>Feature sequence001 1059 25 gene locus_tag LOCUS_00010 1059 25 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_00010 2042 1287 gene locus_tag LOCUS_00020 2042 1287 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00020 2868 2068 gene locus_tag LOCUS_00030 2868 2068 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_00030 4408 3071 gene locus_tag LOCUS_00040 gene mtaB 4408 3071 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_00040 5483 4578 gene locus_tag LOCUS_00050 5483 4578 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_00050 6918 5587 gene locus_tag LOCUS_00060 6918 5587 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_00060 7187 8473 gene locus_tag LOCUS_00070 7187 8473 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_00070 8525 8600 gene locus_tag LOCUS_t00010 8525 8600 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8752 9405 gene locus_tag LOCUS_00080 8752 9405 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_00080 9730 9482 gene locus_tag LOCUS_00090 9730 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_00090 11193 9835 gene locus_tag LOCUS_00100 11193 9835 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_00100 12562 11183 gene locus_tag LOCUS_00110 12562 11183 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_00110 12812 14062 gene locus_tag LOCUS_00120 12812 14062 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_00120 14067 16415 gene locus_tag LOCUS_00130 14067 16415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_00130 16434 17117 gene locus_tag LOCUS_00140 16434 17117 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_00140 17172 19610 gene locus_tag LOCUS_00150 17172 19610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_00150 19639 19929 gene locus_tag LOCUS_00160 19639 19929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20004 21248 gene locus_tag LOCUS_00170 20004 21248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21595 31131 gene locus_tag LOCUS_00180 21595 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 31166 32227 gene locus_tag LOCUS_00190 31166 32227 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_00190 32307 33668 gene locus_tag LOCUS_00200 32307 33668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_00200 33665 34717 gene locus_tag LOCUS_00210 33665 34717 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 693 109 gene locus_tag LOCUS_00220 693 109 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_00220 2524 899 gene locus_tag LOCUS_00230 2524 899 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_00230 3760 2963 gene locus_tag LOCUS_00240 3760 2963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_00240 4364 3768 gene locus_tag LOCUS_00250 4364 3768 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_00250 4682 7162 gene locus_tag LOCUS_00260 4682 7162 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_00260 7819 7595 gene locus_tag LOCUS_00270 7819 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 7967 9880 gene locus_tag LOCUS_00280 gene acs 7967 9880 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_00280 9999 10754 gene locus_tag LOCUS_00290 9999 10754 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_00290 10924 11364 gene locus_tag LOCUS_00300 10924 11364 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_00300 11605 15747 gene locus_tag LOCUS_00310 11605 15747 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_00310 16325 19444 gene locus_tag LOCUS_00320 16325 19444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_00320 19457 21079 gene locus_tag LOCUS_00330 19457 21079 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_00330 21108 22043 gene locus_tag LOCUS_00340 21108 22043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 22344 23618 gene locus_tag LOCUS_00350 22344 23618 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_00350 24027 27041 gene locus_tag LOCUS_00360 24027 27041 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108783.1 protein_id gnl|my_center|LOCUS_00360 28544 27234 gene locus_tag LOCUS_00370 28544 27234 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_00370 28992 29459 gene locus_tag LOCUS_00380 28992 29459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 29663 31288 gene locus_tag LOCUS_00390 29663 31288 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_00390 31498 32094 gene locus_tag LOCUS_00400 gene satP 31498 32094 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence003 5127 781 gene locus_tag LOCUS_00410 5127 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 6209 5373 gene locus_tag LOCUS_00420 gene prmA 6209 5373 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_00420 7272 6505 gene locus_tag LOCUS_00430 gene tpiA 7272 6505 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_00430 8507 7269 gene locus_tag LOCUS_00440 8507 7269 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_00440 8997 8521 gene locus_tag LOCUS_00450 8997 8521 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_00450 9204 10037 gene locus_tag LOCUS_00460 gene folP 9204 10037 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_00460 10089 10880 gene locus_tag LOCUS_00470 gene cdaA 10089 10880 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_00470 11244 11828 gene locus_tag LOCUS_00480 11244 11828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 11988 14537 gene locus_tag LOCUS_00490 11988 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 14534 15922 gene locus_tag LOCUS_00500 14534 15922 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_00500 16390 16815 gene locus_tag LOCUS_00510 16390 16815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 16976 17164 gene locus_tag LOCUS_00520 16976 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 17350 22119 gene locus_tag LOCUS_00530 17350 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 22121 23140 gene locus_tag LOCUS_00540 22121 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 23253 23831 gene locus_tag LOCUS_00550 23253 23831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 23849 24271 gene locus_tag LOCUS_00560 23849 24271 CDS product curli assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_00560 24358 25758 gene locus_tag LOCUS_00570 24358 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 26122 27753 gene locus_tag LOCUS_00580 26122 27753 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence004 <1 3081 gene locus_tag LOCUS_00590 <1 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107855.1:SusC/RagA family TonB-linked outer membrane protein 3138 4508 gene locus_tag LOCUS_00600 3138 4508 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_00600 4586 5449 gene locus_tag LOCUS_00610 4586 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6508 6161 gene locus_tag LOCUS_00620 6508 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7132 6941 gene locus_tag LOCUS_00630 7132 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7349 8893 gene locus_tag LOCUS_00640 7349 8893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 9032 9406 gene locus_tag LOCUS_00650 9032 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 9944 11338 gene locus_tag LOCUS_00660 9944 11338 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_00660 11539 12012 gene locus_tag LOCUS_00670 11539 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 12239 12643 gene locus_tag LOCUS_00680 12239 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 13713 14651 gene locus_tag LOCUS_00690 13713 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 14660 15295 gene locus_tag LOCUS_00700 14660 15295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15279 16334 gene locus_tag LOCUS_00710 15279 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 17197 19170 gene locus_tag LOCUS_00720 17197 19170 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_00720 19548 22319 gene locus_tag LOCUS_00730 19548 22319 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_00730 22443 23723 gene locus_tag LOCUS_00740 22443 23723 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_00740 23745 24701 gene locus_tag LOCUS_00750 gene trxB 23745 24701 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_00750 24899 26014 gene locus_tag LOCUS_00760 24899 26014 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_00760 26344 27804 gene locus_tag LOCUS_00770 26344 27804 CDS product IS66-like element ISBf10 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312011.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence005 1112 762 gene locus_tag LOCUS_00780 1112 762 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070868.1 protein_id gnl|my_center|LOCUS_00780 3144 1690 gene locus_tag LOCUS_00790 3144 1690 CDS product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 protein_id gnl|my_center|LOCUS_00790 3723 4826 gene locus_tag LOCUS_00800 3723 4826 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_00800 4823 5989 gene locus_tag LOCUS_00810 4823 5989 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_00810 5992 6813 gene locus_tag LOCUS_00820 5992 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 7992 7255 gene locus_tag LOCUS_00830 7992 7255 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678739.1 protein_id gnl|my_center|LOCUS_00830 8602 9615 gene locus_tag LOCUS_00840 8602 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 10825 12525 gene locus_tag LOCUS_00850 10825 12525 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_00850 12582 14123 gene locus_tag LOCUS_00860 12582 14123 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_00860 14206 15693 gene locus_tag LOCUS_00870 14206 15693 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_00870 15696 16208 gene locus_tag LOCUS_00880 15696 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 17345 16293 gene locus_tag LOCUS_00890 17345 16293 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_00890 19453 17411 gene locus_tag LOCUS_00900 19453 17411 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_00900 20688 19537 gene locus_tag LOCUS_00910 20688 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 21957 20818 gene locus_tag LOCUS_00920 21957 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 23217 22048 gene locus_tag LOCUS_00930 23217 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 24875 24255 gene locus_tag LOCUS_00940 24875 24255 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_00940 27171 25021 gene locus_tag LOCUS_00950 27171 25021 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence006 3158 39 gene locus_tag LOCUS_00960 3158 39 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036923.1 protein_id gnl|my_center|LOCUS_00960 4375 3383 gene locus_tag LOCUS_00970 4375 3383 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303128.1 protein_id gnl|my_center|LOCUS_00970 6298 4919 gene locus_tag LOCUS_00980 6298 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118384.1 protein_id gnl|my_center|LOCUS_00980 9987 6850 gene locus_tag LOCUS_00990 9987 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 11840 10284 gene locus_tag LOCUS_01000 11840 10284 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_01000 14134 11939 gene locus_tag LOCUS_01010 14134 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 15171 14191 gene locus_tag LOCUS_01020 15171 14191 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_01020 16036 15488 gene locus_tag LOCUS_01030 16036 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 18147 16993 gene locus_tag LOCUS_01040 gene yiaY 18147 16993 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482586.1 protein_id gnl|my_center|LOCUS_01040 18964 18176 gene locus_tag LOCUS_01050 gene rhaD 18964 18176 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_01050 20288 18999 gene locus_tag LOCUS_01060 20288 18999 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_01060 21813 20344 gene locus_tag LOCUS_01070 gene fucK 21813 20344 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808360.1 protein_id gnl|my_center|LOCUS_01070 23677 21890 gene locus_tag LOCUS_01080 gene fucI 23677 21890 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_01080 23731 24705 gene locus_tag LOCUS_01090 23731 24705 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_01090 26005 25154 gene locus_tag LOCUS_01100 26005 25154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 <27674 26009 gene locus_tag LOCUS_01110 <27674 26009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:TonB-dependent receptor >Feature sequence007 116 1921 gene locus_tag LOCUS_01120 gene rpsA 116 1921 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_01120 1940 2299 gene locus_tag LOCUS_01130 1940 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2303 3229 gene locus_tag LOCUS_01140 2303 3229 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_01140 3343 4590 gene locus_tag LOCUS_01150 3343 4590 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_01150 5443 4643 gene locus_tag LOCUS_01160 5443 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 5874 7406 gene locus_tag LOCUS_01170 gene guaA 5874 7406 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_01170 8405 7668 gene locus_tag LOCUS_01180 8405 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 8512 10125 gene locus_tag LOCUS_01190 8512 10125 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_01190 10525 11697 gene locus_tag LOCUS_01200 10525 11697 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_01200 11785 12324 gene locus_tag LOCUS_01210 11785 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 12343 12723 gene locus_tag LOCUS_01220 12343 12723 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_01220 15849 12784 gene locus_tag LOCUS_01230 15849 12784 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_01230 16325 15906 gene locus_tag LOCUS_01240 16325 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 17277 16345 gene locus_tag LOCUS_01250 17277 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 17526 19682 gene locus_tag LOCUS_01260 17526 19682 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_01260 19738 21069 gene locus_tag LOCUS_01270 19738 21069 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_01270 21274 21885 gene locus_tag LOCUS_01280 21274 21885 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_01280 21922 23112 gene locus_tag LOCUS_01290 21922 23112 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766892.1 protein_id gnl|my_center|LOCUS_01290 23217 26393 gene locus_tag LOCUS_01300 23217 26393 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057218.1 protein_id gnl|my_center|LOCUS_01300 26674 27375 gene locus_tag LOCUS_01310 26674 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence008 1258 116 gene locus_tag LOCUS_01320 1258 116 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_01320 1574 2116 gene locus_tag LOCUS_01330 1574 2116 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268649.1 protein_id gnl|my_center|LOCUS_01330 2113 5085 gene locus_tag LOCUS_01340 2113 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 5407 7773 gene locus_tag LOCUS_01350 5407 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 7794 9998 gene locus_tag LOCUS_01360 7794 9998 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_01360 10193 11179 gene locus_tag LOCUS_01370 10193 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 12375 11218 gene locus_tag LOCUS_01380 gene lysA 12375 11218 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_01380 13719 12406 gene locus_tag LOCUS_01390 13719 12406 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_01390 14561 14217 gene locus_tag LOCUS_01400 14561 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15041 14688 gene locus_tag LOCUS_01410 15041 14688 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_01410 15961 15056 gene locus_tag LOCUS_01420 15961 15056 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_01420 16055 16729 gene locus_tag LOCUS_01430 16055 16729 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294671.1 protein_id gnl|my_center|LOCUS_01430 16759 17910 gene locus_tag LOCUS_01440 16759 17910 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_01440 19898 17988 gene locus_tag LOCUS_01450 19898 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 21969 19993 gene locus_tag LOCUS_01460 21969 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 22736 22134 gene locus_tag LOCUS_01470 22736 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 23483 22821 gene locus_tag LOCUS_01480 23483 22821 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_01480 23878 23495 gene locus_tag LOCUS_01490 23878 23495 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762354.1 protein_id gnl|my_center|LOCUS_01490 24145 25317 gene locus_tag LOCUS_01500 24145 25317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 25333 26634 gene locus_tag LOCUS_01510 25333 26634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence009 2289 3848 gene locus_tag LOCUS_01520 2289 3848 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_01520 3869 4285 gene locus_tag LOCUS_01530 gene tsaE 3869 4285 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_01530 4638 5861 gene locus_tag LOCUS_01540 4638 5861 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_01540 6987 6136 gene locus_tag LOCUS_01550 6987 6136 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132563.1 protein_id gnl|my_center|LOCUS_01550 10395 7159 gene locus_tag LOCUS_01560 10395 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_01560 10783 11982 gene locus_tag LOCUS_01570 10783 11982 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_01570 12350 14902 gene locus_tag LOCUS_01580 12350 14902 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_01580 15284 15697 gene locus_tag LOCUS_01590 15284 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 15777 17309 gene locus_tag LOCUS_01600 gene gltX 15777 17309 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_01600 18331 20019 gene locus_tag LOCUS_01610 18331 20019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 23071 20081 gene locus_tag LOCUS_01620 gene infB 23071 20081 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_01620 24373 23141 gene locus_tag LOCUS_01630 gene nusA 24373 23141 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_01630 24858 24394 gene locus_tag LOCUS_01640 gene rimP 24858 24394 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_01640 25478 26731 gene locus_tag LOCUS_01650 25478 26731 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence010 1023 2267 gene locus_tag LOCUS_01660 1023 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2424 4487 gene locus_tag LOCUS_01670 2424 4487 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_01670 4773 5327 gene locus_tag LOCUS_01680 4773 5327 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_01680 5394 5783 gene locus_tag LOCUS_01690 5394 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5794 6273 gene locus_tag LOCUS_01700 5794 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_01700 7693 6332 gene locus_tag LOCUS_01710 gene hisS 7693 6332 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_01710 8531 8178 gene locus_tag LOCUS_01720 8531 8178 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_01720 10300 8612 gene locus_tag LOCUS_01730 gene ettA 10300 8612 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_01730 10509 11024 gene locus_tag LOCUS_01740 10509 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 12459 11176 gene locus_tag LOCUS_01750 gene eno 12459 11176 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_01750 13201 12662 gene locus_tag LOCUS_01760 gene rplQ 13201 12662 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_01760 14200 13208 gene locus_tag LOCUS_01770 14200 13208 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_01770 14830 14222 gene locus_tag LOCUS_01780 gene rpsD 14830 14222 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_01780 15365 14976 gene locus_tag LOCUS_01790 gene rpsK 15365 14976 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_01790 15753 15376 gene locus_tag LOCUS_01800 gene rpsM 15753 15376 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_01800 16173 15919 gene locus_tag LOCUS_01810 gene infA 16173 15919 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_01810 16924 16163 gene locus_tag LOCUS_01820 gene map 16924 16163 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_01820 18289 16946 gene locus_tag LOCUS_01830 gene secY 18289 16946 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_01830 18745 18299 gene locus_tag LOCUS_01840 gene rplO 18745 18299 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_01840 18951 18775 gene locus_tag LOCUS_01850 gene rpmD 18951 18775 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_01850 19475 18963 gene locus_tag LOCUS_01860 gene rpsE 19475 18963 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_01860 19837 19481 gene locus_tag LOCUS_01870 gene rplR 19837 19481 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_01870 20410 19856 gene locus_tag LOCUS_01880 gene rplF 20410 19856 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_01880 20822 20427 gene locus_tag LOCUS_01890 gene rpsH 20822 20427 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_01890 21163 20894 gene locus_tag LOCUS_01900 gene rpsN 21163 20894 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_01900 21722 21168 gene locus_tag LOCUS_01910 gene rplE 21722 21168 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675434.1 protein_id gnl|my_center|LOCUS_01910 22039 21722 gene locus_tag LOCUS_01920 gene rplX 22039 21722 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_01920 22424 22059 gene locus_tag LOCUS_01930 gene rplN 22424 22059 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_01930 22681 22427 gene locus_tag LOCUS_01940 gene rpsQ 22681 22427 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_01940 22886 22689 gene locus_tag LOCUS_01950 gene rpmC 22886 22689 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_01950 23320 22889 gene locus_tag LOCUS_01960 gene rplP 23320 22889 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_01960 24057 23347 gene locus_tag LOCUS_01970 gene rpsC 24057 23347 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_01970 24476 24063 gene locus_tag LOCUS_01980 gene rplV 24476 24063 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_01980 24783 24514 gene locus_tag LOCUS_01990 gene rpsS 24783 24514 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_01990 25627 24803 gene locus_tag LOCUS_02000 gene rplB 25627 24803 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765427.1 protein_id gnl|my_center|LOCUS_02000 25925 25635 gene locus_tag LOCUS_02010 gene rplW 25925 25635 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_02010 26569 25937 gene locus_tag LOCUS_02020 gene rplD 26569 25937 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_02020 27186 26569 gene locus_tag LOCUS_02030 gene rplC 27186 26569 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence011 384 1856 gene locus_tag LOCUS_02040 384 1856 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787973.1 protein_id gnl|my_center|LOCUS_02040 1860 2390 gene locus_tag LOCUS_02050 1860 2390 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478713.1 protein_id gnl|my_center|LOCUS_02050 3071 2403 gene locus_tag LOCUS_02060 3071 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4020 3061 gene locus_tag LOCUS_02070 4020 3061 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767537.1 protein_id gnl|my_center|LOCUS_02070 4658 4032 gene locus_tag LOCUS_02080 4658 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5405 5788 gene locus_tag LOCUS_02090 5405 5788 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_02090 6413 5835 gene locus_tag LOCUS_02100 6413 5835 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202425.1 protein_id gnl|my_center|LOCUS_02100 6480 6986 gene locus_tag LOCUS_02110 6480 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7516 7010 gene locus_tag LOCUS_02120 7516 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 7930 7520 gene locus_tag LOCUS_02130 7930 7520 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_02130 8515 11040 gene locus_tag LOCUS_02140 8515 11040 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107466.1 protein_id gnl|my_center|LOCUS_02140 12287 11082 gene locus_tag LOCUS_02150 12287 11082 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_02150 12758 13159 gene locus_tag LOCUS_02160 12758 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 13441 15849 gene locus_tag LOCUS_02170 13441 15849 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02170 15853 16779 gene locus_tag LOCUS_02180 15853 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 26088 17443 gene locus_tag LOCUS_02190 26088 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 26768 26214 gene locus_tag LOCUS_02200 26768 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence012 339 764 gene locus_tag LOCUS_02210 339 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1731 868 gene locus_tag LOCUS_02220 gene purU 1731 868 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933485.1 protein_id gnl|my_center|LOCUS_02220 1885 2835 gene locus_tag LOCUS_02230 1885 2835 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964929.1 protein_id gnl|my_center|LOCUS_02230 4569 3349 gene locus_tag LOCUS_02240 gene pfp 4569 3349 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_02240 4917 6827 gene locus_tag LOCUS_02250 4917 6827 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_02250 7309 6902 gene locus_tag LOCUS_02260 7309 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8059 7349 gene locus_tag LOCUS_02270 8059 7349 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_02270 8298 9122 gene locus_tag LOCUS_02280 8298 9122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9119 10249 gene locus_tag LOCUS_02290 9119 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 10518 11150 gene locus_tag LOCUS_02300 10518 11150 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262990.1 protein_id gnl|my_center|LOCUS_02300 11960 11196 gene locus_tag LOCUS_02310 11960 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 13613 12096 gene locus_tag LOCUS_02320 13613 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 13941 14654 gene locus_tag LOCUS_02330 13941 14654 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_02330 15181 14651 gene locus_tag LOCUS_02340 15181 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 15566 15174 gene locus_tag LOCUS_02350 15566 15174 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_02350 16084 15590 gene locus_tag LOCUS_02360 16084 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 16557 17609 gene locus_tag LOCUS_02370 16557 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 17996 17682 gene locus_tag LOCUS_02380 17996 17682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 20261 18036 gene locus_tag LOCUS_02390 20261 18036 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_02390 21660 21046 gene locus_tag LOCUS_02400 21660 21046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 22562 21657 gene locus_tag LOCUS_02410 22562 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 23096 22668 gene locus_tag LOCUS_02420 23096 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 24006 23098 gene locus_tag LOCUS_02430 24006 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 24499 24128 gene locus_tag LOCUS_02440 24499 24128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 24476 24667 gene locus_tag LOCUS_02450 24476 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 24747 25451 gene locus_tag LOCUS_02460 24747 25451 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_02460 26757 25786 gene locus_tag LOCUS_02470 26757 25786 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613426.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence013 1974 691 gene locus_tag LOCUS_02480 1974 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2921 1974 gene locus_tag LOCUS_02490 2921 1974 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762845.1 protein_id gnl|my_center|LOCUS_02490 4385 2940 gene locus_tag LOCUS_02500 4385 2940 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_02500 7985 4392 gene locus_tag LOCUS_02510 7985 4392 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_02510 9315 8137 gene locus_tag LOCUS_02520 9315 8137 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_02520 10461 9880 gene locus_tag LOCUS_02530 10461 9880 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_02530 10764 11546 gene locus_tag LOCUS_02540 10764 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11748 13088 gene locus_tag LOCUS_02550 11748 13088 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_02550 13081 13506 gene locus_tag LOCUS_02560 13081 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13516 14223 gene locus_tag LOCUS_02570 13516 14223 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677254.1 protein_id gnl|my_center|LOCUS_02570 14266 15132 gene locus_tag LOCUS_02580 14266 15132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_02580 17090 15294 gene locus_tag LOCUS_02590 17090 15294 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480577.1 protein_id gnl|my_center|LOCUS_02590 17936 17325 gene locus_tag LOCUS_02600 17936 17325 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_02600 18792 18025 gene locus_tag LOCUS_02610 18792 18025 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_02610 20023 18887 gene locus_tag LOCUS_02620 gene dnaN 20023 18887 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_02620 21977 20265 gene locus_tag LOCUS_02630 gene gldG 21977 20265 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_02630 22702 21971 gene locus_tag LOCUS_02640 gene gldF 22702 21971 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_02640 22966 24066 gene locus_tag LOCUS_02650 22966 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 24063 24812 gene locus_tag LOCUS_02660 24063 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 26093 24954 gene locus_tag LOCUS_02670 gene lpxB 26093 24954 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_02670 26570 26271 gene locus_tag LOCUS_02680 26570 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence014 206 580 gene locus_tag LOCUS_02690 206 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 688 1407 gene locus_tag LOCUS_02700 688 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02700 1660 2115 gene locus_tag LOCUS_02710 1660 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2251 2991 gene locus_tag LOCUS_02720 2251 2991 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775732.1 protein_id gnl|my_center|LOCUS_02720 3281 4027 gene locus_tag LOCUS_02730 3281 4027 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810311.1 protein_id gnl|my_center|LOCUS_02730 4870 4028 gene locus_tag LOCUS_02740 gene nfo 4870 4028 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109358.1 protein_id gnl|my_center|LOCUS_02740 7420 4967 gene locus_tag LOCUS_02750 7420 4967 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_02750 9472 8342 gene locus_tag LOCUS_02760 9472 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11639 9756 gene locus_tag LOCUS_02770 11639 9756 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_02770 13125 11887 gene locus_tag LOCUS_02780 13125 11887 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_02780 13627 14655 gene locus_tag LOCUS_02790 13627 14655 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763962.1 protein_id gnl|my_center|LOCUS_02790 15565 14957 gene locus_tag LOCUS_02800 15565 14957 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_02800 17467 15662 gene locus_tag LOCUS_02810 17467 15662 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_02810 18487 17642 gene locus_tag LOCUS_02820 18487 17642 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_02820 18609 20444 gene locus_tag LOCUS_02830 18609 20444 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107187.1 protein_id gnl|my_center|LOCUS_02830 20557 21282 gene locus_tag LOCUS_02840 20557 21282 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986519.1 protein_id gnl|my_center|LOCUS_02840 22330 21380 gene locus_tag LOCUS_02850 22330 21380 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_02850 22571 24127 gene locus_tag LOCUS_02860 22571 24127 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_02860 24348 25754 gene locus_tag LOCUS_02870 24348 25754 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_02870 25791 26726 gene locus_tag LOCUS_02880 25791 26726 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence015 1 303 gene locus_tag LOCUS_02890 1 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 867 2342 gene locus_tag LOCUS_02900 867 2342 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_02900 2435 4384 gene locus_tag LOCUS_02910 2435 4384 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_02910 4413 5852 gene locus_tag LOCUS_02920 4413 5852 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_02920 5868 7442 gene locus_tag LOCUS_02930 5868 7442 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_02930 7444 8892 gene locus_tag LOCUS_02940 7444 8892 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_02940 9529 10926 gene locus_tag LOCUS_02950 9529 10926 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_02950 11445 13649 gene locus_tag LOCUS_02960 11445 13649 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_02960 14480 14833 gene locus_tag LOCUS_02970 14480 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 19296 14884 gene locus_tag LOCUS_02980 19296 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 19597 23643 gene locus_tag LOCUS_02990 19597 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 23809 25035 gene locus_tag LOCUS_03000 23809 25035 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597016.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence016 509 54 gene locus_tag LOCUS_03010 509 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 1207 668 gene locus_tag LOCUS_03020 1207 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 1675 1229 gene locus_tag LOCUS_03030 1675 1229 CDS product DNA N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203018.1 protein_id gnl|my_center|LOCUS_03030 1918 1682 gene locus_tag LOCUS_03040 1918 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 2045 2485 gene locus_tag LOCUS_03050 2045 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 2686 3177 gene locus_tag LOCUS_03060 2686 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5208 3100 gene locus_tag LOCUS_03070 5208 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5220 5375 gene locus_tag LOCUS_03080 5220 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8202 6589 gene locus_tag LOCUS_03090 8202 6589 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_03090 11346 8221 gene locus_tag LOCUS_03100 11346 8221 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_03100 14697 12016 gene locus_tag LOCUS_03110 14697 12016 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_03110 15795 14758 gene locus_tag LOCUS_03120 15795 14758 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_03120 17138 16302 gene locus_tag LOCUS_03130 gene nagB 17138 16302 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_03130 18700 17171 gene locus_tag LOCUS_03140 18700 17171 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_03140 19694 18711 gene locus_tag LOCUS_03150 19694 18711 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_03150 19666 19881 gene locus_tag LOCUS_03160 19666 19881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 20979 20017 gene locus_tag LOCUS_03170 20979 20017 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_03170 25359 21295 gene locus_tag LOCUS_03180 25359 21295 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence017 854 144 gene locus_tag LOCUS_03190 854 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3844 854 gene locus_tag LOCUS_03200 3844 854 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_03200 4067 3852 gene locus_tag LOCUS_03210 4067 3852 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_03210 4226 4426 gene locus_tag LOCUS_03220 4226 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5474 4605 gene locus_tag LOCUS_03230 5474 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6045 5734 gene locus_tag LOCUS_03240 6045 5734 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_03240 7958 6045 gene locus_tag LOCUS_03250 7958 6045 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_03250 8035 9342 gene locus_tag LOCUS_03260 8035 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9524 9862 gene locus_tag LOCUS_03270 9524 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10039 12438 gene locus_tag LOCUS_03280 10039 12438 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_03280 12673 13548 gene locus_tag LOCUS_03290 12673 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 14357 13899 gene locus_tag LOCUS_03300 14357 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 15126 14380 gene locus_tag LOCUS_03310 15126 14380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 15449 16738 gene locus_tag LOCUS_03320 15449 16738 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037226281.1 protein_id gnl|my_center|LOCUS_03320 17529 16735 gene locus_tag LOCUS_03330 17529 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 18356 17526 gene locus_tag LOCUS_03340 18356 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 19177 18425 gene locus_tag LOCUS_03350 19177 18425 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_03350 19914 19174 gene locus_tag LOCUS_03360 19914 19174 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_03360 20262 21323 gene locus_tag LOCUS_03370 20262 21323 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_03370 22249 21404 gene locus_tag LOCUS_03380 gene gldN 22249 21404 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_03380 23749 22265 gene locus_tag LOCUS_03390 23749 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 24796 23843 gene locus_tag LOCUS_03400 24796 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 >Feature sequence018 1116 262 gene locus_tag LOCUS_03410 1116 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1427 2035 gene locus_tag LOCUS_03420 1427 2035 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_03420 2046 3392 gene locus_tag LOCUS_03430 2046 3392 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_03430 3524 4645 gene locus_tag LOCUS_03440 3524 4645 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_03440 4656 8093 gene locus_tag LOCUS_03450 4656 8093 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_03450 8509 9102 gene locus_tag LOCUS_03460 8509 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10546 9137 gene locus_tag LOCUS_03470 10546 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 11472 10648 gene locus_tag LOCUS_03480 11472 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 12156 11689 gene locus_tag LOCUS_03490 12156 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 12601 12167 gene locus_tag LOCUS_03500 12601 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 12885 13502 gene locus_tag LOCUS_03510 12885 13502 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_03510 14250 13543 gene locus_tag LOCUS_03520 14250 13543 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_03520 15372 14275 gene locus_tag LOCUS_03530 15372 14275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_03530 15879 18656 gene locus_tag LOCUS_03540 15879 18656 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_03540 18697 19761 gene locus_tag LOCUS_03550 18697 19761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 20251 19847 gene locus_tag LOCUS_03560 20251 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 21294 20251 gene locus_tag LOCUS_03570 gene hemW 21294 20251 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_03570 21664 22383 gene locus_tag LOCUS_03580 21664 22383 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence019 1526 258 gene locus_tag LOCUS_03590 1526 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2307 1720 gene locus_tag LOCUS_03600 2307 1720 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_03600 2568 3479 gene locus_tag LOCUS_03610 2568 3479 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_03610 6784 3710 gene locus_tag LOCUS_03620 6784 3710 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_03620 8387 6903 gene locus_tag LOCUS_03630 8387 6903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785179.1 protein_id gnl|my_center|LOCUS_03630 9151 8882 gene locus_tag LOCUS_03640 9151 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10657 9224 gene locus_tag LOCUS_03650 10657 9224 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_03650 12336 10939 gene locus_tag LOCUS_03660 12336 10939 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_03660 13256 12342 gene locus_tag LOCUS_03670 13256 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 15575 14004 gene locus_tag LOCUS_03680 15575 14004 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_03680 15871 19887 gene locus_tag LOCUS_03690 15871 19887 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_03690 19891 21279 gene locus_tag LOCUS_03700 19891 21279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 21272 22618 gene locus_tag LOCUS_03710 21272 22618 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_03710 22878 23648 gene locus_tag LOCUS_03720 gene yaaA 22878 23648 