS_04790 97972 97835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 101546 98016 gene locus_tag LOCUS_04800 gene rgy 101546 98016 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 protein_id gnl|my_center|LOCUS_04800 101696 102142 gene locus_tag LOCUS_04810 101696 102142 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 protein_id gnl|my_center|LOCUS_04810 102808 102119 gene locus_tag LOCUS_04820 102808 102119 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879162.1 protein_id gnl|my_center|LOCUS_04820 103830 102805 gene locus_tag LOCUS_04830 gene leuB 103830 102805 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_04830 105531 103837 gene locus_tag LOCUS_04840 gene ilvD 105531 103837 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762493.1 protein_id gnl|my_center|LOCUS_04840 105635 107092 gene locus_tag LOCUS_04850 105635 107092 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_04850 107993 107067 gene locus_tag LOCUS_04860 107993 107067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 108077 110404 gene locus_tag LOCUS_04870 108077 110404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 110550 113120 gene locus_tag LOCUS_04880 110550 113120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_04880 113120 114166 gene locus_tag LOCUS_04890 113120 114166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 protein_id gnl|my_center|LOCUS_04890 114217 114819 gene locus_tag LOCUS_04900 114217 114819 CDS product DUF996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871168.1 protein_id gnl|my_center|LOCUS_04900 114869 115900 gene locus_tag LOCUS_04910 114869 115900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 115934 116683 gene locus_tag LOCUS_04920 gene hisA 115934 116683 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263872.1 protein_id gnl|my_center|LOCUS_04920 116673 117440 gene locus_tag LOCUS_04930 gene hisF 116673 117440 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_04930 117437 117787 gene locus_tag LOCUS_04940 117437 117787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 117835 118260 gene locus_tag LOCUS_04950 117835 118260 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 protein_id gnl|my_center|LOCUS_04950 118748 118320 gene locus_tag LOCUS_04960 118748 118320 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_04960 119725 118781 gene locus_tag LOCUS_04970 119725 118781 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_04970 119808 120122 gene locus_tag LOCUS_04980 119808 120122 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_04980 120289 120119 gene locus_tag LOCUS_04990 120289 120119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 121297 120326 gene locus_tag LOCUS_05000 gene mvaD 121297 120326 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_05000 121400 121780 gene locus_tag LOCUS_05010 121400 121780 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_05010 122933 122013 gene locus_tag LOCUS_05020 122933 122013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 123449 123009 gene locus_tag LOCUS_05030 gene trxA 123449 123009 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_05030 123561 124484 gene locus_tag LOCUS_05040 123561 124484 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_05040 124515 125075 gene locus_tag LOCUS_05050 124515 125075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 125220 125062 gene locus_tag LOCUS_05060 125220 125062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 126452 125250 gene locus_tag LOCUS_05070 gene hflX 126452 125250 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_05070 126999 126628 gene locus_tag LOCUS_05080 126999 126628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 128262 127057 gene locus_tag LOCUS_05090 128262 127057 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_05090 128874 128263 gene locus_tag LOCUS_05100 128874 128263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 129135 128884 gene locus_tag LOCUS_05110 129135 128884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 129258 130505 gene locus_tag LOCUS_05120 129258 130505 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_05120 131428 130502 gene locus_tag LOCUS_05130 gene map 131428 130502 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_05130 133102 131435 gene locus_tag LOCUS_05140 133102 131435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 133202 134167 gene locus_tag LOCUS_05150 gene pdxS 133202 134167 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_05150 134229 134972 gene locus_tag LOCUS_05160 134229 134972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 135338 134943 gene locus_tag LOCUS_05170 135338 134943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 135622 135335 gene locus_tag LOCUS_05180 135622 135335 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_05180 136914 135685 gene locus_tag LOCUS_05190 gene thrC 136914 135685 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142060.1 protein_id gnl|my_center|LOCUS_05190 137128 137565 gene locus_tag LOCUS_05200 137128 137565 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762932.1 protein_id gnl|my_center|LOCUS_05200 137623 140364 gene locus_tag LOCUS_05210 gene acnA 137623 140364 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_05210 140813 140562 gene locus_tag LOCUS_05220 140813 140562 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_05220 140955 141908 gene locus_tag LOCUS_05230 gene ala 140955 141908 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_05230 142544 141909 gene locus_tag LOCUS_05240 142544 141909 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250821.1 protein_id gnl|my_center|LOCUS_05240 143399 142551 gene locus_tag LOCUS_05250 gene pstB 143399 142551 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_05250 144247 143396 gene locus_tag LOCUS_05260 gene pstA 144247 143396 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_05260 145191 144268 gene locus_tag LOCUS_05270 gene pstC 145191 144268 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_05270 146397 145222 gene locus_tag LOCUS_05280 146397 145222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 146526 147557 gene locus_tag LOCUS_05290 146526 147557 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_05290 147588 149042 gene locus_tag LOCUS_05300 147588 149042 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082990.1 protein_id gnl|my_center|LOCUS_05300 149700 149050 gene locus_tag LOCUS_05310 gene rrmJ 149700 149050 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_05310 150229 149765 gene locus_tag LOCUS_05320 150229 149765 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_05320 151749 150658 gene locus_tag LOCUS_05330 151749 150658 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_05330 152381 151815 gene locus_tag LOCUS_05340 152381 151815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 153492 152389 gene locus_tag LOCUS_05350 153492 152389 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583139.1 protein_id gnl|my_center|LOCUS_05350 153682 153960 gene locus_tag LOCUS_05360 153682 153960 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_05360 153957 154178 gene locus_tag LOCUS_05370 153957 154178 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_05370 155169 154183 gene locus_tag LOCUS_05380 gene ilvC 155169 154183 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146977.1 protein_id gnl|my_center|LOCUS_05380 155427 155170 gene locus_tag LOCUS_05390 155427 155170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 155627 155445 gene locus_tag LOCUS_05400 155627 155445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 157374 155641 gene locus_tag LOCUS_05410 gene ilvB 157374 155641 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827711.1 protein_id gnl|my_center|LOCUS_05410 158888 157371 gene locus_tag LOCUS_05420 158888 157371 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_05420 159132 159389 gene locus_tag LOCUS_05430 159132 159389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 159932 159438 gene locus_tag LOCUS_05440 159932 159438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 160076 161470 gene locus_tag LOCUS_05450 gene sufB 160076 161470 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_05450 161813 161472 gene locus_tag LOCUS_05460 161813 161472 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_05460 163047 161827 gene locus_tag LOCUS_05470 163047 161827 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_05470 165977 163221 gene locus_tag LOCUS_05480 165977 163221 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_05480 166126 167172 gene locus_tag LOCUS_05490 166126 167172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 protein_id gnl|my_center|LOCUS_05490 167169 168593 gene locus_tag LOCUS_05500 167169 168593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 protein_id gnl|my_center|LOCUS_05500 168595 169557 gene locus_tag LOCUS_05510 168595 169557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_05510 169550 170563 gene locus_tag LOCUS_05520 169550 170563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762316.1 protein_id gnl|my_center|LOCUS_05520 171129 170560 gene locus_tag LOCUS_05530 171129 170560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 171196 171963 gene locus_tag LOCUS_05540 gene fabG 171196 171963 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257346.1 protein_id gnl|my_center|LOCUS_05540 172009 173472 gene locus_tag LOCUS_05550 172009 173472 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_05550 173561 174652 gene locus_tag LOCUS_05560 173561 174652 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_05560 174688 175500 gene locus_tag LOCUS_05570 174688 175500 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240312.1 protein_id gnl|my_center|LOCUS_05570 175523 175795 gene locus_tag LOCUS_05580 175523 175795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 177304 175838 gene locus_tag LOCUS_05590 gene bgaS 177304 175838 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250712.1 protein_id gnl|my_center|LOCUS_05590 177400 177699 gene locus_tag LOCUS_05600 177400 177699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 177770 178921 gene locus_tag LOCUS_05610 177770 178921 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 protein_id gnl|my_center|LOCUS_05610 180185 178872 gene locus_tag LOCUS_05620 180185 178872 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 protein_id gnl|my_center|LOCUS_05620 181086 180190 gene locus_tag LOCUS_05630 181086 180190 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_05630 181294 181962 gene locus_tag LOCUS_05640 181294 181962 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762300.1 protein_id gnl|my_center|LOCUS_05640 181976 182440 gene locus_tag LOCUS_05650 181976 182440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 183348 182428 gene locus_tag LOCUS_05660 gene rnz 183348 182428 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_05660 184765 183401 gene locus_tag LOCUS_05670 184765 183401 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761902.1 protein_id gnl|my_center|LOCUS_05670 185834 184794 gene locus_tag LOCUS_05680 185834 184794 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 protein_id gnl|my_center|LOCUS_05680 187002 185971 gene locus_tag LOCUS_05690 187002 185971 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_05690 187892 186999 gene locus_tag LOCUS_05700 187892 186999 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_05700 187975 188487 gene locus_tag LOCUS_05710 187975 188487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 188584 188868 gene locus_tag LOCUS_05720 188584 188868 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_05720 188936 189895 gene locus_tag LOCUS_05730 gene htpX 188936 189895 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_05730 190338 189919 gene locus_tag LOCUS_05740 190338 189919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 190412 191710 gene locus_tag LOCUS_05750 190412 191710 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868844.1 protein_id gnl|my_center|LOCUS_05750 193133 191712 gene locus_tag LOCUS_05760 193133 191712 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_05760 194528 193227 gene locus_tag LOCUS_05770 194528 193227 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_05770 195648 194485 gene locus_tag LOCUS_05780 195648 194485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 196578 195649 gene locus_tag LOCUS_05790 196578 195649 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_05790 196663 197106 gene locus_tag LOCUS_05800 196663 197106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 197372 197103 gene locus_tag LOCUS_05810 197372 197103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 197653 197369 gene locus_tag LOCUS_05820 197653 197369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 198054 197650 gene locus_tag LOCUS_05830 198054 197650 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_05830 198911 198081 gene locus_tag LOCUS_05840 198911 198081 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_05840 199717 198908 gene locus_tag LOCUS_05850 199717 198908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 199830 200987 gene locus_tag LOCUS_05860 199830 200987 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_05860 201539 201000 gene locus_tag LOCUS_05870 201539 201000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 201612 202370 gene locus_tag LOCUS_05880 201612 202370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 202367 202756 gene locus_tag LOCUS_05890 202367 202756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 202760 203278 gene locus_tag LOCUS_05900 202760 203278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 203361 203624 gene locus_tag LOCUS_05910 203361 203624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 203693 204133 gene locus_tag LOCUS_05920 203693 204133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 204154 205170 gene locus_tag LOCUS_05930 204154 205170 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877967.1 protein_id gnl|my_center|LOCUS_05930 205219 206961 gene locus_tag LOCUS_05940 205219 206961 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_05940 207014 207277 gene locus_tag LOCUS_05950 gene albA 207014 207277 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_05950 207288 208646 gene locus_tag LOCUS_05960 207288 208646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 208690 209757 gene locus_tag LOCUS_05970 gene rtcA 208690 209757 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_05970 209857 210306 gene locus_tag LOCUS_05980 209857 210306 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923340.1 protein_id gnl|my_center|LOCUS_05980 210303 211298 gene locus_tag LOCUS_05990 210303 211298 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_05990 