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_03720 23756 24469 gene locus_tag LOCUS_03730 23756 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence020 1928 312 gene locus_tag LOCUS_03740 1928 312 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_03740 4117 2069 gene locus_tag LOCUS_03750 4117 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4560 4213 gene locus_tag LOCUS_03760 4560 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5852 4863 gene locus_tag LOCUS_03770 gene mgrA 5852 4863 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_03770 7739 5943 gene locus_tag LOCUS_03780 7739 5943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762293.1 protein_id gnl|my_center|LOCUS_03780 8447 7758 gene locus_tag LOCUS_03790 8447 7758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786394.1 protein_id gnl|my_center|LOCUS_03790 9328 8636 gene locus_tag LOCUS_03800 gene phoU 9328 8636 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_03800 10229 9378 gene locus_tag LOCUS_03810 gene pstB 10229 9378 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_03810 11104 10211 gene locus_tag LOCUS_03820 gene pstA 11104 10211 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_03820 11977 11123 gene locus_tag LOCUS_03830 gene pstC 11977 11123 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_03830 13191 12118 gene locus_tag LOCUS_03840 gene pstS 13191 12118 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107055.1 protein_id gnl|my_center|LOCUS_03840 13605 14345 gene locus_tag LOCUS_03850 gene cobB 13605 14345 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_03850 14563 15309 gene locus_tag LOCUS_03860 gene fabG 14563 15309 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_03860 15670 17112 gene locus_tag LOCUS_03870 15670 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 17267 18265 gene locus_tag LOCUS_03880 17267 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 18285 19322 gene locus_tag LOCUS_03890 18285 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 19346 20116 gene locus_tag LOCUS_03900 19346 20116 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_03900 22135 20681 gene locus_tag LOCUS_03910 22135 20681 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798358.1 protein_id gnl|my_center|LOCUS_03910 23690 22269 gene locus_tag LOCUS_03920 23690 22269 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_03920 23902 24264 gene locus_tag LOCUS_03930 23902 24264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence021 1599 769 gene locus_tag LOCUS_03940 1599 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3452 1851 gene locus_tag LOCUS_03950 3452 1851 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_03950 3918 3463 gene locus_tag LOCUS_03960 3918 3463 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_03960 4423 8250 gene locus_tag LOCUS_03970 4423 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8262 9848 gene locus_tag LOCUS_03980 8262 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10351 9905 gene locus_tag LOCUS_03990 10351 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 11191 10757 gene locus_tag LOCUS_04000 gene gcvH 11191 10757 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_04000 18840 11314 gene locus_tag LOCUS_04010 gene sprA 18840 11314 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_04010 19467 18886 gene locus_tag LOCUS_04020 gene ruvA 19467 18886 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_04020 20842 19784 gene locus_tag LOCUS_04030 gene pdxA 20842 19784 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_04030 22461 21022 gene locus_tag LOCUS_04040 22461 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 23090 22710 gene locus_tag LOCUS_04050 23090 22710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 <23818 23261 gene locus_tag LOCUS_04060 <23818 23261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785463.1:DUF4837 family protein >Feature sequence022 430 1368 gene locus_tag LOCUS_04070 430 1368 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_04070 1455 1904 gene locus_tag LOCUS_04080 1455 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1938 3839 gene locus_tag LOCUS_04090 1938 3839 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_04090 4883 3906 gene locus_tag LOCUS_04100 4883 3906 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_04100 5839 5009 gene locus_tag LOCUS_04110 5839 5009 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_04110 6199 6510 gene locus_tag LOCUS_04120 6199 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6575 7480 gene locus_tag LOCUS_04130 gene rsmH 6575 7480 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_04130 7482 7862 gene locus_tag LOCUS_04140 7482 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 7862 9979 gene locus_tag LOCUS_04150 7862 9979 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_04150 9990 11447 gene locus_tag LOCUS_04160 9990 11447 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_04160 11450 12703 gene locus_tag LOCUS_04170 gene mraY 11450 12703 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_04170 12731 13096 gene locus_tag LOCUS_04180 12731 13096 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_04180 13093 14430 gene locus_tag LOCUS_04190 gene murD 13093 14430 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_04190 14443 15645 gene locus_tag LOCUS_04200 14443 15645 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_04200 15721 16815 gene locus_tag LOCUS_04210 gene murG 15721 16815 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_04210 16817 18184 gene locus_tag LOCUS_04220 gene murC 16817 18184 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_04220 18186 18917 gene locus_tag LOCUS_04230 18186 18917 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_04230 18919 20181 gene locus_tag LOCUS_04240 gene ftsA 18919 20181 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_04240 20214 21515 gene locus_tag LOCUS_04250 20214 21515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 21536 22762 gene locus_tag LOCUS_04260 21536 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 22832 23278 gene locus_tag LOCUS_04270 22832 23278 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence023 311 1537 gene locus_tag LOCUS_04280 gene pepT 311 1537 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_04280 1632 2072 gene locus_tag LOCUS_04290 1632 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 2215 3528 gene locus_tag LOCUS_04300 2215 3528 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_04300 3633 4955 gene locus_tag LOCUS_04310 gene tilS 3633 4955 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_04310 5265 6314 gene locus_tag LOCUS_04320 5265 6314 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093830137.1 protein_id gnl|my_center|LOCUS_04320 6642 6370 gene locus_tag LOCUS_04330 6642 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 8749 7214 gene locus_tag LOCUS_04340 8749 7214 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_04340 9367 8858 gene locus_tag LOCUS_04350 9367 8858 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766266.1 protein_id gnl|my_center|LOCUS_04350 10849 9386 gene locus_tag LOCUS_04360 gene accC 10849 9386 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_04360 12850 11540 gene locus_tag LOCUS_04370 12850 11540 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_04370 13072 14241 gene locus_tag LOCUS_04380 13072 14241 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_04380 14315 14860 gene locus_tag LOCUS_04390 14315 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 17012 14907 gene locus_tag LOCUS_04400 17012 14907 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_04400 18226 17300 gene locus_tag LOCUS_04410 gene nadA 18226 17300 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228349.1 protein_id gnl|my_center|LOCUS_04410 19100 18252 gene locus_tag LOCUS_04420 gene nadC 19100 18252 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_04420 20696 19116 gene locus_tag LOCUS_04430 gene nadB 20696 19116 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_04430 23051 20847 gene locus_tag LOCUS_04440 23051 20847 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence024 405 890 gene locus_tag LOCUS_04450 405 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1047 1310 gene locus_tag LOCUS_04460 1047 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 1407 2429 gene locus_tag LOCUS_04470 1407 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2625 2894 gene locus_tag LOCUS_04480 2625 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2897 3667 gene locus_tag LOCUS_04490 2897 3667 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_04490 3771 6428 gene locus_tag LOCUS_04500 3771 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6521 7351 gene locus_tag LOCUS_04510 6521 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 8802 12251 gene locus_tag LOCUS_04520 8802 12251 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_04520 12272 13744 gene locus_tag LOCUS_04530 12272 13744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 13764 14546 gene locus_tag LOCUS_04540 13764 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 14676 14494 gene locus_tag LOCUS_04550 14676 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16764 14791 gene locus_tag LOCUS_04560 16764 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17769 16876 gene locus_tag LOCUS_04570 17769 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 18597 17905 gene locus_tag LOCUS_04580 18597 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 20848 18758 gene locus_tag LOCUS_04590 20848 18758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 21654 20845 gene locus_tag LOCUS_04600 21654 20845 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704105.1 protein_id gnl|my_center|LOCUS_04600 22405 22016 gene locus_tag LOCUS_04610 22405 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 <23368 22848 gene locus_tag LOCUS_04620 <23368 22848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032496674.1:MFS transporter >Feature sequence025 149 1552 gene locus_tag LOCUS_04630 149 1552 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768920.1 protein_id gnl|my_center|LOCUS_04630 1557 2438 gene locus_tag LOCUS_04640 1557 2438 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_04640 2449 3564 gene locus_tag LOCUS_04650 2449 3564 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_04650 3561 4607 gene locus_tag LOCUS_04660 3561 4607 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_04660 4610 5629 gene locus_tag LOCUS_04670 4610 5629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_04670 5626 6435 gene locus_tag LOCUS_04680 5626 6435 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810480.1 protein_id gnl|my_center|LOCUS_04680 6673 7995 gene locus_tag LOCUS_04690 6673 7995 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_04690 7992 8681 gene locus_tag LOCUS_04700 7992 8681 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932080.1 protein_id gnl|my_center|LOCUS_04700 8674 10077 gene locus_tag LOCUS_04710 gene cobJ 8674 10077 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_04710 11384 10803 gene locus_tag LOCUS_04720 11384 10803 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_04720 13012 11483 gene locus_tag LOCUS_04730 gene gpmI 13012 11483 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_04730 13575 14048 gene locus_tag LOCUS_04740 13575 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 14116 14568 gene locus_tag LOCUS_04750 14116 14568 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402968.1 protein_id gnl|my_center|LOCUS_04750 14897 15445 gene locus_tag LOCUS_04760 14897 15445 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764211.1 protein_id gnl|my_center|LOCUS_04760 15474 15911 gene locus_tag LOCUS_04770 15474 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 16524 17645 gene locus_tag LOCUS_04780 gene ribD 16524 17645 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987156.1 protein_id gnl|my_center|LOCUS_04780 17653 18309 gene locus_tag LOCUS_04790 gene ribE 17653 18309 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987155.1 protein_id gnl|my_center|LOCUS_04790 18403 19641 gene locus_tag LOCUS_04800 18403 19641 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 protein_id gnl|my_center|LOCUS_04800 19781 20242 gene locus_tag LOCUS_04810 gene ribE 19781 20242 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_04810 21373 20366 gene locus_tag LOCUS_04820 21373 20366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 21964 23352 gene locus_tag LOCUS_04830 gene glmM 21964 23352 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence026 316 2292 gene locus_tag LOCUS_04840 316 2292 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_04840 2480 3811 gene locus_tag LOCUS_04850 2480 3811 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_04850 4447 3788 gene locus_tag LOCUS_04860 4447 3788 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_04860 5970 4588 gene locus_tag LOCUS_04870 gene gatD 5970 4588 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_04870 7943 5970 gene locus_tag LOCUS_04880 gene gatE 7943 5970 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_04880 8517 8035 gene locus_tag LOCUS_04890 8517 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9350 8541 gene locus_tag LOCUS_04900 gene blaOXA 9350 8541 CDS product OXA-48 family carbapenem-hydrolyzing class D beta-lactamase OXA-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071128.1 protein_id gnl|my_center|LOCUS_04900 10231 9347 gene locus_tag LOCUS_04910 10231 9347 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014298642.1 protein_id gnl|my_center|LOCUS_04910 10810 11109 gene locus_tag LOCUS_04920 10810 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 12506 11190 gene locus_tag LOCUS_04930 gene gdhA 12506 11190 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_04930 12765 16223 gene locus_tag LOCUS_04940 12765 16223 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_04940 17559 16318 gene locus_tag LOCUS_04950 17559 16318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_04950 17663 18916 gene locus_tag LOCUS_04960 17663 18916 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_04960 19504 19001 gene locus_tag LOCUS_04970 19504 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 19724 20305 gene locus_tag LOCUS_04980 19724 20305 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_04980 <22137 21207 gene locus_tag LOCUS_04990 <22137 21207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005776370.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence027 <1 3173 gene locus_tag LOCUS_05000 <1 3173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086345.1:VCBS domain-containing protein 3175 4128 gene locus_tag LOCUS_05010 3175 4128 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_05010 4149 6284 gene locus_tag LOCUS_05020 4149 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9691 6428 gene locus_tag LOCUS_05030 9691 6428 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107757.1 protein_id gnl|my_center|LOCUS_05030 10124 10579 gene locus_tag LOCUS_05040 10124 10579 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_05040 11020 12168 gene locus_tag LOCUS_05050 11020 12168 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203444.1 protein_id gnl|my_center|LOCUS_05050 12444 15962 gene locus_tag LOCUS_05060 12444 15962 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_05060 15974 17413 gene locus_tag LOCUS_05070 15974 17413 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130964755.1 protein_id gnl|my_center|LOCUS_05070 17487 18743 gene locus_tag LOCUS_05080 17487 18743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19199 20191 gene locus_tag LOCUS_05090 19199 20191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 20195 21361 gene locus_tag LOCUS_05100 20195 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 21654 21490 gene locus_tag LOCUS_05110 21654 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence028 2200 1181 gene locus_tag LOCUS_05120 2200 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3581 2247 gene locus_tag LOCUS_05130 gene gldK 3581 2247 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_05130 4475 3627 gene locus_tag LOCUS_05140 4475 3627 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_05140 7357 4934 gene locus_tag LOCUS_05150 gene topA 7357 4934 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_05150 7564 9957 gene locus_tag LOCUS_05160 7564 9957 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_05160 10896 10501 gene locus_tag LOCUS_05170 10896 10501 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803452.1 protein_id gnl|my_center|LOCUS_05170 12493 11117 gene locus_tag LOCUS_05180 gene radA 12493 11117 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_05180 13021 12524 gene locus_tag LOCUS_05190 13021 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13805 13455 gene locus_tag LOCUS_05200 13805 13455 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_05200 14663 13824 gene locus_tag LOCUS_05210 gene panC 14663 13824 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_05210 14856 15665 gene locus_tag LOCUS_05220 14856 15665 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_05220 15914 17749 gene locus_tag LOCUS_05230 gene glmS 15914 17749 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_05230 18896 17841 gene locus_tag LOCUS_05240 gene rfbB 18896 17841 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_05240 19955 18921 gene locus_tag LOCUS_05250 gene galE 19955 18921 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_05250 20127 21080 gene locus_tag LOCUS_05260 20127 21080 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_05260 <21935 21143 gene locus_tag LOCUS_05270 <21935 21143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791925.1:methionine--tRNA ligase >Feature sequence029 1180 164 gene locus_tag LOCUS_05280 1180 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05280 2844 1978 gene locus_tag LOCUS_05290 2844 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3405 2866 gene locus_tag LOCUS_05300 3405 2866 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_05300 3889 3512 gene locus_tag LOCUS_05310 3889 3512 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_05310 4475 3900 gene locus_tag LOCUS_05320 gene pth 4475 3900 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_05320 5249 4668 gene locus_tag LOCUS_05330 5249 4668 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_05330 6299 5367 gene locus_tag LOCUS_05340 6299 5367 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_05340 7094 6492 gene locus_tag LOCUS_05350 gene yihA 7094 6492 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_05350 8205 7225 gene locus_tag LOCUS_05360 8205 7225 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_05360 8559 8257 gene locus_tag LOCUS_05370 8559 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 8651 9268 gene locus_tag LOCUS_05380 gene udk 8651 9268 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_05380 9354 10076 gene locus_tag LOCUS_05390 9354 10076 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_05390 11325 10516 gene locus_tag LOCUS_05400 11325 10516 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_05400 12226 11513 gene locus_tag LOCUS_05410 12226 11513 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_05410 12334 12999 gene locus_tag LOCUS_05420 12334 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 13109 13993 gene locus_tag LOCUS_05430 13109 13993 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_05430 14202 14858 gene locus_tag LOCUS_05440 14202 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 14866 15612 gene locus_tag LOCUS_05450 14866 15612 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_05450 15637 18150 gene locus_tag LOCUS_05460 15637 18150 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_05460 18226 18747 gene locus_tag LOCUS_05470 18226 18747 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_05470 18777 19292 gene locus_tag LOCUS_05480 18777 19292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 19375 20208 gene locus_tag LOCUS_05490 gene murI 19375 20208 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_05490 20782 20249 gene locus_tag LOCUS_05500 20782 20249 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence030 433 2988 gene locus_tag LOCUS_05510 433 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 5233 3191 gene locus_tag LOCUS_05520 5233 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5682 6389 gene locus_tag LOCUS_05530 5682 6389 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_05530 6748 7521 gene locus_tag LOCUS_05540 6748 7521 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291082.1 protein_id gnl|my_center|LOCUS_05540 7654 8982 gene locus_tag LOCUS_05550 7654 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 9149 10393 gene locus_tag LOCUS_05560 9149 10393 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_05560 10616 11755 gene locus_tag LOCUS_05570 10616 11755 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_05570 11826 12578 gene locus_tag LOCUS_05580 11826 12578 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_05580 12809 13777 gene locus_tag LOCUS_05590 12809 13777 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_05590 13911 15173 gene locus_tag LOCUS_05600 13911 15173 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_05600 15475 16269 gene locus_tag LOCUS_05610 15475 16269 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_05610 16281 19631 gene locus_tag LOCUS_05620 16281 19631 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143960588.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence031 157 1338 gene locus_tag LOCUS_05630 157 1338 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108616.1 protein_id gnl|my_center|LOCUS_05630 5172 1684 gene locus_tag LOCUS_05640 5172 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_05640 6136 7059 gene locus_tag LOCUS_05650 6136 7059 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_05650 7888 7244 gene locus_tag LOCUS_05660 gene pdxH 7888 7244 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814302.1 protein_id gnl|my_center|LOCUS_05660 8298 7900 gene locus_tag LOCUS_05670 8298 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9633 8539 gene locus_tag LOCUS_05680 9633 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10617 11777 gene locus_tag LOCUS_05690 10617 11777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 11996 12514 gene locus_tag LOCUS_05700 11996 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 12913 12530 gene locus_tag LOCUS_05710 12913 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 13650 13435 gene locus_tag LOCUS_05720 13650 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 14198 13671 gene locus_tag LOCUS_05730 14198 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 15396 14359 gene locus_tag LOCUS_05740 gene asnA 15396 14359 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_05740 15946 16137 gene locus_tag LOCUS_05750 15946 16137 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_05750 16827 17243 gene locus_tag LOCUS_05760 16827 17243 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_05760 17246 18355 gene locus_tag LOCUS_05770 17246 18355 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_05770 18561 20303 gene locus_tag LOCUS_05780 gene menD 18561 20303 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence032 <1 624 gene locus_tag LOCUS_05790 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108986.1:ABC-F family ATP-binding cassette domain-containing protein 756 2000 gene locus_tag LOCUS_05800 756 2000 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903543.1 protein_id gnl|my_center|LOCUS_05800 2005 2745 gene locus_tag LOCUS_05810 gene rlmB 2005 2745 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_05810 3076 3936 gene locus_tag LOCUS_05820 3076 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5347 3974 gene locus_tag LOCUS_05830 5347 3974 CDS product reductive dehalogenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889925.1 protein_id gnl|my_center|LOCUS_05830 6766 5675 gene locus_tag LOCUS_05840 6766 5675 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_05840 7544 6969 gene locus_tag LOCUS_05850 7544 6969 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_05850 7869 7576 gene locus_tag LOCUS_05860 7869 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 9238 8000 gene locus_tag LOCUS_05870 9238 8000 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_05870 9524 10780 gene locus_tag LOCUS_05880 9524 10780 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_05880 11256 10921 gene locus_tag LOCUS_05890 11256 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11854 12429 gene locus_tag LOCUS_05900 11854 12429 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_05900 12450 12875 gene locus_tag LOCUS_05910 12450 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13371 13000 gene locus_tag LOCUS_05920 13371 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 13829 13395 gene locus_tag LOCUS_05930 13829 13395 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_05930 14781 14077 gene locus_tag LOCUS_05940 14781 14077 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_05940 15407 14805 gene locus_tag LOCUS_05950 15407 14805 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_05950 16230 15532 gene locus_tag LOCUS_05960 gene mnmD 16230 15532 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_05960 17722 16205 gene locus_tag LOCUS_05970 17722 16205 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786958.1 protein_id gnl|my_center|LOCUS_05970 17831 18895 gene locus_tag LOCUS_05980 gene dinB 17831 18895 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968218.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence033 <1 1205 gene locus_tag LOCUS_05990 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:GlmU family protein 1369 3822 gene locus_tag LOCUS_06000 gene lon 1369 3822 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_06000 6248 4398 gene locus_tag LOCUS_06010 gene yidC 6248 4398 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_06010 8026 6371 gene locus_tag LOCUS_06020 8026 6371 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_06020 10114 8165 gene locus_tag LOCUS_06030 10114 8165 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_06030 10844 10407 gene locus_tag LOCUS_06040 10844 10407 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_06040 11085 11792 gene locus_tag LOCUS_06050 gene trmD 11085 11792 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_06050 12488 11910 gene locus_tag LOCUS_06060 12488 11910 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_06060 13335 12700 gene locus_tag LOCUS_06070 13335 12700 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_06070 14350 13472 gene locus_tag LOCUS_06080 14350 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 17968 14606 gene locus_tag LOCUS_06090 17968 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 18815 18354 gene locus_tag LOCUS_06100 18815 18354 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence034 579 253 gene locus_tag LOCUS_06110 579 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3610 848 gene locus_tag LOCUS_06120 3610 848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_06120 4023 6908 gene locus_tag LOCUS_06130 4023 6908 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_06130 7267 10251 gene locus_tag LOCUS_06140 7267 10251 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_06140 10264 11748 gene locus_tag LOCUS_06150 10264 11748 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_06150 11751 13796 gene locus_tag LOCUS_06160 11751 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13807 15441 gene locus_tag LOCUS_06170 13807 15441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 15523 16356 gene locus_tag LOCUS_06180 15523 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 16463 18019 gene locus_tag LOCUS_06190 16463 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence035 264 3536 gene locus_tag LOCUS_06200 264 3536 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_06200 3764 4525 gene locus_tag LOCUS_06210 3764 4525 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_06210 4665 6269 gene locus_tag LOCUS_06220 gene fumB 4665 6269 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066697.1 protein_id gnl|my_center|LOCUS_06220 6921 6505 gene locus_tag LOCUS_06230 gene arfB 6921 6505 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_06230 8206 7004 gene locus_tag LOCUS_06240 gene trpB 8206 7004 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482634.1 protein_id gnl|my_center|LOCUS_06240 8563 9327 gene locus_tag LOCUS_06250 8563 9327 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119458.1 protein_id gnl|my_center|LOCUS_06250 13549 9500 gene locus_tag LOCUS_06260 13549 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 13766 14185 gene locus_tag LOCUS_06270 13766 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 14317 14634 gene locus_tag LOCUS_06280 14317 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 14645 14830 gene locus_tag LOCUS_06290 14645 14830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14860 15198 gene locus_tag LOCUS_06300 14860 15198 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392924.1 protein_id gnl|my_center|LOCUS_06300 15261 16136 gene locus_tag LOCUS_06310 15261 16136 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_06310 16129 16998 gene locus_tag LOCUS_06320 16129 16998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_06320 17009 17425 gene locus_tag LOCUS_06330 17009 17425 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06330 17719 18432 gene locus_tag LOCUS_06340 17719 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence036 2022 535 gene locus_tag LOCUS_06350 2022 535 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_06350 5555 2043 gene locus_tag LOCUS_06360 5555 2043 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_06360 7019 5862 gene locus_tag LOCUS_06370 7019 5862 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108736.1 protein_id gnl|my_center|LOCUS_06370 7721 7092 gene locus_tag LOCUS_06380 7721 7092 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_06380 8609 7920 gene locus_tag LOCUS_06390 8609 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 10450 9419 gene locus_tag LOCUS_06400 gene tdh 10450 9419 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_06400 12108 10663 gene locus_tag LOCUS_06410 12108 10663 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_06410 12547 12332 gene locus_tag LOCUS_06420 12547 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13079 14392 gene locus_tag LOCUS_06430 13079 14392 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_06430 14894 14484 gene locus_tag LOCUS_06440 14894 14484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_06440 17719 15341 gene locus_tag LOCUS_06450 17719 15341 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_06450 18481 17732 gene locus_tag LOCUS_06460 18481 17732 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence037 400 1329 gene locus_tag LOCUS_06470 400 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2453 4906 gene locus_tag LOCUS_06480 2453 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5131 7170 gene locus_tag LOCUS_06490 5131 7170 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_06490 7167 8321 gene locus_tag LOCUS_06500 7167 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8344 9630 gene locus_tag LOCUS_06510 8344 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10389 13739 gene locus_tag LOCUS_06520 10389 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 13845 15257 gene locus_tag LOCUS_06530 13845 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15337 17325 gene locus_tag LOCUS_06540 15337 17325 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_06540 17325 18437 gene locus_tag LOCUS_06550 17325 18437 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence038 1236 61 gene locus_tag LOCUS_06560 1236 61 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_06560 2516 1329 gene locus_tag LOCUS_06570 2516 1329 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_06570 3189 2689 gene locus_tag LOCUS_06580 3189 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797867.1 protein_id gnl|my_center|LOCUS_06580 4406 3180 gene locus_tag LOCUS_06590 4406 3180 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_06590 5112 4522 gene locus_tag LOCUS_06600 5112 4522 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_06600 5775 5146 gene locus_tag LOCUS_06610 5775 5146 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109201.1 protein_id gnl|my_center|LOCUS_06610 7820 5913 gene locus_tag LOCUS_06620 7820 5913 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109026.1 protein_id gnl|my_center|LOCUS_06620 8002 9471 gene locus_tag LOCUS_06630 gene guaB 8002 9471 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_06630 9553 11190 gene locus_tag LOCUS_06640 9553 11190 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_06640 11193 12032 gene locus_tag LOCUS_06650 11193 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 12043 13392 gene locus_tag LOCUS_06660 12043 13392 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_06660 13472 14437 gene locus_tag LOCUS_06670 13472 14437 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_06670 14443 16002 gene locus_tag LOCUS_06680 14443 16002 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_06680 16272 16051 gene locus_tag LOCUS_06690 16272 16051 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_06690 16891 16331 gene locus_tag LOCUS_06700 16891 16331 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_06700 17732 16995 gene locus_tag LOCUS_06710 17732 16995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence039 155 1159 gene locus_tag LOCUS_06720 155 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1785 3299 gene locus_tag LOCUS_06730 1785 3299 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_06730 3441 5594 gene locus_tag LOCUS_06740 3441 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 6039 7499 gene locus_tag LOCUS_06750 6039 7499 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_06750 7532 8674 gene locus_tag LOCUS_06760 7532 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8675 9328 gene locus_tag LOCUS_06770 8675 9328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_06770 9365 13075 gene locus_tag LOCUS_06780 9365 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13156 14208 gene locus_tag LOCUS_06790 13156 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 14957 15511 gene locus_tag LOCUS_06800 14957 15511 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_06800 16013 17179 gene locus_tag LOCUS_06810 16013 17179 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence040 1075 527 gene locus_tag LOCUS_06820 1075 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1216 1300 gene locus_tag LOCUS_t00020 1216 1300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5464 1505 gene locus_tag LOCUS_06830 5464 1505 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_06830 6128 8980 gene locus_tag LOCUS_06840 6128 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9054 10883 gene locus_tag LOCUS_06850 9054 10883 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_06850 10983 11861 gene locus_tag LOCUS_06860 10983 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760094.1 protein_id gnl|my_center|LOCUS_06860 11893 13086 gene locus_tag LOCUS_06870 11893 13086 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870366.1 protein_id gnl|my_center|LOCUS_06870 13102 13788 gene locus_tag LOCUS_06880 gene deoC 13102 13788 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066692.1 protein_id gnl|my_center|LOCUS_06880 13794 15323 gene locus_tag LOCUS_06890 13794 15323 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970032.1 protein_id gnl|my_center|LOCUS_06890 15326 16336 gene locus_tag LOCUS_06900 15326 16336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388678.1 protein_id gnl|my_center|LOCUS_06900 17078 18127 gene locus_tag LOCUS_06910 17078 18127 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence041 451 1173 gene locus_tag LOCUS_06920 451 1173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_06920 1184 1540 gene locus_tag LOCUS_06930 gene folX 1184 1540 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_06930 1552 1923 gene locus_tag LOCUS_06940 1552 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06940 2309 1908 gene locus_tag LOCUS_06950 gene mutT 2309 1908 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459573.1 protein_id gnl|my_center|LOCUS_06950 2689 2306 gene locus_tag LOCUS_06960 2689 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3212 2787 gene locus_tag LOCUS_06970 3212 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3646 4191 gene locus_tag LOCUS_06980 3646 4191 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109391.1 protein_id gnl|my_center|LOCUS_06980 4483 4914 gene locus_tag LOCUS_06990 4483 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4939 6135 gene locus_tag LOCUS_07000 4939 6135 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_07000 6304 7581 gene locus_tag LOCUS_07010 6304 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 7949 11554 gene locus_tag LOCUS_07020 7949 11554 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_07020 11566 13056 gene locus_tag LOCUS_07030 11566 13056 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_07030 13075 14361 gene locus_tag LOCUS_07040 13075 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 14695 16014 gene locus_tag LOCUS_07050 14695 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16290 16967 gene locus_tag LOCUS_07060 gene tenA 16290 16967 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 protein_id gnl|my_center|LOCUS_07060 17085 17891 gene locus_tag LOCUS_07070 gene thiD 17085 17891 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence042 804 253 gene locus_tag LOCUS_07080 804 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1003 2274 gene locus_tag LOCUS_07090 1003 2274 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_07090 2276 3895 gene locus_tag LOCUS_07100 2276 3895 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_07100 4229 4888 gene locus_tag LOCUS_07110 4229 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5063 5893 gene locus_tag LOCUS_07120 5063 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6608 6015 gene locus_tag LOCUS_07130 6608 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7064 7531 gene locus_tag LOCUS_07140 7064 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_07140 8649 7600 gene locus_tag LOCUS_07150 8649 7600 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_07150 9160 9459 gene locus_tag LOCUS_07160 9160 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 12203 9750 gene locus_tag LOCUS_07170 12203 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 12487 13002 gene locus_tag LOCUS_07180 12487 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13354 13965 gene locus_tag LOCUS_07190 13354 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 14535 14011 gene locus_tag LOCUS_07200 14535 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 15012 16253 gene locus_tag LOCUS_07210 15012 16253 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_07210 16266 16994 gene locus_tag LOCUS_07220 16266 16994 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203021.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence043 <1 1133 gene locus_tag LOCUS_07230 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108628.1:RagB/SusD family nutrient uptake outer membrane protein 2122 4410 gene locus_tag LOCUS_07240 2122 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4480 5622 gene locus_tag LOCUS_07250 4480 5622 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_07250 6082 7230 gene locus_tag LOCUS_07260 6082 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7434 8576 gene locus_tag LOCUS_07270 7434 8576 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_07270 8774 9295 gene locus_tag LOCUS_07280 8774 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9481 10926 gene locus_tag LOCUS_07290 9481 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10934 11473 gene locus_tag LOCUS_07300 10934 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 11486 12796 gene locus_tag LOCUS_07310 11486 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 12888 14486 gene locus_tag LOCUS_07320 12888 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 14591 16183 gene locus_tag LOCUS_07330 14591 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence044 <1 789 gene locus_tag LOCUS_07340 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004339941.1:2-oxoglutarate dehydrogenase E1 component 887 2131 gene locus_tag LOCUS_07350 gene odhB 887 2131 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_07350 4134 2881 gene locus_tag LOCUS_07360 gene hutI 4134 2881 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_07360 4535 6130 gene locus_tag LOCUS_07370 4535 6130 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_07370 7559 6183 gene locus_tag LOCUS_07380 7559 6183 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_07380 10603 7577 gene locus_tag LOCUS_07390 10603 7577 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_07390 11323 11153 gene locus_tag LOCUS_07400 11323 11153 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_07400 11492 12316 gene locus_tag LOCUS_07410 gene zupT 11492 12316 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_07410 13002 12346 gene locus_tag LOCUS_07420 gene nth 13002 12346 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_07420 13138 15003 gene locus_tag LOCUS_07430 13138 15003 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_07430 15070 16410 gene locus_tag LOCUS_07440 15070 16410 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_07440 16492 17358 gene locus_tag LOCUS_07450 16492 17358 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence045 2429 306 gene locus_tag LOCUS_07460 2429 306 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404166.1 protein_id gnl|my_center|LOCUS_07460 3923 2664 gene locus_tag LOCUS_07470 3923 2664 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_07470 4127 3924 gene locus_tag LOCUS_07480 4127 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4752 4168 gene locus_tag LOCUS_07490 4752 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6034 4745 gene locus_tag LOCUS_07500 6034 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7013 6336 gene locus_tag LOCUS_07510 7013 6336 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_07510 7291 8757 gene locus_tag LOCUS_07520 7291 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 12291 8941 gene locus_tag LOCUS_07530 gene mfd 12291 8941 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_07530 12821 14164 gene locus_tag LOCUS_07540 12821 14164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 15183 14614 gene locus_tag LOCUS_07550 15183 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 15789 16451 gene locus_tag LOCUS_07560 15789 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 16812 17003 gene locus_tag LOCUS_07570 16812 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence046 1462 1136 gene locus_tag LOCUS_07580 gene sugE 1462 1136 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005156471.1 protein_id gnl|my_center|LOCUS_07580 2754 1465 gene locus_tag LOCUS_07590 2754 1465 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_07590 4373 2859 gene locus_tag LOCUS_07600 gene gldJ 4373 2859 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_07600 4711 8484 gene locus_tag LOCUS_07610 gene porU 4711 8484 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_07610 8544 9722 gene locus_tag LOCUS_07620 gene porV 8544 9722 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_07620 9723 10199 gene locus_tag LOCUS_07630 gene ispF 9723 10199 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_07630 10334 10702 gene locus_tag LOCUS_07640 10334 10702 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_07640 11076 10753 gene locus_tag LOCUS_07650 11076 10753 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 protein_id gnl|my_center|LOCUS_07650 11982 11146 gene locus_tag LOCUS_07660 11982 11146 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_07660 13081 11987 gene locus_tag LOCUS_07670 13081 11987 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_07670 13436 13101 gene locus_tag LOCUS_07680 13436 13101 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_07680 14559 13591 gene locus_tag LOCUS_07690 14559 13591 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_07690 14768 17323 gene locus_tag LOCUS_07700 gene alaS 14768 17323 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence047 1882 707 gene locus_tag LOCUS_07710 1882 707 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456088.1 protein_id gnl|my_center|LOCUS_07710 2426 1887 gene locus_tag LOCUS_07720 2426 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2906 3838 gene locus_tag LOCUS_07730 2906 3838 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_07730 4485 3835 gene locus_tag LOCUS_07740 4485 3835 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_07740 5337 4606 gene locus_tag LOCUS_07750 5337 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5933 8368 gene locus_tag LOCUS_07760 gene thrA 5933 8368 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_07760 8381 9364 gene locus_tag LOCUS_07770 8381 9364 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_07770 9376 10671 gene locus_tag LOCUS_07780 gene thrC 9376 10671 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_07780 11105 11377 gene locus_tag LOCUS_07790 11105 11377 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_07790 11446 12138 gene locus_tag LOCUS_07800 11446 12138 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_07800 12303 13010 gene locus_tag LOCUS_07810 12303 13010 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_07810 13064 14257 gene locus_tag LOCUS_07820 13064 14257 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_07820 14260 15057 gene locus_tag LOCUS_07830 14260 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 15061 17013 gene locus_tag LOCUS_07840 15061 17013 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence048 1895 1341 gene locus_tag LOCUS_07850 1895 1341 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_07850 3719 2301 gene locus_tag LOCUS_07860 3719 2301 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750838.1 protein_id gnl|my_center|LOCUS_07860 7253 3741 gene locus_tag LOCUS_07870 7253 3741 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_07870 8681 7506 gene locus_tag LOCUS_07880 8681 7506 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_07880 9397 8864 gene locus_tag LOCUS_07890 9397 8864 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797529.1 protein_id gnl|my_center|LOCUS_07890 12823 10010 gene locus_tag LOCUS_07900 12823 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 14186 12852 gene locus_tag LOCUS_07910 14186 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 17167 14189 gene locus_tag LOCUS_07920 17167 14189 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence049 470 2707 gene locus_tag LOCUS_07930 470 2707 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_07930 2711 3244 gene locus_tag LOCUS_07940 2711 3244 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_07940 3258 4199 gene locus_tag LOCUS_07950 gene nrfD 3258 4199 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073772.1 protein_id gnl|my_center|LOCUS_07950 4233 4754 gene locus_tag LOCUS_07960 4233 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4777 5370 gene locus_tag LOCUS_07970 4777 5370 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_07970 5396 6016 gene locus_tag LOCUS_07980 5396 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7008 6055 gene locus_tag LOCUS_07990 7008 6055 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_07990 7259 7780 gene locus_tag LOCUS_08000 7259 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_08000 7768 8493 gene locus_tag LOCUS_08010 7768 8493 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_08010 10198 8540 gene locus_tag LOCUS_08020 gene pckA 10198 8540 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813680.1 protein_id gnl|my_center|LOCUS_08020 11512 10607 gene locus_tag LOCUS_08030 gene xerD 11512 10607 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_08030 11699 12124 gene locus_tag LOCUS_08040 gene aroQ 11699 12124 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_08040 12255 13670 gene locus_tag LOCUS_08050 gene pyk 12255 13670 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_08050 15204 14446 gene locus_tag LOCUS_08060 15204 14446 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_08060 16388 15204 gene locus_tag LOCUS_08070 16388 15204 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence050 41 676 gene locus_tag LOCUS_08080 41 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2254 857 gene locus_tag LOCUS_08090 2254 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4136 2265 gene locus_tag LOCUS_08100 4136 2265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_08100 5590 4565 gene locus_tag LOCUS_08110 5590 4565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_08110 6701 5649 gene locus_tag LOCUS_08120 6701 5649 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_08120 7885 6704 gene locus_tag LOCUS_08130 7885 6704 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_08130 9273 8275 gene locus_tag LOCUS_08140 9273 8275 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_08140 9776 10375 gene locus_tag LOCUS_08150 9776 10375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 11770 12030 gene locus_tag LOCUS_08160 11770 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 12110 13648 gene locus_tag LOCUS_08170 12110 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13743 16787 gene locus_tag LOCUS_08180 13743 16787 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence051 <1 661 gene locus_tag LOCUS_08190 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073173113.1:lysylphosphatidylglycerol synthase transmembrane domain-containing protein 663 1841 gene locus_tag LOCUS_08200 663 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_08200 4183 2006 gene locus_tag LOCUS_08210 gene recQ 4183 2006 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_08210 4443 5411 gene locus_tag LOCUS_08220 4443 5411 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_08220 5439 6275 gene locus_tag LOCUS_08230 gene tatC 5439 6275 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_08230 6353 8857 gene locus_tag LOCUS_08240 6353 8857 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_08240 8912 9646 gene locus_tag LOCUS_08250 gene lptB 8912 9646 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_08250 9787 9869 gene locus_tag LOCUS_t00030 9787 9869 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10103 11452 gene locus_tag LOCUS_08260 gene tig 10103 11452 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_08260 11598 12272 gene locus_tag LOCUS_08270 gene clpP 11598 12272 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_08270 12360 13574 gene locus_tag LOCUS_08280 gene clpX 12360 13574 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_08280 14996 14142 gene locus_tag LOCUS_08290 14996 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 15518 15030 gene locus_tag LOCUS_08300 gene dfrA 15518 15030 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_08300 15888 15532 gene locus_tag LOCUS_08310 15888 15532 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_08310 16710 15916 gene locus_tag LOCUS_08320 16710 15916 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence052 1521 133 gene locus_tag LOCUS_08330 1521 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2384 1707 gene locus_tag LOCUS_08340 2384 1707 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616157.1 protein_id gnl|my_center|LOCUS_08340 4289 3201 gene locus_tag LOCUS_08350 4289 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6479 4683 gene locus_tag LOCUS_08360 6479 4683 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813804.1 protein_id gnl|my_center|LOCUS_08360 9809 6492 gene locus_tag LOCUS_08370 9809 6492 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201911.1 protein_id gnl|my_center|LOCUS_08370 11240 10053 gene locus_tag LOCUS_08380 11240 10053 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_08380 12010 11438 gene locus_tag LOCUS_08390 12010 11438 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784829.1 protein_id gnl|my_center|LOCUS_08390 12574 13173 gene locus_tag LOCUS_08400 12574 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 13947 13402 gene locus_tag LOCUS_08410 13947 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15437 14250 gene locus_tag LOCUS_08420 15437 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16212 15562 gene locus_tag LOCUS_08430 16212 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence053 2506 1553 gene locus_tag LOCUS_08440 2506 1553 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_08440 3126 2509 gene locus_tag LOCUS_08450 3126 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4231 3230 gene locus_tag LOCUS_08460 gene holA 4231 3230 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_08460 5011 4241 gene locus_tag LOCUS_08470 5011 4241 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_08470 5072 5530 gene locus_tag LOCUS_08480 5072 5530 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_08480 6053 5517 gene locus_tag LOCUS_08490 6053 5517 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_08490 9152 6069 gene locus_tag LOCUS_08500 9152 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10792 9479 gene locus_tag LOCUS_08510 10792 9479 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_08510 11675 11055 gene locus_tag LOCUS_08520 gene recR 11675 11055 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_08520 11987 11751 gene locus_tag LOCUS_08530 11987 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11926 13218 gene locus_tag LOCUS_08540 11926 13218 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_08540 13484 13804 gene locus_tag LOCUS_08550 13484 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 14154 14840 gene locus_tag LOCUS_08560 14154 14840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 15192 16055 gene locus_tag LOCUS_08570 15192 16055 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence054 344 862 gene locus_tag LOCUS_08580 344 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 966 3146 gene locus_tag LOCUS_08590 966 3146 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_08590 3269 6106 gene locus_tag LOCUS_08600 3269 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6117 7445 gene locus_tag LOCUS_08610 6117 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7575 8306 gene locus_tag LOCUS_08620 7575 8306 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_08620 8500 9738 gene locus_tag LOCUS_08630 8500 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 11417 9801 gene locus_tag LOCUS_08640 gene pckA 11417 9801 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964464.1 protein_id gnl|my_center|LOCUS_08640 13142 12243 gene locus_tag LOCUS_08650 gene xerD 13142 12243 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_08650 13346 13768 gene locus_tag LOCUS_08660 gene aroQ 13346 13768 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_08660 13829 15295 gene locus_tag LOCUS_08670 gene pyk 13829 15295 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_08670 15642 15716 gene locus_tag LOCUS_t00040 15642 15716 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15762 15836 gene locus_tag LOCUS_t00050 15762 15836 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15879 15953 gene locus_tag LOCUS_t00060 15879 15953 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 1106 555 gene locus_tag LOCUS_08680 1106 555 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109391.1 protein_id gnl|my_center|LOCUS_08680 2754 1297 gene locus_tag LOCUS_08690 2754 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3832 2765 gene locus_tag LOCUS_08700 3832 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5384 3843 gene locus_tag LOCUS_08710 5384 3843 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_08710 8954 5388 gene locus_tag LOCUS_08720 8954 5388 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_08720 10240 9095 gene locus_tag LOCUS_08730 10240 9095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10815 10267 gene locus_tag LOCUS_08740 10815 10267 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_08740 11925 11353 gene locus_tag LOCUS_08750 11925 11353 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_08750 13106 12345 gene locus_tag LOCUS_08760 13106 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 13853 13146 gene locus_tag LOCUS_08770 13853 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14678 13869 gene locus_tag LOCUS_08780 14678 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 15102 15251 gene locus_tag LOCUS_08790 15102 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15248 15529 gene locus_tag LOCUS_08800 15248 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence056 431 1360 gene locus_tag LOCUS_08810 431 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1387 5001 gene locus_tag LOCUS_08820 1387 5001 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_08820 5126 7489 gene locus_tag LOCUS_08830 5126 7489 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_08830 8132 7632 gene locus_tag LOCUS_08840 gene sixA 8132 7632 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_08840 10305 8206 gene locus_tag LOCUS_08850 10305 8206 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657449.1 protein_id gnl|my_center|LOCUS_08850 10886 10608 gene locus_tag LOCUS_08860 10886 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 11380 10919 gene locus_tag LOCUS_08870 11380 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 11927 11397 gene locus_tag LOCUS_08880 11927 11397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 12403 12161 gene locus_tag LOCUS_08890 12403 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 12695 13168 gene locus_tag LOCUS_08900 12695 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 15130 15693 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgttaatagctttcaaaaagaaactgattacacc >Feature sequence057 <1 3785 gene locus_tag LOCUS_08910 <1 3785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 3992 4975 gene locus_tag LOCUS_08920 3992 4975 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_08920 6119 5112 gene locus_tag LOCUS_08930 6119 5112 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_08930 7417 6374 gene locus_tag LOCUS_08940 gene galE 7417 6374 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_08940 9132 7471 gene locus_tag LOCUS_08950 9132 7471 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_08950 10272 9226 gene locus_tag LOCUS_08960 gene galT 10272 9226 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_08960 11453 10290 gene locus_tag LOCUS_08970 11453 10290 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_08970 12696 11683 gene locus_tag LOCUS_08980 12696 11683 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_08980 13692 12781 gene locus_tag LOCUS_08990 13692 12781 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_08990 15116 13695 gene locus_tag LOCUS_09000 15116 13695 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787024.1 protein_id gnl|my_center|LOCUS_09000 15416 15126 gene locus_tag LOCUS_09010 15416 15126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 >Feature sequence058 <1 1163 gene locus_tag LOCUS_09020 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108497.1:tetratricopeptide repeat protein 1165 2937 gene locus_tag LOCUS_09030 1165 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3199 3699 gene locus_tag LOCUS_09040 3199 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4062 6023 gene locus_tag LOCUS_09050 gene gyrB 4062 6023 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_09050 6180 6746 gene locus_tag LOCUS_09060 6180 6746 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 protein_id gnl|my_center|LOCUS_09060 9439 6743 gene locus_tag LOCUS_09070 9439 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 10351 9566 gene locus_tag LOCUS_09080 gene dapF 10351 9566 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_09080 10627 12075 gene locus_tag LOCUS_09090 10627 12075 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_09090 12181 13041 gene locus_tag LOCUS_09100 12181 13041 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_09100 15112 13097 gene locus_tag LOCUS_09110 gene uvrB 15112 13097 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence059 702 397 gene locus_tag LOCUS_09120 702 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 1562 1486 gene locus_tag LOCUS_t00070 1562 1486 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1745 2737 gene locus_tag LOCUS_09130 gene trxB 1745 2737 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_09130 4154 2904 gene locus_tag LOCUS_09140 4154 2904 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_09140 4296 5126 gene locus_tag LOCUS_09150 gene bamD 4296 5126 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_09150 5150 5485 gene locus_tag LOCUS_09160 5150 5485 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_09160 5551 6108 gene locus_tag LOCUS_09170 5551 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09170 6195 6755 gene locus_tag LOCUS_09180 6195 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09180 6814 7713 gene locus_tag LOCUS_09190 6814 7713 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_09190 7784 9439 gene locus_tag LOCUS_09200 gene recN 7784 9439 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_09200 9557 10396 gene locus_tag LOCUS_09210 9557 10396 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_09210 10718 11623 gene locus_tag LOCUS_09220 gene cysD 10718 11623 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_09220 11652 12962 gene locus_tag LOCUS_09230 11652 12962 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_09230 14541 13072 gene locus_tag LOCUS_09240 14541 13072 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence060 <1 873 gene locus_tag LOCUS_09250 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119131.1:glycoside hydrolase family 130 protein 2094 934 gene locus_tag LOCUS_09260 2094 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3133 2102 gene locus_tag LOCUS_09270 3133 2102 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_09270 3539 3138 gene locus_tag LOCUS_09280 3539 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3755 4129 gene locus_tag LOCUS_09290 3755 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4225 5394 gene locus_tag LOCUS_09300 4225 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5556 6653 gene locus_tag LOCUS_09310 5556 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6662 8368 gene locus_tag LOCUS_09320 6662 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9611 8469 gene locus_tag LOCUS_09330 9611 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12238 9740 gene locus_tag LOCUS_09340 gene gyrA 12238 9740 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_09340 12540 15038 gene locus_tag LOCUS_09350 12540 15038 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence061 1134 445 gene locus_tag LOCUS_09360 1134 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1618 2844 gene locus_tag LOCUS_09370 1618 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3911 3495 gene locus_tag LOCUS_09380 3911 3495 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_09380 4722 4003 gene locus_tag LOCUS_09390 4722 4003 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656803.1 protein_id gnl|my_center|LOCUS_09390 5446 4859 gene locus_tag LOCUS_09400 gene coaE 5446 4859 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_09400 6469 5456 gene locus_tag LOCUS_09410 6469 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6836 6519 gene locus_tag LOCUS_09420 gene yajC 6836 6519 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_09420 7279 6893 gene locus_tag LOCUS_09430 7279 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8423 7473 gene locus_tag LOCUS_09440 gene nusB 8423 7473 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_09440 8710 9105 gene locus_tag LOCUS_09450 8710 9105 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_09450 11667 9616 gene locus_tag LOCUS_09460 gene htpG 11667 9616 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_09460 12081 12878 gene locus_tag LOCUS_09470 12081 12878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_09470 12932 14533 gene locus_tag LOCUS_09480 12932 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948484.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence062 1276 254 gene locus_tag LOCUS_09490 gene galE 1276 254 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_09490 2954 1359 gene locus_tag LOCUS_09500 2954 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4563 2995 gene locus_tag LOCUS_09510 4563 2995 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263807.1 protein_id gnl|my_center|LOCUS_09510 4809 6326 gene locus_tag LOCUS_09520 4809 6326 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_09520 7684 6440 gene locus_tag LOCUS_09530 7684 6440 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_09530 12149 8124 gene locus_tag LOCUS_09540 12149 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 13887 12442 gene locus_tag LOCUS_09550 13887 12442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 14627 13884 gene locus_tag LOCUS_09560 14627 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence063 216 938 gene locus_tag LOCUS_09570 216 938 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797789.1 protein_id gnl|my_center|LOCUS_09570 1140 1739 gene locus_tag LOCUS_09580 1140 1739 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_09580 1813 2799 gene locus_tag LOCUS_09590 1813 2799 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_09590 3055 6459 gene locus_tag LOCUS_09600 3055 6459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_09600 6471 7880 gene locus_tag LOCUS_09610 6471 7880 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_09610 7936 8856 gene locus_tag LOCUS_09620 7936 8856 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_09620 8882 9811 gene locus_tag LOCUS_09630 8882 9811 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_09630 9921 11264 gene locus_tag LOCUS_09640 9921 11264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_09640 11494 12702 gene locus_tag LOCUS_09650 11494 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence064 514 3486 gene locus_tag LOCUS_09660 514 3486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_09660 3506 5068 gene locus_tag LOCUS_09670 3506 5068 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_09670 5087 6190 gene locus_tag LOCUS_09680 5087 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6193 7950 gene locus_tag LOCUS_09690 6193 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8060 11449 gene locus_tag LOCUS_09700 8060 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 13231 11846 gene locus_tag LOCUS_09710 13231 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 14096 13524 gene locus_tag LOCUS_09720 14096 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence065 1854 298 gene locus_tag LOCUS_09730 1854 298 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_09730 3375 1966 gene locus_tag LOCUS_09740 3375 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4592 3384 gene locus_tag LOCUS_09750 4592 3384 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_09750 5808 4618 gene locus_tag LOCUS_09760 5808 4618 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_09760 6283 7668 gene locus_tag LOCUS_09770 6283 7668 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_09770 7850 8545 gene locus_tag LOCUS_09780 7850 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 8563 11640 gene locus_tag LOCUS_09790 8563 11640 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_09790 11660 12379 gene locus_tag LOCUS_09800 11660 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence066 1017 481 gene locus_tag LOCUS_09810 1017 481 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_09810 1856 1008 gene locus_tag LOCUS_09820 1856 1008 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764221.1 protein_id gnl|my_center|LOCUS_09820 2509 1868 gene locus_tag LOCUS_09830 2509 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_09830 2599 4032 gene locus_tag LOCUS_09840 2599 4032 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_09840 5249 4029 gene locus_tag LOCUS_09850 5249 4029 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025517.1 protein_id gnl|my_center|LOCUS_09850 7040 5295 gene locus_tag LOCUS_09860 7040 5295 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_09860 7934 7062 gene locus_tag LOCUS_09870 gene rfbD 7934 7062 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_09870 8503 7943 gene locus_tag LOCUS_09880 gene rfbC 8503 7943 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_09880 9392 8505 gene locus_tag LOCUS_09890 gene rfbA 9392 8505 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_09890 10431 9484 gene locus_tag LOCUS_09900 10431 9484 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_09900 11839 10490 gene locus_tag LOCUS_09910 11839 10490 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_09910 12287 13273 gene locus_tag LOCUS_09920 12287 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 13921 13349 gene locus_tag LOCUS_09930 13921 13349 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence067 2362 2946 gene locus_tag LOCUS_09940 2362 2946 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_09940 2973 5837 gene locus_tag LOCUS_09950 2973 5837 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_09950 6152 8062 gene locus_tag LOCUS_09960 6152 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 8770 8237 gene locus_tag LOCUS_09970 8770 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 9495 12605 gene locus_tag LOCUS_09980 9495 12605 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_09980 13034 12576 gene locus_tag LOCUS_09990 13034 12576 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_09990 13828 13061 gene locus_tag LOCUS_10000 13828 13061 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence068 512 1039 gene locus_tag LOCUS_10010 512 1039 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_10010 1141 2445 gene locus_tag LOCUS_10020 1141 2445 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_10020 2598 4334 gene locus_tag LOCUS_10030 2598 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4454 5335 gene locus_tag LOCUS_10040 4454 5335 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_10040 5469 6014 gene locus_tag LOCUS_10050 5469 6014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786945.1 protein_id gnl|my_center|LOCUS_10050 6130 6417 gene locus_tag LOCUS_10060 6130 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6468 7190 gene locus_tag LOCUS_10070 6468 7190 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_10070 7190 7525 gene locus_tag LOCUS_10080 7190 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8708 9145 gene locus_tag LOCUS_10090 8708 9145 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107510.1 protein_id gnl|my_center|LOCUS_10090 9207 9971 gene locus_tag LOCUS_10100 9207 9971 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_10100 9965 10879 gene locus_tag LOCUS_10110 9965 10879 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_10110 11029 12054 gene locus_tag LOCUS_10120 gene cobD 11029 12054 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_10120 12036 12968 gene locus_tag LOCUS_10130 gene cbiB 12036 12968 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_10130 13069 13581 gene locus_tag LOCUS_10140 gene cobU 13069 13581 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence069 1098 1892 gene locus_tag LOCUS_10150 1098 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2354 3238 gene locus_tag LOCUS_10160 2354 3238 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_10160 3464 3919 gene locus_tag LOCUS_10170 3464 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4034 6073 gene locus_tag LOCUS_10180 4034 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_10180 6190 7173 gene locus_tag LOCUS_10190 6190 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7244 8491 gene locus_tag LOCUS_10200 7244 8491 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_10200 8650 9888 gene locus_tag LOCUS_10210 8650 9888 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202865.1 protein_id gnl|my_center|LOCUS_10210 10134 11465 gene locus_tag LOCUS_10220 10134 11465 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_10220 11496 12581 gene locus_tag LOCUS_10230 11496 12581 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence070 951 145 gene locus_tag LOCUS_10240 951 145 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_10240 3096 1012 gene locus_tag LOCUS_10250 3096 1012 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_10250 4396 3488 gene locus_tag LOCUS_10260 4396 3488 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_10260 6838 4397 gene locus_tag LOCUS_10270 6838 4397 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_10270 7214 7486 gene locus_tag LOCUS_10280 7214 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 7507 8334 gene locus_tag LOCUS_10290 7507 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8391 8921 gene locus_tag LOCUS_10300 8391 8921 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_10300 9351 8926 gene locus_tag LOCUS_10310 9351 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10011 10598 gene locus_tag LOCUS_10320 10011 10598 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_10320 10608 10973 gene locus_tag LOCUS_10330 10608 10973 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540506.1 protein_id gnl|my_center|LOCUS_10330 11224 12105 gene locus_tag LOCUS_10340 11224 12105 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211372.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence071 133 639 gene locus_tag LOCUS_10350 133 639 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_10350 1143 3407 gene locus_tag LOCUS_10360 1143 3407 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_10360 3477 4811 gene locus_tag LOCUS_10370 3477 4811 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_10370 7310 5514 gene locus_tag LOCUS_10380 7310 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 8003 7497 gene locus_tag LOCUS_10390 8003 7497 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_10390 8744 8022 gene locus_tag LOCUS_10400 8744 8022 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_10400 9414 8749 gene locus_tag LOCUS_10410 9414 8749 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_10410 10488 9841 gene locus_tag LOCUS_10420 10488 9841 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_10420 12358 10538 gene locus_tag LOCUS_10430 12358 10538 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_10430 12544 13626 gene locus_tag LOCUS_10440 12544 13626 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404432.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence072 2090 420 gene locus_tag LOCUS_10450 2090 420 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_10450 5351 2262 gene locus_tag LOCUS_10460 5351 2262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_10460 5728 5653 gene locus_tag LOCUS_t00080 5728 5653 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5829 6458 gene locus_tag LOCUS_10470 5829 6458 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_10470 7245 6460 gene locus_tag LOCUS_10480 7245 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 9189 7318 gene locus_tag LOCUS_10490 9189 7318 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_10490 9480 10391 gene locus_tag LOCUS_10500 gene gldA 9480 10391 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_10500 11084 12340 gene locus_tag LOCUS_10510 gene metK 11084 12340 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_10510 12659 12970 gene locus_tag LOCUS_10520 12659 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 13402 13025 gene locus_tag LOCUS_10530 13402 13025 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence073 319 924 gene locus_tag LOCUS_10540 319 924 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459262.1 protein_id gnl|my_center|LOCUS_10540 2939 1155 gene locus_tag LOCUS_10550 2939 1155 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_10550 4446 3271 gene locus_tag LOCUS_10560 4446 3271 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_10560 6946 4547 gene locus_tag LOCUS_10570 6946 4547 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_10570 8793 6982 gene locus_tag LOCUS_10580 8793 6982 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_10580 10238 9282 gene locus_tag LOCUS_10590 gene fmt 10238 9282 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_10590 10545 10378 gene locus_tag LOCUS_10600 10545 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 11017 10547 gene locus_tag LOCUS_10610 11017 10547 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_10610 12383 11010 gene locus_tag LOCUS_10620 12383 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 13001 12627 gene locus_tag LOCUS_10630 13001 12627 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence074 377 943 gene locus_tag LOCUS_10640 377 943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_10640 1359 937 gene locus_tag LOCUS_10650 1359 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1744 1370 gene locus_tag LOCUS_10660 1744 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2699 3097 gene locus_tag LOCUS_10670 2699 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3185 5485 gene locus_tag LOCUS_10680 3185 5485 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_10680 6354 5668 gene locus_tag LOCUS_10690 6354 5668 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_10690 7209 6364 gene locus_tag LOCUS_10700 7209 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 7386 9314 gene locus_tag LOCUS_10710 gene dnaG 7386 9314 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_10710 9380 9904 gene locus_tag LOCUS_10720 9380 9904 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783533.1 protein_id gnl|my_center|LOCUS_10720 10114 11943 gene locus_tag LOCUS_10730 10114 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 12240 13271 gene locus_tag LOCUS_10740 12240 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence075 443 1600 gene locus_tag LOCUS_10750 443 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1584 2876 gene locus_tag LOCUS_10760 1584 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2848 3918 gene locus_tag LOCUS_10770 2848 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3943 5244 gene locus_tag LOCUS_10780 3943 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6084 5719 gene locus_tag LOCUS_10790 6084 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5978 6652 gene locus_tag LOCUS_10800 5978 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 7179 8093 gene locus_tag LOCUS_10810 7179 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 8086 9204 gene locus_tag LOCUS_10820 8086 9204 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_10820 9201 10379 gene locus_tag LOCUS_10830 gene wecB 9201 10379 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_10830 10419 11432 gene locus_tag LOCUS_10840 10419 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 11498 12505 gene locus_tag LOCUS_10850 11498 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 12564 13313 gene locus_tag LOCUS_10860 12564 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021095.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence076 <1 2352 gene locus_tag LOCUS_10870 <1 2352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:MG2 domain-containing protein 3031 5265 gene locus_tag LOCUS_10880 gene pbpC 3031 5265 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_10880 5402 6388 gene locus_tag LOCUS_10890 5402 6388 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_10890 6504 7847 gene locus_tag LOCUS_10900 6504 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8659 7961 gene locus_tag LOCUS_10910 8659 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8917 9642 gene locus_tag LOCUS_10920 gene rluF 8917 9642 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence077 2175 4520 gene locus_tag LOCUS_10930 2175 4520 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_10930 4844 5818 gene locus_tag LOCUS_10940 4844 5818 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_10940 5913 7424 gene locus_tag LOCUS_10950 gene atpD 5913 7424 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_10950 7533 7772 gene locus_tag LOCUS_10960 gene atpC 7533 7772 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_10960 8006 9043 gene locus_tag LOCUS_10970 8006 9043 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_10970 9160 9825 gene locus_tag LOCUS_10980 9160 9825 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_10980 10272 11546 gene locus_tag LOCUS_10990 10272 11546 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_10990 12074 12871 gene locus_tag LOCUS_11000 12074 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 13097 12900 gene locus_tag LOCUS_11010 13097 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence078 769 164 gene locus_tag LOCUS_11020 769 164 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938535.1 protein_id gnl|my_center|LOCUS_11020 1064 792 gene locus_tag LOCUS_11030 1064 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2691 1225 gene locus_tag LOCUS_11040 2691 1225 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791109.1 protein_id gnl|my_center|LOCUS_11040 4057 2696 gene locus_tag LOCUS_11050 4057 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5784 4045 gene locus_tag LOCUS_11060 5784 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11060 6845 6573 gene locus_tag LOCUS_11070 6845 6573 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_11070 7189 8250 gene locus_tag LOCUS_11080 7189 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8285 11449 gene locus_tag LOCUS_11090 8285 11449 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_11090 11490 12776 gene locus_tag LOCUS_11100 11490 12776 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence079 800 147 gene locus_tag LOCUS_11110 gene elbB 800 147 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_11110 907 1473 gene locus_tag LOCUS_11120 gene thpR 907 1473 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_11120 2562 1522 gene locus_tag LOCUS_11130 2562 1522 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_11130 2865 3512 gene locus_tag LOCUS_11140 2865 3512 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_11140 3854 6742 gene locus_tag LOCUS_11150 gene gcvP 3854 6742 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_11150 8105 7134 gene locus_tag LOCUS_11160 8105 7134 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_11160 9178 8123 gene locus_tag LOCUS_11170 9178 8123 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_11170 10021 9194 gene locus_tag LOCUS_11180 10021 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11194 10574 gene locus_tag LOCUS_11190 gene rsmG 11194 10574 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_11190 11874 11260 gene locus_tag LOCUS_11200 11874 11260 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_11200 12998 11874 gene locus_tag LOCUS_11210 12998 11874 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107806.