211295 212167 gene locus_tag LOCUS_06000 211295 212167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_06000 212968 212168 gene locus_tag LOCUS_06010 212968 212168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 213686 212940 gene locus_tag LOCUS_06020 213686 212940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 214663 213713 gene locus_tag LOCUS_06030 214663 213713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762654.1 protein_id gnl|my_center|LOCUS_06030 215177 214686 gene locus_tag LOCUS_06040 215177 214686 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763400.1 protein_id gnl|my_center|LOCUS_06040 215283 217469 gene locus_tag LOCUS_06050 215283 217469 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763679.1 protein_id gnl|my_center|LOCUS_06050 217738 220905 gene locus_tag LOCUS_06060 217738 220905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 221607 221086 gene locus_tag LOCUS_06070 221607 221086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 222772 221702 gene locus_tag LOCUS_06080 222772 221702 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_06080 222868 223314 gene locus_tag LOCUS_06090 222868 223314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978455.1 protein_id gnl|my_center|LOCUS_06090 226402 223265 gene locus_tag LOCUS_06100 226402 223265 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 protein_id gnl|my_center|LOCUS_06100 227192 226452 gene locus_tag LOCUS_06110 227192 226452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 227243 227884 gene locus_tag LOCUS_06120 227243 227884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 228267 227881 gene locus_tag LOCUS_06130 228267 227881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 229014 228307 gene locus_tag LOCUS_06140 229014 228307 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_06140 229209 229121 gene locus_tag LOCUS_t00130 229209 229121 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 229484 230461 gene locus_tag LOCUS_06150 229484 230461 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146617.1 protein_id gnl|my_center|LOCUS_06150 231597 232454 gene locus_tag LOCUS_06160 231597 232454 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_06160 232694 235252 gene locus_tag LOCUS_06170 232694 235252 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_06170 236046 236432 gene locus_tag LOCUS_06180 236046 236432 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 protein_id gnl|my_center|LOCUS_06180 236429 236794 gene locus_tag LOCUS_06190 236429 236794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 237128 237053 gene locus_tag LOCUS_t00140 237128 237053 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 237301 238248 gene locus_tag LOCUS_06200 237301 238248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence03 <1 1121 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaacctcacaaagaggattgaaag 1509 1240 gene locus_tag LOCUS_06210 1509 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1409 1921 gene locus_tag LOCUS_06220 1409 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2137 1928 gene locus_tag LOCUS_06230 2137 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2320 5016 gene locus_tag LOCUS_06240 2320 5016 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_06240 5498 5013 gene locus_tag LOCUS_06250 5498 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 6742 5558 gene locus_tag LOCUS_06260 6742 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6829 7086 gene locus_tag LOCUS_06270 6829 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 7197 7691 gene locus_tag LOCUS_06280 7197 7691 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_06280 7702 7935 gene locus_tag LOCUS_06290 7702 7935 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_06290 7932 9134 gene locus_tag LOCUS_06300 7932 9134 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_06300 9131 9469 gene locus_tag LOCUS_06310 9131 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 9606 9692 gene locus_tag LOCUS_t00150 9606 9692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9861 9706 gene locus_tag LOCUS_06320 9861 9706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10337 9849 gene locus_tag LOCUS_06330 10337 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10956 10756 gene locus_tag LOCUS_06340 10956 10756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 11622 11697 gene locus_tag LOCUS_t00160 11622 11697 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11759 12736 gene locus_tag LOCUS_06350 11759 12736 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_06350 12809 13993 gene locus_tag LOCUS_06360 12809 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 14078 15322 gene locus_tag LOCUS_06370 gene rifK 14078 15322 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_06370 15336 16424 gene locus_tag LOCUS_06380 gene ugpC 15336 16424 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_06380 17284 16421 gene locus_tag LOCUS_06390 17284 16421 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969645.1 protein_id gnl|my_center|LOCUS_06390 18126 17281 gene locus_tag LOCUS_06400 18126 17281 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 protein_id gnl|my_center|LOCUS_06400 19531 18215 gene locus_tag LOCUS_06410 19531 18215 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_06410 19902 20330 gene locus_tag LOCUS_06420 19902 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 20379 22415 gene locus_tag LOCUS_06430 20379 22415 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229021.1 protein_id gnl|my_center|LOCUS_06430 22797 22405 gene locus_tag LOCUS_06440 22797 22405 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_06440 22956 23657 gene locus_tag LOCUS_06450 22956 23657 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_06450 23943 25490 gene locus_tag LOCUS_06460 gene crtI 23943 25490 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061143.1 protein_id gnl|my_center|LOCUS_06460 25491 26375 gene locus_tag LOCUS_06470 25491 26375 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485796.1 protein_id gnl|my_center|LOCUS_06470 26366 27235 gene locus_tag LOCUS_06480 26366 27235 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877411.1 protein_id gnl|my_center|LOCUS_06480 27770 27336 gene locus_tag LOCUS_06490 27770 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 28226 28540 gene locus_tag LOCUS_06500 28226 28540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 29272 31011 gene locus_tag LOCUS_06510 29272 31011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 31008 31733 gene locus_tag LOCUS_06520 31008 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 31737 32381 gene locus_tag LOCUS_06530 31737 32381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 35229 32374 gene locus_tag LOCUS_06540 35229 32374 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_06540 35480 36820 gene locus_tag LOCUS_06550 35480 36820 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_06550 36860 37678 gene locus_tag LOCUS_06560 36860 37678 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229133.1 protein_id gnl|my_center|LOCUS_06560 37952 37692 gene locus_tag LOCUS_06570 37952 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 38627 38007 gene locus_tag LOCUS_06580 38627 38007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 40270 38750 gene locus_tag LOCUS_06590 gene xylB 40270 38750 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_06590 40549 43044 gene locus_tag LOCUS_06600 40549 43044 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_06600 43359 43147 gene locus_tag LOCUS_06610 43359 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 45446 43929 gene locus_tag LOCUS_06620 gene glnA 45446 43929 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_06620 45882 48059 gene locus_tag LOCUS_06630 45882 48059 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_06630 49087 48350 gene locus_tag LOCUS_06640 49087 48350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 49930 49148 gene locus_tag LOCUS_06650 49930 49148 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869745.1 protein_id gnl|my_center|LOCUS_06650 50052 50849 gene locus_tag LOCUS_06660 50052 50849 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_06660 50862 51698 gene locus_tag LOCUS_06670 50862 51698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 52091 52462 gene locus_tag LOCUS_06680 52091 52462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 53472 52492 gene locus_tag LOCUS_06690 53472 52492 CDS product dihydroorotase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679913.1 protein_id gnl|my_center|LOCUS_06690 53948 53472 gene locus_tag LOCUS_06700 gene pyrI 53948 53472 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_06700 54961 53945 gene locus_tag LOCUS_06710 gene pyrB 54961 53945 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_06710 55318 55013 gene locus_tag LOCUS_06720 55318 55013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 57190 55430 gene locus_tag LOCUS_06730 57190 55430 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496860.1 protein_id gnl|my_center|LOCUS_06730 57345 57920 gene locus_tag LOCUS_06740 57345 57920 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928824.1 protein_id gnl|my_center|LOCUS_06740 58938 57934 gene locus_tag LOCUS_06750 58938 57934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 59402 58935 gene locus_tag LOCUS_06760 59402 58935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 59364 59534 gene locus_tag LOCUS_06770 59364 59534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 59573 60016 gene locus_tag LOCUS_06780 59573 60016 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258944.1 protein_id gnl|my_center|LOCUS_06780 60513 60037 gene locus_tag LOCUS_06790 60513 60037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 61055 61411 gene locus_tag LOCUS_06800 61055 61411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 64094 61440 gene locus_tag LOCUS_06810 gene ppdK 64094 61440 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_06810 65295 64213 gene locus_tag LOCUS_06820 65295 64213 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250249.1 protein_id gnl|my_center|LOCUS_06820 65424 65963 gene locus_tag LOCUS_06830 65424 65963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 66023 66655 gene locus_tag LOCUS_06840 66023 66655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 67206 66652 gene locus_tag LOCUS_06850 67206 66652 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_06850 67277 68590 gene locus_tag LOCUS_06860 gene glyA 67277 68590 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_06860 69279 68599 gene locus_tag LOCUS_06870 69279 68599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 69436 70500 gene locus_tag LOCUS_06880 gene priL 69436 70500 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_06880 70541 70942 gene locus_tag LOCUS_06890 70541 70942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 70991 72376 gene locus_tag LOCUS_06900 70991 72376 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_06900 73384 72395 gene locus_tag LOCUS_06910 73384 72395 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_06910 74473 73397 gene locus_tag LOCUS_06920 74473 73397 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_06920 74612 79282 gene locus_tag LOCUS_06930 74612 79282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 79296 80315 gene locus_tag LOCUS_06940 79296 80315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 80308 81198 gene locus_tag LOCUS_06950 80308 81198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 81263 81334 gene locus_tag LOCUS_t00170 81263 81334 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 82205 81522 gene locus_tag LOCUS_06960 82205 81522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 82295 83788 gene locus_tag LOCUS_06970 gene proS 82295 83788 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_06970 84578 83805 gene locus_tag LOCUS_06980 84578 83805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 84733 84912 gene locus_tag LOCUS_06990 84733 84912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 85269 85826 gene locus_tag LOCUS_07000 85269 85826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 85856 86632 gene locus_tag LOCUS_07010 gene fabG 85856 86632 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_07010 86690 87316 gene locus_tag LOCUS_07020 86690 87316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 87324 87767 gene locus_tag LOCUS_07030 87324 87767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 87982 87743 gene locus_tag LOCUS_07040 87982 87743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 88136 88585 gene locus_tag LOCUS_07050 gene lysM 88136 88585 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_07050 89105 88569 gene locus_tag LOCUS_07060 89105 88569 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900858.1 protein_id gnl|my_center|LOCUS_07060 89657 89130 gene locus_tag LOCUS_07070 89657 89130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 90930 90121 gene locus_tag LOCUS_07080 90930 90121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 91198 91722 gene locus_tag LOCUS_07090 91198 91722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 92396 93175 gene locus_tag LOCUS_07100 92396 93175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 93102 93524 gene locus_tag LOCUS_07110 93102 93524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 94012 93539 gene locus_tag LOCUS_07120 94012 93539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 95003 94092 gene locus_tag LOCUS_07130 95003 94092 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_07130 95184 95777 gene locus_tag LOCUS_07140 95184 95777 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_07140 96136 95810 gene locus_tag LOCUS_07150 96136 95810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 96612 96148 gene locus_tag LOCUS_07160 96612 96148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 96672 97691 gene locus_tag LOCUS_07170 gene trxB 96672 97691 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777150.1 protein_id gnl|my_center|LOCUS_07170 98298 97645 gene locus_tag LOCUS_07180 98298 97645 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978559.1 protein_id gnl|my_center|LOCUS_07180 99565 98351 gene locus_tag LOCUS_07190 99565 98351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965738.1 protein_id gnl|my_center|LOCUS_07190 100617 99562 gene locus_tag LOCUS_07200 100617 99562 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453864.1 protein_id gnl|my_center|LOCUS_07200 101873 100626 gene locus_tag LOCUS_07210 101873 100626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763676.1 protein_id gnl|my_center|LOCUS_07210 102110 101889 gene locus_tag LOCUS_07220 102110 