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence080 999 187 gene locus_tag LOCUS_11220 999 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2792 996 gene locus_tag LOCUS_11230 2792 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3987 2773 gene locus_tag LOCUS_11240 3987 2773 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108247.1 protein_id gnl|my_center|LOCUS_11240 4249 4034 gene locus_tag LOCUS_11250 4249 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4880 5587 gene locus_tag LOCUS_11260 4880 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6434 5652 gene locus_tag LOCUS_11270 6434 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6596 7351 gene locus_tag LOCUS_11280 6596 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 7378 8109 gene locus_tag LOCUS_11290 7378 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 8898 9170 gene locus_tag LOCUS_11300 8898 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11300 9205 9960 gene locus_tag LOCUS_11310 9205 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 10113 12794 gene locus_tag LOCUS_11320 10113 12794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence081 3 203 gene locus_tag LOCUS_11330 3 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 479 3541 gene locus_tag LOCUS_11340 479 3541 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_11340 3616 4200 gene locus_tag LOCUS_11350 3616 4200 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_11350 4357 5625 gene locus_tag LOCUS_11360 gene purD 4357 5625 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_11360 5684 6658 gene locus_tag LOCUS_11370 5684 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8584 6713 gene locus_tag LOCUS_11380 8584 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9821 8742 gene locus_tag LOCUS_11390 9821 8742 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555792.1 protein_id gnl|my_center|LOCUS_11390 10132 12354 gene locus_tag LOCUS_11400 10132 12354 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence082 205 26 gene locus_tag LOCUS_11410 205 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 273 1397 gene locus_tag LOCUS_11420 273 1397 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815413.1 protein_id gnl|my_center|LOCUS_11420 2200 1817 gene locus_tag LOCUS_11430 2200 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3362 2652 gene locus_tag LOCUS_11440 3362 2652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_11440 5124 3682 gene locus_tag LOCUS_11450 5124 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7057 5678 gene locus_tag LOCUS_11460 7057 5678 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_11460 7647 9278 gene locus_tag LOCUS_11470 7647 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9404 9871 gene locus_tag LOCUS_11480 9404 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9970 10404 gene locus_tag LOCUS_11490 9970 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 10898 10401 gene locus_tag LOCUS_11500 10898 10401 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_11500 11641 12735 gene locus_tag LOCUS_11510 11641 12735 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence083 1677 388 gene locus_tag LOCUS_11520 1677 388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_11520 3349 2027 gene locus_tag LOCUS_11530 3349 2027 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_11530 4618 3623 gene locus_tag LOCUS_11540 4618 3623 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_11540 5558 4668 gene locus_tag LOCUS_11550 5558 4668 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_11550 7101 5629 gene locus_tag LOCUS_11560 7101 5629 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_11560 7321 8151 gene locus_tag LOCUS_11570 7321 8151 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_11570 8161 8985 gene locus_tag LOCUS_11580 gene murQ 8161 8985 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_11580 10410 9037 gene locus_tag LOCUS_11590 10410 9037 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_11590 11170 12372 gene locus_tag LOCUS_11600 11170 12372 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence084 271 183 gene locus_tag LOCUS_t00090 271 183 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2271 655 gene locus_tag LOCUS_11610 2271 655 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_11610 2692 3390 gene locus_tag LOCUS_11620 2692 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3724 4764 gene locus_tag LOCUS_11630 3724 4764 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 protein_id gnl|my_center|LOCUS_11630 5826 6776 gene locus_tag LOCUS_11640 5826 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7762 6854 gene locus_tag LOCUS_11650 7762 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7958 8854 gene locus_tag LOCUS_11660 7958 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9215 8994 gene locus_tag LOCUS_11670 9215 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 9654 9226 gene locus_tag LOCUS_11680 9654 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 9989 9630 gene locus_tag LOCUS_11690 9989 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 10370 11212 gene locus_tag LOCUS_11700 gene phnX 10370 11212 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687375.1 protein_id gnl|my_center|LOCUS_11700 11263 12372 gene locus_tag LOCUS_11710 gene phnW 11263 12372 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203965.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence085 807 106 gene locus_tag LOCUS_11720 807 106 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_11720 2399 807 gene locus_tag LOCUS_11730 2399 807 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_11730 3265 2516 gene locus_tag LOCUS_11740 gene kdsB 3265 2516 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_11740 4459 3284 gene locus_tag LOCUS_11750 4459 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4639 5880 gene locus_tag LOCUS_11760 4639 5880 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_11760 5911 6423 gene locus_tag LOCUS_11770 5911 6423 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_11770 6428 7444 gene locus_tag LOCUS_11780 6428 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7451 7792 gene locus_tag LOCUS_11790 gene secG 7451 7792 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_11790 8033 8311 gene locus_tag LOCUS_11800 8033 8311 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_11800 8348 9985 gene locus_tag LOCUS_11810 gene groL 8348 9985 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_11810 11624 10077 gene locus_tag LOCUS_11820 11624 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 11798 12157 gene locus_tag LOCUS_11830 11798 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence086 <1 939 gene locus_tag LOCUS_11840 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986381.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB 936 2219 gene locus_tag LOCUS_11850 gene mtaB 936 2219 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_11850 3377 2265 gene locus_tag LOCUS_11860 3377 2265 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_11860 3680 4030 gene locus_tag LOCUS_11870 gene rpsF 3680 4030 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_11870 4034 4303 gene locus_tag LOCUS_11880 gene rpsR 4034 4303 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_11880 4327 4770 gene locus_tag LOCUS_11890 gene rplI 4327 4770 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_11890 5389 4886 gene locus_tag LOCUS_11900 5389 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5594 6301 gene locus_tag LOCUS_11910 5594 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7195 6326 gene locus_tag LOCUS_11920 7195 6326 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 protein_id gnl|my_center|LOCUS_11920 7665 7192 gene locus_tag LOCUS_11930 7665 7192 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203605.1 protein_id gnl|my_center|LOCUS_11930 7884 7675 gene locus_tag LOCUS_11940 7884 7675 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358328.1 protein_id gnl|my_center|LOCUS_11940 8286 8056 gene locus_tag LOCUS_11950 8286 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8293 9132 gene locus_tag LOCUS_11960 8293 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 9145 10053 gene locus_tag LOCUS_11970 gene cysK 9145 10053 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_11970 10867 10238 gene locus_tag LOCUS_11980 10867 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 11657 10980 gene locus_tag LOCUS_11990 11657 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <12544 11661 gene locus_tag LOCUS_12000 <12544 11661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784442.1:ABC transporter permease >Feature sequence087 570 1457 gene locus_tag LOCUS_12010 570 1457 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_12010 2203 1511 gene locus_tag LOCUS_12020 2203 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_12020 2380 3483 gene locus_tag LOCUS_12030 gene recF 2380 3483 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_12030 3589 3879 gene locus_tag LOCUS_12040 3589 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4347 3928 gene locus_tag LOCUS_12050 4347 3928 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_12050 4648 5682 gene locus_tag LOCUS_12060 4648 5682 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_12060 6799 6092 gene locus_tag LOCUS_12070 6799 6092 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_12070 6985 7917 gene locus_tag LOCUS_12080 6985 7917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 7949 8713 gene locus_tag LOCUS_12090 7949 8713 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_12090 9979 8807 gene locus_tag LOCUS_12100 9979 8807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940860.1 protein_id gnl|my_center|LOCUS_12100 10196 12007 gene locus_tag LOCUS_12110 10196 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 12419 12494 gene locus_tag LOCUS_t00100 12419 12494 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 266 1414 gene locus_tag LOCUS_12120 266 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1418 2455 gene locus_tag LOCUS_12130 1418 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2571 3620 gene locus_tag LOCUS_12140 2571 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3905 4660 gene locus_tag LOCUS_12150 3905 4660 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963577.1 protein_id gnl|my_center|LOCUS_12150 4667 5197 gene locus_tag LOCUS_12160 gene cobC 4667 5197 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_12160 5745 6614 gene locus_tag LOCUS_12170 5745 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6719 7453 gene locus_tag LOCUS_12180 6719 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787597.1 protein_id gnl|my_center|LOCUS_12180 7612 8019 gene locus_tag LOCUS_12190 7612 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 8415 10676 gene locus_tag LOCUS_12200 8415 10676 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_12200 10965 11570 gene locus_tag LOCUS_12210 10965 11570 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence089 241 1923 gene locus_tag LOCUS_12220 241 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1949 3421 gene locus_tag LOCUS_12230 1949 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5349 3685 gene locus_tag LOCUS_12240 5349 3685 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_12240 8782 5414 gene locus_tag LOCUS_12250 8782 5414 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_12250 10313 9123 gene locus_tag LOCUS_12260 10313 9123 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_12260 11649 11083 gene locus_tag LOCUS_12270 11649 11083 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_12270 12121 12366 gene locus_tag LOCUS_12280 12121 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence090 4327 3287 gene locus_tag LOCUS_12290 4327 3287 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_12290 6174 4330 gene locus_tag LOCUS_12300 6174 4330 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_12300 7409 6531 gene locus_tag LOCUS_12310 7409 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 8934 7435 gene locus_tag LOCUS_12320 8934 7435 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_12320 12150 8947 gene locus_tag LOCUS_12330 12150 8947 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence091 463 314 gene locus_tag LOCUS_12340 463 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1122 601 gene locus_tag LOCUS_12350 1122 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 2562 1216 gene locus_tag LOCUS_12360 2562 1216 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_12360 2957 3676 gene locus_tag LOCUS_12370 2957 3676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_12370 3698 4951 gene locus_tag LOCUS_12380 3698 4951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_12380 5008 6258 gene locus_tag LOCUS_12390 5008 6258 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_12390 6290 7426 gene locus_tag LOCUS_12400 6290 7426 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_12400 7525 8886 gene locus_tag LOCUS_12410 7525 8886 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_12410 9115 9828 gene locus_tag LOCUS_12420 gene tsaB 9115 9828 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_12420 9846 10610 gene locus_tag LOCUS_12430 9846 10610 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_12430 11361 11930 gene locus_tag LOCUS_12440 gene efp 11361 11930 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence092 775 5 gene locus_tag LOCUS_12450 gene modA 775 5 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101984.1 protein_id gnl|my_center|LOCUS_12450 962 1636 gene locus_tag LOCUS_12460 962 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2262 1588 gene locus_tag LOCUS_12470 2262 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3122 2418 gene locus_tag LOCUS_12480 3122 2418 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081905.1 protein_id gnl|my_center|LOCUS_12480 3851 3285 gene locus_tag LOCUS_12490 3851 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6551 4002 gene locus_tag LOCUS_12500 gene ppc 6551 4002 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_12500 6757 7770 gene locus_tag LOCUS_12510 6757 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7828 9279 gene locus_tag LOCUS_12520 7828 9279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_12520 9276 9701 gene locus_tag LOCUS_12530 9276 9701 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_12530 9739 10182 gene locus_tag LOCUS_12540 9739 10182 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_12540 10670 12148 gene locus_tag LOCUS_12550 10670 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence093 81 470 gene locus_tag LOCUS_12560 81 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964284.1 protein_id gnl|my_center|LOCUS_12560 580 1431 gene locus_tag LOCUS_12570 580 1431 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 protein_id gnl|my_center|LOCUS_12570 1636 1563 gene locus_tag LOCUS_t00110 1636 1563 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1889 2332 gene locus_tag LOCUS_12580 1889 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2662 2372 gene locus_tag LOCUS_12590 gene raiA 2662 2372 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_12590 4311 3292 gene locus_tag LOCUS_12600 4311 3292 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_12600 4636 5478 gene locus_tag LOCUS_12610 gene kduI 4636 5478 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_12610 5511 6302 gene locus_tag LOCUS_12620 5511 6302 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_12620 6508 7770 gene locus_tag LOCUS_12630 6508 7770 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_12630 7877 9997 gene locus_tag LOCUS_12640 7877 9997 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674964.1 protein_id gnl|my_center|LOCUS_12640 10068 11108 gene locus_tag LOCUS_12650 10068 11108 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_12650 11200 11868 gene locus_tag LOCUS_12660 11200 11868 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence094 3203 951 gene locus_tag LOCUS_12670 3203 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 5112 3700 gene locus_tag LOCUS_12680 5112 3700 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_12680 8571 5131 gene locus_tag LOCUS_12690 8571 5131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_12690 10690 9503 gene locus_tag LOCUS_12700 10690 9503 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_12700 11303 10740 gene locus_tag LOCUS_12710 11303 10740 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence095 950 624 gene locus_tag LOCUS_12720 950 624 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_12720 5422 1160 gene locus_tag LOCUS_12730 gene rpoC 5422 1160 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_12730 9318 5506 gene locus_tag LOCUS_12740 gene rpoB 9318 5506 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_12740 9798 9424 gene locus_tag LOCUS_12750 gene rplL 9798 9424 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963313.1 protein_id gnl|my_center|LOCUS_12750 10356 9838 gene locus_tag LOCUS_12760 gene rplJ 10356 9838 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_12760 11078 10386 gene locus_tag LOCUS_12770 gene rplA 11078 10386 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_12770 11542 11099 gene locus_tag LOCUS_12780 gene rplK 11542 11099 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_12780 12005 11568 gene locus_tag LOCUS_12790 gene nusG 12005 11568 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12790 >Feature sequence096 <1 2216 gene locus_tag LOCUS_12800 <1 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785391.1:glutamine synthetase III 2567 4798 gene locus_tag LOCUS_12810 2567 4798 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_12810 4900 6069 gene locus_tag LOCUS_12820 4900 6069 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_12820 6457 6125 gene locus_tag LOCUS_12830 6457 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7037 8122 gene locus_tag LOCUS_12840 gene prfA 7037 8122 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_12840 8247 9074 gene locus_tag LOCUS_12850 gene pyrF 8247 9074 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_12850 9187 10473 gene locus_tag LOCUS_12860 9187 10473 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_12860 10537 11571 gene locus_tag LOCUS_12870 10537 11571 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931815.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence097 35 472 gene locus_tag LOCUS_12880 35 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 567 1517 gene locus_tag LOCUS_12890 567 1517 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_12890 1510 1734 gene locus_tag LOCUS_12900 1510 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1749 3011 gene locus_tag LOCUS_12910 1749 3011 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_12910 3329 3150 gene locus_tag LOCUS_12920 3329 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3613 3540 gene locus_tag LOCUS_t00120 3613 3540 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3726 3653 gene locus_tag LOCUS_t00130 3726 3653 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6134 3921 gene locus_tag LOCUS_12930 6134 3921 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_12930 6517 8469 gene locus_tag LOCUS_12940 gene thrS 6517 8469 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_12940 8660 9046 gene locus_tag LOCUS_12950 8660 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 9373 9726 gene locus_tag LOCUS_12960 gene rplT 9373 9726 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_12960 11513 9801 gene locus_tag LOCUS_12970 11513 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106069478.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence098 1859 78 gene locus_tag LOCUS_12980 1859 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_12980 2678 2226 gene locus_tag LOCUS_12990 2678 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3316 2753 gene locus_tag LOCUS_13000 3316 2753 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_13000 3633 3956 gene locus_tag LOCUS_13010 gene trxA 3633 3956 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_13010 4845 4021 gene locus_tag LOCUS_13020 4845 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5228 6346 gene locus_tag LOCUS_13030 5228 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_13030 6777 7208 gene locus_tag LOCUS_13040 6777 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8177 8644 gene locus_tag LOCUS_13050 gene nuoE 8177 8644 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874113.1 protein_id gnl|my_center|LOCUS_13050 8688 9875 gene locus_tag LOCUS_13060 8688 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9924 11714 gene locus_tag LOCUS_13070 9924 11714 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence099 295 750 gene locus_tag LOCUS_13080 295 750 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_13080 889 2274 gene locus_tag LOCUS_13090 889 2274 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence100 116 880 gene locus_tag LOCUS_13100 116 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_13100 1675 842 gene locus_tag LOCUS_13110 1675 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1939 2934 gene locus_tag LOCUS_13120 gene dusB 1939 2934 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797153.1 protein_id gnl|my_center|LOCUS_13120 3902 3249 gene locus_tag LOCUS_13130 3902 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4552 3902 gene locus_tag LOCUS_13140 4552 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5965 4859 gene locus_tag LOCUS_13150 5965 4859 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_13150 6424 6089 gene locus_tag LOCUS_13160 gene rbfA 6424 6089 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_13160 6607 7050 gene locus_tag LOCUS_13170 6607 7050 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_13170 7418 8410 gene locus_tag LOCUS_13180 gene trpS 7418 8410 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_13180 8841 9491 gene locus_tag LOCUS_13190 8841 9491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 10038 9535 gene locus_tag LOCUS_13200 10038 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11114 10041 gene locus_tag LOCUS_13210 gene buk 11114 10041 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230311.1 protein_id gnl|my_center|LOCUS_13210 <11775 11125 gene locus_tag LOCUS_13220 <11775 11125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202917.1:DUF169 domain-containing protein >Feature sequence101 340 2409 gene locus_tag LOCUS_13230 340 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 2495 3919 gene locus_tag LOCUS_13240 2495 3919 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_13240 4136 4642 gene locus_tag LOCUS_13250 4136 4642 CDS product DUF6155 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963095.1 protein_id gnl|my_center|LOCUS_13250 5580 4639 gene locus_tag LOCUS_13260 5580 4639 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_13260 6347 5961 gene locus_tag LOCUS_13270 6347 5961 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990602.1 protein_id gnl|my_center|LOCUS_13270 6911 6354 gene locus_tag LOCUS_13280 gene fldA 6911 6354 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_13280 7175 8785 gene locus_tag LOCUS_13290 7175 8785 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_13290 9070 9528 gene locus_tag LOCUS_13300 9070 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9635 10588 gene locus_tag LOCUS_13310 9635 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 >Feature sequence102 2723 171 gene locus_tag LOCUS_13320 gene acnB 2723 171 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_13320 3914 2907 gene locus_tag LOCUS_13330 gene gap 3914 2907 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_13330 4458 6155 gene locus_tag LOCUS_13340 4458 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7069 6509 gene locus_tag LOCUS_13350 7069 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 7354 10248 gene locus_tag LOCUS_13360 7354 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 10776 11147 gene locus_tag LOCUS_13370 10776 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence103 1059 46 gene locus_tag LOCUS_13380 1059 46 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_13380 1319 2788 gene locus_tag LOCUS_13390 1319 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2925 4100 gene locus_tag LOCUS_13400 2925 4100 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_13400 4668 6101 gene locus_tag LOCUS_13410 gene hydG 4668 6101 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_13410 6189 6452 gene locus_tag LOCUS_13420 6189 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10417 6620 gene locus_tag LOCUS_13430 10417 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 <11630 10845 gene locus_tag LOCUS_13440 <11630 10845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048412.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydE >Feature sequence104 3361 548 gene locus_tag LOCUS_13450 3361 548 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_13450 4856 3612 gene locus_tag LOCUS_13460 4856 3612 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_13460 6516 4927 gene locus_tag LOCUS_13470 6516 4927 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_13470 9814 6671 gene locus_tag LOCUS_13480 9814 6671 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence105 992 321 gene locus_tag LOCUS_13490 992 321 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_13490 1458 1979 gene locus_tag LOCUS_13500 1458 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2467 3690 gene locus_tag LOCUS_13510 2467 3690 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786608.1 protein_id gnl|my_center|LOCUS_13510 3821 4720 gene locus_tag LOCUS_13520 3821 4720 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_13520 4831 6099 gene locus_tag LOCUS_13530 4831 6099 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_13530 6110 7213 gene locus_tag LOCUS_13540 6110 7213 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_13540 7298 9625 gene locus_tag LOCUS_13550 7298 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9686 10318 gene locus_tag LOCUS_13560 9686 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 10388 11353 gene locus_tag LOCUS_13570 10388 11353 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence106 849 208 gene locus_tag LOCUS_13580 849 208 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_13580 3539 1146 gene locus_tag LOCUS_13590 3539 1146 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_13590 4346 3666 gene locus_tag LOCUS_13600 4346 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4789 5745 gene locus_tag LOCUS_13610 gene arcC 4789 5745 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_13610 5840 6841 gene locus_tag LOCUS_13620 5840 6841 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_13620 7169 6960 gene locus_tag LOCUS_13630 7169 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9686 7176 gene locus_tag LOCUS_13640 gene feoB 9686 7176 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_13640 11347 10028 gene locus_tag LOCUS_13650 11347 10028 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence107 2103 850 gene locus_tag LOCUS_13660 gene hemA 2103 850 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_13660 2802 3089 gene locus_tag LOCUS_13670 2802 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3614 3090 gene locus_tag LOCUS_13680 3614 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5292 3601 gene locus_tag LOCUS_13690 5292 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7383 5551 gene locus_tag LOCUS_13700 7383 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9951 7546 gene locus_tag LOCUS_13710 9951 7546 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_13710 11197 10067 gene locus_tag LOCUS_13720 11197 10067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence108 4375 5364 gene locus_tag LOCUS_13730 4375 5364 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_13730 6646 5420 gene locus_tag LOCUS_13740 gene hflX 6646 5420 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_13740 7516 6833 gene locus_tag LOCUS_13750 7516 6833 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_13750 8134 8209 gene locus_tag LOCUS_t00140 8134 8209 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9720 8509 gene locus_tag LOCUS_13760 9720 8509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_13760 10758 10540 gene locus_tag LOCUS_13770 10758 10540 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681617.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence109 2175 967 gene locus_tag LOCUS_13780 2175 967 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_13780 3378 2332 gene locus_tag LOCUS_13790 3378 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3985 7032 gene locus_tag LOCUS_13800 3985 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 8890 7175 gene locus_tag LOCUS_13810 8890 7175 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_13810 10046 9027 gene locus_tag LOCUS_13820 10046 9027 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_13820 11024 10149 gene locus_tag LOCUS_13830 11024 10149 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence110 301 1869 gene locus_tag LOCUS_13840 301 1869 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_13840 2896 2003 gene locus_tag LOCUS_13850 2896 2003 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_13850 3110 5434 gene locus_tag LOCUS_13860 3110 5434 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_13860 5556 6689 gene locus_tag LOCUS_13870 gene fbaA 5556 6689 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 protein_id gnl|my_center|LOCUS_13870 6837 8204 gene locus_tag LOCUS_13880 6837 8204 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_13880 8264 9343 gene locus_tag LOCUS_13890 8264 9343 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_13890 9526 9717 gene locus_tag LOCUS_13900 gene rpsU 9526 9717 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_13900 9795 10673 gene locus_tag LOCUS_13910 gene xerC 9795 10673 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_13910 10692 10988 gene locus_tag LOCUS_13920 gene raiA 10692 10988 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_13920 11096 11170 gene locus_tag LOCUS_t00150 11096 11170 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11186 11269 gene locus_tag LOCUS_t00160 11186 11269 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11306 11379 gene locus_tag LOCUS_t00170 11306 11379 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111 1150 116 gene locus_tag LOCUS_13930 1150 116 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_13930 2522 1281 gene locus_tag LOCUS_13940 2522 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4113 2665 gene locus_tag LOCUS_13950 4113 2665 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_13950 7757 4236 gene locus_tag LOCUS_13960 7757 4236 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107855.1 protein_id gnl|my_center|LOCUS_13960 9110 7914 gene locus_tag LOCUS_13970 9110 7914 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_13970 9171 9335 gene locus_tag LOCUS_13980 9171 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 9988 9440 gene locus_tag LOCUS_13990 9988 9440 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769868.1 protein_id gnl|my_center|LOCUS_13990 10627 10400 gene locus_tag LOCUS_14000 10627 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 11009 10824 gene locus_tag LOCUS_14010 11009 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence112 1174 317 gene locus_tag LOCUS_14020 1174 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2082 1210 gene locus_tag LOCUS_14030 2082 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4803 2146 gene locus_tag LOCUS_14040 4803 2146 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_14040 5130 4912 gene locus_tag LOCUS_14050 5130 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5729 7384 gene locus_tag LOCUS_14060 5729 7384 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_14060 10106 7929 gene locus_tag LOCUS_14070 10106 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 10149 11084 gene locus_tag LOCUS_14080 10149 11084 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence113 2524 173 gene locus_tag LOCUS_14090 2524 173 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_14090 3409 2567 gene locus_tag LOCUS_14100 3409 2567 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_14100 3887 3423 gene locus_tag LOCUS_14110 3887 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4444 4043 gene locus_tag LOCUS_14120 4444 4043 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_14120 6767 4554 gene locus_tag LOCUS_14130 6767 4554 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_14130 7347 7162 gene locus_tag LOCUS_14140 7347 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 9503 7428 gene locus_tag LOCUS_14150 9503 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 11108 9714 gene locus_tag LOCUS_14160 11108 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence114 725 1294 gene locus_tag LOCUS_14170 725 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1531 2493 gene locus_tag LOCUS_14180 1531 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3088 3387 gene locus_tag LOCUS_14190 3088 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3454 4548 gene locus_tag LOCUS_14200 3454 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6222 4672 gene locus_tag LOCUS_14210 6222 4672 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_14210 6756 6472 gene locus_tag LOCUS_14220 6756 6472 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_14220 6907 7956 gene locus_tag LOCUS_14230 gene mutY 6907 7956 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291960.1 protein_id gnl|my_center|LOCUS_14230 8032 8457 gene locus_tag LOCUS_14240 gene ssb 8032 8457 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_14240 8583 9821 gene locus_tag LOCUS_14250 8583 9821 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_14250 9852 10436 gene locus_tag LOCUS_14260 gene gldD 9852 10436 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_14260 10450 11091 gene locus_tag LOCUS_14270 10450 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence115 2270 45 gene locus_tag LOCUS_14280 2270 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2833 4338 gene locus_tag LOCUS_14290 2833 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5323 4721 gene locus_tag LOCUS_14300 gene plsY 5323 4721 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986658.1 protein_id gnl|my_center|LOCUS_14300 5796 5320 gene locus_tag LOCUS_14310 5796 5320 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_14310 6623 5898 gene locus_tag LOCUS_14320 6623 5898 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732640.1 protein_id gnl|my_center|LOCUS_14320 8646 6862 gene locus_tag LOCUS_14330 8646 6862 CDS product DegV family EDD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905447.1 protein_id gnl|my_center|LOCUS_14330 9588 9007 gene locus_tag LOCUS_14340 9588 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10855 9581 gene locus_tag LOCUS_14350 10855 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence116 <1 3105 gene locus_tag LOCUS_14360 <1 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108737.1:TonB-dependent receptor 3111 4550 gene locus_tag LOCUS_14370 3111 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5402 5710 gene locus_tag LOCUS_14380 5402 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 6626 6225 gene locus_tag LOCUS_14390 6626 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6963 7961 gene locus_tag LOCUS_14400 6963 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 8559 9083 gene locus_tag LOCUS_14410 8559 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 9331 9074 gene locus_tag LOCUS_14420 9331 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 9369 10127 gene locus_tag LOCUS_14430 9369 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence117 2740 2814 gene locus_tag LOCUS_t00180 2740 2814 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3592 3119 gene locus_tag LOCUS_14440 3592 3119 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_14440 4083 3592 gene locus_tag LOCUS_14450 4083 3592 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_14450 4664 4215 gene locus_tag LOCUS_14460 4664 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_14460 5492 4674 gene locus_tag LOCUS_14470 5492 4674 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_14470 6741 5707 gene locus_tag LOCUS_14480 6741 5707 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_14480 7520 6753 gene locus_tag LOCUS_14490 7520 6753 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_14490 9030 7696 gene locus_tag LOCUS_14500 gene gdhA 9030 7696 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_14500 10340 9234 gene locus_tag LOCUS_14510 gene dprA 10340 9234 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_14510 10983 10390 gene locus_tag LOCUS_14520 10983 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence118 1542 595 gene locus_tag LOCUS_14530 1542 595 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_14530 2299 1517 gene locus_tag LOCUS_14540 2299 1517 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_14540 2903 2457 gene locus_tag LOCUS_14550 2903 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4551 3313 gene locus_tag LOCUS_14560 4551 3313 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_14560 6233 4722 gene locus_tag LOCUS_14570 gene nrfA 6233 4722 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_14570 6852 6253 gene locus_tag LOCUS_14580 gene nrfH 6852 6253 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201985.1 protein_id gnl|my_center|LOCUS_14580 8100 6883 gene locus_tag LOCUS_14590 8100 6883 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence119 386 216 gene locus_tag LOCUS_14600 386 216 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_14600 1757 576 gene locus_tag LOCUS_14610 1757 576 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_14610 2171 3268 gene locus_tag LOCUS_14620 2171 3268 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_14620 3439 4572 gene locus_tag LOCUS_14630 gene meaB 3439 4572 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_14630 4668 5762 gene locus_tag LOCUS_14640 4668 5762 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_14640 5977 6849 gene locus_tag LOCUS_14650 5977 6849 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797001.1 protein_id gnl|my_center|LOCUS_14650 6864 7595 gene locus_tag LOCUS_14660 6864 7595 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_14660 7597 8439 gene locus_tag LOCUS_14670 7597 8439 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_14670 8541 9935 gene locus_tag LOCUS_14680 gene lpdA 8541 9935 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence120 <1 1389 gene locus_tag LOCUS_14690 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1847 1500 gene locus_tag LOCUS_14700 gene rplS 1847 1500 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_14700 1903 2091 gene locus_tag LOCUS_14710 1903 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2724 3050 gene locus_tag LOCUS_14720 2724 3050 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_14720 3354 3734 gene locus_tag LOCUS_14730 3354 3734 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_14730 3760 4842 gene locus_tag LOCUS_14740 gene acr3 3760 4842 CDS product arsenite efflux transporter Acr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398718.1 protein_id gnl|my_center|LOCUS_14740 4941 6473 gene locus_tag LOCUS_14750 4941 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6500 7186 gene locus_tag LOCUS_14760 6500 7186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564199.1 protein_id gnl|my_center|LOCUS_14760 7754 8119 gene locus_tag LOCUS_14770 7754 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8137 9219 gene locus_tag LOCUS_14780 8137 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 9239 10270 gene locus_tag LOCUS_14790 9239 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence121 4744 3581 gene locus_tag LOCUS_14800 4744 3581 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_14800 5385 4831 gene locus_tag LOCUS_14810 5385 4831 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_14810 6713 5538 gene locus_tag LOCUS_14820 6713 5538 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_14820 7088 6735 gene locus_tag LOCUS_14830 7088 6735 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_14830 7479 7880 gene locus_tag LOCUS_14840 7479 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 8242 7877 gene locus_tag LOCUS_14850 8242 7877 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_14850 9153 8242 gene locus_tag LOCUS_14860 9153 8242 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence122 1 1299 gene locus_tag LOCUS_14870 1 1299 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_14870 1332 2282 gene locus_tag LOCUS_14880 1332 2282 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_14880 2435 3319 gene locus_tag LOCUS_14890 2435 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3330 3698 gene locus_tag LOCUS_14900 3330 3698 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_14900 4080 5561 gene locus_tag LOCUS_14910 4080 5561 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_14910 5662 6096 gene locus_tag LOCUS_14920 gene dut 5662 6096 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784036.1 protein_id gnl|my_center|LOCUS_14920 6190 7194 gene locus_tag LOCUS_14930 6190 7194 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_14930 7202 8974 gene locus_tag LOCUS_14940 7202 8974 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_14940 8964 9827 gene locus_tag LOCUS_14950 8964 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence123 2730 628 gene locus_tag LOCUS_14960 gene recQ 2730 628 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_14960 2981 4159 gene locus_tag LOCUS_14970 2981 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_14970 7007 4494 gene locus_tag LOCUS_14980 7007 4494 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_14980 7781 7134 gene locus_tag LOCUS_14990 7781 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 10397 7842 gene locus_tag LOCUS_15000 10397 7842 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186922643.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence124 567 1406 gene locus_tag LOCUS_15010 567 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1502 2611 gene locus_tag LOCUS_15020 1502 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090662474.1 protein_id gnl|my_center|LOCUS_15020 2618 3283 gene locus_tag LOCUS_15030 2618 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3342 4517 gene locus_tag LOCUS_15040 3342 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 4469 4876 gene locus_tag LOCUS_15050 4469 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4860 5348 gene locus_tag LOCUS_15060 4860 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5338 6480 gene locus_tag LOCUS_15070 5338 6480 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_15070 6575 6988 gene locus_tag LOCUS_15080 6575 6988 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_15080 6995 7489 gene locus_tag LOCUS_15090 6995 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 7480 8907 gene locus_tag LOCUS_15100 7480 8907 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence125 513 1205 gene locus_tag LOCUS_15110 513 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2499 1195 gene locus_tag LOCUS_15120 2499 1195 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_15120 2678 3280 gene locus_tag LOCUS_15130 2678 3280 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_15130 3373 3990 gene locus_tag LOCUS_15140 3373 3990 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770533.1 protein_id gnl|my_center|LOCUS_15140 5414 4320 gene locus_tag LOCUS_15150 5414 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 5587 6159 gene locus_tag LOCUS_15160 5587 6159 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_15160 6244 6912 gene locus_tag LOCUS_15170 6244 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 8307 7330 gene locus_tag LOCUS_15180 gene bioB 8307 7330 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_15180 8594 8328 gene locus_tag LOCUS_15190 8594 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 10189 8900 gene locus_tag LOCUS_15200 10189 8900 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence126 <1 822 gene locus_tag LOCUS_15210 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814920.1:MFS transporter 843 1490 gene locus_tag LOCUS_15220 gene pgmB 843 1490 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_15220 1564 3876 gene locus_tag LOCUS_15230 1564 3876 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_15230 3947 5812 gene locus_tag LOCUS_15240 3947 5812 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_15240 5848 8256 gene locus_tag LOCUS_15250 5848 8256 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_15250 8256 9899 gene locus_tag LOCUS_15260 8256 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence127 497 1837 gene locus_tag LOCUS_15270 gene trkA 497 1837 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_15270 1921 3369 gene locus_tag LOCUS_15280 1921 3369 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_15280 3820 3326 gene locus_tag LOCUS_15290 3820 3326 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_15290 5116 3839 gene locus_tag LOCUS_15300 5116 3839 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_15300 5912 5037 gene locus_tag LOCUS_15310 5912 5037 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406949.1 protein_id gnl|my_center|LOCUS_15310 7186 5909 gene locus_tag LOCUS_15320 7186 5909 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_15320 7914 7201 gene locus_tag LOCUS_15330 7914 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 8945 7926 gene locus_tag LOCUS_15340 8945 7926 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_15340 9601 8951 gene locus_tag LOCUS_15350 9601 8951 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence128 280 660 gene locus_tag LOCUS_15360 280 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1841 657 gene locus_tag LOCUS_15370 1841 657 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_15370 3694 1841 gene locus_tag LOCUS_15380 3694 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3984 3733 gene locus_tag LOCUS_15390 3984 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 5199 4015 gene locus_tag LOCUS_15400 5199 4015 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_15400 6933 5221 gene locus_tag LOCUS_15410 6933 5221 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_15410 7330 8556 gene locus_tag LOCUS_15420 7330 8556 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_15420 8768 9973 gene locus_tag LOCUS_15430 8768 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence129 2146 455 gene locus_tag LOCUS_15440 gene asnB 2146 455 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_15440 3906 2479 gene locus_tag LOCUS_15450 3906 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4846 4160 gene locus_tag LOCUS_15460 4846 4160 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_15460 5458 5078 gene locus_tag LOCUS_15470 5458 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6343 5513 gene locus_tag LOCUS_15480 6343 5513 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_15480 7545 6748 gene locus_tag LOCUS_15490 7545 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8100 7762 gene locus_tag LOCUS_15500 8100 7762 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_15500 9910 8129 gene locus_tag LOCUS_15510 9910 8129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence130 2 193 gene locus_tag LOCUS_15520 2 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1058 345 gene locus_tag LOCUS_15530 gene rsmI 1058 345 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_15530 1703 1062 gene locus_tag LOCUS_15540 1703 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2146 2736 gene locus_tag LOCUS_15550 2146 2736 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_15550 2744 5215 gene locus_tag LOCUS_15560 2744 5215 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_15560 6155 6877 gene locus_tag LOCUS_15570 6155 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6945 7151 gene locus_tag LOCUS_15580 6945 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 8154 7438 gene locus_tag LOCUS_15590 8154 7438 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_15590 9959 8313 gene locus_tag LOCUS_15600 9959 8313 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence131 1802 441 gene locus_tag LOCUS_15610 1802 441 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794243.1 protein_id gnl|my_center|LOCUS_15610 5351 1827 gene locus_tag LOCUS_15620 5351 1827 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_15620 6746 5550 gene locus_tag LOCUS_15630 6746 5550 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_15630 7763 7212 gene locus_tag LOCUS_15640 7763 7212 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_15640 8082 8780 gene locus_tag LOCUS_15650 8082 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 9937 9131 gene locus_tag LOCUS_15660 9937 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence132 1193 828 gene locus_tag LOCUS_15670 1193 828 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_15670 2167 1247 gene locus_tag LOCUS_15680 2167 1247 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_15680 3402 2326 gene locus_tag LOCUS_15690 gene serC 3402 2326 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_15690 4936 3833 gene locus_tag LOCUS_15700 gene gcvT 4936 3833 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_15700 6825 5071 gene locus_tag LOCUS_15710 6825 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 7117 7572 gene locus_tag LOCUS_15720 7117 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 7588 7935 gene locus_tag LOCUS_15730 7588 7935 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_15730 7946 9508 gene locus_tag LOCUS_15740 7946 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence133 617 1246 gene locus_tag LOCUS_15750 617 1246 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_15750 1395 6218 gene locus_tag LOCUS_15760 1395 6218 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_15760 6236 7891 gene locus_tag LOCUS_15770 6236 7891 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979810.1 protein_id gnl|my_center|LOCUS_15770 8068 8418 gene locus_tag LOCUS_15780 8068 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8412 9716 gene locus_tag LOCUS_15790 8412 9716 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence134 566 228 gene locus_tag LOCUS_15800 gene cas2 566 228 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_15800 1461 535 gene locus_tag LOCUS_15810 gene cas1 1461 535 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_15810 3113 1473 gene locus_tag LOCUS_15820 3113 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3281 4174 gene locus_tag LOCUS_15830 3281 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 7771 4175 gene locus_tag LOCUS_15840 7771 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 9241 8462 gene locus_tag LOCUS_15850 9241 8462 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678739.1 protein_id gnl|my_center|LOCUS_15850 9373 9747 gene locus_tag LOCUS_15860 9373 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence135 41 388 gene locus_tag LOCUS_15870 41 388 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_15870 381 680 gene locus_tag LOCUS_15880 381 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1255 722 gene locus_tag LOCUS_15890 gene ruvC 1255 722 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_15890 2162 1269 gene locus_tag LOCUS_15900 2162 1269 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940333.1 protein_id gnl|my_center|LOCUS_15900 2485 2174 gene locus_tag LOCUS_15910 2485 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3700 2708 gene locus_tag LOCUS_15920 gene rhuM 3700 2708 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_15920 5607 3826 gene locus_tag LOCUS_15930 5607 3826 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_15930 7005 5731 gene locus_tag LOCUS_15940 gene serS 7005 5731 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_15940 7382 7122 gene locus_tag LOCUS_15950 gene rpmA 7382 7122 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_15950 7713 7402 gene locus_tag LOCUS_15960 7713 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8195 8797 gene locus_tag LOCUS_15970 8195 8797 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence136 <1 614 gene locus_tag LOCUS_15980 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795608.1:endonuclease MutS2 2179 1109 gene locus_tag LOCUS_15990 2179 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_15990 2533 4647 gene locus_tag LOCUS_16000 gene recQ 2533 4647 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_16000 4841 5608 gene locus_tag LOCUS_16010 4841 5608 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_16010 5732 8284 gene locus_tag LOCUS_16020 5732 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence137 934 281 gene locus_tag LOCUS_16030 934 281 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937025.1 protein_id gnl|my_center|LOCUS_16030 2179 935 gene locus_tag LOCUS_16040 2179 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3268 2354 gene locus_tag LOCUS_16050 3268 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4056 3280 gene locus_tag LOCUS_16060 4056 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4260 4553 gene locus_tag LOCUS_16070 4260 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4666 5289 gene locus_tag LOCUS_16080 4666 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5534 5452 gene locus_tag LOCUS_t00190 5534 5452 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6053 5691 gene locus_tag LOCUS_16090 6053 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6396 6139 gene locus_tag LOCUS_16100 6396 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 6919 8316 gene locus_tag LOCUS_16110 gene mnmE 6919 8316 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_16110 8560 8922 gene locus_tag LOCUS_16120 8560 8922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence138 2 550 gene locus_tag LOCUS_16130 2 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 675 451 gene locus_tag LOCUS_16140 675 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 682 1395 gene locus_tag LOCUS_16150 682 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1404 1844 gene locus_tag LOCUS_16160 1404 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2250 2675 gene locus_tag LOCUS_16170 2250 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2788 3303 gene locus_tag LOCUS_16180 2788 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3303 3995 gene locus_tag LOCUS_16190 3303 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3996 4301 gene locus_tag LOCUS_16200 3996 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4301 4810 gene locus_tag LOCUS_16210 4301 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 4815 5246 gene locus_tag LOCUS_16220 4815 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5243 5500 gene locus_tag LOCUS_16230 5243 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5747 6454 gene locus_tag LOCUS_16240 5747 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6429 7172 gene locus_tag LOCUS_16250 6429 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 7172 7477 gene locus_tag LOCUS_16260 7172 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 7470 8135 gene locus_tag LOCUS_16270 7470 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 8125 9891 gene locus_tag LOCUS_16280 8125 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence139 <1 883 gene locus_tag LOCUS_16290 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840521.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN 2009 990 gene locus_tag LOCUS_16300 2009 990 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_16300 3760 2369 gene locus_tag LOCUS_16310 3760 2369 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_16310 5571 3931 gene locus_tag LOCUS_16320 5571 3931 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_16320 6781 7476 gene locus_tag LOCUS_16330 6781 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 7895 8626 gene locus_tag LOCUS_16340 7895 8626 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928906.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence140 622 876 gene locus_tag LOCUS_16350 622 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1101 1829 gene locus_tag LOCUS_16360 1101 1829 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202968.1 protein_id gnl|my_center|LOCUS_16360 1839 2432 gene locus_tag LOCUS_16370 1839 2432 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765039.1 protein_id gnl|my_center|LOCUS_16370 6180 2446 gene locus_tag LOCUS_16380 6180 2446 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_16380 6669 6196 gene locus_tag LOCUS_16390 gene rlmH 6669 6196 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_16390 6878 7279 gene locus_tag LOCUS_16400 6878 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7949 7281 gene locus_tag LOCUS_16410 gene ung 7949 7281 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_16410 9582 8077 gene locus_tag LOCUS_16420 9582 8077 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence141 3308 264 gene locus_tag LOCUS_16430 3308 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4766 3615 gene locus_tag LOCUS_16440 4766 3615 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_16440 5880 4879 gene locus_tag LOCUS_16450 gene pta 5880 4879 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_16450 6076 9078 gene locus_tag LOCUS_16460 6076 9078 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_16460 9702 9136 gene locus_tag LOCUS_16470 9702 9136 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064627.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence142 1502 849 gene locus_tag LOCUS_16480 1502 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 1666 1908 gene locus_tag LOCUS_16490 1666 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2281 3294 gene locus_tag LOCUS_16500 2281 3294 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_16500 3621 4136 gene locus_tag LOCUS_16510 3621 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4271 5152 gene locus_tag LOCUS_16520 4271 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5145 5639 gene locus_tag LOCUS_16530 5145 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5869 7665 gene locus_tag LOCUS_16540 5869 7665 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_16540 9208 7907 gene locus_tag LOCUS_16550 9208 7907 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence143 3915 172 gene locus_tag LOCUS_16560 3915 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4953 4435 gene locus_tag LOCUS_16570 4953 4435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963178.1 protein_id gnl|my_center|LOCUS_16570 5904 5233 gene locus_tag LOCUS_16580 5904 5233 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883553.1 protein_id gnl|my_center|LOCUS_16580 7809 6271 gene locus_tag LOCUS_16590 7809 6271 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_16590 8570 7995 gene locus_tag LOCUS_16600 gene lpcA 8570 7995 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694260.1 protein_id gnl|my_center|LOCUS_16600 8718 9521 gene locus_tag LOCUS_16610 8718 9521 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence144 3426 436 gene locus_tag LOCUS_16620 3426 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3803 4363 gene locus_tag LOCUS_16630 3803 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4378 6813 gene locus_tag LOCUS_16640 4378 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 7847 6810 gene locus_tag LOCUS_16650 7847 6810 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_16650 <9631 7847 gene locus_tag LOCUS_16660 <9631 7847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162903181.1:PKD domain-containing protein >Feature sequence145 716 450 gene locus_tag LOCUS_16670 716 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3450 790 gene locus_tag LOCUS_16680 3450 790 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_16680 4406 3561 gene locus_tag LOCUS_16690 4406 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4773 4534 gene locus_tag LOCUS_16700 4773 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6218 4839 gene locus_tag LOCUS_16710 6218 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 6867 6478 gene locus_tag LOCUS_16720 6867 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7164 7033 gene locus_tag LOCUS_16730 7164 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 7597 8970 gene locus_tag LOCUS_16740 7597 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence146 398 3736 gene locus_tag LOCUS_16750 398 3736 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202219.1 protein_id gnl|my_center|LOCUS_16750 3801 5495 gene locus_tag LOCUS_16760 3801 5495 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790207.1 protein_id gnl|my_center|LOCUS_16760 5681 7972 gene locus_tag LOCUS_16770 5681 7972 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203457.1 protein_id gnl|my_center|LOCUS_16770 8008 9531 gene locus_tag LOCUS_16780 8008 9531 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence147 4 498 gene locus_tag LOCUS_16790 4 498 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962936.1 protein_id gnl|my_center|LOCUS_16790 712 533 gene locus_tag LOCUS_16800 712 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 844 1419 gene locus_tag LOCUS_16810 844 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1496 1777 gene locus_tag LOCUS_16820 1496 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2037 2345 gene locus_tag LOCUS_16830 2037 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2338 3816 gene locus_tag LOCUS_16840 2338 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 3818 4789 gene locus_tag LOCUS_16850 3818 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4786 5799 gene locus_tag LOCUS_16860 4786 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 5802 6359 gene locus_tag LOCUS_16870 5802 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 6363 6797 gene locus_tag LOCUS_16880 6363 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence148 166 1590 gene locus_tag LOCUS_16890 gene dacB 166 1590 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_16890 1715 3493 gene locus_tag LOCUS_16900 1715 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 4815 3553 gene locus_tag LOCUS_16910 4815 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_16910 5921 5298 gene locus_tag LOCUS_16920 5921 5298 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_16920 6558 5962 gene locus_tag LOCUS_16930 gene pnuC 6558 5962 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_16930 9100 6611 gene locus_tag LOCUS_16940 9100 6611 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence149 520 1362 gene locus_tag LOCUS_16950 520 1362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279230.1 protein_id gnl|my_center|LOCUS_16950 3612 1528 gene locus_tag LOCUS_16960 3612 1528 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_16960 4497 3832 gene locus_tag LOCUS_16970 4497 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4889 5575 gene locus_tag LOCUS_16980 4889 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5804 6535 gene locus_tag LOCUS_16990 5804 6535 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_16990 6596 8368 gene locus_tag LOCUS_17000 6596 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9011 9343 gene locus_tag LOCUS_17010 9011 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence150 <1 1123 gene locus_tag LOCUS_17020 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000745444.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 1205 2227 gene locus_tag LOCUS_17030 1205 2227 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_17030 2268 3095 gene locus_tag LOCUS_17040 gene mreC 2268 3095 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_17040 3092 3595 gene locus_tag LOCUS_17050 3092 3595 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_17050 3612 5480 gene locus_tag LOCUS_17060 gene mrdA 3612 5480 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_17060 5489 6913 gene locus_tag LOCUS_17070 gene rodA 5489 6913 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_17070 7490 6867 gene locus_tag LOCUS_17080 7490 6867 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_17080 7730 9085 gene locus_tag LOCUS_17090 7730 9085 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence151 <1 678 gene locus_tag LOCUS_17100 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:CotH kinase family protein 675 1871 gene locus_tag LOCUS_17110 675 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1868 3334 gene locus_tag LOCUS_17120 1868 3334 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_17120 4123 3437 gene locus_tag LOCUS_17130 4123 3437 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787692.1 protein_id gnl|my_center|LOCUS_17130 4754 5614 gene locus_tag LOCUS_17140 gene hisG 4754 5614 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_17140 5645 6937 gene locus_tag LOCUS_17150 gene hisD 5645 6937 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_17150 6931 7992 gene locus_tag LOCUS_17160 gene hisC 6931 7992 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_17160 7996 9138 gene locus_tag LOCUS_17170 gene hisB 7996 9138 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence152 1706 543 gene locus_tag LOCUS_17180 1706 543 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_17180 2247 1726 gene locus_tag LOCUS_17190 2247 1726 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_17190 3622 2252 gene locus_tag LOCUS_17200 gene nrfD 3622 2252 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_17200 6605 3633 gene locus_tag LOCUS_17210 6605 3633 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_17210 7814 6663 gene locus_tag LOCUS_17220 7814 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 <9246 8146 gene locus_tag LOCUS_17230 <9246 8146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784844.1:lytic transglycosylase domain-containing protein >Feature sequence153 748 83 gene locus_tag LOCUS_17240 748 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1915 1079 gene locus_tag LOCUS_17250 1915 1079 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_17250 3131 2196 gene locus_tag LOCUS_17260 gene queG 3131 2196 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_17260 4013 3702 gene locus_tag LOCUS_17270 4013 3702 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_17270 4441 4022 gene locus_tag LOCUS_17280 4441 4022 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_17280 5740 4517 gene locus_tag LOCUS_17290 5740 4517 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767609.1 protein_id gnl|my_center|LOCUS_17290 7124 5763 gene locus_tag LOCUS_17300 gene sufD 7124 5763 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_17300 7953 7201 gene locus_tag LOCUS_17310 gene sufC 7953 7201 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_17310 <9233 8105 gene locus_tag LOCUS_17320 <9233 8105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783924.1:Fe-S cluster assembly protein SufB >Feature sequence154 1476 241 gene locus_tag LOCUS_17330 1476 241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_17330 2430 1504 gene locus_tag LOCUS_17340 2430 1504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_17340 4722 2500 gene locus_tag LOCUS_17350 4722 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4740 4904 gene locus_tag LOCUS_17360 4740 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5074 6360 gene locus_tag LOCUS_17370 5074 6360 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897667.1 protein_id gnl|my_center|LOCUS_17370 6406 7113 gene locus_tag LOCUS_17380 6406 7113 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_17380 7243 8271 gene locus_tag LOCUS_17390 7243 8271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_17390 8387 8629 gene locus_tag LOCUS_17400 8387 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902080.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence155 2854 209 gene locus_tag LOCUS_17410 gene polA 2854 209 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_17410 3960 3040 gene locus_tag LOCUS_17420 3960 3040 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_17420 4457 4008 gene locus_tag LOCUS_17430 4457 4008 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_17430 4799 4500 gene locus_tag LOCUS_17440 4799 4500 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_17440 5137 6123 gene locus_tag LOCUS_17450 5137 6123 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_17450 8034 6124 gene locus_tag LOCUS_17460 8034 6124 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023330.1 protein_id gnl|my_center|LOCUS_17460 9063 8164 gene locus_tag LOCUS_17470 gene deoC 9063 8164 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence156 994 35 gene locus_tag LOCUS_17480 994 35 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_17480 1204 1920 gene locus_tag LOCUS_17490 1204 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 2042 2296 gene locus_tag LOCUS_17500 2042 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2559 3110 gene locus_tag LOCUS_17510 gene sigZ 2559 3110 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 protein_id gnl|my_center|LOCUS_17510 4295 3147 gene locus_tag LOCUS_17520 4295 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4722 5591 gene locus_tag LOCUS_17530 4722 5591 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_17530 5768 6775 gene locus_tag LOCUS_17540 5768 6775 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_17540 7364 6990 gene locus_tag LOCUS_17550 7364 6990 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_17550 8961 7387 gene locus_tag LOCUS_17560 8961 7387 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence157 2084 1248 gene locus_tag LOCUS_17570 2084 1248 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_17570 2859 6224 gene locus_tag LOCUS_17580 2859 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9016 6587 gene locus_tag LOCUS_17590 9016 6587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence158 632 2782 gene locus_tag LOCUS_17600 gene rnr 632 2782 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_17600 3138 4490 gene locus_tag LOCUS_17610 3138 4490 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_17610 7029 4492 gene locus_tag LOCUS_17620 7029 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 7478 8341 gene locus_tag LOCUS_17630 7478 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_17630 8490 8906 gene locus_tag LOCUS_17640 8490 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence159 1416 214 gene locus_tag LOCUS_17650 1416 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2770 1502 gene locus_tag LOCUS_17660 2770 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4374 2890 gene locus_tag LOCUS_17670 4374 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 6386 4452 gene locus_tag LOCUS_17680 6386 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 7739 6609 gene locus_tag LOCUS_17690 7739 6609 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_17690 8579 8028 gene locus_tag LOCUS_17700 8579 8028 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence160 67 141 gene locus_tag LOCUS_t00200 67 141 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 958 344 gene locus_tag LOCUS_17710 958 344 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_17710 1664 1050 gene locus_tag LOCUS_17720 1664 1050 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_17720 2534 1764 gene locus_tag LOCUS_17730 2534 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4052 2541 gene locus_tag LOCUS_17740 4052 2541 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_17740 4185 4727 gene locus_tag LOCUS_17750 4185 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4724 5794 gene locus_tag LOCUS_17760 4724 5794 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018972380.1 protein_id gnl|my_center|LOCUS_17760 5893 7185 gene locus_tag LOCUS_17770 gene tyrS 5893 7185 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_17770 7260 7715 gene locus_tag LOCUS_17780 7260 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 <8899 7764 gene locus_tag LOCUS_17790 <8899 7764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225866427.1:SpoIIE family protein phosphatase >Feature sequence161 506 1582 gene locus_tag LOCUS_17800 gene buk 506 1582 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_17800 2015 4072 gene locus_tag LOCUS_17810 2015 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 5619 4138 gene locus_tag LOCUS_17820 gene lpdA 5619 4138 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582893.1 protein_id gnl|my_center|LOCUS_17820 6738 6082 gene locus_tag LOCUS_17830 6738 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7398 6940 gene locus_tag LOCUS_17840 gene pyrI 7398 6940 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_17840 8336 7431 gene locus_tag LOCUS_17850 gene pyrB 8336 7431 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence162 2849 3262 gene locus_tag LOCUS_17860 2849 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3640 4221 gene locus_tag LOCUS_17870 3640 4221 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230605.1 protein_id gnl|my_center|LOCUS_17870 7750 4682 gene locus_tag LOCUS_17880 7750 4682 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence163 702 1166 gene locus_tag LOCUS_17890 702 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17890 2646 1282 gene locus_tag LOCUS_17900 2646 1282 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_17900 4826 3390 gene locus_tag LOCUS_17910 4826 3390 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_17910 5022 6440 gene locus_tag LOCUS_17920 5022 6440 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957965.1 protein_id gnl|my_center|LOCUS_17920 6518 7630 gene locus_tag LOCUS_17930 6518 7630 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863093.1 protein_id gnl|my_center|LOCUS_17930 8008 8481 gene locus_tag LOCUS_17940 8008 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence164 1076 210 gene locus_tag LOCUS_17950 1076 210 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939098.1 protein_id gnl|my_center|LOCUS_17950 2147 1197 gene locus_tag LOCUS_17960 2147 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2438 2151 gene locus_tag LOCUS_17970 2438 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3063 2449 gene locus_tag LOCUS_17980 3063 2449 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_17980 4666 3056 gene locus_tag LOCUS_17990 gene ctaD 4666 3056 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939102.1 protein_id gnl|my_center|LOCUS_17990 4962 4747 gene locus_tag LOCUS_18000 4962 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5772 4990 gene locus_tag LOCUS_18010 5772 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5998 6435 gene locus_tag LOCUS_18020 5998 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6751 6488 gene locus_tag LOCUS_18030 6751 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 7677 6901 gene locus_tag LOCUS_18040 7677 6901 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080200.1 protein_id gnl|my_center|LOCUS_18040 8648 7824 gene locus_tag LOCUS_18050 8648 7824 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence165 <1 904 gene locus_tag LOCUS_18060 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192488.1:polyamine aminopropyltransferase 904 1257 gene locus_tag LOCUS_18070 904 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1286 1651 gene locus_tag LOCUS_18080 1286 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1551 2576 gene locus_tag LOCUS_18090 1551 2576 CDS product potassium channel protein MjK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869633.1 protein_id gnl|my_center|LOCUS_18090 3365 2907 gene locus_tag LOCUS_18100 gene rnhA 3365 2907 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_18100 4161 3685 gene locus_tag LOCUS_18110 gene tnpA 4161 3685 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475483.1 protein_id gnl|my_center|LOCUS_18110 6537 4360 gene locus_tag LOCUS_18120 6537 4360 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_18120 7403 6804 gene locus_tag LOCUS_18130 7403 6804 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_18130 8399 7464 gene locus_tag LOCUS_18140 8399 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence166 2051 252 gene locus_tag LOCUS_18150 gene typA 2051 252 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_18150 2985 6233 gene locus_tag LOCUS_18160 2985 6233 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_18160 8169 6715 gene locus_tag LOCUS_18170 gene rpoN 8169 6715 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence167 159 70 gene locus_tag LOCUS_t00210 159 70 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1336 356 gene locus_tag LOCUS_18180 gene floA 1336 356 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_18180 1811 1347 gene locus_tag LOCUS_18190 1811 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2113 1832 gene locus_tag LOCUS_18200 2113 1832 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_18200 4255 2126 gene locus_tag LOCUS_18210 4255 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4963 5430 gene locus_tag LOCUS_18220 gene bcp 4963 5430 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_18220 5546 6562 gene locus_tag LOCUS_18230 gene recA 5546 6562 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence168 <1 620 gene locus_tag LOCUS_18240 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763594.1:nucleoside kinase 1723 1277 gene locus_tag LOCUS_18250 gene smpB 1723 1277 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_18250 2347 1757 gene locus_tag LOCUS_18260 2347 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3207 2632 gene locus_tag LOCUS_18270 3207 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3470 4381 gene locus_tag LOCUS_18280 gene miaA 3470 4381 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_18280 5212 4562 gene locus_tag LOCUS_18290 5212 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5662 6474 gene locus_tag LOCUS_18300 5662 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6511 7236 gene locus_tag LOCUS_18310 6511 7236 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_18310 7618 8445 gene locus_tag LOCUS_18320 7618 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence169 1172 2164 gene locus_tag LOCUS_18330 1172 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 5993 3159 gene locus_tag LOCUS_18340 5993 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 6773 6201 gene locus_tag LOCUS_18350 gene rsxA 6773 6201 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_18350 7369 6785 gene locus_tag LOCUS_18360 7369 6785 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_18360 7977 7369 gene locus_tag LOCUS_18370 7977 7369 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_18370 <8526 7980 gene locus_tag LOCUS_18380 <8526 7980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761244.1:RnfABCDGE type electron transport complex subunit D >Feature sequence170 2606 543 gene locus_tag LOCUS_18390 2606 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3981 2653 gene locus_tag LOCUS_18400 3981 2653 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_18400 5653 5102 gene locus_tag LOCUS_18410 5653 5102 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_18410 6461 5688 gene locus_tag LOCUS_18420 6461 5688 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_18420 7550 6465 gene locus_tag LOCUS_18430 7550 6465 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025074588.1 protein_id gnl|my_center|LOCUS_18430 7829 7602 gene locus_tag LOCUS_18440 7829 7602 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence171 180 1256 gene locus_tag LOCUS_18450 180 1256 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_18450 1456 3000 gene locus_tag LOCUS_18460 1456 3000 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_18460 3013 3321 gene locus_tag LOCUS_18470 3013 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4369 3554 gene locus_tag LOCUS_18480 gene ispE 4369 3554 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_18480 4553 6085 gene locus_tag LOCUS_18490 gene dnaB 4553 6085 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_18490 6241 7422 gene locus_tag LOCUS_18500 6241 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_18500 7888 7508 gene locus_tag LOCUS_18510 7888 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence172 1802 465 gene locus_tag LOCUS_18520 1802 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 3457 2150 gene locus_tag LOCUS_18530 3457 2150 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247973.1 protein_id gnl|my_center|LOCUS_18530 4820 3543 gene locus_tag LOCUS_18540 4820 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6046 4928 gene locus_tag LOCUS_18550 6046 4928 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_18550 7171 6065 gene locus_tag LOCUS_18560 7171 6065 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_18560 7935 7189 gene locus_tag LOCUS_18570 7935 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 8332 7928 gene locus_tag LOCUS_18580 8332 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence173 226 1425 gene locus_tag LOCUS_18590 226 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1432 2127 gene