101889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 102239 102925 gene locus_tag LOCUS_07230 gene rpiA 102239 102925 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_07230 103120 103908 gene locus_tag LOCUS_07240 103120 103908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 103987 104874 gene locus_tag LOCUS_07250 103987 104874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 104944 106383 gene locus_tag LOCUS_07260 gene argH 104944 106383 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_07260 107431 106364 gene locus_tag LOCUS_07270 107431 106364 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_07270 108594 107431 gene locus_tag LOCUS_07280 108594 107431 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_07280 109453 108602 gene locus_tag LOCUS_07290 gene lysX 109453 108602 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978130.1 protein_id gnl|my_center|LOCUS_07290 109640 109458 gene locus_tag LOCUS_07300 gene lysW/argW 109640 109458 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_07300 110546 109749 gene locus_tag LOCUS_07310 110546 109749 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_07310 111623 110568 gene locus_tag LOCUS_07320 gene argC 111623 110568 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_07320 112465 111620 gene locus_tag LOCUS_07330 gene lysX 112465 111620 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 protein_id gnl|my_center|LOCUS_07330 113295 112612 gene locus_tag LOCUS_07340 113295 112612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 113468 115267 gene locus_tag LOCUS_07350 113468 115267 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_07350 115709 115275 gene locus_tag LOCUS_07360 115709 115275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 116496 115732 gene locus_tag LOCUS_07370 116496 115732 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763544.1 protein_id gnl|my_center|LOCUS_07370 117161 116493 gene locus_tag LOCUS_07380 117161 116493 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763543.1 protein_id gnl|my_center|LOCUS_07380 118006 117176 gene locus_tag LOCUS_07390 118006 117176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762112.1 protein_id gnl|my_center|LOCUS_07390 118189 118527 gene locus_tag LOCUS_07400 118189 118527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 118855 118598 gene locus_tag LOCUS_07410 118855 118598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 119008 119790 gene locus_tag LOCUS_07420 gene lsrF 119008 119790 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098846.1 protein_id gnl|my_center|LOCUS_07420 119886 120851 gene locus_tag LOCUS_07430 119886 120851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 120930 121559 gene locus_tag LOCUS_07440 120930 121559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 121671 122804 gene locus_tag LOCUS_07450 gene trm14 121671 122804 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 protein_id gnl|my_center|LOCUS_07450 123445 122801 gene locus_tag LOCUS_07460 gene rpsB 123445 122801 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870496.1 protein_id gnl|my_center|LOCUS_07460 124789 123542 gene locus_tag LOCUS_07470 gene eno 124789 123542 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_07470 125005 124790 gene locus_tag LOCUS_07480 125005 124790 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_07480 125096 125908 gene locus_tag LOCUS_07490 125096 125908 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762405.1 protein_id gnl|my_center|LOCUS_07490 127185 125860 gene locus_tag LOCUS_07500 127185 125860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 127336 127746 gene locus_tag LOCUS_07510 127336 127746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 129752 127803 gene locus_tag LOCUS_07520 129752 127803 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082989.1 protein_id gnl|my_center|LOCUS_07520 129845 130570 gene locus_tag LOCUS_07530 gene tpiA 129845 130570 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_07530 131231 130560 gene locus_tag LOCUS_07540 131231 130560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 131355 132290 gene locus_tag LOCUS_07550 131355 132290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 132287 133033 gene locus_tag LOCUS_07560 gene phnC 132287 133033 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682233.1 protein_id gnl|my_center|LOCUS_07560 133142 133879 gene locus_tag LOCUS_07570 gene phnE 133142 133879 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 protein_id gnl|my_center|LOCUS_07570 134499 135353 gene locus_tag LOCUS_07580 134499 135353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 136161 137837 gene locus_tag LOCUS_07590 gene glgP 136161 137837 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021875.1 protein_id gnl|my_center|LOCUS_07590 138689 137886 gene locus_tag LOCUS_07600 138689 137886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 139630 138689 gene locus_tag LOCUS_07610 139630 138689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 140475 139720 gene locus_tag LOCUS_07620 140475 139720 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 protein_id gnl|my_center|LOCUS_07620 140626 140701 gene locus_tag LOCUS_t00180 140626 140701 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 140866 141633 gene locus_tag LOCUS_07630 140866 141633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 142320 141889 gene locus_tag LOCUS_07640 142320 141889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 142553 142311 gene locus_tag LOCUS_07650 142553 142311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 143289 143214 gene locus_tag LOCUS_t00190 143289 143214 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 144587 143343 gene locus_tag LOCUS_07660 gene pgk 144587 143343 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_07660 145608 144571 gene locus_tag LOCUS_07670 gene gap 145608 144571 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_07670 145963 147339 gene locus_tag LOCUS_07680 gene cimA 145963 147339 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146979.1 protein_id gnl|my_center|LOCUS_07680 148175 147366 gene locus_tag LOCUS_07690 148175 147366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 148337 148263 gene locus_tag LOCUS_t00200 148337 148263 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 148720 148385 gene locus_tag LOCUS_07700 148720 148385 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762194.1 protein_id gnl|my_center|LOCUS_07700 148979 148794 gene locus_tag LOCUS_07710 148979 148794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 149668 149057 gene locus_tag LOCUS_07720 149668 149057 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_07720 149732 150328 gene locus_tag LOCUS_07730 gene tmk 149732 150328 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_07730 150709 150332 gene locus_tag LOCUS_07740 150709 150332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 152075 150780 gene locus_tag LOCUS_07750 152075 150780 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142660068.1 protein_id gnl|my_center|LOCUS_07750 152842 152072 gene locus_tag LOCUS_07760 152842 152072 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_07760 153702 152842 gene locus_tag LOCUS_07770 153702 152842 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_07770 154181 153699 gene locus_tag LOCUS_07780 154181 153699 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_07780 155320 154178 gene locus_tag LOCUS_07790 155320 154178 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_07790 155844 155497 gene locus_tag LOCUS_07800 155844 155497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 156268 155867 gene locus_tag LOCUS_07810 156268 155867 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979628.1 protein_id gnl|my_center|LOCUS_07810 157150 156377 gene locus_tag LOCUS_07820 157150 156377 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_07820 157565 157131 gene locus_tag LOCUS_07830 gene hypA 157565 157131 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582498.1 protein_id gnl|my_center|LOCUS_07830 157670 157593 gene locus_tag LOCUS_t00210 157670 157593 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 159416 157980 gene locus_tag LOCUS_07840 gene xylB 159416 157980 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965900.1 protein_id gnl|my_center|LOCUS_07840 160682 159684 gene locus_tag LOCUS_07850 gene akrN 160682 159684 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_07850 161657 160854 gene locus_tag LOCUS_07860 gene deoC 161657 160854 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_07860 161979 162962 gene locus_tag LOCUS_07870 161979 162962 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 protein_id gnl|my_center|LOCUS_07870 163022 164320 gene locus_tag LOCUS_07880 163022 164320 CDS product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839470.1 protein_id gnl|my_center|LOCUS_07880 164419 165276 gene locus_tag LOCUS_07890 164419 165276 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_07890 166720 165311 gene locus_tag LOCUS_07900 166720 165311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 167612 166893 gene locus_tag LOCUS_07910 167612 166893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 169411 170064 gene locus_tag LOCUS_07920 169411 170064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 170518 170114 gene locus_tag LOCUS_07930 170518 170114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence04 406 330 gene locus_tag LOCUS_t00220 406 330 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 516 1259 gene locus_tag LOCUS_07940 516 1259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080881.1 protein_id gnl|my_center|LOCUS_07940 1256 2779 gene locus_tag LOCUS_07950 1256 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2898 4820 gene locus_tag LOCUS_07960 2898 4820 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_07960 6585 4810 gene locus_tag LOCUS_07970 6585 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6709 7110 gene locus_tag LOCUS_07980 6709 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7215 8117 gene locus_tag LOCUS_07990 7215 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8529 8170 gene locus_tag LOCUS_08000 8529 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8688 10007 gene locus_tag LOCUS_08010 8688 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 11292 10024 gene locus_tag LOCUS_08020 11292 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 11364 11498 gene locus_tag LOCUS_08030 11364 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 11661 11864 gene locus_tag LOCUS_08040 11661 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 13566 11842 gene locus_tag LOCUS_08050 13566 11842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 14698 13568 gene locus_tag LOCUS_08060 14698 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 15529 15341 gene locus_tag LOCUS_08070 15529 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 15649 16602 gene locus_tag LOCUS_08080 15649 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 17197 16631 gene locus_tag LOCUS_08090 17197 16631 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_08090 17322 18215 gene locus_tag LOCUS_08100 gene cutB 17322 18215 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_08100 18208 18768 gene locus_tag LOCUS_08110 18208 18768 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_08110 18869 19717 gene locus_tag LOCUS_08120 gene cyoE 18869 19717 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_08120 22501 19733 gene locus_tag LOCUS_08130 22501 19733 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_08130 22689 22615 gene locus_tag LOCUS_t00230 22689 22615 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24505 22883 gene locus_tag LOCUS_08140 gene thsB 24505 22883 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_08140 24649 25497 gene locus_tag LOCUS_08150 24649 25497 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_08150 25490 26002 gene locus_tag LOCUS_08160 25490 26002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 26384 25941 gene locus_tag LOCUS_08170 26384 25941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 26449 27372 gene locus_tag LOCUS_08180 26449 27372 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_08180 27467 29242 gene locus_tag LOCUS_08190 27467 29242 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_08190 29360 31507 gene locus_tag LOCUS_08200 29360 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 32145 31546 gene locus_tag LOCUS_08210 32145 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 32574 33077 gene locus_tag LOCUS_08220 32574 33077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762862.1 protein_id gnl|my_center|LOCUS_08220 33161 35953 gene locus_tag LOCUS_08230 33161 35953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 36043 36492 gene locus_tag LOCUS_08240 36043 36492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 37066 36449 gene locus_tag LOCUS_08250 37066 36449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 37213 37356 gene locus_tag LOCUS_08260 37213 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 37540 37842 gene locus_tag LOCUS_08270 37540 37842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 38404 39030 gene locus_tag LOCUS_08280 38404 39030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 39027 39461 gene locus_tag LOCUS_08290 39027 39461 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_08290 40795 40376 gene locus_tag LOCUS_08300 40795 40376 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_08300 41541 40792 gene locus_tag LOCUS_08310 41541 40792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 41971 43320 gene locus_tag LOCUS_08320 gene gatD 41971 43320 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979283.1 protein_id gnl|my_center|LOCUS_08320 43317 45194 gene locus_tag LOCUS_08330 gene gatE 43317 45194 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 protein_id gnl|my_center|LOCUS_08330 46353 45283 gene locus_tag LOCUS_08340 46353 45283 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867210.1 protein_id gnl|my_center|LOCUS_08340 46705 46520 gene locus_tag LOCUS_08350 46705 46520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 48436 46721 gene locus_tag LOCUS_08360 48436 46721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 49462 48578 gene locus_tag LOCUS_08370 49462 48578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 49625 49515 gene locus_tag LOCUS_r00010 49625 49515 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 49783 50334 gene locus_tag LOCUS_08380 49783 50334 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_08380 50454 51119 gene locus_tag LOCUS_08390 gene sfsA 50454 51119 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 protein_id gnl|my_center|LOCUS_08390 51514 51137 