locus_tag LOCUS_18600 1432 2127 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_18600 2134 2958 gene locus_tag LOCUS_18610 2134 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3333 4568 gene locus_tag LOCUS_18620 3333 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4841 5275 gene locus_tag LOCUS_18630 4841 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5600 6205 gene locus_tag LOCUS_18640 5600 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6235 6651 gene locus_tag LOCUS_18650 6235 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 7900 6773 gene locus_tag LOCUS_18660 7900 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence174 1435 689 gene locus_tag LOCUS_18670 1435 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2145 2612 gene locus_tag LOCUS_18680 2145 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2983 3804 gene locus_tag LOCUS_18690 2983 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3797 3991 gene locus_tag LOCUS_18700 3797 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4086 4349 gene locus_tag LOCUS_18710 4086 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4495 5007 gene locus_tag LOCUS_18720 4495 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 5890 6747 gene locus_tag LOCUS_18730 5890 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 6901 6698 gene locus_tag LOCUS_18740 6901 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7535 7825 gene locus_tag LOCUS_18750 7535 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence175 446 2593 gene locus_tag LOCUS_18760 446 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2614 4140 gene locus_tag LOCUS_18770 2614 4140 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202612.1 protein_id gnl|my_center|LOCUS_18770 4357 5355 gene locus_tag LOCUS_18780 4357 5355 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_18780 5389 6549 gene locus_tag LOCUS_18790 5389 6549 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_18790 6559 8043 gene locus_tag LOCUS_18800 6559 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence176 150 1319 gene locus_tag LOCUS_18810 150 1319 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_18810 2266 1535 gene locus_tag LOCUS_18820 2266 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2914 4488 gene locus_tag LOCUS_18830 2914 4488 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_18830 4454 5389 gene locus_tag LOCUS_18840 4454 5389 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064715.1 protein_id gnl|my_center|LOCUS_18840 5517 6173 gene locus_tag LOCUS_18850 5517 6173 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_18850 6187 6555 gene locus_tag LOCUS_18860 6187 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6860 7525 gene locus_tag LOCUS_18870 6860 7525 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence177 823 3339 gene locus_tag LOCUS_18880 823 3339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_18880 4813 4334 gene locus_tag LOCUS_18890 4813 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 6619 4826 gene locus_tag LOCUS_18900 6619 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 7224 6775 gene locus_tag LOCUS_18910 7224 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence178 <1 612 gene locus_tag LOCUS_18920 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759596.1:UMP kinase 806 1369 gene locus_tag LOCUS_18930 gene frr 806 1369 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_18930 4101 1435 gene locus_tag LOCUS_18940 4101 1435 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_18940 4942 4112 gene locus_tag LOCUS_18950 4942 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 6131 5283 gene locus_tag LOCUS_18960 6131 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6893 6192 gene locus_tag LOCUS_18970 6893 6192 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_18970 7737 6883 gene locus_tag LOCUS_18980 7737 6883 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence179 374 1813 gene locus_tag LOCUS_18990 374 1813 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_18990 2031 2765 gene locus_tag LOCUS_19000 2031 2765 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_19000 2885 3514 gene locus_tag LOCUS_19010 2885 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020078137.1 protein_id gnl|my_center|LOCUS_19010 3942 4607 gene locus_tag LOCUS_19020 3942 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 5037 5411 gene locus_tag LOCUS_19030 5037 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5408 7786 gene locus_tag LOCUS_19040 5408 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence180 426 350 gene locus_tag LOCUS_t00220 426 350 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 975 622 gene locus_tag LOCUS_19050 975 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1580 1503 gene locus_tag LOCUS_t00230 1580 1503 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1811 1735 gene locus_tag LOCUS_t00240 1811 1735 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1892 1817 gene locus_tag LOCUS_t00250 1892 1817 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2096 1896 gene locus_tag LOCUS_19060 2096 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2326 2250 gene locus_tag LOCUS_t00260 2326 2250 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2495 2418 gene locus_tag LOCUS_t00270 2495 2418 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2595 2510 gene locus_tag LOCUS_t00280 2595 2510 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2918 2601 gene locus_tag LOCUS_19070 2918 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3145 3068 gene locus_tag LOCUS_t00290 3145 3068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3420 3346 gene locus_tag LOCUS_t00300 3420 3346 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3912 3837 gene locus_tag LOCUS_t00310 3912 3837 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4466 4379 gene locus_tag LOCUS_t00320 4466 4379 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5157 4468 gene locus_tag LOCUS_19080 5157 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 5417 5346 gene locus_tag LOCUS_t00330 5417 5346 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5498 5425 gene locus_tag LOCUS_t00340 5498 5425 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5666 5590 gene locus_tag LOCUS_t00350 5666 5590 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5854 5672 gene locus_tag LOCUS_19090 5854 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 6102 6012 gene locus_tag LOCUS_t00360 6102 6012 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6658 6574 gene locus_tag LOCUS_t00370 6658 6574 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7782 7706 gene locus_tag LOCUS_t00380 7782 7706 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence181 <1 756 gene locus_tag LOCUS_19100 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362010.1:site-specific integrase 882 1385 gene locus_tag LOCUS_19110 882 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1375 2061 gene locus_tag LOCUS_19120 1375 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_19120 3117 3377 gene locus_tag LOCUS_19130 3117 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3374 3697 gene locus_tag LOCUS_19140 3374 3697 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_19140 3703 4686 gene locus_tag LOCUS_19150 3703 4686 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_19150 5094 5021 gene locus_tag LOCUS_t00390 5094 5021 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5346 6659 gene locus_tag LOCUS_19160 5346 6659 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_19160 6781 6708 gene locus_tag LOCUS_t00400 6781 6708 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6883 6810 gene locus_tag LOCUS_t00410 6883 6810 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 323 814 gene locus_tag LOCUS_19170 323 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1438 1842 gene locus_tag LOCUS_19180 1438 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence183 869 303 gene locus_tag LOCUS_19190 869 303 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_19190 1160 2335 gene locus_tag LOCUS_19200 1160 2335 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108736.1 protein_id gnl|my_center|LOCUS_19200 2410 5880 gene locus_tag LOCUS_19210 2410 5880 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108737.1 protein_id gnl|my_center|LOCUS_19210 5892 7019 gene locus_tag LOCUS_19220 5892 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7025 7264 gene locus_tag LOCUS_19230 7025 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence184 897 2372 gene locus_tag LOCUS_19240 gene proS 897 2372 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_19240 2466 3149 gene locus_tag LOCUS_19250 2466 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4541 3519 gene locus_tag LOCUS_19260 gene pheS 4541 3519 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_19260 5653 4949 gene locus_tag LOCUS_19270 5653 4949 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_19270 5810 5631 gene locus_tag LOCUS_19280 5810 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6808 5996 gene locus_tag LOCUS_19290 6808 5996 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_19290 7350 7000 gene locus_tag LOCUS_19300 7350 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7492 7567 gene locus_tag LOCUS_t00420 7492 7567 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7592 7667 gene locus_tag LOCUS_t00430 7592 7667 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence185 907 2013 gene locus_tag LOCUS_19310 907 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2024 3550 gene locus_tag LOCUS_19320 2024 3550 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_19320 3591 5030 gene locus_tag LOCUS_19330 3591 5030 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_19330 5095 6687 gene locus_tag LOCUS_19340 5095 6687 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_19340 6777 7826 gene locus_tag LOCUS_19350 6777 7826 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence186 616 1842 gene locus_tag LOCUS_19360 616 1842 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_19360 2803 3333 gene locus_tag LOCUS_19370 2803 3333 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_19370 3364 4650 gene locus_tag LOCUS_19380 gene wecC 3364 4650 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202257.1 protein_id gnl|my_center|LOCUS_19380 4693 5916 gene locus_tag LOCUS_19390 gene wecB 4693 5916 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799504.1 protein_id gnl|my_center|LOCUS_19390 5929 7389 gene locus_tag LOCUS_19400 5929 7389 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence187 887 444 gene locus_tag LOCUS_19410 887 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1091 897 gene locus_tag LOCUS_19420 1091 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2391 1093 gene locus_tag LOCUS_19430 2391 1093 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_19430 2542 3315 gene locus_tag LOCUS_19440 2542 3315 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_19440 3431 3958 gene locus_tag LOCUS_19450 3431 3958 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_19450 3970 4923 gene locus_tag LOCUS_19460 3970 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4943 5521 gene locus_tag LOCUS_19470 4943 5521 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_19470 5563 7746 gene locus_tag LOCUS_19480 5563 7746 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence188 359 1000 gene locus_tag LOCUS_19490 359 1000 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_19490 1830 1060 gene locus_tag LOCUS_19500 1830 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2071 3111 gene locus_tag LOCUS_19510 gene selD 2071 3111 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043069.1 protein_id gnl|my_center|LOCUS_19510 3114 3455 gene locus_tag LOCUS_19520 3114 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4051 6288 gene locus_tag LOCUS_19530 4051 6288 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_19530 <7912 6344 gene locus_tag LOCUS_19540 <7912 6344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986835.1:cobalt-precorrin-5B (C(1))-methyltransferase CbiD >Feature sequence189 1369 149 gene locus_tag LOCUS_19550 1369 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1539 2135 gene locus_tag LOCUS_19560 1539 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2116 3165 gene locus_tag LOCUS_19570 2116 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 5175 3346 gene locus_tag LOCUS_19580 5175 3346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_19580 6636 5299 gene locus_tag LOCUS_19590 gene purB 6636 5299 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_19590 7460 7059 gene locus_tag LOCUS_19600 7460 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence190 >Feature sequence191 460 1155 gene locus_tag LOCUS_19610 460 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1288 2112 gene locus_tag LOCUS_19620 1288 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2025 2795 gene locus_tag LOCUS_19630 2025 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2873 3631 gene locus_tag LOCUS_19640 2873 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3640 4089 gene locus_tag LOCUS_19650 3640 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4139 5074 gene locus_tag LOCUS_19660 4139 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5133 7460 gene locus_tag LOCUS_19670 5133 7460 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence192 184 951 gene locus_tag LOCUS_19680 184 951 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_19680 2937 1423 gene locus_tag LOCUS_19690 gene gldG 2937 1423 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_19690 3680 2955 gene locus_tag LOCUS_19700 3680 2955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_19700 4616 3687 gene locus_tag LOCUS_19710 4616 3687 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_19710 4762 5415 gene locus_tag LOCUS_19720 gene hxpB 4762 5415 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_19720 5914 5393 gene locus_tag LOCUS_19730 5914 5393 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_19730 <7760 6047 gene locus_tag LOCUS_19740 <7760 6047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048696320.1:DNA gyrase/topoisomerase IV subunit A >Feature sequence193 230 1015 gene locus_tag LOCUS_19750 230 1015 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_19750 1157 2149 gene locus_tag LOCUS_19760 1157 2149 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_19760 5193 2845 gene locus_tag LOCUS_19770 5193 2845 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_19770 6113 5412 gene locus_tag LOCUS_19780 6113 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 <7745 6456 gene locus_tag LOCUS_19790 <7745 6456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209873.1:sulfatase >Feature sequence194 331 1482 gene locus_tag LOCUS_19800 331 1482 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_19800 1867 5337 gene locus_tag LOCUS_19810 1867 5337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_19810 5456 6925 gene locus_tag LOCUS_19820 5456 6925 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767524.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence195 1689 325 gene locus_tag LOCUS_19830 1689 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4278 2143 gene locus_tag LOCUS_19840 gene ovoA 4278 2143 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_19840 4743 4426 gene locus_tag LOCUS_19850 4743 4426 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_19850 5687 4740 gene locus_tag LOCUS_19860 5687 4740 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_19860 5862 6560 gene locus_tag LOCUS_19870 gene mtnN 5862 6560 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689868.1 protein_id gnl|my_center|LOCUS_19870 6577 7056 gene locus_tag LOCUS_19880 6577 7056 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_19880 7148 7600 gene locus_tag LOCUS_19890 7148 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence196 1796 528 gene locus_tag LOCUS_19900 1796 528 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_19900 3011 1863 gene locus_tag LOCUS_19910 3011 1863 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_19910 3679 3101 gene locus_tag LOCUS_19920 3679 3101 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_19920 5129 3984 gene locus_tag LOCUS_19930 5129 3984 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_19930 6910 5717 gene locus_tag LOCUS_19940 6910 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7403 7098 gene locus_tag LOCUS_19950 7403 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence197 1810 1166 gene locus_tag LOCUS_19960 1810 1166 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110878.1 protein_id gnl|my_center|LOCUS_19960 2884 2207 gene locus_tag LOCUS_19970 gene bioD 2884 2207 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_19970 3651 2890 gene locus_tag LOCUS_19980 gene bioC 3651 2890 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107785.1 protein_id gnl|my_center|LOCUS_19980 4321 3632 gene locus_tag LOCUS_19990 4321 3632 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107784.1 protein_id gnl|my_center|LOCUS_19990 5432 4311 gene locus_tag LOCUS_20000 5432 4311 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202494.1 protein_id gnl|my_center|LOCUS_20000 6726 5434 gene locus_tag LOCUS_20010 6726 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence198 <1 1700 gene locus_tag LOCUS_20020 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172726565.1:ATP-dependent DNA helicase RecG 1851 3236 gene locus_tag LOCUS_20030 1851 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4070 4498 gene locus_tag LOCUS_20040 4070 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4503 5456 gene locus_tag LOCUS_20050 4503 5456 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_20050 5588 6916 gene locus_tag LOCUS_20060 gene rsxC 5588 6916 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence199 1886 789 gene locus_tag LOCUS_20070 1886 789 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_20070 2333 1995 gene locus_tag LOCUS_20080 2333 1995 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_20080 3076 2333 gene locus_tag LOCUS_20090 gene trmB 3076 2333 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_20090 3568 3095 gene locus_tag LOCUS_20100 3568 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4719 3565 gene locus_tag LOCUS_20110 4719 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5939 4815 gene locus_tag LOCUS_20120 5939 4815 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_20120 7007 6528 gene locus_tag LOCUS_20130 7007 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence200 767 222 gene locus_tag LOCUS_20140 767 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1220 993 gene locus_tag LOCUS_20150 1220 993 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_20150 1579 1280 gene locus_tag LOCUS_20160 1579 1280 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_20160 4165 1922 gene locus_tag LOCUS_20170 4165 1922 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_20170 4391 4561 gene locus_tag LOCUS_20180 4391 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5418 5810 gene locus_tag LOCUS_20190 5418 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence201 1621 881 gene locus_tag LOCUS_20200 gene rnc 1621 881 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108787.1 protein_id gnl|my_center|LOCUS_20200 2878 1625 gene locus_tag LOCUS_20210 gene fabF 2878 1625 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_20210 3136 2900 gene locus_tag LOCUS_20220 3136 2900 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_20220 3333 3893 gene locus_tag LOCUS_20230 gene purN 3333 3893 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_20230 5227 3890 gene locus_tag LOCUS_20240 5227 3890 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_20240 6192 5326 gene locus_tag LOCUS_20250 6192 5326 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_20250 7099 6203 gene locus_tag LOCUS_20260 7099 6203 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence202 3248 198 gene locus_tag LOCUS_20270 3248 198 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_20270 4757 3348 gene locus_tag LOCUS_20280 4757 3348 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 protein_id gnl|my_center|LOCUS_20280 <7474 4859 gene locus_tag LOCUS_20290 <7474 4859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798729.1:efflux RND transporter permease subunit >Feature sequence203 6344 2391 gene locus_tag LOCUS_20300 6344 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303087.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence204 1 141 gene locus_tag LOCUS_20310 1 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 194 907 gene locus_tag LOCUS_20320 194 907 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_20320 1432 947 gene locus_tag LOCUS_20330 gene cdd 1432 947 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_20330 2017 2922 gene locus_tag LOCUS_20340 2017 2922 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_20340 3516 3061 gene locus_tag LOCUS_20350 3516 3061 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_20350 3802 7092 gene locus_tag LOCUS_20360 3802 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence205 1281 1529 gene locus_tag LOCUS_20370 1281 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2143 1766 gene locus_tag LOCUS_20380 2143 1766 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_20380 3258 2275 gene locus_tag LOCUS_20390 3258 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 6099 3409 gene locus_tag LOCUS_20400 6099 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 7023 6229 gene locus_tag LOCUS_20410 7023 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence206 332 1402 gene locus_tag LOCUS_20420 gene mltG 332 1402 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_20420 2532 1519 gene locus_tag LOCUS_20430 gene murB 2532 1519 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_20430 3605 2577 gene locus_tag LOCUS_20440 3605 2577 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108001.1 protein_id gnl|my_center|LOCUS_20440 4381 4052 gene locus_tag LOCUS_20450 4381 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 4493 5365 gene locus_tag LOCUS_20460 4493 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6295 5435 gene locus_tag LOCUS_20470 6295 5435 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence207 829 11 gene locus_tag LOCUS_20480 gene panB 829 11 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_20480 1252 3156 gene locus_tag LOCUS_20490 gene dnaK 1252 3156 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_20490 3340 4776 gene locus_tag LOCUS_20500 3340 4776 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_20500 6598 5132 gene locus_tag LOCUS_20510 6598 5132 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence208 2180 3046 gene locus_tag LOCUS_20520 2180 3046 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_20520 3493 4143 gene locus_tag LOCUS_20530 gene rpe 3493 4143 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_20530 5427 4195 gene locus_tag LOCUS_20540 5427 4195 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_20540 5801 6202 gene locus_tag LOCUS_tm00010 5801 6202 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 1495 152 gene locus_tag LOCUS_20550 1495 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1771 4089 gene locus_tag LOCUS_20560 1771 4089 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_20560 4348 4977 gene locus_tag LOCUS_20570 4348 4977 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_20570 5093 6403 gene locus_tag LOCUS_20580 gene murA 5093 6403 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_20580 6486 7013 gene locus_tag LOCUS_20590 6486 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence210 3276 661 gene locus_tag LOCUS_20600 3276 661 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_20600 4057 3353 gene locus_tag LOCUS_20610 4057 3353 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770033.1 protein_id gnl|my_center|LOCUS_20610 5778 4720 gene locus_tag LOCUS_20620 5778 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6911 6210 gene locus_tag LOCUS_20630 6911 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence211 737 1474 gene locus_tag LOCUS_20640 737 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 1487 1918 gene locus_tag LOCUS_20650 1487 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4736 1953 gene locus_tag LOCUS_20660 gene uvrA 4736 1953 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_20660 4931 5527 gene locus_tag LOCUS_20670 4931 5527 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_20670 5632 5877 gene locus_tag LOCUS_20680 5632 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5981 6835 gene locus_tag LOCUS_20690 5981 6835 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_20690 6846 7025 gene locus_tag LOCUS_20700 6846 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence212 843 1769 gene locus_tag LOCUS_20710 843 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1747 2865 gene locus_tag LOCUS_20720 1747 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2822 4150 gene locus_tag LOCUS_20730 gene vpsH 2822 4150 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_20730 4449 5714 gene locus_tag LOCUS_20740 gene vpsH 4449 5714 CDS product exopolysaccharide biosynthesis protein VpsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495305.1 protein_id gnl|my_center|LOCUS_20740 6036 7133 gene locus_tag LOCUS_20750 6036 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence213 552 202 gene locus_tag LOCUS_20760 552 202 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_20760 2548 608 gene locus_tag LOCUS_20770 2548 608 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_20770 3117 2569 gene locus_tag LOCUS_20780 3117 2569 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_20780 3680 4465 gene locus_tag LOCUS_20790 3680 4465 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_20790 6452 4755 gene locus_tag LOCUS_20800 6452 4755 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence214 800 1078 gene locus_tag LOCUS_20810 800 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1578 3068 gene locus_tag LOCUS_20820 1578 3068 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403298.1 protein_id gnl|my_center|LOCUS_20820 3485 3297 gene locus_tag LOCUS_20830 3485 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5048 3708 gene locus_tag LOCUS_20840 5048 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 5611 5042 gene locus_tag LOCUS_20850 5611 5042 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_20850 5841 6578 gene locus_tag LOCUS_20860 5841 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence215 185 358 gene locus_tag LOCUS_20870 185 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 824 687 gene locus_tag LOCUS_20880 824 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 850 1194 gene locus_tag LOCUS_20890 850 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 1201 1572 gene locus_tag LOCUS_20900 1201 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2487 2651 gene locus_tag LOCUS_20910 2487 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 4946 6733 gene locus_tag LOCUS_20920 gene lepA 4946 6733 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence216 1939 197 gene locus_tag LOCUS_20930 1939 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3603 2164 gene locus_tag LOCUS_20940 3603 2164 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_20940 4488 3724 gene locus_tag LOCUS_20950 4488 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5187 4534 gene locus_tag LOCUS_20960 5187 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 6467 5277 gene locus_tag LOCUS_20970 gene kbl 6467 5277 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_20970 6847 6921 gene locus_tag LOCUS_t00440 6847 6921 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence217 1685 315 gene locus_tag LOCUS_20980 1685 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 2631 2233 gene locus_tag LOCUS_20990 2631 2233 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721609.1 protein_id gnl|my_center|LOCUS_20990 3961 3242 gene locus_tag LOCUS_21000 3961 3242 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_21000 6454 4247 gene locus_tag LOCUS_21010 gene katG 6454 4247 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_21010 >Feature sequence218 786 334 gene locus_tag LOCUS_21020 gene dtd 786 334 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_21020 943 1950 gene locus_tag LOCUS_21030 943 1950 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_21030 3823 2021 gene locus_tag LOCUS_21040 gene uvrC 3823 2021 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_21040 5489 3846 gene locus_tag LOCUS_21050 gene ade 5489 3846 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022289.1 protein_id gnl|my_center|LOCUS_21050 <6876 5623 gene locus_tag LOCUS_21060 <6876 5623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762875.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence219 2742 1996 gene locus_tag LOCUS_21070 2742 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 4098 2878 gene locus_tag LOCUS_21080 4098 2878 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence220 973 3420 gene locus_tag LOCUS_21090 gene pheT 973 3420 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_21090 3637 5436 gene locus_tag LOCUS_21100 3637 5436 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104548.1 protein_id gnl|my_center|LOCUS_21100 6662 5703 gene locus_tag LOCUS_21110 6662 5703 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence221 <1 701 gene locus_tag LOCUS_21120 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202936.1:DegT/DnrJ/EryC1/StrS family aminotransferase 729 1691 gene locus_tag LOCUS_21130 729 1691 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108799.1 protein_id gnl|my_center|LOCUS_21130 1694 2461 gene locus_tag LOCUS_21140 1694 2461 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_21140 2495 3700 gene locus_tag LOCUS_21150 2495 3700 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_21150 3707 4666 gene locus_tag LOCUS_21160 3707 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4663 5931 gene locus_tag LOCUS_21170 4663 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence222 <1 3069 gene locus_tag LOCUS_21180 <1 3069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785421.1:SusC/RagA family TonB-linked outer membrane protein 3086 4609 gene locus_tag LOCUS_21190 3086 4609 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_21190 4737 6482 gene locus_tag LOCUS_21200 4737 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence223 379 200 gene locus_tag LOCUS_21210 379 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1188 511 gene locus_tag LOCUS_21220 1188 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 1479 4973 gene locus_tag LOCUS_21230 1479 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence224 13 4464 gene locus_tag LOCUS_21240 13 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4482 6257 gene locus_tag LOCUS_21250 4482 6257 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence225 652 945 gene locus_tag LOCUS_21260 652 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1394 990 gene locus_tag LOCUS_21270 1394 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2402 1410 gene locus_tag LOCUS_21280 2402 1410 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_21280 5499 2500 gene locus_tag LOCUS_21290 5499 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence226 445 1776 gene locus_tag LOCUS_21300 gene miaB 445 1776 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_21300 1850 2368 gene locus_tag LOCUS_21310 1850 2368 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_21310 2687 2376 gene locus_tag LOCUS_21320 2687 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2969 6229 gene locus_tag LOCUS_21330 2969 6229 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence227 2619 124 gene locus_tag LOCUS_21340 2619 124 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_21340 3489 2620 gene locus_tag LOCUS_21350 3489 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3974 3489 gene locus_tag LOCUS_21360 3974 3489 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_21360 5027 4083 gene locus_tag LOCUS_21370 5027 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 5331 5603 gene locus_tag LOCUS_21380 5331 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence228 926 243 gene locus_tag LOCUS_21390 926 243 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707242.1 protein_id gnl|my_center|LOCUS_21390 1327 2082 gene locus_tag LOCUS_21400 1327 2082 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_21400 2085 2639 gene locus_tag LOCUS_21410 2085 2639 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948547.1 protein_id gnl|my_center|LOCUS_21410 2874 3065 gene locus_tag LOCUS_21420 2874 3065 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_21420 3760 3305 gene locus_tag LOCUS_21430 3760 3305 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_21430 4088 4273 gene locus_tag LOCUS_21440 4088 4273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4316 4768 gene locus_tag LOCUS_21450 4316 4768 CDS product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_21450 5183 6331 gene locus_tag LOCUS_21460 5183 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence229 2388 829 gene locus_tag LOCUS_21470 2388 829 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_21470 3551 2556 gene locus_tag LOCUS_21480 3551 2556 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_21480 4161 5159 gene locus_tag LOCUS_21490 4161 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 5197 5955 gene locus_tag LOCUS_21500 5197 5955 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_21500 6021 6467 gene locus_tag LOCUS_21510 6021 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence230 1959 1642 gene locus_tag LOCUS_21520 1959 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2852 2046 gene locus_tag LOCUS_21530 2852 2046 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_21530 4579 3269 gene locus_tag LOCUS_21540 4579 3269 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_21540 5939 4593 gene locus_tag LOCUS_21550 5939 4593 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence231 3389 96 gene locus_tag LOCUS_21560 gene secA 3389 96 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_21560 3909 3517 gene locus_tag LOCUS_21570 3909 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 4151 5608 gene locus_tag LOCUS_21580 4151 5608 CDS product aspartyl protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202958.1 protein_id gnl|my_center|LOCUS_21580 6202 5756 gene locus_tag LOCUS_21590 6202 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence232 4091 1230 gene locus_tag LOCUS_21600 gene uvrA 4091 1230 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_21600 5114 4122 gene locus_tag LOCUS_21610 5114 4122 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_21610 5407 6150 gene locus_tag LOCUS_21620 5407 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence233 <1 1320 gene locus_tag LOCUS_21630 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794507.1:C1 family peptidase 2102 1644 gene locus_tag LOCUS_21640 2102 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 2362 2841 gene locus_tag LOCUS_21650 2362 2841 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_21650 3508 2891 gene locus_tag LOCUS_21660 3508 2891 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_21660 5445 3598 gene locus_tag LOCUS_21670 5445 3598 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_21670 5707 6297 gene locus_tag LOCUS_21680 5707 6297 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence234 2494 1196 gene locus_tag LOCUS_21690 2494 1196 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_21690 4448 2514 gene locus_tag LOCUS_21700 4448 2514 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_21700 4827 6284 gene locus_tag LOCUS_21710 4827 6284 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence235 68 140 gene locus_tag LOCUS_t00450 68 140 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 374 1594 gene locus_tag LOCUS_21720 374 1594 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_21720 2191 1607 gene locus_tag LOCUS_21730 2191 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2329 2547 gene locus_tag LOCUS_21740 2329 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 2767 4134 gene locus_tag LOCUS_21750 2767 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 4280 4891 gene locus_tag LOCUS_21760 4280 4891 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172412315.1 protein_id gnl|my_center|LOCUS_21760 4937 5287 gene locus_tag LOCUS_21770 4937 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence236 501 731 gene locus_tag LOCUS_21780 501 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 753 1520 gene locus_tag LOCUS_21790 753 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1890 1579 gene locus_tag LOCUS_21800 1890 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1974 2435 gene locus_tag LOCUS_21810 1974 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 3376 2432 gene locus_tag LOCUS_21820 gene rarD 3376 2432 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 protein_id gnl|my_center|LOCUS_21820 3499 4161 gene locus_tag LOCUS_21830 3499 4161 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence237 1768 143 gene locus_tag LOCUS_21840 1768 143 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_21840 2097 2543 gene locus_tag LOCUS_21850 gene tnpA 2097 2543 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_21850 3064 2714 gene locus_tag LOCUS_21860 3064 2714 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_21860 3500 3123 gene locus_tag LOCUS_21870 gene crcB 3500 3123 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_21870 4926 3826 gene locus_tag LOCUS_21880 gene ychF 4926 3826 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_21880 5109 6152 gene locus_tag LOCUS_21890 5109 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence238 1112 252 gene locus_tag LOCUS_21900 1112 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2514 1219 gene locus_tag LOCUS_21910 gene dnaA 2514 1219 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_21910 4266 3040 gene locus_tag LOCUS_21920 4266 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 5478 4324 gene locus_tag LOCUS_21930 5478 4324 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence239 1123 3987 gene locus_tag LOCUS_21940 1123 3987 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_21940 4007 5509 gene locus_tag LOCUS_21950 4007 5509 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203622.1 protein_id gnl|my_center|LOCUS_21950 5688 5888 gene locus_tag LOCUS_21960 5688 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence240 1212 4277 gene locus_tag LOCUS_21970 1212 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence241 895 299 gene locus_tag LOCUS_21980 895 299 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108735.1 protein_id gnl|my_center|LOCUS_21980 2296 1550 gene locus_tag LOCUS_21990 2296 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2555 2755 gene locus_tag LOCUS_22000 2555 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 4787 3198 gene locus_tag LOCUS_22010 4787 3198 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659443.1 protein_id gnl|my_center|LOCUS_22010 <6372 4817 gene locus_tag LOCUS_22020 <6372 4817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202526.1:TonB-dependent receptor >Feature sequence242 665 1348 gene locus_tag LOCUS_22030 665 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1349 2569 gene locus_tag LOCUS_22040 1349 2569 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107919.1 protein_id gnl|my_center|LOCUS_22040 2682 4061 gene locus_tag LOCUS_22050 2682 4061 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_22050 4087 5052 gene locus_tag LOCUS_22060 4087 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 <6351 5139 gene locus_tag LOCUS_22070 <6351 5139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873593.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence243 130 825 gene locus_tag LOCUS_22080 gene modB 130 825 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628423.1 protein_id gnl|my_center|LOCUS_22080 849 1943 gene locus_tag LOCUS_22090 gene modC 849 1943 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394039.1 protein_id gnl|my_center|LOCUS_22090 2509 2267 gene locus_tag LOCUS_22100 2509 2267 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_22100 3774 2644 gene locus_tag LOCUS_22110 gene mnmA 3774 2644 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203548.1 protein_id gnl|my_center|LOCUS_22110 3920 5959 gene locus_tag LOCUS_22120 3920 5959 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence244 3789 1210 gene locus_tag LOCUS_22130 3789 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 4539 3802 gene locus_tag LOCUS_22140 4539 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 5318 4578 gene locus_tag LOCUS_22150 5318 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 6068 5367 gene locus_tag LOCUS_22160 6068 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence245 1602 415 gene locus_tag LOCUS_22170 1602 415 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_22170 2857 1700 gene locus_tag LOCUS_22180 2857 1700 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_22180 4071 2869 gene locus_tag LOCUS_22190 4071 2869 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_22190 5285 4095 gene locus_tag LOCUS_22200 5285 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6269 5334 gene locus_tag LOCUS_22210 6269 5334 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528105.