gene locus_tag LOCUS_08400 51514 51137 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_08400 52431 51607 gene locus_tag LOCUS_08410 52431 51607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 53986 52448 gene locus_tag LOCUS_08420 53986 52448 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979490.1 protein_id gnl|my_center|LOCUS_08420 54233 55126 gene locus_tag LOCUS_08430 54233 55126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 55251 56399 gene locus_tag LOCUS_08440 55251 56399 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_08440 57513 56461 gene locus_tag LOCUS_08450 57513 56461 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_08450 58529 57576 gene locus_tag LOCUS_08460 58529 57576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 58740 59003 gene locus_tag LOCUS_08470 58740 59003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 59209 59000 gene locus_tag LOCUS_08480 59209 59000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 59497 59249 gene locus_tag LOCUS_08490 59497 59249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 60337 59528 gene locus_tag LOCUS_08500 60337 59528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 60519 61304 gene locus_tag LOCUS_08510 60519 61304 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250846.1 protein_id gnl|my_center|LOCUS_08510 62086 61301 gene locus_tag LOCUS_08520 62086 61301 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_08520 63015 62098 gene locus_tag LOCUS_08530 gene mptA 63015 62098 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496622.1 protein_id gnl|my_center|LOCUS_08530 64409 63102 gene locus_tag LOCUS_08540 gene asnS 64409 63102 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_08540 65559 64900 gene locus_tag LOCUS_08550 65559 64900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 66197 65625 gene locus_tag LOCUS_08560 66197 65625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 67070 66240 gene locus_tag LOCUS_08570 67070 66240 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582623.1 protein_id gnl|my_center|LOCUS_08570 67360 67067 gene locus_tag LOCUS_08580 67360 67067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 67516 67367 gene locus_tag LOCUS_08590 67516 67367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 67634 68008 gene locus_tag LOCUS_08600 67634 68008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 68049 68357 gene locus_tag LOCUS_08610 68049 68357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 68943 68344 gene locus_tag LOCUS_08620 68943 68344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 69224 68940 gene locus_tag LOCUS_08630 69224 68940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 70414 69221 gene locus_tag LOCUS_08640 70414 69221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 70468 70758 gene locus_tag LOCUS_08650 70468 70758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 70755 72224 gene locus_tag LOCUS_08660 70755 72224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 72252 73043 gene locus_tag LOCUS_08670 72252 73043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 73055 74011 gene locus_tag LOCUS_08680 73055 74011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 74071 74895 gene locus_tag LOCUS_08690 74071 74895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 74892 75263 gene locus_tag LOCUS_08700 74892 75263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 75271 75549 gene locus_tag LOCUS_08710 75271 75549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 75528 76412 gene locus_tag LOCUS_08720 75528 76412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 76437 77354 gene locus_tag LOCUS_08730 76437 77354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 77365 77706 gene locus_tag LOCUS_08740 77365 77706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 77703 77867 gene locus_tag LOCUS_08750 77703 77867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 77881 78312 gene locus_tag LOCUS_08760 77881 78312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 78309 80615 gene locus_tag LOCUS_08770 78309 80615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 80832 82556 gene locus_tag LOCUS_08780 80832 82556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 82553 83620 gene locus_tag LOCUS_08790 82553 83620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 83623 84078 gene locus_tag LOCUS_08800 83623 84078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 84218 84784 gene locus_tag LOCUS_08810 84218 84784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 85223 85429 gene locus_tag LOCUS_08820 85223 85429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 85633 85854 gene locus_tag LOCUS_08830 85633 85854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 85793 87139 gene locus_tag LOCUS_08840 85793 87139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 89627 87123 gene locus_tag LOCUS_08850 89627 87123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 89921 90328 gene locus_tag LOCUS_08860 89921 90328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 90716 90291 gene locus_tag LOCUS_08870 90716 90291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 91248 91571 gene locus_tag LOCUS_08880 91248 91571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 92031 91564 gene locus_tag LOCUS_08890 92031 91564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 92965 92132 gene locus_tag LOCUS_08900 92965 92132 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_08900 93285 92962 gene locus_tag LOCUS_08910 93285 92962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 93929 93387 gene locus_tag LOCUS_08920 93929 93387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 94229 94876 gene locus_tag LOCUS_08930 94229 94876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 94873 95376 gene locus_tag LOCUS_08940 94873 95376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 95384 95899 gene locus_tag LOCUS_08950 95384 95899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 95896 96615 gene locus_tag LOCUS_08960 95896 96615 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546206.1 protein_id gnl|my_center|LOCUS_08960 96617 99427 gene locus_tag LOCUS_08970 96617 99427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 99399 100889 gene locus_tag LOCUS_08980 99399 100889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 100886 101350 gene locus_tag LOCUS_08990 100886 101350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 101818 101330 gene locus_tag LOCUS_09000 101818 101330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 101899 102213 gene locus_tag LOCUS_09010 101899 102213 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879960.1 protein_id gnl|my_center|LOCUS_09010 103240 102194 gene locus_tag LOCUS_09020 103240 102194 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870059.1 protein_id gnl|my_center|LOCUS_09020 103350 104123 gene locus_tag LOCUS_09030 103350 104123 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_09030 105131 104115 gene locus_tag LOCUS_09040 105131 104115 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_09040 106017 105247 gene locus_tag LOCUS_09050 106017 105247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 106568 106185 gene locus_tag LOCUS_09060 106568 106185 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_09060 106765 106607 gene locus_tag LOCUS_09070 106765 106607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 107048 106857 gene locus_tag LOCUS_09080 107048 106857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 108361 107108 gene locus_tag LOCUS_09090 gene purB 108361 107108 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257052.1 protein_id gnl|my_center|LOCUS_09090 108457 109107 gene locus_tag LOCUS_09100 108457 109107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 109720 109175 gene locus_tag LOCUS_09110 109720 109175 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763584.1 protein_id gnl|my_center|LOCUS_09110 110584 109832 gene locus_tag LOCUS_09120 110584 109832 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_09120 110739 111116 gene locus_tag LOCUS_09130 110739 111116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 111273 111195 gene locus_tag LOCUS_t00240 111273 111195 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 111866 111390 gene locus_tag LOCUS_09140 111866 111390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 112178 111951 gene locus_tag LOCUS_09150 112178 111951 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_09150 112804 114075 gene locus_tag LOCUS_09160 112804 114075 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_09160 114059 115492 gene locus_tag LOCUS_09170 114059 115492 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289503.1 protein_id gnl|my_center|LOCUS_09170 115945 115766 gene locus_tag LOCUS_09180 115945 115766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 116112 115933 gene locus_tag LOCUS_09190 116112 115933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 116329 116072 gene locus_tag LOCUS_09200 116329 116072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 116699 116391 gene locus_tag LOCUS_09210 116699 116391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 116895 117062 gene locus_tag LOCUS_09220 116895 117062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 117663 119549 gene locus_tag LOCUS_09230 117663 119549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 119842 119570 gene locus_tag LOCUS_09240 119842 119570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 121287 119959 gene locus_tag LOCUS_09250 121287 119959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 121949 121284 gene locus_tag LOCUS_09260 121949 121284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 122323 121946 gene locus_tag LOCUS_09270 122323 121946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 122757 122320 gene locus_tag LOCUS_09280 122757 122320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 123178 122747 gene locus_tag LOCUS_09290 123178 122747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 123621 124505 gene locus_tag LOCUS_09300 123621 124505 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_09300 124659 125000 gene locus_tag LOCUS_09310 124659 125000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09310 125139 125888 gene locus_tag LOCUS_09320 125139 125888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09320 125925 126359 gene locus_tag LOCUS_09330 125925 126359 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 protein_id gnl|my_center|LOCUS_09330 127412 126360 gene locus_tag LOCUS_09340 127412 126360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 128571 127477 gene locus_tag LOCUS_09350 gene araD 128571 127477 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence05 1265 378 gene locus_tag LOCUS_09360 1265 378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082483.1 protein_id gnl|my_center|LOCUS_09360 2311 1298 gene locus_tag LOCUS_09370 2311 1298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082581.1 protein_id gnl|my_center|LOCUS_09370 2489 3448 gene locus_tag LOCUS_09380 2489 3448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978692.1 protein_id gnl|my_center|LOCUS_09380 3445 4440 gene locus_tag LOCUS_09390 3445 4440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082591.1 protein_id gnl|my_center|LOCUS_09390 4527 5465 gene locus_tag LOCUS_09400 4527 5465 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 protein_id gnl|my_center|LOCUS_09400 6505 5483 gene locus_tag LOCUS_09410 6505 5483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_09410 7562 6519 gene locus_tag LOCUS_09420 7562 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8537 7623 gene locus_tag LOCUS_09430 gene iolN 8537 7623 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_09430 8663 9841 gene locus_tag LOCUS_09440 gene iolM 8663 9841 CDS product scyllo-inosose 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083260.1 protein_id gnl|my_center|LOCUS_09440 9838 10164 gene locus_tag LOCUS_09450 9838 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10161 11333 gene locus_tag LOCUS_09460 10161 11333 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460067.1 protein_id gnl|my_center|LOCUS_09460 13581 11443 gene locus_tag LOCUS_09470 13581 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 15700 13751 gene locus_tag LOCUS_09480 15700 13751 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_09480 16921 15794 gene locus_tag LOCUS_09490 16921 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 18108 16918 gene locus_tag LOCUS_09500 18108 16918 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_09500 18816 18247 gene locus_tag LOCUS_09510 18816 18247 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_09510 20941 18842 gene locus_tag LOCUS_09520 20941 18842 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904206.1 protein_id gnl|my_center|LOCUS_09520 21515 20934 gene locus_tag LOCUS_09530 21515 20934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 21615 22556 gene locus_tag LOCUS_09540 21615 22556 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_09540 22573 23712 gene locus_tag LOCUS_09550 22573 23712 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_09550 24437 23724 gene locus_tag LOCUS_09560 24437 23724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089217.1 protein_id gnl|my_center|LOCUS_09560 25141 24428 gene locus_tag LOCUS_09570 25141 24428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_09570 26081 25131 gene locus_tag LOCUS_09580 26081 25131 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 protein_id gnl|my_center|LOCUS_09580 26947 26078 gene locus_tag LOCUS_09590 26947 26078 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_09590 28268 26952 gene locus_tag LOCUS_09600 28268 26952 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 protein_id gnl|my_center|LOCUS_09600 28351 29442 gene locus_tag LOCUS_09610 28351 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 29439 29957 gene locus_tag LOCUS_09620 29439 29957 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886218.1 protein_id gnl|my_center|LOCUS_09620 30067 30351 gene locus_tag LOCUS_09630 30067 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 30335 30874 gene locus_tag LOCUS_09640 30335 30874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 31333 30887 gene locus_tag LOCUS_09650 31333 30887 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_09650 31438 32535 gene locus_tag LOCUS_09660 31438 32535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 33636 32551 gene locus_tag LOCUS_09670 33636 32551 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_09670 33735 34769 gene locus_tag LOCUS_09680 33735 34769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 36021 34771 gene locus_tag LOCUS_09690 36021 