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence246 366 1208 gene locus_tag LOCUS_22220 366 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3678 1384 gene locus_tag LOCUS_22230 3678 1384 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 protein_id gnl|my_center|LOCUS_22230 4160 3678 gene locus_tag LOCUS_22240 4160 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 5407 4160 gene locus_tag LOCUS_22250 5407 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence247 131 901 gene locus_tag LOCUS_22260 131 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1554 2375 gene locus_tag LOCUS_22270 1554 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2875 3747 gene locus_tag LOCUS_22280 2875 3747 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_22280 4100 3849 gene locus_tag LOCUS_22290 4100 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 4459 5334 gene locus_tag LOCUS_22300 4459 5334 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_22300 5425 6288 gene locus_tag LOCUS_22310 5425 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence248 1272 295 gene locus_tag LOCUS_22320 1272 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 4553 1263 gene locus_tag LOCUS_22330 4553 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 5256 4558 gene locus_tag LOCUS_22340 5256 4558 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768470.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence249 321 1613 gene locus_tag LOCUS_22350 321 1613 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_22350 1856 2428 gene locus_tag LOCUS_22360 1856 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4314 2677 gene locus_tag LOCUS_22370 4314 2677 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_22370 4662 6278 gene locus_tag LOCUS_22380 4662 6278 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence250 2056 608 gene locus_tag LOCUS_22390 2056 608 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_22390 2422 2222 gene locus_tag LOCUS_22400 2422 2222 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964571.1 protein_id gnl|my_center|LOCUS_22400 3828 2476 gene locus_tag LOCUS_22410 gene rseP 3828 2476 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_22410 5052 3904 gene locus_tag LOCUS_22420 5052 3904 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_22420 5946 5074 gene locus_tag LOCUS_22430 5946 5074 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence251 1443 3530 gene locus_tag LOCUS_22440 1443 3530 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_22440 4365 3778 gene locus_tag LOCUS_22450 4365 3778 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261539.1 protein_id gnl|my_center|LOCUS_22450 4863 5393 gene locus_tag LOCUS_22460 4863 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392281.1 protein_id gnl|my_center|LOCUS_22460 5477 5743 gene locus_tag LOCUS_22470 5477 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence252 2499 157 gene locus_tag LOCUS_22480 2499 157 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_22480 4857 2548 gene locus_tag LOCUS_22490 4857 2548 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474357.1 protein_id gnl|my_center|LOCUS_22490 <6267 5197 gene locus_tag LOCUS_22500 <6267 5197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014548276.1:ROK family protein >Feature sequence253 291 3410 gene locus_tag LOCUS_22510 291 3410 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_22510 4461 3559 gene locus_tag LOCUS_22520 4461 3559 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845702.1 protein_id gnl|my_center|LOCUS_22520 4840 5268 gene locus_tag LOCUS_22530 4840 5268 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_22530 5261 5578 gene locus_tag LOCUS_22540 5261 5578 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962809.1 protein_id gnl|my_center|LOCUS_22540 6217 5768 gene locus_tag LOCUS_22550 6217 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence254 1935 661 gene locus_tag LOCUS_22560 1935 661 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_22560 3959 1974 gene locus_tag LOCUS_22570 3959 1974 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_22570 4128 4838 gene locus_tag LOCUS_22580 4128 4838 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence255 1088 156 gene locus_tag LOCUS_22590 1088 156 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974852.1 protein_id gnl|my_center|LOCUS_22590 1812 1066 gene locus_tag LOCUS_22600 1812 1066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_22600 2603 1827 gene locus_tag LOCUS_22610 2603 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 3379 2621 gene locus_tag LOCUS_22620 3379 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 4004 5905 gene locus_tag LOCUS_22630 gene pepF 4004 5905 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence256 568 395 gene locus_tag LOCUS_22640 568 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 661 1539 gene locus_tag LOCUS_22650 661 1539 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922574.1 protein_id gnl|my_center|LOCUS_22650 5824 1595 gene locus_tag LOCUS_22660 5824 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence257 1482 358 gene locus_tag LOCUS_22670 1482 358 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_22670 1650 2018 gene locus_tag LOCUS_22680 1650 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2174 5932 gene locus_tag LOCUS_22690 2174 5932 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence258 235 726 gene locus_tag LOCUS_22700 gene ybaK 235 726 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_22700 720 1358 gene locus_tag LOCUS_22710 720 1358 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116118.1 protein_id gnl|my_center|LOCUS_22710 1414 2070 gene locus_tag LOCUS_22720 1414 2070 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_22720 2093 3391 gene locus_tag LOCUS_22730 2093 3391 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_22730 3667 4578 gene locus_tag LOCUS_22740 3667 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 6043 4808 gene locus_tag LOCUS_22750 6043 4808 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_22750 >Feature sequence259 195 836 gene locus_tag LOCUS_22760 195 836 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_22760 1647 862 gene locus_tag LOCUS_22770 1647 862 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_22770 1935 4094 gene locus_tag LOCUS_22780 gene purL 1935 4094 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_22780 4277 5005 gene locus_tag LOCUS_22790 gene ubiE 4277 5005 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_22790 5018 5758 gene locus_tag LOCUS_22800 5018 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence260 672 1277 gene locus_tag LOCUS_22810 672 1277 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_22810 1281 1778 gene locus_tag LOCUS_22820 gene gmhB 1281 1778 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966334.1 protein_id gnl|my_center|LOCUS_22820 1780 2634 gene locus_tag LOCUS_22830 1780 2634 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957563.1 protein_id gnl|my_center|LOCUS_22830 3230 2631 gene locus_tag LOCUS_22840 3230 2631 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_22840 3709 4422 gene locus_tag LOCUS_22850 3709 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22850 4450 5637 gene locus_tag LOCUS_22860 4450 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22860 >Feature sequence261 <1 532 gene locus_tag LOCUS_22870 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000024529.1:thiol peroxidase 594 1184 gene locus_tag LOCUS_22880 594 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1627 1232 gene locus_tag LOCUS_22890 1627 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3162 1864 gene locus_tag LOCUS_22900 gene rimO 3162 1864 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_22900 4251 3301 gene locus_tag LOCUS_22910 gene ftsY 4251 3301 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_22910 4566 4411 gene locus_tag LOCUS_22920 4566 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 4757 4575 gene locus_tag LOCUS_22930 gene rpmG 4757 4575 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_22930 5016 4774 gene locus_tag LOCUS_22940 gene rpmB 5016 4774 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_22940 <6060 5296 gene locus_tag LOCUS_22950 <6060 5296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583758.1:YitT family protein >Feature sequence262 2003 1278 gene locus_tag LOCUS_22960 gene pflA 2003 1278 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303181.1 protein_id gnl|my_center|LOCUS_22960 4375 2150 gene locus_tag LOCUS_22970 gene pflB 4375 2150 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766750.1 protein_id gnl|my_center|LOCUS_22970 5778 4921 gene locus_tag LOCUS_22980 5778 4921 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence263 1470 70 gene locus_tag LOCUS_22990 1470 70 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_22990 2415 3569 gene locus_tag LOCUS_23000 2415 3569 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_23000 3573 4469 gene locus_tag LOCUS_23010 3573 4469 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_23010 4650 5738 gene locus_tag LOCUS_23020 4650 5738 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence264 3052 3465 gene locus_tag LOCUS_23030 3052 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 4426 3542 gene locus_tag LOCUS_23040 4426 3542 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence265 2123 489 gene locus_tag LOCUS_23050 2123 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2677 2255 gene locus_tag LOCUS_23060 2677 2255 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_23060 3033 2683 gene locus_tag LOCUS_23070 3033 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4601 3045 gene locus_tag LOCUS_23080 4601 3045 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_23080 5041 4637 gene locus_tag LOCUS_23090 gene mce 5041 4637 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_23090 5359 5195 gene locus_tag LOCUS_23100 5359 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence266 450 1043 gene locus_tag LOCUS_23110 450 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3640 1079 gene locus_tag LOCUS_23120 3640 1079 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_23120 4532 3642 gene locus_tag LOCUS_23130 4532 3642 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_23130 4987 4577 gene locus_tag LOCUS_23140 4987 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence267 <1 1110 gene locus_tag LOCUS_23150 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203671.1:aminopeptidase P family protein 1338 2297 gene locus_tag LOCUS_23160 1338 2297 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960316.1 protein_id gnl|my_center|LOCUS_23160 2308 3348 gene locus_tag LOCUS_23170 2308 3348 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_23170 3512 4810 gene locus_tag LOCUS_23180 3512 4810 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence268 965 306 gene locus_tag LOCUS_23190 965 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2037 2795 gene locus_tag LOCUS_23200 2037 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3831 2848 gene locus_tag LOCUS_23210 3831 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4891 3815 gene locus_tag LOCUS_23220 4891 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 5600 4950 gene locus_tag LOCUS_23230 5600 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence269 1353 337 gene locus_tag LOCUS_23240 1353 337 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_23240 1955 1371 gene locus_tag LOCUS_23250 1955 1371 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706953.1 protein_id gnl|my_center|LOCUS_23250 2276 2644 gene locus_tag LOCUS_23260 2276 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3394 2690 gene locus_tag LOCUS_23270 3394 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4118 3696 gene locus_tag LOCUS_23280 4118 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 5090 4404 gene locus_tag LOCUS_23290 5090 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 5580 5251 gene locus_tag LOCUS_23300 5580 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence270 353 616 gene locus_tag LOCUS_23310 353 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 1034 1780 gene locus_tag LOCUS_23320 1034 1780 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_23320 1805 2554 gene locus_tag LOCUS_23330 1805 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2565 3296 gene locus_tag LOCUS_23340 2565 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3653 4138 gene locus_tag LOCUS_23350 3653 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4430 4936 gene locus_tag LOCUS_23360 4430 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 4963 5457 gene locus_tag LOCUS_23370 4963 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence271 1430 1891 gene locus_tag LOCUS_23380 1430 1891 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_23380 2151 2867 gene locus_tag LOCUS_23390 gene deoD 2151 2867 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110707.1 protein_id gnl|my_center|LOCUS_23390 3620 3126 gene locus_tag LOCUS_23400 3620 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 4419 3604 gene locus_tag LOCUS_23410 4419 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4881 4474 gene locus_tag LOCUS_23420 4881 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 <5838 4944 gene locus_tag LOCUS_23430 <5838 4944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007757189.1:JAB-like toxin 1 domain-containing protein >Feature sequence272 508 1251 gene locus_tag LOCUS_23440 508 1251 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_23440 3979 1313 gene locus_tag LOCUS_23450 3979 1313 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_23450 4829 4098 gene locus_tag LOCUS_23460 4829 4098 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence273 524 9 gene locus_tag LOCUS_23470 524 9 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_23470 668 1810 gene locus_tag LOCUS_23480 668 1810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_23480 1811 2665 gene locus_tag LOCUS_23490 1811 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2671 3171 gene locus_tag LOCUS_23500 2671 3171 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459984.1 protein_id gnl|my_center|LOCUS_23500 4057 3398 gene locus_tag LOCUS_23510 4057 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 4337 5257 gene locus_tag LOCUS_23520 gene dapA 4337 5257 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence274 2184 16 gene locus_tag LOCUS_23530 2184 16 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_23530 3676 2339 gene locus_tag LOCUS_23540 3676 2339 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142242.1 protein_id gnl|my_center|LOCUS_23540 5057 3681 gene locus_tag LOCUS_23550 5057 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5283 5119 gene locus_tag LOCUS_23560 5283 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence275 828 2003 gene locus_tag LOCUS_23570 828 2003 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_23570 2223 5309 gene locus_tag LOCUS_23580 2223 5309 CDS product chondroitinase family polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767535.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence276 43 1113 gene locus_tag LOCUS_23590 gene proB 43 1113 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202027.1 protein_id gnl|my_center|LOCUS_23590 1168 2415 gene locus_tag LOCUS_23600 1168 2415 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933139.1 protein_id gnl|my_center|LOCUS_23600 2526 3839 gene locus_tag LOCUS_23610 2526 3839 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence277 <1 1048 gene locus_tag LOCUS_23620 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994211.1:MFS transporter 1361 5389 gene locus_tag LOCUS_23630 1361 5389 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence278 <1 1309 gene locus_tag LOCUS_23640 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195116.1:DUF4041 domain-containing protein 1573 1433 gene locus_tag LOCUS_23650 1573 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3223 1925 gene locus_tag LOCUS_23660 3223 1925 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_23660 3479 3267 gene locus_tag LOCUS_23670 3479 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 4235 3480 gene locus_tag LOCUS_23680 4235 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5239 4298 gene locus_tag LOCUS_23690 5239 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence279 681 929 gene locus_tag LOCUS_23700 681 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 3725 1263 gene locus_tag LOCUS_23710 3725 1263 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_23710 4443 3799 gene locus_tag LOCUS_23720 gene degU 4443 3799 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_23720 <5526 4451 gene locus_tag LOCUS_23730 <5526 4451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101434.1:sensor histidine kinase >Feature sequence280 1077 346 gene locus_tag LOCUS_23740 1077 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1427 3439 gene locus_tag LOCUS_23750 1427 3439 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_23750 3443 5143 gene locus_tag LOCUS_23760 3443 5143 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence281 803 4540 gene locus_tag LOCUS_23770 803 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence282 376 591 gene locus_tag LOCUS_23780 376 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 811 2517 gene locus_tag LOCUS_23790 811 2517 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_23790 2744 3439 gene locus_tag LOCUS_23800 2744 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3818 3609 gene locus_tag LOCUS_23810 3818 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 3854 4444 gene locus_tag LOCUS_23820 3854 4444 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_23820 4441 5295 gene locus_tag LOCUS_23830 4441 5295 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477139.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence283 290 496 gene locus_tag LOCUS_23840 290 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1164 1517 gene locus_tag LOCUS_23850 1164 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1843 2784 gene locus_tag LOCUS_23860 1843 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 3089 3724 gene locus_tag LOCUS_23870 3089 3724 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_23870 <5483 3783 gene locus_tag LOCUS_23880 <5483 3783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109177.1:M3 family metallopeptidase >Feature sequence284 1075 275 gene locus_tag LOCUS_23890 gene lgt 1075 275 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_23890 1760 1296 gene locus_tag LOCUS_23900 1760 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23900 2386 1844 gene locus_tag LOCUS_23910 2386 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2768 4243 gene locus_tag LOCUS_23920 gene cysS 2768 4243 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence285 <1 1098 gene locus_tag LOCUS_23930 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763485.1:DUF1015 domain-containing protein 1325 3712 gene locus_tag LOCUS_23940 1325 3712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_23940 3889 4548 gene locus_tag LOCUS_23950 3889 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence286 2656 572 gene locus_tag LOCUS_23960 2656 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3696 2875 gene locus_tag LOCUS_23970 3696 2875 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_23970 <5434 4340 gene locus_tag LOCUS_23980 <5434 4340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108753.1:DEAD/DEAH box helicase >Feature sequence287 963 1910 gene locus_tag LOCUS_23990 gene rsgA 963 1910 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_23990 2118 3149 gene locus_tag LOCUS_24000 gene mnmH 2118 3149 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_24000 3642 3151 gene locus_tag LOCUS_24010 3642 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 4108 5157 gene locus_tag LOCUS_24020 4108 5157 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence288 <1 521 gene locus_tag LOCUS_24030 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015682.1:endonuclease MutS2 596 2149 gene locus_tag LOCUS_24040 596 2149 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_24040 2288 3076 gene locus_tag LOCUS_24050 2288 3076 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_24050 3166 3828 gene locus_tag LOCUS_24060 3166 3828 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_24060 3934 5139 gene locus_tag LOCUS_24070 3934 5139 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence289 1042 152 gene locus_tag LOCUS_24080 1042 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1869 1201 gene locus_tag LOCUS_24090 1869 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2428 1937 gene locus_tag LOCUS_24100 2428 1937 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_24100 2596 3561 gene locus_tag LOCUS_24110 2596 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_24110 3567 4712 gene locus_tag LOCUS_24120 3567 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4712 5110 gene locus_tag LOCUS_24130 4712 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence290 <1 1236 gene locus_tag LOCUS_24140 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108758.1:TonB-dependent receptor 2439 1567 gene locus_tag LOCUS_24150 2439 1567 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_24150 3861 2680 gene locus_tag LOCUS_24160 3861 2680 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_24160 4082 5200 gene locus_tag LOCUS_24170 4082 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence291 318 25 gene locus_tag LOCUS_24180 318 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2332 299 gene locus_tag LOCUS_24190 gene ftsH 2332 299 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_24190 2732 2349 gene locus_tag LOCUS_24200 gene rsfS 2732 2349 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_24200 2911 3708 gene locus_tag LOCUS_24210 2911 3708 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_24210 4407 3916 gene locus_tag LOCUS_24220 4407 3916 CDS product DUF4625 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784028.1 protein_id gnl|my_center|LOCUS_24220 4927 4472 gene locus_tag LOCUS_24230 4927 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence292 355 2148 gene locus_tag LOCUS_24240 gene nuoF 355 2148 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_24240 2129 3934 gene locus_tag LOCUS_24250 2129 3934 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766747.1 protein_id gnl|my_center|LOCUS_24250 4033 4512 gene locus_tag LOCUS_24260 gene nuoE 4033 4512 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence293 <1 757 gene locus_tag LOCUS_24270 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870112.1:aldolase/citrate lyase family protein 799 2358 gene locus_tag LOCUS_24280 gene citF 799 2358 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868780.1 protein_id gnl|my_center|LOCUS_24280 2962 4365 gene locus_tag LOCUS_24290 gene citG 2962 4365 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence294 182 991 gene locus_tag LOCUS_24300 gene cysQ 182 991 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_24300 1432 2073 gene locus_tag LOCUS_24310 1432 2073 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922512.1 protein_id gnl|my_center|LOCUS_24310 3229 2291 gene locus_tag LOCUS_24320 3229 2291 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937953.1 protein_id gnl|my_center|LOCUS_24320 <5299 3291 gene locus_tag LOCUS_24330 <5299 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555650.1:TonB-dependent receptor >Feature sequence295 <1 652 gene locus_tag LOCUS_24340 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_129254226.1:peptidoglycan DD-metalloendopeptidase family protein 675 3971 gene locus_tag LOCUS_24350 675 3971 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_24350 3964 4371 gene locus_tag LOCUS_24360 3964 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 4372 4797 gene locus_tag LOCUS_24370 gene ybeY 4372 4797 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence296 671 1150 gene locus_tag LOCUS_24380 671 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3525 3737 gene locus_tag LOCUS_24390 3525 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence297 2283 58 gene locus_tag LOCUS_24400 2283 58 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932043.1 protein_id gnl|my_center|LOCUS_24400 4284 2521 gene locus_tag LOCUS_24410 4284 2521 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_24410 <5241 4537 gene locus_tag LOCUS_24420 <5241 4537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787468.1:RelA/SpoT family protein >Feature sequence298 3264 1279 gene locus_tag LOCUS_24430 3264 1279 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444411.1 protein_id gnl|my_center|LOCUS_24430 4174 3377 gene locus_tag LOCUS_24440 4174 3377 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_24440 <5185 4268 gene locus_tag LOCUS_24450 <5185 4268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532608.1:carboxyl transferase domain-containing protein >Feature sequence299 3615 2527 gene locus_tag LOCUS_24460 gene carA 3615 2527 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_24460 5060 3723 gene locus_tag LOCUS_24470 gene argH 5060 3723 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence300 204 2522 gene locus_tag LOCUS_24480 204 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 3475 2534 gene locus_tag LOCUS_24490 3475 2534 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_24490 4106 4849 gene locus_tag LOCUS_24500 gene pssA 4106 4849 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence301 1640 237 gene locus_tag LOCUS_24510 1640 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2866 2135 gene locus_tag LOCUS_24520 gene vpsK 2866 2135 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245630.1 protein_id gnl|my_center|LOCUS_24520 4052 2850 gene locus_tag LOCUS_24530 gene vpsj 4052 2850 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence302 1533 277 gene locus_tag LOCUS_24540 1533 277 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963821.1 protein_id gnl|my_center|LOCUS_24540 2348 3262 gene locus_tag LOCUS_24550 2348 3262 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_24550 4545 3277 gene locus_tag LOCUS_24560 4545 3277 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_24560 4786 4547 gene locus_tag LOCUS_24570 4786 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence303 441 136 gene locus_tag LOCUS_24580 441 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2398 716 gene locus_tag LOCUS_24590 gene pruA 2398 716 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_24590 4341 2902 gene locus_tag LOCUS_24600 4341 2902 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_24600 <5143 4441 gene locus_tag LOCUS_24610 <5143 4441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763964.1:LuxR C-terminal-related transcriptional regulator >Feature sequence304 473 2776 gene locus_tag LOCUS_24620 473 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence305 1884 349 gene locus_tag LOCUS_24630 1884 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 2707 1973 gene locus_tag LOCUS_24640 2707 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 4227 2794 gene locus_tag LOCUS_24650 4227 2794 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108730.1 protein_id gnl|my_center|LOCUS_24650 <5117 4243 gene locus_tag LOCUS_24660 <5117 4243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303104.1:TonB-dependent receptor >Feature sequence306 336 998 gene locus_tag LOCUS_24670 336 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1029 4364 gene locus_tag LOCUS_24680 1029 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 4374 4805 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtgtaatcagtttctttttgaaagctattaacacc >Feature sequence307 530 93 gene locus_tag LOCUS_24690 530 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030561.1 protein_id gnl|my_center|LOCUS_24690 1396 719 gene locus_tag LOCUS_24700 1396 719 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_24700 1672 2841 gene locus_tag LOCUS_24710 1672 2841 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813548.1 protein_id gnl|my_center|LOCUS_24710 3074 3244 gene locus_tag LOCUS_24720 3074 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3353 3610 gene locus_tag LOCUS_24730 3353 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 3744 4028 gene locus_tag LOCUS_24740 3744 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 <5094 4420 gene locus_tag LOCUS_24750 <5094 4420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962449.1:aspartate--tRNA ligase >Feature sequence308 862 1158 gene locus_tag LOCUS_24760 862 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1176 1409 gene locus_tag LOCUS_24770 1176 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1731 2228 gene locus_tag LOCUS_24780 1731 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3581 2304 gene locus_tag LOCUS_24790 3581 2304 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence309 1663 845 gene locus_tag LOCUS_24800 gene rpsB 1663 845 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_24800 2152 1766 gene locus_tag LOCUS_24810 gene rpsI 2152 1766 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_24810 2613 2158 gene locus_tag LOCUS_24820 gene rplM 2613 2158 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_24820 3025 3546 gene locus_tag LOCUS_24830 3025 3546 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_24830 4973 3843 gene locus_tag LOCUS_24840 4973 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence310 109 1632 gene locus_tag LOCUS_24850 109 1632 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767366.1 protein_id gnl|my_center|LOCUS_24850 1800 2918 gene locus_tag LOCUS_24860 1800 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2972 4252 gene locus_tag LOCUS_24870 2972 4252 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence311 182 994 gene locus_tag LOCUS_24880 182 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1046 3037 gene locus_tag LOCUS_24890 1046 3037 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_24890 3104 3577 gene locus_tag LOCUS_24900 3104 3577 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_24900 4532 3627 gene locus_tag LOCUS_24910 4532 3627 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence312 <1 1515 gene locus_tag LOCUS_24920 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005453805.1:methionine synthase 1871 2830 gene locus_tag LOCUS_24930 gene metF 1871 2830 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_24930 2982 3491 gene locus_tag LOCUS_24940 2982 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence313 381 1712 gene locus_tag LOCUS_24950 gene nhaA 381 1712 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_24950 1952 2034 gene locus_tag LOCUS_t00460 1952 2034 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2367 3044 gene locus_tag LOCUS_24960 2367 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3733 4242 gene locus_tag LOCUS_24970 3733 4242 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_24970 4487 4987 gene locus_tag LOCUS_24980 4487 4987 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence314 <1 796 gene locus_tag LOCUS_24990 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763300.1:AAA family ATPase 858 4412 gene locus_tag LOCUS_25000 gene nifJ 858 4412 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence315 <1 1328 gene locus_tag LOCUS_25010 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765466.1:signal peptide peptidase SppA 1499 2626 gene locus_tag LOCUS_25020 gene lpxK 1499 2626 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_25020 <4917 2827 gene locus_tag LOCUS_25030 <4917 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838773.1:lamin tail domain-containing protein >Feature sequence316 1730 1071 gene locus_tag LOCUS_25040 1730 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 >Feature sequence317 807 1676 gene locus_tag LOCUS_25050 807 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 1979 3106 gene locus_tag LOCUS_25060 1979 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 4269 3133 gene locus_tag LOCUS_25070 4269 3133 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence318 1016 324 gene locus_tag LOCUS_25080 1016 324 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680128.1 protein_id gnl|my_center|LOCUS_25080 1315 1719 gene locus_tag LOCUS_25090 1315 1719 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_25090 2347 1724 gene locus_tag LOCUS_25100 2347 1724 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065173.1 protein_id gnl|my_center|LOCUS_25100 3064 4290 gene locus_tag LOCUS_25110 3064 4290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence319 333 2393 gene locus_tag LOCUS_25120 333 2393 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_25120 2417 2566 gene locus_tag LOCUS_25130 2417 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2658 3350 gene locus_tag LOCUS_25140 2658 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_25140 3401 3922 gene locus_tag LOCUS_25150 gene fldA 3401 3922 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018618.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence320 1527 1886 gene locus_tag LOCUS_25160 1527 1886 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071058.1 protein_id gnl|my_center|LOCUS_25160 3016 2147 gene locus_tag LOCUS_25170 3016 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4554 3604 gene locus_tag LOCUS_25180 4554 3604 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence321 321 914 gene locus_tag LOCUS_25190 321 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2551 965 gene locus_tag LOCUS_25200 2551 965 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765024.1 protein_id gnl|my_center|LOCUS_25200 3435 2725 gene locus_tag LOCUS_25210 gene pepE 3435 2725 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 protein_id gnl|my_center|LOCUS_25210 <4816 3635 gene locus_tag LOCUS_25220 <4816 3635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787406.1:response regulator >Feature sequence322 317 1471 gene locus_tag LOCUS_25230 317 1471 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_25230 2392 1517 gene locus_tag LOCUS_25240 gene sucD 2392 1517 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_25240 3561 2392 gene locus_tag LOCUS_25250 gene sucC 3561 2392 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_25250 4399 3893 gene locus_tag LOCUS_25260 4399 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence323 495 2858 gene locus_tag LOCUS_25270 495 2858 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_25270 3757 3149 gene locus_tag LOCUS_25280 3757 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 4460 3747 gene locus_tag LOCUS_25290 4460 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence324 <1 1935 gene locus_tag LOCUS_25300 <1 1935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000488898.1:methyl-accepting chemotaxis protein 3192 2446 gene locus_tag LOCUS_25310 3192 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence325 1275 115 gene locus_tag LOCUS_25320 1275 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 >Feature sequence326 1188 253 gene locus_tag LOCUS_25330 1188 253 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_25330 1703 2857 gene locus_tag LOCUS_25340 1703 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2996 3766 gene locus_tag LOCUS_25350 2996 3766 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence327 1372 401 gene locus_tag LOCUS_25360 1372 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 1539 2297 gene locus_tag LOCUS_25370 1539 2297 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545056.1 protein_id gnl|my_center|LOCUS_25370 2287 4365 gene locus_tag LOCUS_25380 2287 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence328 1674 346 gene locus_tag LOCUS_25390 1674 346 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_25390 3818 1677 gene locus_tag LOCUS_25400 3818 1677 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence329 580 383 gene locus_tag LOCUS_25410 580 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2180 603 gene locus_tag LOCUS_25420 2180 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3054 2503 gene locus_tag LOCUS_25430 3054 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 <4703 3174 gene locus_tag LOCUS_25440 <4703 3174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962836.1:PspC domain-containing protein >Feature sequence330 2805 292 gene locus_tag LOCUS_25450 2805 292 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_25450 3554 3123 gene locus_tag LOCUS_25460 3554 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 3691 4137 gene locus_tag LOCUS_25470 3691 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence331 <1 825 gene locus_tag LOCUS_25480 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785727.1:FAD:protein FMN transferase 1452 1207 gene locus_tag LOCUS_25490 1452 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1631 4129 gene locus_tag LOCUS_25500 1631 4129 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence332 355 639 gene locus_tag LOCUS_25510 355 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25510 564 830 gene locus_tag LOCUS_25520 564 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25520 2130 1120 gene locus_tag LOCUS_25530 gene hemH 2130 1120 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957341.1 protein_id gnl|my_center|LOCUS_25530 3128 2220 gene locus_tag LOCUS_25540 gene hemF 3128 2220 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_25540 3806 4006 gene locus_tag LOCUS_25550 3806 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence333 <1 1019 gene locus_tag LOCUS_25560 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015884.1:L-erythro-3,5-diaminohexanoate dehydrogenase 1019 2281 gene locus_tag LOCUS_25570 gene ablA 1019 2281 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_25570 2268 3284 gene locus_tag LOCUS_25580 2268 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence334 373 1566 gene locus_tag LOCUS_25590 373 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 1617 2318 gene locus_tag LOCUS_25600 1617 2318 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_25600 2356 2982 gene locus_tag LOCUS_25610 2356 2982 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_25610 3121 4323 gene locus_tag LOCUS_25620 3121 4323 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence335 460 1173 gene locus_tag LOCUS_25630 460 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_25630 1419 3614 gene locus_tag LOCUS_25640 1419 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3620 4438 gene locus_tag LOCUS_25650 3620 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence336 1051 245 gene locus_tag LOCUS_25660 1051 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2187 1150 gene locus_tag LOCUS_25670 2187 1150 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_25670 3215 2223 gene locus_tag LOCUS_25680 3215 2223 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_25680 4256 3219 gene locus_tag LOCUS_25690 4256 3219 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence337 623 549 gene locus_tag LOCUS_t00470 623 549 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 715 641 gene locus_tag LOCUS_t00480 715 641 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 839 1513 gene locus_tag LOCUS_25700 839 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1641 2402 gene locus_tag LOCUS_25710 1641 2402 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_25710 2439 3653 gene locus_tag LOCUS_25720 2439 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038521.1 protein_id gnl|my_center|LOCUS_25720 3741 3992 gene locus_tag LOCUS_25730 3741 3992 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence338 1651 62 gene locus_tag LOCUS_25740 1651 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2136 1648 gene locus_tag LOCUS_25750 2136 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2934 2149 gene locus_tag LOCUS_25760 2934 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3535 3314 gene locus_tag LOCUS_25770 3535 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3742 4164 gene locus_tag LOCUS_25780 3742 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 4204 4527 gene locus_tag LOCUS_25790 4204 4527 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence339 1641 310 gene locus_tag LOCUS_25800 1641 310 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_25800 2621 1641 gene locus_tag LOCUS_25810 2621 1641 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_25810 3823 2636 gene locus_tag LOCUS_25820 3823 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 <4535 3825 gene locus_tag LOCUS_25830 <4535 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801447.1:DUF4129 domain-containing protein >Feature sequence340 1112 1495 gene locus_tag LOCUS_25840 1112 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1741 2763 gene locus_tag LOCUS_25850 gene ruvB 1741 2763 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_25850 2775 3104 gene locus_tag LOCUS_25860 2775 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 4291 3428 gene locus_tag LOCUS_25870 4291 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence341 326 478 gene locus_tag LOCUS_25880 326 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2104 3066 gene locus_tag LOCUS_25890 2104 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3135 4205 gene locus_tag LOCUS_25900 3135 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25900 >Feature sequence342 284 469 gene locus_tag LOCUS_25910 284 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1251 520 gene locus_tag LOCUS_25920 1251 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2231 3172 gene locus_tag LOCUS_25930 2231 3172 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_25930 3401 3473 gene locus_tag LOCUS_t00490 3401 3473 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3509 3760 gene locus_tag LOCUS_25940 gene rpsT 3509 3760 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence343 392 2191 gene locus_tag LOCUS_25950 392 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2188 2790 gene locus_tag LOCUS_25960 2188 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2947 4278 gene locus_tag LOCUS_25970 gene ffh 2947 4278 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence344 1868 330 gene locus_tag LOCUS_25980 1868 330 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_25980 3031 1886 gene locus_tag LOCUS_25990 3031 1886 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_25990 4443 3400 gene locus_tag LOCUS_26000 4443 3400 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence345 1569 166 gene locus_tag LOCUS_26010 1569 166 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_26010 <4466 1582 gene locus_tag LOCUS_26020 <4466 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108255.1:TonB-dependent receptor >Feature sequence346 2145 1087 gene locus_tag LOCUS_26030 2145 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 3317 2211 gene locus_tag LOCUS_26040 3317 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3814 3329 gene locus_tag LOCUS_26050 3814 3329 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823962.1 protein_id gnl|my_center|LOCUS_26050 >Feature sequence347 2626 317 gene locus_tag LOCUS_26060 gene gshAB 2626 317 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990064.1 protein_id gnl|my_center|LOCUS_26060 4041 2761 gene locus_tag LOCUS_26070 4041 2761 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence348 1554 223 gene locus_tag LOCUS_26080 1554 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26080 3453 1579 gene locus_tag LOCUS_26090 3453 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26090 <4412 3875 gene locus_tag LOCUS_26100 <4412 3875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202310.1:glycoside hydrolase family 97 protein >Feature sequence349 <1 537 gene locus_tag LOCUS_26110 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037019.1:acyltransferase 3467 1470 gene locus_tag LOCUS_26120 3467 1470 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_26120 4208 3480 gene locus_tag LOCUS_26130 4208 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26130 >Feature sequence350 1463 372 gene locus_tag LOCUS_26140 1463 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2664 1477 gene locus_tag LOCUS_26150 2664 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2905 4155 gene locus_tag LOCUS_26160 2905 4155 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence351 971 2671 gene locus_tag LOCUS_26170 971 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 >Feature sequence352 809 1600 gene locus_tag LOCUS_26180 gene rsmA 809 1600 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_26180 1626 2987 gene locus_tag LOCUS_26190 gene mgtE 1626 2987 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760927.