34771 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762086.1 protein_id gnl|my_center|LOCUS_09690 36236 36048 gene locus_tag LOCUS_09700 36236 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 36807 36307 gene locus_tag LOCUS_09710 36807 36307 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_09710 37448 36804 gene locus_tag LOCUS_09720 37448 36804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 38534 37518 gene locus_tag LOCUS_09730 38534 37518 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_09730 40694 38589 gene locus_tag LOCUS_09740 40694 38589 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_09740 40788 41750 gene locus_tag LOCUS_09750 40788 41750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 41794 41870 gene locus_tag LOCUS_t00250 41794 41870 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 42332 41889 gene locus_tag LOCUS_09760 42332 41889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 42614 42348 gene locus_tag LOCUS_09770 42614 42348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 42708 43139 gene locus_tag LOCUS_09780 42708 43139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 43232 43867 gene locus_tag LOCUS_09790 43232 43867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 43918 46197 gene locus_tag LOCUS_09800 43918 46197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 46207 46482 gene locus_tag LOCUS_09810 46207 46482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 48549 46594 gene locus_tag LOCUS_09820 48549 46594 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_09820 48992 48693 gene locus_tag LOCUS_09830 48992 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 49704 48985 gene locus_tag LOCUS_09840 49704 48985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 50767 49742 gene locus_tag LOCUS_09850 gene radA 50767 49742 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_09850 51267 50833 gene locus_tag LOCUS_09860 51267 50833 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 protein_id gnl|my_center|LOCUS_09860 51560 51264 gene locus_tag LOCUS_09870 51560 51264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 55363 51560 gene locus_tag LOCUS_09880 55363 51560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 58755 55360 gene locus_tag LOCUS_09890 58755 55360 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_09890 58943 58752 gene locus_tag LOCUS_09900 58943 58752 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_09900 59225 59566 gene locus_tag LOCUS_09910 gene erpA 59225 59566 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_09910 59576 60037 gene locus_tag LOCUS_09920 gene bcp 59576 60037 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_09920 60281 60030 gene locus_tag LOCUS_09930 60281 60030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 61417 60524 gene locus_tag LOCUS_09940 61417 60524 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_09940 61335 61535 gene locus_tag LOCUS_09950 61335 61535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 61645 62973 gene locus_tag LOCUS_09960 61645 62973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 64054 62978 gene locus_tag LOCUS_09970 64054 62978 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 protein_id gnl|my_center|LOCUS_09970 64870 64088 gene locus_tag LOCUS_09980 64870 64088 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762640.1 protein_id gnl|my_center|LOCUS_09980 65854 64967 gene locus_tag LOCUS_09990 65854 64967 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022486.1 protein_id gnl|my_center|LOCUS_09990 69048 65851 gene locus_tag LOCUS_10000 gene ileS 69048 65851 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763377.1 protein_id gnl|my_center|LOCUS_10000 69176 69976 gene locus_tag LOCUS_10010 69176 69976 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_10010 69987 71279 gene locus_tag LOCUS_10020 69987 71279 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_10020 71730 71293 gene locus_tag LOCUS_10030 71730 71293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 71797 72516 gene locus_tag LOCUS_10040 71797 72516 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979052.1 protein_id gnl|my_center|LOCUS_10040 72525 73205 gene locus_tag LOCUS_10050 gene tenA 72525 73205 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979013.1 protein_id gnl|my_center|LOCUS_10050 73255 74559 gene locus_tag LOCUS_10060 73255 74559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763695.1 protein_id gnl|my_center|LOCUS_10060 74607 75365 gene locus_tag LOCUS_10070 74607 75365 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_10070 75491 76972 gene locus_tag LOCUS_10080 gene leuC 75491 76972 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067266.1 protein_id gnl|my_center|LOCUS_10080 76977 77606 gene locus_tag LOCUS_10090 gene leuD 76977 77606 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918084.1 protein_id gnl|my_center|LOCUS_10090 77744 78895 gene locus_tag LOCUS_10100 77744 78895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249078.1 protein_id gnl|my_center|LOCUS_10100 80080 78944 gene locus_tag LOCUS_10110 80080 78944 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_10110 80662 80117 gene locus_tag LOCUS_10120 80662 80117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 80782 81960 gene locus_tag LOCUS_10130 80782 81960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 protein_id gnl|my_center|LOCUS_10130 81957 83135 gene locus_tag LOCUS_10140 81957 83135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 protein_id gnl|my_center|LOCUS_10140 83511 83089 gene locus_tag LOCUS_10150 83511 83089 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249106.1 protein_id gnl|my_center|LOCUS_10150 83983 83702 gene locus_tag LOCUS_10160 83983 83702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 83967 85118 gene locus_tag LOCUS_10170 83967 85118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 85329 86720 gene locus_tag LOCUS_10180 85329 86720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 87576 86731 gene locus_tag LOCUS_10190 gene amrB 87576 86731 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_10190 87805 87569 gene locus_tag LOCUS_10200 87805 87569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 87924 88058 gene locus_tag LOCUS_10210 87924 88058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 88051 88545 gene locus_tag LOCUS_10220 88051 88545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 88795 90201 gene locus_tag LOCUS_10230 gene lysS 88795 90201 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence06 2229 779 gene locus_tag LOCUS_r00020 2229 779 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2521 3432 gene locus_tag LOCUS_10240 2521 3432 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 protein_id gnl|my_center|LOCUS_10240 4072 3458 gene locus_tag LOCUS_10250 4072 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4568 4173 gene locus_tag LOCUS_10260 4568 4173 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_10260 4755 6188 gene locus_tag LOCUS_10270 4755 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6293 6847 gene locus_tag LOCUS_10280 6293 6847 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461318.1 protein_id gnl|my_center|LOCUS_10280 8543 6885 gene locus_tag LOCUS_10290 8543 6885 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 protein_id gnl|my_center|LOCUS_10290 8903 10069 gene locus_tag LOCUS_10300 gene trpE 8903 10069 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10300 10077 10661 gene locus_tag LOCUS_10310 10077 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10705 11952 gene locus_tag LOCUS_10320 gene coaBC 10705 11952 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763051.1 protein_id gnl|my_center|LOCUS_10320 12125 13066 gene locus_tag LOCUS_10330 12125 13066 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763057.1 protein_id gnl|my_center|LOCUS_10330 13404 13081 gene locus_tag LOCUS_10340 13404 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 13566 13964 gene locus_tag LOCUS_10350 13566 13964 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980139.1 protein_id gnl|my_center|LOCUS_10350 15479 13968 gene locus_tag LOCUS_10360 gene bgaS 15479 13968 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_10360 15623 17848 gene locus_tag LOCUS_10370 15623 17848 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_10370 17942 18949 gene locus_tag LOCUS_10380 17942 18949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_10380 18959 19879 gene locus_tag LOCUS_10390 18959 19879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582576.1 protein_id gnl|my_center|LOCUS_10390 19888 20871 gene locus_tag LOCUS_10400 19888 20871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041426669.1 protein_id gnl|my_center|LOCUS_10400 20874 21857 gene locus_tag LOCUS_10410 20874 21857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_10410 22938 21862 gene locus_tag LOCUS_10420 22938 21862 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_10420 23262 23068 gene locus_tag LOCUS_10430 23262 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 23498 23262 gene locus_tag LOCUS_10440 23498 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 23467 24054 gene locus_tag LOCUS_10450 23467 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 25753 24056 gene locus_tag LOCUS_10460 25753 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 26222 25761 gene locus_tag LOCUS_10470 26222 25761 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_10470 26813 26268 gene locus_tag LOCUS_10480 26813 26268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 27521 26877 gene locus_tag LOCUS_10490 27521 26877 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_10490 27662 28093 gene locus_tag LOCUS_10500 27662 28093 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_10500 28090 28281 gene locus_tag LOCUS_10510 28090 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 29516 28287 gene locus_tag LOCUS_10520 29516 28287 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_10520 29642 30115 gene locus_tag LOCUS_10530 29642 30115 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_10530 31671 30112 gene locus_tag LOCUS_10540 gene gapN 31671 30112 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249656.1 protein_id gnl|my_center|LOCUS_10540 31791 32855 gene locus_tag LOCUS_10550 31791 32855 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_10550 32852 33310 gene locus_tag LOCUS_10560 32852 33310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 33363 33671 gene locus_tag LOCUS_10570 33363 33671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 33674 33829 gene locus_tag LOCUS_10580 33674 33829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 34305 33832 gene locus_tag LOCUS_10590 34305 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 34388 35287 gene locus_tag LOCUS_10600 gene tatC 34388 35287 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763345.1 protein_id gnl|my_center|LOCUS_10600 35593 35294 gene locus_tag LOCUS_10610 35593 35294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36293 35568 gene locus_tag LOCUS_10620 36293 35568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 36659 36294 gene locus_tag LOCUS_10630 36659 36294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 37221 36703 gene locus_tag LOCUS_10640 37221 36703 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_10640 37379 38917 gene locus_tag LOCUS_10650 gene glpK 37379 38917 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870283.1 protein_id gnl|my_center|LOCUS_10650 40458 38914 gene locus_tag LOCUS_10660 40458 38914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 40532 40951 gene locus_tag LOCUS_10670 40532 40951 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 protein_id gnl|my_center|LOCUS_10670 40948 41376 gene locus_tag LOCUS_10680 40948 41376 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_10680 41380 41955 gene locus_tag LOCUS_10690 41380 41955 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 protein_id gnl|my_center|LOCUS_10690 41975 42355 gene locus_tag LOCUS_10700 41975 42355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 42434 42688 gene locus_tag LOCUS_10710 42434 42688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 42685 42945 gene locus_tag LOCUS_10720 42685 42945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 42948 43262 gene locus_tag LOCUS_10730 gene nuoK 42948 43262 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_10730 43554 43252 gene locus_tag LOCUS_10740 43554 43252 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147008.1 protein_id gnl|my_center|LOCUS_10740 44671 43640 gene locus_tag LOCUS_10750 44671 43640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_10750 45876 44725 gene locus_tag LOCUS_10760 45876 44725 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867623.1 protein_id gnl|my_center|LOCUS_10760 45979 47862 gene locus_tag LOCUS_10770 45979 47862 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_10770 48646 47873 gene locus_tag LOCUS_10780 48646 47873 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250685.1 protein_id gnl|my_center|LOCUS_10780 49148 48672 gene locus_tag LOCUS_10790 49148 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 50449 49145 gene locus_tag LOCUS_10800 50449 49145 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902768.1 protein_id gnl|my_center|LOCUS_10800 50915 50460 gene locus_tag LOCUS_10810 50915 50460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 51850 50915 gene locus_tag LOCUS_10820 51850 50915 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_10820 52503 51847 gene locus_tag LOCUS_10830 52503 51847 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082367.1 protein_id gnl|my_center|LOCUS_10830 53975 52527 gene locus_tag LOCUS_10840 53975 52527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 54906 53959 gene locus_tag LOCUS_10850 54906 53959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 55029 55481 gene locus_tag LOCUS_10860 55029 55481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 55962 55468 gene locus_tag LOCUS_10870 55962 55468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 56601 56017 gene locus_tag LOCUS_10880 56601 56017 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_10880 56709 56882 gene locus_tag LOCUS_10890 56709 56882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 57330 56893 gene locus_tag LOCUS_10900 57330 56893 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_10900 57421 58719 gene locus_tag LOCUS_10910 gene ahcY 57421 58719 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240285.1 protein_id gnl|my_center|LOCUS_10910 59448 58732 gene locus_tag LOCUS_10920 59448 58732 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_10920 59706 59461 gene locus_tag LOCUS_10930 59706 59461 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_10930 60535 59699 gene locus_tag LOCUS_10940 gene rpl4p 60535 59699 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_10940 61533 60532 gene locus_tag LOCUS_10950 61533 60532 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_10950 61699 62961 gene locus_tag LOCUS_10960 61699 62961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 63967 62921 gene locus_tag LOCUS_10970 gene mtnA 63967 62921 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_10970 64998 64000 gene locus_tag LOCUS_10980 64998 64000 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_10980 66082 64991 gene locus_tag LOCUS_10990 66082 64991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 66314 66075 gene locus_tag LOCUS_11000 66314 66075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 67297 66302 gene locus_tag LOCUS_11010 67297 66302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 67364 68413 gene locus_tag LOCUS_11020 67364 68413 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_11020 70000 68396 gene locus_tag LOCUS_11030 70000 68396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 70087 70659 gene locus_tag LOCUS_11040 70087 70659 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_11040 70693 71808 gene locus_tag LOCUS_11050 70693 71808 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_11050 71883 72647 gene locus_tag LOCUS_11060 71883 72647 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 protein_id gnl|my_center|LOCUS_11060 73916 72648 gene locus_tag LOCUS_11070 73916 72648 CDS product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 protein_id gnl|my_center|LOCUS_11070 74782 73988 gene locus_tag LOCUS_11080 74782 73988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 75002 75223 gene locus_tag LOCUS_11090 gene hpkB 75002 75223 CDS product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 protein_id gnl|my_center|LOCUS_11090 75264 75860 gene locus_tag LOCUS_11100 75264 75860 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763413.1 protein_id gnl|my_center|LOCUS_11100 76741 75869 gene locus_tag LOCUS_11110 76741 75869 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_11110 76901 77863 gene locus_tag LOCUS_11120 76901 77863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 77905 78219 gene locus_tag LOCUS_11130 gene rpsJ 77905 78219 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_11130 79514 78216 gene locus_tag LOCUS_11140 gene tuf 79514 78216 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_11140 80137 79580 gene locus_tag LOCUS_11150 80137 79580 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762409.1 protein_id gnl|my_center|LOCUS_11150 80801 80169 gene locus_tag LOCUS_11160 80801 80169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 80880 82598 gene locus_tag LOCUS_11170 80880 82598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 83872 82595 gene locus_tag LOCUS_11180 83872 82595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 85346 83859 gene locus_tag LOCUS_11190 85346 83859 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence07 378 608 gene locus_tag LOCUS_11200 378 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 608 808 gene locus_tag LOCUS_11210 608 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1524 1129 gene locus_tag LOCUS_11220 gene rpsS 1524 1129 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_11220 2106 1603 gene locus_tag LOCUS_11230 2106 1603 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978465.1 protein_id gnl|my_center|LOCUS_11230 3044 2199 gene locus_tag LOCUS_11240 3044 2199 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_11240 3145 4068 gene locus_tag LOCUS_11250 3145 4068 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_11250 4065 4673 gene locus_tag LOCUS_11260 4065 4673 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_11260 5688 4645 gene locus_tag LOCUS_11270 5688 4645 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227788.1 protein_id gnl|my_center|LOCUS_11270 5802 6833 gene locus_tag LOCUS_11280 gene dph5 5802 6833 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_11280 6827 7330 gene locus_tag LOCUS_11290 6827 7330 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_11290 8588 7293 gene locus_tag LOCUS_11300 8588 7293 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_11300 8641 10065 gene locus_tag LOCUS_11310 8641 10065 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_11310 10159 10335 gene locus_tag LOCUS_11320 10159 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 10847 10494 gene locus_tag LOCUS_11330 10847 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 10943 12193 gene locus_tag LOCUS_11340 10943 12193 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970423.1 protein_id gnl|my_center|LOCUS_11340 12320 13096 gene locus_tag LOCUS_11350 12320 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 13081 13506 gene locus_tag LOCUS_11360 13081 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 14461 13496 gene locus_tag LOCUS_11370 gene mer 14461 13496 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_11370 14730 14458 gene locus_tag LOCUS_11380 14730 14458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 15904 14789 gene locus_tag LOCUS_11390 gene dnaJ 15904 14789 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880419.1 protein_id gnl|my_center|LOCUS_11390 16300 15965 gene locus_tag LOCUS_11400 gene metG 16300 15965 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249194.1 protein_id gnl|my_center|LOCUS_11400 16952 16374 gene locus_tag LOCUS_11410 16952 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 17267 17061 gene locus_tag LOCUS_11420 17267 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 17351 18403 gene locus_tag LOCUS_11430 17351 18403 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_11430 19121 18387 gene locus_tag LOCUS_11440 19121 18387 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_11440 19741 19118 gene locus_tag LOCUS_11450 19741 19118 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_11450 20657 19785 gene locus_tag LOCUS_11460 20657 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 21681 20659 gene locus_tag LOCUS_11470 21681 20659 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_11470 21800 22978 gene locus_tag LOCUS_11480 gene fbp 21800 22978 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762924.1 protein_id gnl|my_center|LOCUS_11480 23800 23033 gene locus_tag LOCUS_11490 23800 23033 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_11490 24043 24903 gene locus_tag LOCUS_11500 24043 24903 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980238.1 protein_id gnl|my_center|LOCUS_11500 24953 25828 gene locus_tag LOCUS_11510 24953 25828 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847022.1 protein_id gnl|my_center|LOCUS_11510 25983 26117 gene locus_tag LOCUS_11520 25983 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 26260 27156 gene locus_tag LOCUS_11530 26260 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 27907 27146 gene locus_tag LOCUS_11540 27907 27146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 28665 28036 gene locus_tag LOCUS_11550 28665 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 28872 29315 gene locus_tag LOCUS_11560 28872 29315 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763410.1 protein_id gnl|my_center|LOCUS_11560 29354 29731 gene locus_tag LOCUS_11570 29354 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 30110 29718 gene locus_tag LOCUS_11580 30110 29718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 31901 30111 gene locus_tag LOCUS_11590 gene dnaK 31901 30111 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_11590 32533 31958 gene locus_tag LOCUS_11600 32533 31958 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_11600 32929 32540 gene locus_tag LOCUS_11610 32929 32540 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_11610 33835 33041 gene locus_tag LOCUS_11620 33835 33041 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240518.1 protein_id gnl|my_center|LOCUS_11620 34305 33874 gene locus_tag LOCUS_11630 34305 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 34541 35473 gene locus_tag LOCUS_11640 34541 35473 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053897.1 protein_id gnl|my_center|LOCUS_11640 35525 35884 gene locus_tag LOCUS_11650 35525 35884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 36189 35881 gene locus_tag LOCUS_11660 gene yciH 36189 35881 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_11660 36949 36254 gene locus_tag LOCUS_11670 36949 36254 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_11670 37142 38236 gene locus_tag LOCUS_11680 37142 38236 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_11680 39018 38233 gene locus_tag LOCUS_11690 gene uppS 39018 38233 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_11690 40159 39011 gene locus_tag LOCUS_11700 40159 39011 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_11700 40358 40699 gene locus_tag LOCUS_11710 40358 40699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 41612 40722 gene locus_tag LOCUS_11720 41612 40722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 42383 41622 gene locus_tag LOCUS_11730 42383 41622 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_11730 44043 42439 gene locus_tag LOCUS_11740 gene guaA 44043 42439 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_11740 44234 45091 gene locus_tag LOCUS_11750 44234 45091 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763234.1 protein_id gnl|my_center|LOCUS_11750 45107 46483 gene locus_tag LOCUS_11760 45107 46483 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_11760 46544 46616 gene locus_tag LOCUS_t00260 46544 46616 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 47462 46620 gene locus_tag LOCUS_11770 47462 46620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 47594 48364 gene locus_tag LOCUS_11780 47594 48364 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868662.1 protein_id gnl|my_center|LOCUS_11780 48451 48723 gene locus_tag LOCUS_11790 gene albA 48451 48723 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869708.1 protein_id gnl|my_center|LOCUS_11790 49016 49285 gene locus_tag LOCUS_11800 49016 49285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 49353 50675 gene locus_tag LOCUS_11810 gene aspS 49353 50675 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_11810 50672 50902 gene locus_tag LOCUS_11820 50672 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 50982 51374 gene locus_tag LOCUS_11830 50982 51374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 51371 52429 gene locus_tag LOCUS_11840 gene nuoH 51371 52429 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564432.1 protein_id gnl|my_center|LOCUS_11840 52784 52434 gene locus_tag LOCUS_11850 52784 52434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 54482 52851 gene locus_tag LOCUS_11860 54482 52851 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_11860 55669 54578 gene locus_tag LOCUS_11870 gene fgd 55669 54578 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907639.1 protein_id gnl|my_center|LOCUS_11870 56653 55730 gene locus_tag LOCUS_11880 56653 55730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 56745 57443 gene locus_tag LOCUS_11890 gene nth 56745 57443 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773154.1 protein_id gnl|my_center|LOCUS_11890 57503 58354 gene locus_tag LOCUS_11900 57503 58354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 59057 58335 gene locus_tag LOCUS_11910 59057 58335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 59126 59467 gene locus_tag LOCUS_11920 59126 59467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 59443 60891 gene locus_tag LOCUS_11930 59443 60891 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 protein_id gnl|my_center|LOCUS_11930 61004 62329 gene locus_tag LOCUS_11940 61004 62329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080510.1 protein_id gnl|my_center|LOCUS_11940 64056 62467 gene locus_tag LOCUS_11950 gene lysS 64056 62467 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_11950 65252 64125 gene locus_tag LOCUS_11960 65252 64125 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_11960 66563 65325 gene locus_tag LOCUS_11970 66563 65325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 67492 66560 gene locus_tag LOCUS_11980 67492 66560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865109.1 protein_id gnl|my_center|LOCUS_11980 70309 67562 gene locus_tag LOCUS_11990 70309 67562 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257097.1 protein_id gnl|my_center|LOCUS_11990 70423 71001 gene locus_tag LOCUS_12000 70423 71001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_12000 71046 72551 gene locus_tag LOCUS_12010 71046 72551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 72606 73493 gene locus_tag LOCUS_12020 gene ilvE 72606 73493 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870521.1 protein_id gnl|my_center|LOCUS_12020 73542 73985 gene locus_tag LOCUS_12030 73542 73985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 74045 74536 gene locus_tag LOCUS_12040 74045 74536 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583265.1 protein_id gnl|my_center|LOCUS_12040 75876 74542 gene locus_tag LOCUS_12050 75876 74542 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146938.1 protein_id gnl|my_center|LOCUS_12050 75970 77595 gene locus_tag LOCUS_12060 75970 77595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 78623 77598 gene locus_tag LOCUS_12070 78623 77598 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_12070 79458 78649 gene locus_tag LOCUS_12080 79458 78649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 79381 79563 gene locus_tag LOCUS_12090 79381 79563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence08 1291 2739 gene locus_tag LOCUS_12100 1291 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2812 3774 gene locus_tag LOCUS_12110 2812 3774 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870568.1 protein_id gnl|my_center|LOCUS_12110 4885 3761 gene locus_tag LOCUS_12120 4885 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 5992 4973 gene locus_tag LOCUS_12130 5992 4973 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_12130 6056 7462 gene locus_tag LOCUS_12140 6056 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7753 7481 gene locus_tag LOCUS_12150 7753 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7938 7756 gene locus_tag LOCUS_12160 7938 7756 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981301.1 protein_id gnl|my_center|LOCUS_12160 9388 8039 gene locus_tag LOCUS_12170 9388 8039 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762726.1 protein_id gnl|my_center|LOCUS_12170 9518 11092 gene locus_tag LOCUS_12180 9518 