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence353 151 77 gene locus_tag LOCUS_t00500 151 77 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 439 1239 gene locus_tag LOCUS_26200 439 1239 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_26200 1707 4190 gene locus_tag LOCUS_26210 1707 4190 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence354 939 3158 gene locus_tag LOCUS_26220 939 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 <4297 3584 gene locus_tag LOCUS_26230 <4297 3584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767535.1:chondroitinase family polysaccharide lyase >Feature sequence355 296 544 gene locus_tag LOCUS_26240 296 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 557 802 gene locus_tag LOCUS_26250 557 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 874 1209 gene locus_tag LOCUS_26260 874 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1213 1605 gene locus_tag LOCUS_26270 1213 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence356 1360 353 gene locus_tag LOCUS_26280 1360 353 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_26280 1910 1365 gene locus_tag LOCUS_26290 1910 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3164 2217 gene locus_tag LOCUS_26300 3164 2217 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_26300 3731 3174 gene locus_tag LOCUS_26310 3731 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 4110 4184 gene locus_tag LOCUS_t00510 4110 4184 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence357 735 394 gene locus_tag LOCUS_26320 735 394 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081549.1 protein_id gnl|my_center|LOCUS_26320 2103 739 gene locus_tag LOCUS_26330 2103 739 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_26330 2522 2109 gene locus_tag LOCUS_26340 2522 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2880 2533 gene locus_tag LOCUS_26350 2880 2533 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_26350 3200 4006 gene locus_tag LOCUS_26360 3200 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence358 420 1445 gene locus_tag LOCUS_26370 420 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1508 3670 gene locus_tag LOCUS_26380 1508 3670 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_26380 3695 4012 gene locus_tag LOCUS_26390 3695 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence359 587 240 gene locus_tag LOCUS_26400 587 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1281 637 gene locus_tag LOCUS_26410 1281 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 2825 1287 gene locus_tag LOCUS_26420 2825 1287 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_26420 3817 2945 gene locus_tag LOCUS_26430 3817 2945 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence360 1411 263 gene locus_tag LOCUS_26440 1411 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1888 1694 gene locus_tag LOCUS_26450 1888 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 2155 1937 gene locus_tag LOCUS_26460 2155 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3590 2187 gene locus_tag LOCUS_26470 gene fumC 3590 2187 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_26470 <4191 3670 gene locus_tag LOCUS_26480 <4191 3670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002855629.1:flavodoxin FldA >Feature sequence361 2008 851 gene locus_tag LOCUS_26490 2008 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2641 2063 gene locus_tag LOCUS_26500 2641 2063 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_26500 3085 3468 gene locus_tag LOCUS_26510 3085 3468 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109078.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence362 213 76 gene locus_tag LOCUS_26520 213 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence363 1958 1410 gene locus_tag LOCUS_26530 gene atpH 1958 1410 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_26530 2574 2080 gene locus_tag LOCUS_26540 2574 2080 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_26540 2937 2683 gene locus_tag LOCUS_26550 gene atpE 2937 2683 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_26550 4081 2999 gene locus_tag LOCUS_26560 gene atpB 4081 2999 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence364 926 468 gene locus_tag LOCUS_26570 926 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2546 1044 gene locus_tag LOCUS_26580 2546 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26580 3392 2574 gene locus_tag LOCUS_26590 3392 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26590 >Feature sequence365 912 244 gene locus_tag LOCUS_26600 912 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1603 1088 gene locus_tag LOCUS_26610 1603 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2416 1616 gene locus_tag LOCUS_26620 2416 1616 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_26620 3401 2601 gene locus_tag LOCUS_26630 3401 2601 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_26630 3619 3404 gene locus_tag LOCUS_26640 3619 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence366 568 395 gene locus_tag LOCUS_26650 568 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 902 1903 gene locus_tag LOCUS_26660 gene rfaE1 902 1903 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_26660 2119 2922 gene locus_tag LOCUS_26670 2119 2922 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_26670 2943 3818 gene locus_tag LOCUS_26680 2943 3818 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence367 1276 224 gene locus_tag LOCUS_26690 1276 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1518 1327 gene locus_tag LOCUS_26700 1518 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2471 1515 gene locus_tag LOCUS_26710 2471 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 3628 2474 gene locus_tag LOCUS_26720 3628 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3883 3665 gene locus_tag LOCUS_26730 3883 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence368 >Feature sequence369 863 66 gene locus_tag LOCUS_26740 863 66 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_26740 1199 3184 gene locus_tag LOCUS_26750 1199 3184 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_26750 3364 3915 gene locus_tag LOCUS_26760 3364 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence370 828 130 gene locus_tag LOCUS_26770 828 130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_26770 1125 2489 gene locus_tag LOCUS_26780 1125 2489 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_26780 2722 3825 gene locus_tag LOCUS_26790 2722 3825 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence371 2008 491 gene locus_tag LOCUS_26800 2008 491 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_26800 2321 3832 gene locus_tag LOCUS_26810 2321 3832 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence372 23 2356 gene locus_tag LOCUS_26820 23 2356 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202081.1 protein_id gnl|my_center|LOCUS_26820 2405 3625 gene locus_tag LOCUS_26830 2405 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784605.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence373 749 1306 gene locus_tag LOCUS_26840 749 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 1306 2058 gene locus_tag LOCUS_26850 1306 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 <4025 2337 gene locus_tag LOCUS_26860 <4025 2337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence374 446 679 gene locus_tag LOCUS_26870 446 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 760 3690 gene locus_tag LOCUS_26880 760 3690 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence375 1909 1232 gene locus_tag LOCUS_26890 1909 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2161 3636 gene locus_tag LOCUS_26900 2161 3636 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_26900 >Feature sequence376 <1 973 gene locus_tag LOCUS_26910 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:DUF6443 domain-containing protein 978 1445 gene locus_tag LOCUS_26920 978 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1923 2534 gene locus_tag LOCUS_26930 1923 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2573 3064 gene locus_tag LOCUS_26940 2573 3064 CDS product TIGR02594 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951317.1 protein_id gnl|my_center|LOCUS_26940 3067 3528 gene locus_tag LOCUS_26950 3067 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3806 3588 gene locus_tag LOCUS_26960 3806 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence377 2594 207 gene locus_tag LOCUS_26970 2594 207 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence378 177 1979 gene locus_tag LOCUS_26980 177 1979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107303.1 protein_id gnl|my_center|LOCUS_26980 1976 3721 gene locus_tag LOCUS_26990 1976 3721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107304.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence379 165 1205 gene locus_tag LOCUS_27000 gene lpxD 165 1205 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_27000 1247 2638 gene locus_tag LOCUS_27010 1247 2638 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_27010 2707 3489 gene locus_tag LOCUS_27020 gene lpxA 2707 3489 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_27020 >Feature sequence380 1093 506 gene locus_tag LOCUS_27030 1093 506 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_27030 3736 2651 gene locus_tag LOCUS_27040 3736 2651 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766211.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence381 <1 1601 gene locus_tag LOCUS_27050 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120684.1:polyprenyl synthetase family protein 1604 2578 gene locus_tag LOCUS_27060 1604 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence382 1561 170 gene locus_tag LOCUS_27070 gene xseA 1561 170 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_27070 2384 1575 gene locus_tag LOCUS_27080 2384 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2543 2662 gene locus_tag LOCUS_27090 2543 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2751 3425 gene locus_tag LOCUS_27100 2751 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence383 3123 1945 gene locus_tag LOCUS_27110 3123 1945 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence384 1795 1046 gene locus_tag LOCUS_27120 1795 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2334 2828 gene locus_tag LOCUS_27130 2334 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 2843 3214 gene locus_tag LOCUS_27140 2843 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3226 3774 gene locus_tag LOCUS_27150 3226 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence385 1 420 gene locus_tag LOCUS_27160 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 503 1660 gene locus_tag LOCUS_27170 503 1660 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_27170 1692 2495 gene locus_tag LOCUS_27180 gene argB 1692 2495 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_27180 2585 3649 gene locus_tag LOCUS_27190 2585 3649 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence386 697 242 gene locus_tag LOCUS_27200 697 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 1693 827 gene locus_tag LOCUS_27210 1693 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 3369 1912 gene locus_tag LOCUS_27220 3369 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence387 1125 841 gene locus_tag LOCUS_27230 1125 841 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_27230 1225 2223 gene locus_tag LOCUS_27240 1225 2223 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_27240 2471 3418 gene locus_tag LOCUS_27250 2471 3418 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence388 1923 460 gene locus_tag LOCUS_27260 1923 460 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_27260 3829 1949 gene locus_tag LOCUS_27270 3829 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence389 1571 2305 gene locus_tag LOCUS_27280 1571 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2392 2769 gene locus_tag LOCUS_27290 2392 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 2911 3453 gene locus_tag LOCUS_27300 2911 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 >Feature sequence390 2885 1980 gene locus_tag LOCUS_27310 2885 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 3409 2897 gene locus_tag LOCUS_27320 3409 2897 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065175.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence391 <1 894 gene locus_tag LOCUS_27330 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962675.1:anthranilate phosphoribosyltransferase 898 1695 gene locus_tag LOCUS_27340 gene trpC 898 1695 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_27340 1885 3696 gene locus_tag LOCUS_27350 1885 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence392 366 295 gene locus_tag LOCUS_t00520 366 295 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 536 3589 gene locus_tag LOCUS_27360 536 3589 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence393 674 3148 gene locus_tag LOCUS_27370 674 3148 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence394 1826 642 gene locus_tag LOCUS_27380 1826 642 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_27380 3299 1944 gene locus_tag LOCUS_27390 3299 1944 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence395 634 978 gene locus_tag LOCUS_27400 634 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 1203 913 gene locus_tag LOCUS_27410 1203 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 <3759 2231 gene locus_tag LOCUS_27420 <3759 2231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase >Feature sequence396 9 239 gene locus_tag LOCUS_27430 9 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1895 1725 gene locus_tag LOCUS_27440 1895 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence397 76 1716 gene locus_tag LOCUS_27450 76 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence398 878 300 gene locus_tag LOCUS_27460 878 300 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817332.1 protein_id gnl|my_center|LOCUS_27460 997 1614 gene locus_tag LOCUS_27470 gene msrA 997 1614 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962794.1 protein_id gnl|my_center|LOCUS_27470 2102 2566 gene locus_tag LOCUS_27480 2102 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3600 2524 gene locus_tag LOCUS_27490 3600 2524 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence399 1994 366 gene locus_tag LOCUS_27500 gene sulP 1994 366 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_27500 2304 3521 gene locus_tag LOCUS_27510 2304 3521 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_27510 >Feature sequence400 76 150 gene locus_tag LOCUS_t00530 76 150 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 178 429 gene locus_tag LOCUS_27520 gene rpsT 178 429 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_27520 549 1244 gene locus_tag LOCUS_27530 gene radC 549 1244 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_27530 1461 2117 gene locus_tag LOCUS_27540 gene upp 1461 2117 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_27540 2656 2168 gene locus_tag LOCUS_27550 gene folK 2656 2168 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence401 1953 265 gene locus_tag LOCUS_27560 1953 265 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_27560 >Feature sequence402 2133 1138 gene locus_tag LOCUS_27570 2133 1138 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_27570 <3643 2257 gene locus_tag LOCUS_27580 <3643 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802230.1:lysine--tRNA ligase >Feature sequence403 525 265 gene locus_tag LOCUS_27590 525 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1841 633 gene locus_tag LOCUS_27600 gene nicX 1841 633 CDS product group II intron reverse transcriptase/nicotine-degrading enzyme NicX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108394.1 protein_id gnl|my_center|LOCUS_27600 2063 1911 gene locus_tag LOCUS_27610 2063 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2400 2681 gene locus_tag LOCUS_27620 2400 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3231 2713 gene locus_tag LOCUS_27630 3231 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence404 1226 483 gene locus_tag LOCUS_27640 1226 483 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_27640 2391 1783 gene locus_tag LOCUS_27650 2391 1783 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_27650 2885 2511 gene locus_tag LOCUS_27660 2885 2511 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_27660 <3635 2931 gene locus_tag LOCUS_27670 <3635 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107458.1:isoleucine--tRNA ligase >Feature sequence405 1114 368 gene locus_tag LOCUS_27680 1114 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2211 3023 gene locus_tag LOCUS_27690 2211 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence406 551 958 gene locus_tag LOCUS_27700 551 958 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763608.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence407 1668 196 gene locus_tag LOCUS_27710 1668 196 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence408 972 742 gene locus_tag LOCUS_27720 972 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1831 2727 gene locus_tag LOCUS_27730 1831 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 <3564 2728 gene locus_tag LOCUS_27740 <3564 2728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288004.1:response regulator >Feature sequence409 1577 645 gene locus_tag LOCUS_27750 1577 645 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_27750 2455 1634 gene locus_tag LOCUS_27760 2455 1634 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_27760 <3557 2580 gene locus_tag LOCUS_27770 <3557 2580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760778.1:DNA mismatch repair endonuclease MutL >Feature sequence410 321 2399 gene locus_tag LOCUS_27780 321 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3232 2435 gene locus_tag LOCUS_27790 gene proC 3232 2435 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence411 2228 2935 gene locus_tag LOCUS_27800 2228 2935 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence412 473 910 gene locus_tag LOCUS_27810 473 910 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072758.1 protein_id gnl|my_center|LOCUS_27810 1048 2370 gene locus_tag LOCUS_27820 1048 2370 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_27820 2374 2586 gene locus_tag LOCUS_27830 2374 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence413 191 877 gene locus_tag LOCUS_27840 191 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1674 988 gene locus_tag LOCUS_27850 1674 988 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_27850 3179 1680 gene locus_tag LOCUS_27860 3179 1680 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence414 943 209 gene locus_tag LOCUS_27870 943 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2548 1214 gene locus_tag LOCUS_27880 2548 1214 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence415 <1 672 gene locus_tag LOCUS_27890 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023304.1:dipeptidase 993 838 gene locus_tag LOCUS_27900 993 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2687 1050 gene locus_tag LOCUS_27910 2687 1050 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence416 1815 2555 gene locus_tag LOCUS_27920 1815 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 >Feature sequence417 582 1232 gene locus_tag LOCUS_27930 582 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2015 2749 gene locus_tag LOCUS_27940 2015 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence418 >Feature sequence419 409 32 gene locus_tag LOCUS_27950 gene rpsL 409 32 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_27950 817 2973 gene locus_tag LOCUS_27960 817 2973 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_27960 >Feature sequence420 <1 724 gene locus_tag LOCUS_27970 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762922.1:4-hydroxy-tetrahydrodipicolinate reductase 760 2148 gene locus_tag LOCUS_27980 760 2148 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_27980 2325 2882 gene locus_tag LOCUS_27990 2325 2882 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_27990 3311 2874 gene locus_tag LOCUS_28000 3311 2874 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence421 2927 447 gene locus_tag LOCUS_28010 2927 447 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_28010 3180 3254 gene locus_tag LOCUS_t00540 3180 3254 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 1325 1687 gene locus_tag LOCUS_28020 1325 1687 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_28020 1695 2885 gene locus_tag LOCUS_28030 1695 2885 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793362.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence423 1879 623 gene locus_tag LOCUS_28040 1879 623 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_28040 2170 3192 gene locus_tag LOCUS_28050 gene fbp 2170 3192 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454699.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence424 <1 771 gene locus_tag LOCUS_28060 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001211395.1:acetyl-CoA hydrolase/transferase C-terminal domain-containing protein 3129 823 gene locus_tag LOCUS_28070 3129 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence425 1003 2067 gene locus_tag LOCUS_28080 1003 2067 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_28080 2080 2649 gene locus_tag LOCUS_28090 2080 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence426 1286 1561 gene locus_tag LOCUS_28100 1286 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1823 2911 gene locus_tag LOCUS_28110 1823 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence427 1146 769 gene locus_tag LOCUS_28120 1146 769 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479566.1 protein_id gnl|my_center|LOCUS_28120 1218 1790 gene locus_tag LOCUS_28130 1218 1790 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_28130 <3312 1834 gene locus_tag LOCUS_28140 <3312 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108148.1:putative LPS assembly protein LptD >Feature sequence428 <3311 1334 gene locus_tag LOCUS_28150 <3311 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203621.1:TonB-dependent receptor >Feature sequence429 1179 430 gene locus_tag LOCUS_28160 1179 430 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_28160 3000 1195 gene locus_tag LOCUS_28170 3000 1195 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence430 1165 86 gene locus_tag LOCUS_28180 1165 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 3058 1187 gene locus_tag LOCUS_28190 3058 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence431 1044 241 gene locus_tag LOCUS_28200 1044 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 3075 1522 gene locus_tag LOCUS_28210 3075 1522 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence432 <1 750 gene locus_tag LOCUS_28220 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783491.1:succinate dehydrogenase/fumarate reductase iron-sulfur subunit 1090 1950 gene locus_tag LOCUS_28230 1090 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2223 2005 gene locus_tag LOCUS_28240 2223 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28240 >Feature sequence433 1111 320 gene locus_tag LOCUS_28250 1111 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 <3243 1098 gene locus_tag LOCUS_28260 <3243 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor >Feature sequence434 1060 146 gene locus_tag LOCUS_28270 1060 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964401.1 protein_id gnl|my_center|LOCUS_28270 1638 1189 gene locus_tag LOCUS_28280 1638 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2909 1707 gene locus_tag LOCUS_28290 2909 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence435 360 1904 gene locus_tag LOCUS_28300 360 1904 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_28300 2090 2172 gene locus_tag LOCUS_t00550 2090 2172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2753 3238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattccacattggtacgattgagag >Feature sequence436 1664 312 gene locus_tag LOCUS_28310 1664 312 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_28310 3232 1988 gene locus_tag LOCUS_28320 3232 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence437 1503 487 gene locus_tag LOCUS_28330 1503 487 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_28330 2406 1612 gene locus_tag LOCUS_28340 2406 1612 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_28340 2913 2410 gene locus_tag LOCUS_28350 2913 2410 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026207845.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence438 440 135 gene locus_tag LOCUS_28360 gene rpsJ 440 135 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_28360 2583 469 gene locus_tag LOCUS_28370 gene fusA 2583 469 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_28370 3096 2620 gene locus_tag LOCUS_28380 gene rpsG 3096 2620 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence439 416 895 gene locus_tag LOCUS_28390 416 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1174 2490 gene locus_tag LOCUS_28400 1174 2490 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_28400 3034 2642 gene locus_tag LOCUS_28410 3034 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence440 252 1184 gene locus_tag LOCUS_28420 252 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 1241 1627 gene locus_tag LOCUS_28430 1241 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1714 2367 gene locus_tag LOCUS_28440 1714 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 2580 2780 gene locus_tag LOCUS_28450 2580 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 >Feature sequence441 106 750 gene locus_tag LOCUS_28460 106 750 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_28460 818 1387 gene locus_tag LOCUS_28470 gene nqrE 818 1387 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_28470 1442 2698 gene locus_tag LOCUS_28480 gene nqrF 1442 2698 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705064.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence442 210 1694 gene locus_tag LOCUS_28490 210 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2369 2199 gene locus_tag LOCUS_28500 2369 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2611 2976 gene locus_tag LOCUS_28510 2611 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence443 2710 527 gene locus_tag LOCUS_28520 2710 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence444 1623 1285 gene locus_tag LOCUS_28530 1623 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2064 2279 gene locus_tag LOCUS_28540 2064 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence445 862 1050 gene locus_tag LOCUS_28550 862 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 1047 1862 gene locus_tag LOCUS_28560 1047 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 2201 2608 gene locus_tag LOCUS_28570 2201 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence446 208 135 gene locus_tag LOCUS_t00560 208 135 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 819 370 gene locus_tag LOCUS_28580 819 370 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_28580 1029 2084 gene locus_tag LOCUS_28590 1029 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2097 2777 gene locus_tag LOCUS_28600 2097 2777 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence447 783 406 gene locus_tag LOCUS_28610 783 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 991 1779 gene locus_tag LOCUS_28620 991 1779 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_28620 2714 1830 gene locus_tag LOCUS_28630 2714 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence448 <1 1047 gene locus_tag LOCUS_28640 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963539.1:cytochrome c biogenesis protein CcsA 1287 2708 gene locus_tag LOCUS_28650 1287 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence449 427 2388 gene locus_tag LOCUS_28660 427 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 2453 2920 gene locus_tag LOCUS_28670 2453 2920 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948363.1 protein_id gnl|my_center|LOCUS_28670 >Feature sequence450 225 746 gene locus_tag LOCUS_28680 225 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1954 785 gene locus_tag LOCUS_28690 1954 785 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence451 473 1660 gene locus_tag LOCUS_28700 473 1660 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence452 <1 945 gene locus_tag LOCUS_28710 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626879.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 1075 1650 gene locus_tag LOCUS_28720 1075 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1656 2513 gene locus_tag LOCUS_28730 1656 2513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence453 1243 2475 gene locus_tag LOCUS_28740 1243 2475 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_28740 2518 2724 gene locus_tag LOCUS_28750 2518 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence454 455 2488 gene locus_tag LOCUS_28760 gene ygjK 455 2488 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387456.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence455 1743 508 gene locus_tag LOCUS_28770 1743 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 2785 1817 gene locus_tag LOCUS_28780 2785 1817 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785424.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence456 1211 174 gene locus_tag LOCUS_28790 1211 174 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785910.1 protein_id gnl|my_center|LOCUS_28790 1355 2371 gene locus_tag LOCUS_28800 1355 2371 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence457 1368 655 gene locus_tag LOCUS_28810 1368 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 2478 2026 gene locus_tag LOCUS_28820 gene tnpA 2478 2026 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence458 710 312 gene locus_tag LOCUS_28830 710 312 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_28830 851 2161 gene locus_tag LOCUS_28840 851 2161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence459 335 129 gene locus_tag LOCUS_28850 335 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2326 356 gene locus_tag LOCUS_28860 2326 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence460 >Feature sequence461 1146 790 gene locus_tag LOCUS_28870 1146 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1827 2735 gene locus_tag LOCUS_28880 1827 2735 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence462 <1 2292 gene locus_tag LOCUS_28890 <1 2292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963916.1:efflux RND transporter permease subunit 2311 2499 gene locus_tag LOCUS_28900 2311 2499 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence463 1787 1515 gene locus_tag LOCUS_28910 1787 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 2080 1790 gene locus_tag LOCUS_28920 2080 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 2325 2083 gene locus_tag LOCUS_28930 2325 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2527 2306 gene locus_tag LOCUS_28940 2527 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence464 734 126 gene locus_tag LOCUS_28950 734 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1820 753 gene locus_tag LOCUS_28960 1820 753 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807789.1 protein_id gnl|my_center|LOCUS_28960 2635 1817 gene locus_tag LOCUS_28970 2635 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence465 1307 150 gene locus_tag LOCUS_28980 1307 150 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_28980 1615 2556 gene locus_tag LOCUS_28990 1615 2556 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062858.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence466 1023 271 gene locus_tag LOCUS_29000 1023 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 2112 2390 gene locus_tag LOCUS_29010 2112 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2441 2683 gene locus_tag LOCUS_29020 2441 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence467 2374 1439 gene locus_tag LOCUS_29030 2374 1439 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124047.1 protein_id gnl|my_center|LOCUS_29030 >Feature sequence468 1313 1720 gene locus_tag LOCUS_29040 1313 1720 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence469 388 1059 gene locus_tag LOCUS_29050 388 1059 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_29050 1265 2464 gene locus_tag LOCUS_29060 1265 2464 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence470 330 767 gene locus_tag LOCUS_29070 330 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1281 2396 gene locus_tag LOCUS_29080 1281 2396 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009129703.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence471 828 2555 gene locus_tag LOCUS_29090 828 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence472 1131 403 gene locus_tag LOCUS_29100 1131 403 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202917.1 protein_id gnl|my_center|LOCUS_29100 1422 2786 gene locus_tag LOCUS_29110 gene hemN 1422 2786 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence473 <2787 527 gene locus_tag LOCUS_29120 <2787 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence474 >Feature sequence475 1284 1433 gene locus_tag LOCUS_29130 1284 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence476 1376 222 gene locus_tag LOCUS_29140 1376 222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766592.1 protein_id gnl|my_center|LOCUS_29140 2388 1390 gene locus_tag LOCUS_29150 2388 1390 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721854.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence477 845 480 gene locus_tag LOCUS_29160 845 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 999 1070 gene locus_tag LOCUS_t00570 999 1070 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1377 1105 gene locus_tag LOCUS_29170 1377 1105 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence478 343 591 gene locus_tag LOCUS_29180 343 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1395 838 gene locus_tag LOCUS_29190 1395 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2039 1854 gene locus_tag LOCUS_29200 2039 1854 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_29200 2510 2205 gene locus_tag LOCUS_29210 2510 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence479 2652 1447 gene locus_tag LOCUS_29220 2652 1447 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence480 689 1774 gene locus_tag LOCUS_29230 689 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence481 128 313 gene locus_tag LOCUS_29240 gene rpmF 128 313 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_29240 527 1525 gene locus_tag LOCUS_29250 527 1525 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_29250 1807 2199 gene locus_tag LOCUS_29260 1807 2199 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_29260 2183 2419 gene locus_tag LOCUS_29270 2183 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence482 697 1209 gene locus_tag LOCUS_29280 697 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence483 >Feature sequence484 >Feature sequence485 2725 2183 gene locus_tag LOCUS_29290 2725 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence486 <1 2610 gene locus_tag LOCUS_29300 <1 2610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801208.1:valine--tRNA ligase >Feature sequence487 946 797 gene locus_tag LOCUS_29310 946 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2040 1903 gene locus_tag LOCUS_29320 2040 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 >Feature sequence488 >Feature sequence489 >Feature sequence490 2 1126 gene locus_tag LOCUS_29330 2 1126 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_29330 1204 1734 gene locus_tag LOCUS_29340 1204 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1910 2296 gene locus_tag LOCUS_29350 1910 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence491 <1 829 gene locus_tag LOCUS_29360 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760413.1:1,4-dihydroxy-2-naphthoyl-CoA synthase 1209 1595 gene locus_tag LOCUS_29370 1209 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 2018 2563 gene locus_tag LOCUS_29380 2018 2563 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469482.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence492 1192 320 gene locus_tag LOCUS_29390 1192 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1314 1895 gene locus_tag LOCUS_29400 1314 1895 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence493 >Feature sequence494 2234 384 gene locus_tag LOCUS_29410 2234 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence495 2067 997 gene locus_tag LOCUS_29420 gene leuB 2067 997 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_29420 2561 2139 gene locus_tag LOCUS_29430 2561 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence496 1893 253 gene locus_tag LOCUS_29440 1893 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence497 >Feature sequence498 <1 821 gene locus_tag LOCUS_29450 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964152.1:cell division protein FtsZ 958 1407 gene locus_tag LOCUS_29460 958 1407 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_29460 1815 1684 gene locus_tag LOCUS_29470 1815 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470