11092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_12180 11079 12197 gene locus_tag LOCUS_12190 11079 12197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970677.1 protein_id gnl|my_center|LOCUS_12190 12194 13180 gene locus_tag LOCUS_12200 12194 13180 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_12200 14349 13183 gene locus_tag LOCUS_12210 14349 13183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 14771 14424 gene locus_tag LOCUS_12220 14771 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 15404 16165 gene locus_tag LOCUS_12230 15404 16165 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 protein_id gnl|my_center|LOCUS_12230 16631 16158 gene locus_tag LOCUS_12240 16631 16158 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_12240 16763 17059 gene locus_tag LOCUS_12250 16763 17059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 18383 17730 gene locus_tag LOCUS_12260 18383 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 18724 18386 gene locus_tag LOCUS_12270 18724 18386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 18953 19438 gene locus_tag LOCUS_12280 18953 19438 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_12280 19626 19435 gene locus_tag LOCUS_12290 19626 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19707 20375 gene locus_tag LOCUS_12300 19707 20375 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941145.1 protein_id gnl|my_center|LOCUS_12300 20422 20799 gene locus_tag LOCUS_12310 20422 20799 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240467.1 protein_id gnl|my_center|LOCUS_12310 21358 20780 gene locus_tag LOCUS_12320 gene thpR 21358 20780 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_12320 22083 21394 gene locus_tag LOCUS_12330 22083 21394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 22198 22587 gene locus_tag LOCUS_12340 22198 22587 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_12340 23008 22565 gene locus_tag LOCUS_12350 23008 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 23350 23051 gene locus_tag LOCUS_12360 23350 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 23968 23360 gene locus_tag LOCUS_12370 23968 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 24050 24394 gene locus_tag LOCUS_12380 24050 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 26903 24384 gene locus_tag LOCUS_12390 26903 24384 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_12390 26978 27727 gene locus_tag LOCUS_12400 gene sufC 26978 27727 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_12400 28334 27732 gene locus_tag LOCUS_12410 28334 27732 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_12410 28487 29056 gene locus_tag LOCUS_12420 28487 29056 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_12420 30378 29434 gene locus_tag LOCUS_12430 30378 29434 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_12430 30981 30718 gene locus_tag LOCUS_12440 30981 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 31606 33330 gene locus_tag LOCUS_12450 31606 33330 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_12450 33784 33323 gene locus_tag LOCUS_12460 33784 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 33948 34577 gene locus_tag LOCUS_12470 33948 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 34952 34578 gene locus_tag LOCUS_12480 34952 34578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 35079 37223 gene locus_tag LOCUS_12490 35079 37223 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 protein_id gnl|my_center|LOCUS_12490 37996 37220 gene locus_tag LOCUS_12500 37996 37220 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_12500 38121 38966 gene locus_tag LOCUS_12510 38121 38966 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_12510 38992 39666 gene locus_tag LOCUS_12520 38992 39666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 39711 40868 gene locus_tag LOCUS_12530 39711 40868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 42051 40858 gene locus_tag LOCUS_12540 42051 40858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114845.1 protein_id gnl|my_center|LOCUS_12540 44334 42177 gene locus_tag LOCUS_r00030 44334 42177 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 66 percent of the 23S ribosomal RNA >Feature sequence09 880 1887 gene locus_tag LOCUS_12550 880 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879358.1 protein_id gnl|my_center|LOCUS_12550 2303 2378 gene locus_tag LOCUS_t00270 2303 2378 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2732 2418 gene locus_tag LOCUS_12560 2732 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3038 2790 gene locus_tag LOCUS_12570 3038 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3697 3771 gene locus_tag LOCUS_t00280 3697 3771 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4168 3827 gene locus_tag LOCUS_12580 4168 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4272 5480 gene locus_tag LOCUS_12590 4272 5480 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_12590 6452 5484 gene locus_tag LOCUS_12600 6452 5484 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_12600 6584 7726 gene locus_tag LOCUS_12610 gene dinB 6584 7726 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_12610 8278 7682 gene locus_tag LOCUS_12620 8278 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8575 8288 gene locus_tag LOCUS_12630 8575 8288 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_12630 8958 9956 gene locus_tag LOCUS_12640 gene ilvA 8958 9956 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_12640 11141 9972 gene locus_tag LOCUS_12650 11141 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 11641 11138 gene locus_tag LOCUS_12660 11641 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 11880 11644 gene locus_tag LOCUS_12670 11880 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12165 12776 gene locus_tag LOCUS_12680 12165 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 12769 13545 gene locus_tag LOCUS_12690 12769 13545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13648 15549 gene locus_tag LOCUS_12700 13648 15549 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_12700 16869 15574 gene locus_tag LOCUS_12710 16869 15574 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_12710 19599 16936 gene locus_tag LOCUS_12720 19599 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 19862 20632 gene locus_tag LOCUS_12730 19862 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 20724 21221 gene locus_tag LOCUS_12740 20724 21221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 21225 23222 gene locus_tag LOCUS_12750 21225 23222 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762898.1 protein_id gnl|my_center|LOCUS_12750 23229 25376 gene locus_tag LOCUS_12760 23229 25376 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762897.1 protein_id gnl|my_center|LOCUS_12760 26300 25365 gene locus_tag LOCUS_12770 26300 25365 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_12770 27214 26297 gene locus_tag LOCUS_12780 27214 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 27288 28022 gene locus_tag LOCUS_12790 27288 28022 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763052.1 protein_id gnl|my_center|LOCUS_12790 28076 28561 gene locus_tag LOCUS_12800 28076 28561 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_12800 29624 28566 gene locus_tag LOCUS_12810 gene twy1 29624 28566 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_12810 29737 31131 gene locus_tag LOCUS_12820 29737 31131 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_12820 32375 31149 gene locus_tag LOCUS_12830 gene priS 32375 31149 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 protein_id gnl|my_center|LOCUS_12830 33053 32430 gene locus_tag LOCUS_12840 33053 32430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 33177 33461 gene locus_tag LOCUS_12850 33177 33461 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259328.1 protein_id gnl|my_center|LOCUS_12850 33553 34695 gene locus_tag LOCUS_12860 gene moeB 33553 34695 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_12860 36596 34857 gene locus_tag LOCUS_12870 36596 34857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 37650 36682 gene locus_tag LOCUS_12880 37650 36682 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_12880 37867 38874 gene locus_tag LOCUS_12890 37867 38874 CDS product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582609.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence10 1420 1256 gene locus_tag LOCUS_12900 1420 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2160 1423 gene locus_tag LOCUS_12910 2160 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2306 2157 gene locus_tag LOCUS_12920 2306 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2348 3058 gene locus_tag LOCUS_12930 2348 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 4310 3753 gene locus_tag LOCUS_12940 4310 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4721 4467 gene locus_tag LOCUS_12950 4721 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12950 5577 5260 gene locus_tag LOCUS_12960 5577 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5708 7015 gene locus_tag LOCUS_12970 5708 7015 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391605.1 protein_id gnl|my_center|LOCUS_12970 7053 7913 gene locus_tag LOCUS_12980 7053 7913 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 protein_id gnl|my_center|LOCUS_12980 8285 8770 gene locus_tag LOCUS_12990 8285 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 9926 8883 gene locus_tag LOCUS_13000 9926 8883 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 protein_id gnl|my_center|LOCUS_13000 10036 11580 gene locus_tag LOCUS_13010 10036 11580 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525578.1 protein_id gnl|my_center|LOCUS_13010 11628 12494 gene locus_tag LOCUS_13020 11628 12494 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_13020 12502 13323 gene locus_tag LOCUS_13030 12502 13323 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_13030 13414 14211 gene locus_tag LOCUS_13040 13414 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 14684 14232 gene locus_tag LOCUS_13050 14684 14232 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 protein_id gnl|my_center|LOCUS_13050 15038 15976 gene locus_tag LOCUS_13060 gene argE 15038 15976 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967970.1 protein_id gnl|my_center|LOCUS_13060 16190 16459 gene locus_tag LOCUS_13070 16190 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 16713 17417 gene locus_tag LOCUS_13080 16713 17417 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249791.1 protein_id gnl|my_center|LOCUS_13080 17419 17973 gene locus_tag LOCUS_13090 17419 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 18135 18737 gene locus_tag LOCUS_13100 18135 18737 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762237.1 protein_id gnl|my_center|LOCUS_13100 19830 18763 gene locus_tag LOCUS_13110 19830 18763 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_13110 20597 19878 gene locus_tag LOCUS_13120 gene alaXM 20597 19878 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_13120 20697 21104 gene locus_tag LOCUS_13130 20697 21104 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250901.1 protein_id gnl|my_center|LOCUS_13130 21186 21599 gene locus_tag LOCUS_13140 21186 21599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 22606 21560 gene locus_tag LOCUS_13150 22606 21560 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220209699.1 protein_id gnl|my_center|LOCUS_13150 22768 23703 gene locus_tag LOCUS_13160 22768 23703 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970360.1 protein_id gnl|my_center|LOCUS_13160 23703 24455 gene locus_tag LOCUS_13170 23703 24455 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_13170 24458 25291 gene locus_tag LOCUS_13180 24458 25291 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_13180 25332 25784 gene locus_tag LOCUS_13190 25332 25784 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_13190 26719 25799 gene locus_tag LOCUS_13200 26719 25799 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 protein_id gnl|my_center|LOCUS_13200 28570 26768 gene locus_tag LOCUS_13210 gene infB 28570 26768 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_13210 28657 29442 gene locus_tag LOCUS_13220 28657 29442 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence11 217 1077 gene locus_tag LOCUS_13230 217 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1567 1130 gene locus_tag LOCUS_13240 1567 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1642 2457 gene locus_tag LOCUS_13250 1642 2457 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860293.1 protein_id gnl|my_center|LOCUS_13250 3338 2439 gene locus_tag LOCUS_13260 3338 2439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879344.1 protein_id gnl|my_center|LOCUS_13260 3401 4330 gene locus_tag LOCUS_13270 gene mdh 3401 4330 CDS product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_13270 5738 4221 gene locus_tag LOCUS_13280 5738 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6773 5856 gene locus_tag LOCUS_13290 6773 5856 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_13290 6959 8038 gene locus_tag LOCUS_13300 6959 8038 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_13300 8930 8040 gene locus_tag LOCUS_13310 gene sucD 8930 8040 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_13310 9664 8960 gene locus_tag LOCUS_13320 9664 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10602 9661 gene locus_tag LOCUS_13330 10602 9661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_13330 10685 11191 gene locus_tag LOCUS_13340 gene tfe 10685 11191 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 protein_id gnl|my_center|LOCUS_13340 11197 11751 gene locus_tag LOCUS_13350 11197 11751 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870902.1 protein_id gnl|my_center|LOCUS_13350 11774 11846 gene locus_tag LOCUS_t00290 11774 11846 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11897 12349 gene locus_tag LOCUS_13360 11897 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 12901 12344 gene locus_tag LOCUS_13370 12901 12344 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762014.1 protein_id gnl|my_center|LOCUS_13370 13019 13294 gene locus_tag LOCUS_13380 13019 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 13255 13677 gene locus_tag LOCUS_13390 13255 13677 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_13390 13747 14085 gene locus_tag LOCUS_13400 13747 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 15260 14112 gene locus_tag LOCUS_13410 15260 14112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_13410 16204 15329 gene locus_tag LOCUS_13420 16204 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 17592 16738 gene locus_tag LOCUS_13430 17592 16738 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404004.1 protein_id gnl|my_center|LOCUS_13430 17766 19127 gene locus_tag LOCUS_13440 17766 19127 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence12 <1 1083 gene locus_tag LOCUS_13450 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250726.1:ABC transporter ATP-binding protein 2473 1088 gene locus_tag LOCUS_13460 gene aspC 2473 1088 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080007.1 protein_id gnl|my_center|LOCUS_13460 3586 2483 gene locus_tag LOCUS_13470 gene aroC 3586 2483 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_13470 4854 3583 gene locus_tag LOCUS_13480 gene aroA 4854 3583 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_13480 5690 4851 gene locus_tag LOCUS_13490 5690 4851 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_13490 6382 5669 gene locus_tag LOCUS_13500 gene aroD 6382 5669 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_13500 7370 6372 gene locus_tag LOCUS_13510 7370 6372 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_13510 8164 7367 gene locus_tag LOCUS_13520 8164 7367 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869899.1 protein_id gnl|my_center|LOCUS_13520 9222 8170 gene locus_tag LOCUS_13530 gene asd 9222 8170 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_13530 9427 10287 gene locus_tag LOCUS_13540 9427 10287 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_13540 10284 10664 gene locus_tag LOCUS_13550 gene pth2 10284 10664 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_13550 10751 12775 gene locus_tag LOCUS_13560 gene acs 10751 12775 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 protein_id gnl|my_center|LOCUS_13560 13916 12783 gene locus_tag LOCUS_13570 gene pepQ 13916 12783 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_13570 14057 15081 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctctttgtgaggttc >Feature sequence13 122 997 gene locus_tag LOCUS_13580 122 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761944.1 protein_id gnl|my_center|LOCUS_13580 1119 2216 gene locus_tag LOCUS_13590 1119 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2250 3623 gene locus_tag LOCUS_13600 2250 3623 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_13600 3693 4805 gene locus_tag LOCUS_13610 3693 4805 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311004.1 protein_id gnl|my_center|LOCUS_13610 4947 5393 gene locus_tag LOCUS_13620 gene gcvH 4947 5393 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_13620 5400 5735 gene locus_tag LOCUS_13630 5400 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5759 5908 gene locus_tag LOCUS_13640 5759 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 7622 5895 gene locus_tag LOCUS_13650 7622 5895 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_13650 8826 7609 gene locus_tag LOCUS_13660 8826 7609 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_13660 8996 10018 gene locus_tag LOCUS_13670 8996 10018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082485.1 protein_id gnl|my_center|LOCUS_13670 10022 10876 gene locus_tag LOCUS_13680 10022 10876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582630.1 protein_id gnl|my_center|LOCUS_13680 10878 11864 gene locus_tag LOCUS_13690 10878 11864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082481.1 protein_id gnl|my_center|LOCUS_13690 11866 12657 gene locus_tag LOCUS_13700 11866 12657 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582632.1 protein_id gnl|my_center|LOCUS_13700 12664 12870 gene locus_tag LOCUS_13710 12664 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence14 504 896 gene locus_tag LOCUS_13720 504 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 901 1647 gene locus_tag LOCUS_13730 gene csx7 901 1647 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977938.1 protein_id gnl|my_center|LOCUS_13730 1644 2591 gene locus_tag LOCUS_13740 gene csx7 1644 2591 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977939.1 protein_id gnl|my_center|LOCUS_13740 2641 3588 gene locus_tag LOCUS_13750 2641 3588 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977941.1 protein_id gnl|my_center|LOCUS_13750 3581 6295 gene locus_tag LOCUS_13760 3581 6295 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977942.1 protein_id gnl|my_center|LOCUS_13760 6292 6924 gene locus_tag LOCUS_13770 6292 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6905 7966 gene locus_tag LOCUS_13780 6905 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7969 8910 gene locus_tag LOCUS_13790 7969 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8900 9118 gene locus_tag LOCUS_13800 8900 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 9085 10092 gene locus_tag LOCUS_13810 9085 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11233 10556 gene locus_tag LOCUS_13820 11233 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12065 11562 gene locus_tag LOCUS_13830 12065 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence15 <1 1565 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaacctcacaaagaggattgaaag 2882 1749 gene locus_tag LOCUS_13840 2882 1749 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763090.1 protein_id gnl|my_center|LOCUS_13840 4453 2879 gene locus_tag LOCUS_13850 4453 2879 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763089.1 protein_id gnl|my_center|LOCUS_13850 4651 4729 gene locus_tag LOCUS_t00300 4651 4729 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4917 6146 gene locus_tag LOCUS_13860 4917 6146 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_13860 6361 7713 gene locus_tag LOCUS_13870 6361 7713 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_13870 7688 9019 gene locus_tag LOCUS_13880 7688 9019 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_13880 9098 9394 gene locus_tag LOCUS_13890 9098 9394 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_13890 9404 9778 gene locus_tag LOCUS_13900 9404 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 9771 10373 gene locus_tag LOCUS_13910 9771 10373 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence16 1799 519 gene locus_tag LOCUS_13920 gene serS 1799 519 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_13920 2376 1855 gene locus_tag LOCUS_13930 2376 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3314 2529 gene locus_tag LOCUS_13940 3314 2529 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867969.1 protein_id gnl|my_center|LOCUS_13940 3707 3552 gene locus_tag LOCUS_13950 3707 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5451 3850 gene locus_tag LOCUS_13960 5451 3850 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_13960 5588 6091 gene locus_tag LOCUS_13970 gene rimI 5588 6091 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_13970 6411 6088 gene locus_tag LOCUS_13980 6411 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 7172 6459 gene locus_tag LOCUS_13990 7172 6459 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_13990 8686 7217 gene locus_tag LOCUS_14000 gene cysS 8686 7217 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence17 <1 957 gene locus_tag LOCUS_14010 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249665.1:ferrous iron transport protein B note possible pseudo, frameshifted 966 1952 gene locus_tag LOCUS_14020 966 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 2180 3073 gene locus_tag LOCUS_14030 2180 3073 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870499.1 protein_id gnl|my_center|LOCUS_14030 3179 4015 gene locus_tag LOCUS_14040 3179 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4038 4979 gene locus_tag LOCUS_14050 4038 4979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980522.1 protein_id gnl|my_center|LOCUS_14050 4966 5808 gene locus_tag LOCUS_14060 4966 5808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980523.1 protein_id gnl|my_center|LOCUS_14060 5873 6832 gene locus_tag LOCUS_14070 5873 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7865 6837 gene locus_tag LOCUS_14080 7865 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence18 327 1367 gene locus_tag LOCUS_14090 327 1367 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_14090 1386 1931 gene locus_tag LOCUS_14100 1386 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1986 2315 gene locus_tag LOCUS_14110 1986 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 3020 2304 gene locus_tag LOCUS_14120 3020 2304 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023041.1 protein_id gnl|my_center|LOCUS_14120 4282 3011 gene locus_tag LOCUS_14130 gene gdhA 4282 3011 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_14130 5422 4310 gene locus_tag LOCUS_14140 5422 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5506 6120 gene locus_tag LOCUS_14150 5506 6120 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762550.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence19 2054 471 gene locus_tag LOCUS_14160 2054 471 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_14160 3145 2054 gene locus_tag LOCUS_14170 3145 2054 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_14170 3376 4743 gene locus_tag LOCUS_14180 gene codB 3376 4743 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084659.1 protein_id gnl|my_center|LOCUS_14180 4750 5148 gene locus_tag LOCUS_14190 4750 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5333 5890 gene locus_tag LOCUS_14200 5333 5890 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_14200 <6605 5892 gene locus_tag LOCUS_14210 <6605 5892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024146.1:isocitrate/isopropylmalate dehydrogenase family protein >Feature sequence20 <1 539 gene locus_tag LOCUS_14220 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546835.1:anthranilate phosphoribosyltransferase 520 1311 gene locus_tag LOCUS_14230 gene trpC 520 1311 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979246.1 protein_id gnl|my_center|LOCUS_14230 1311 1943 gene locus_tag LOCUS_14240 1311 1943 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_14240 1936 3138 gene locus_tag LOCUS_14250 gene trpB 1936 3138 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_14250 3135 3941 gene locus_tag LOCUS_14260 gene trpA 3135 3941 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_14260 4429 3944 gene locus_tag LOCUS_14270 4429 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4468 5391 gene locus_tag LOCUS_14280 4468 5391 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491187.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence21 <1 780 gene locus_tag LOCUS_14290 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868848.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase 926 1945 gene locus_tag LOCUS_14300 926 1945 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_14300 1956 2972 gene locus_tag LOCUS_14310 1956 2972 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_14310 3735 3205 gene locus_tag LOCUS_14320 3735 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence22 <1 618 gene locus_tag LOCUS_14330 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023106.1:Glu/Leu/Phe/Val dehydrogenase 851 928 gene locus_tag LOCUS_t00310 851 928 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2228 1059 gene locus_tag LOCUS_14340 2228 1059 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_14340 2361 3632 gene locus_tag LOCUS_14350 2361 3632 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989646.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence23 960 1259 gene locus_tag LOCUS_14360 960 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1545 1342 gene locus_tag LOCUS_14370 1545 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1882 1595 gene locus_tag LOCUS_14380 1882 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2144 1872 gene locus_tag LOCUS_14390 2144 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2234 2620 gene locus_tag LOCUS_14400 2234 2620 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173512.1 protein_id gnl|my_center|LOCUS_14400 2948 2631 gene locus_tag LOCUS_14410 2948 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3475 2984 gene locus_tag LOCUS_14420 3475 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence24 1950 1276 gene locus_tag LOCUS_14430 1950 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2854 1967 gene locus_tag LOCUS_14440 2854 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3478 2978 gene locus_tag LOCUS_14450 3478 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence25 445 519 gene locus_tag LOCUS_t00320 445 519 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 936 754 gene locus_tag LOCUS_14460 936 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1855 1004 gene locus_tag LOCUS_14470 1855 1004 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_14470 1946 2944 gene locus_tag LOCUS_14480 gene fgd 1946 2944 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence26 1306 293 gene locus_tag LOCUS_14490 gene iolG 1306 293 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence27 981 493 gene locus_tag LOCUS_14500 981 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2151 1015 gene locus_tag LOCUS_14510 2151 1015 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762312.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence28 1227 310 gene locus_tag LOCUS_14520 1227 310 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_14520 2405 1224 gene locus_tag LOCUS_14530 2405 1224 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_14530 2646 2398 gene locus_tag LOCUS_14540 2646 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence29 2260 1121 gene locus_tag LOCUS_14550 2260 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence30 175 1113 gene locus_tag LOCUS_14560 175 1113 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_14560 1635 1123 gene locus_tag LOCUS_14570 1635 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 <2224 1642 gene locus_tag LOCUS_14580 <2224 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003692227.1:SCO family protein >Feature sequence31 403 618 gene locus_tag LOCUS_14590 403 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1584 628 gene locus_tag LOCUS_14600 1584 628 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_14600 1744 1589 gene locus_tag LOCUS_14610 1744 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence32 1216 164 gene locus_tag LOCUS_14620 1216 164 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240229.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence33 <1 606 gene locus_tag LOCUS_14630 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250187.1:ATP-binding protein 987 709 gene locus_tag LOCUS_14640 987 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence34 1209 613 gene locus_tag LOCUS_14650 1209 613 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022833.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence35