COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..74867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 478..1920 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 2222..3664 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102230.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 3791..5176 product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene araE CDS 5216..5890 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102108.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 tRNA 6020..6107 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(6618..8267) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144178156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(8588..10975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 11220..12008 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180334577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(13369..13671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(14109..14297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 14568..14966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 14963..17236 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(17263..18033) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 18383..19003 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389798.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(19022..19768) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 19990..20913 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776102.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 20917..22968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(22941..23789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 24089..25414 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 25894..31341 product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207553109.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 31638..32963 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 33095..34051 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829947.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 34051..34956 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068764.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 35005..37200 product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene gnpA CDS 37187..38266 product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene nahK CDS 38263..39795 product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389960.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 39855..40595 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 40686..41078 product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 41168..41872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(41859..42320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(42376..42669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(42759..43223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 43168..47928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 note possible pseudo, frameshifted CDS 48160..48576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(48687..49871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 note possible pseudo, frameshifted CDS complement(49868..50314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 note possible pseudo, frameshifted CDS complement(50274..50489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(50549..50836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(50796..51041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 note possible pseudo, internal stop codon, frameshifted CDS complement(51126..51671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 note possible pseudo, internal stop codon, frameshifted CDS complement(52232..55726) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 55887..57359 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 57461..58696 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 58693..59724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 59807..60712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(60691..61347) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 61479..63071 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene zwf CDS 63068..64075 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 64156..64947 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene pgl CDS complement(64977..65693) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 65986..67431 product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 67468..67974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 note possible pseudo, frameshifted CDS 67952..68146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 68234..69112 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gnd CDS 69208..69390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(69450..70916) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814647.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene gndA CDS complement(71029..73233) product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(73526..74482) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 sequence002 source 1..58027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..2492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 2669..4021 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 4140..4736 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 4751..5458 product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 5455..6402 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152349884.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 6591..7388 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993690.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 7432..7728 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815962.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene gatC CDS 7733..9286 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene gatA CDS 9311..10813 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene gatB CDS 10945..12111 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 12108..12422 product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS 12560..14149 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(14210..14872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 15068..16960 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056503.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rho CDS 17328..17687 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(18027..20768) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene valS CDS complement(20813..22345) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390283.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(22356..23072) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene nth CDS complement(23065..23895) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 24059..24721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(24723..25286) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390280.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(25553..26197) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(26201..26647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(26799..27290) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054759.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 27448..31341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 31869..32825 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(32963..33970) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 34756..35013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 35132..36658 product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 36950..37777 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(37779..38006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(38003..38806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(38816..39040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(40227..41729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(41726..43837) product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101626140.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(43970..44263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(44266..44649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(44642..45076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(45096..45449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(45446..45775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(45772..47337) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(47324..48436) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(48552..49997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(49994..50299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(50411..51148) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(51148..51339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(51329..51691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(51691..51975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(52371..52571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(52601..52861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 tRNA complement(53205..53279) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 53375..54421 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene metA CDS 54613..55428 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814317.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene atpB CDS 55560..55787 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene atpE CDS 55838..56380 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS 56432..57259 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819067.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 sequence003 source 1..51222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..1720) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(1806..3773) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(3944..5842) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 6074..7372 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene tgt tRNA 7431..7514 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(7589..8224) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028272.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(8322..9131) product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 9385..10476 product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene rmgQ CDS complement(10473..11837) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(12003..12284) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 12400..15273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(15295..16386) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(16423..18753) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(18753..21386) product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(21663..22970) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(23027..25456) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144418951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 25796..26659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 26859..27563 product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 27597..28115 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 28122..29690 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 29693..31237 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 31227..32696 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 32693..33685 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 33682..35841 product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene pknB CDS complement(36093..37208) product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362941.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(37209..37967) product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 38052..38492 product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene crgA CDS complement(38958..39791) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 39873..40103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125969027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 40237..40656 product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(40820..41203) product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815101.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 41357..42442 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene trpS CDS complement(42439..44448) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 44641..47400 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(47811..48095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 48236..48541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(49278..49451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 misc_feature complement(49705..>51222) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056574.1:FAD-dependent oxidoreductase locus_tag LOCUS_01490 sequence004 source 1..44393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..1482) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 1824..3239 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171023377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene dnaB CDS 3244..4635 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 4662..5462 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815981.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 5726..6136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(6359..7219) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 7403..8482 product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(8451..10526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(11102..11740) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene upp CDS complement(11988..12707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(12697..13776) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(13838..16084) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 16925..17746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 17743..18855 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363998.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 18845..19507 product Flp pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene tadB CDS 19498..20040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 20346..20606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 20593..20970 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004573653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 20974..21369 product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410434.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 21441..24353 product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 24353..24955 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene recR CDS 25286..26119 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 26116..26679 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 26699..27787 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 27830..28450 product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 28710..30620 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene leuA CDS complement(30704..32950) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 33144..34286 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(34526..35704) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene glf CDS 36132..37151 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414672.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 37300..40176 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene topA CDS 40173..41180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 41177..42337 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(42356..43414) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(43467..43742) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 sequence005 source 1..39458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(700..2031) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene murA CDS complement(2173..3210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(3329..4309) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431769.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 4235..4483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(5554..6513) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811640.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(6627..7313) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene leuD CDS complement(7360..8763) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene leuC CDS 8915..9703 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192829039.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(9731..11197) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 11426..12385 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(12629..14122) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674819.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(14384..16243) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene cydC CDS complement(16263..18233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(18295..19347) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene cydB CDS complement(19344..19616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(19670..20833) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 tRNA complement(21160..21232) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(21273..21346) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(21415..22215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 note possible pseudo, frameshifted CDS complement(22121..22942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 note possible pseudo, frameshifted CDS complement(22999..23721) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 gene nrdG CDS complement(23791..26202) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112200.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene nrdD CDS complement(26548..27552) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 27954..28970 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 28967..29755 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389454.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 29935..30942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(30995..31861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(31937..32593) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 32807..34144 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 34205..34729 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 34839..35186 product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(35340..35789) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rplI CDS complement(35804..36052) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rpsR CDS complement(36089..36706) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(36835..37131) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811753.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rpsF CDS complement(37271..38266) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109056741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene rfbB misc_feature complement(38900..>39458) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068683.1:ABC transporter ATP-binding protein locus_tag LOCUS_02190 sequence006 source 1..38223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 396..2249 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(2337..3392) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(3520..4278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 4492..7107 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene pepN CDS 7205..8581 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene glmM CDS 8612..9265 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(9214..9945) product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 10171..11289 product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(11398..12528) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150382938.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(12556..13854) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 14055..15245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(15276..15995) product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389601.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 16169..17215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 17329..17532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(17582..17881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 18225..19181 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 19233..20621 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(21125..24532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 24693..25037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(25070..27457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 28154..28333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 29349..29705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(30068..30631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(30986..32404) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(32401..32850) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(33073..34131) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 34338..35261 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 35258..36226 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 36331..37692 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068327.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 sequence007 source 1..37634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(304..3276) product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 3250..7389 product bacterial Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 7409..11125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(11258..12181) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 12887..13951 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(14271..15287) product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033892099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(15323..16207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(16233..16493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 16666..16971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 16989..19133 product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 19218..19574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 19789..20283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 20280..21020 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225856.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 21061..22368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(22358..23449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052829080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(23439..24347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(24310..26169) product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(26204..26752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(26852..27493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(27536..29095) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(29111..30616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(30616..32721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(32762..33160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 33302..33589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(33723..34415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(34883..35644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 misc_feature complement(35960..>37634) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068089.1:LPXTG cell wall anchor domain-containing protein locus_tag LOCUS_02750 sequence008 source 1..29125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..726 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812880.1:CTP synthase locus_tag LOCUS_02760 CDS 943..2442 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene sufB CDS 2442..3668 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene sufD CDS 3670..4449 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene sufC CDS 4471..5745 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 5806..6393 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 6390..7112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 7214..8530 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(8733..9599) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 tRNA complement(9873..9962) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 10082..10882 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 10954..11301 product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 11342..12517 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 12514..13068 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene ybeY CDS 13061..14473 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 14470..15423 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816894.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene era CDS complement(15430..17367) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 17687..18310 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812918.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 18498..19625 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 19809..20603 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053361.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(20644..20904) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene rpsT CDS 21050..22927 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene lepA CDS 22932..24275 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene hemW CDS 24399..28973 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033496496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene gltB sequence009 source 1..24824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..1460 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(1500..2468) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 2679..3818 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene dapE CDS 4055..6730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 6886..7194 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene rplU CDS 7227..7478 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene rpmA CDS 7619..9286 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene obgE CDS 9283..10425 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene proB CDS 10463..11677 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 tRNA 11798..11873 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 11912..12142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 12173..13006 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene nusG CDS 13145..13576 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene rplK CDS 13641..14330 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene rplA CDS complement(14421..15653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(15650..17491) product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 18215..18826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 18892..20727 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053766.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 20724..22295 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 sequence010 source 1..23319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 58..2646 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene ligA CDS 2716..3912 product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363328.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(4063..5409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(5610..7046) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene glnA CDS complement(7192..7926) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(7975..9462) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(9604..10230) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 10297..11673 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 11811..12539 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS 12550..15045 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(15152..15772) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(15954..16205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 16116..16913 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 16983..18050 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene pheS CDS 18064..20664 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene pheT CDS 20690..21298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 21322..21912 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 22021..23115 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene argC sequence011 source 1..23005 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(568..984) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(1036..1815) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 1997..3619 product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(3656..5146) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 5250..6908 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389618.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 6998..7237 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(7302..8210) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 8283..8915 product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(8916..9854) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389615.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dapF CDS 9949..10734 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene murI CDS 10803..11654 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(11717..12682) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 12850..13797 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(13916..17260) product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene ileS CDS complement(17535..18809) product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821099.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(18947..21247) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(21727..22380) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 misc_feature complement(22464..>23005) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068820.1:acyl-CoA dehydratase activase-related protein locus_tag LOCUS_03520 sequence012 source 1..22932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..678 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013410658.1:AzlC family ABC transporter permease locus_tag LOCUS_03530 CDS 675..1031 product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene azlD CDS 1072..1839 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 1882..2307 product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 2497..3552 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene gap CDS complement(3626..4222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 4300..4806 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054439.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene ybaK CDS complement(4826..5899) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014483607.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 6072..7040 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(7332..7619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(7659..8408) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 8433..9191 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 9366..10934 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 11021..12265 product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 12262..13005 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(12938..16576) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389674.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene smc CDS complement(16576..17997) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 18153..19754 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 19757..20311 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(20421..21656) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 sequence013 source 1..22169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(359..1279) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100494330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(1352..2614) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 3127..4047 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(4099..5562) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene uxaC CDS complement(5696..6706) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(6703..7770) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 8015..9658 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 9732..10859 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene uxuA CDS complement(11228..12673) product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(12770..13435) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(13528..14532) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(14772..16010) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 16389..17453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 17504..18694 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 18704..20524 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965650.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 sequence014 source 1..22012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..2736 product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217062444.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(2764..3669) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389509.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(3666..4118) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 4311..4988 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(4948..5760) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 6197..7222 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 7347..7541 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene rpmB CDS 7642..10116 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 10133..10732 product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(10756..11700) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389536.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene trmD CDS 11979..13382 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(13413..14429) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152580630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 14789..15607 product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 15604..17109 product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674742.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 17106..17810 product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674741.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(17930..18535) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene rimM CDS complement(18532..18765) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(18802..19260) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene rpsP CDS complement(19431..20393) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 misc_feature complement(20426..>22012) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022527326.1:signal recognition particle protein locus_tag LOCUS_04070 sequence015 source 1..20053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 38..1735 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene pgi CDS 1958..2329 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rplS CDS 2475..3239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 3247..3954 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 3993..5114 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 5217..6830 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 6895..7587 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 7619..9133 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene araA CDS 9377..11347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 11541..12368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 12528..14066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 14196..15044 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 15099..15896 product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(16038..17609) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 17983..19086 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene pstS CDS 19083..20036 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene pstC sequence016 source 1..19866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(531..1478) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813106.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(1475..2320) product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389895.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(2317..3378) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene pyrF CDS complement(3381..4760) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389893.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(4762..5175) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(5172..6113) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene pyrB CDS complement(6250..7290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 note possible pseudo, frameshifted CDS complement(7367..9331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, frameshifted CDS 9306..9683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 9690..9929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 9986..10321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(10382..11263) product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389889.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene metF CDS complement(11256..13592) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389888.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene metE CDS complement(13771..14331) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(14412..15545) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(15552..17498) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(17499..19262) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 sequence017 source 1..18963 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(253..681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 833..1648 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene lexA CDS complement(1753..2616) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(2755..3663) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(3816..5369) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812294.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene hflX CDS 5517..6179 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 6176..10264 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389653.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene hrpA CDS 10261..11148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(11158..12495) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812280.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene glnA CDS complement(12542..13273) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene priA CDS complement(13275..14048) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812274.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene hisH CDS complement(14056..14859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(14856..15458) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene hisB CDS complement(15589..16737) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(16734..18107) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene hisD misc_feature complement(18214..>18963) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582833.1:DNA polymerase III subunit alpha locus_tag LOCUS_04560 sequence018 source 1..17588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..1317) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 1570..2367 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(2377..2805) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(2865..5600) product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 6174..8393 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(8400..9122) product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(9187..9996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(10188..10421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 tRNA complement(11825..11896) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(12020..13138) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 13444..13779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 13849..14892 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 14889..17024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 sequence019 source 1..17376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..2413) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(2425..3429) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(3446..4372) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(4563..6224) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(6354..8024) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(8198..9130) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 9242..9520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052610.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(9510..10619) product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(10613..11599) product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(11596..12060) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(12133..14052) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene typA CDS complement(14167..14829) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene scpB CDS complement(14826..15629) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(15626..16465) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 misc_feature complement(16511..>17376) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068014.1:site-specific tyrosine recombinase XerD locus_tag LOCUS_04830 sequence020 source 1..16901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(294..560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 note possible pseudo, internal stop codon, frameshifted CDS complement(585..1367) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(1396..3204) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 3447..4136 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(4252..5853) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(5960..6703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(6924..7148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 7413..7964 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 8070..11048 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene uvrA CDS 11045..13345 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene uvrC CDS 13629..14435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 14432..15331 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene rapZ CDS 15452..16411 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene whiA sequence021 source 1..16425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 411..1115 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 1118..4576 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 4672..7497 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 7579..8451 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 8577..8960 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(9035..10648) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene ptsP CDS complement(10645..10905) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(10916..11665) product D-allulose 6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185669695.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene alsE CDS complement(11692..12810) product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366291.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(12848..13159) product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(13199..13663) product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(13663..14163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(14160..15662) product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 sequence022 source 1..16403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1009 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068002.1:aminopeptidase P family protein locus_tag LOCUS_05100 CDS 1013..1582 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(1609..2844) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 3038..4591 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(4611..7841) product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene lacZ CDS complement(8102..9445) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene xylA CDS 10076..11353 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 11343..12242 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(12336..13811) product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964898.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 14114..15736 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 sequence023 source 1..16253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(621..1541) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 1891..2766 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819774.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 2763..3590 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812712.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(3597..4076) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene ispF CDS complement(4091..4711) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 4935..5672 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 5682..6821 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 6892..7509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 7506..8858 product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(8855..9559) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(9684..10547) product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 10601..11047 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545171.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(11057..12580) product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(12577..15615) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(15773..16030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 sequence024 source 1..14685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(473..1495) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819388.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene yidC CDS complement(1498..1809) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051770.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene yidD CDS complement(1806..2126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(2336..2470) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene rpmH CDS 2802..4547 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene dnaA CDS 4962..6086 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene dnaN CDS 6116..7378 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 7375..7872 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815036.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 8084..10204 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815936.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene gyrB CDS 10249..12966 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene gyrA CDS 13014..13697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 sequence025 source 1..14323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 314..1207 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 1429..2322 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 2503..4161 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(4171..4581) product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 4771..6060 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(6267..6818) product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(6820..7758) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(7751..8425) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(8412..9065) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(9477..9719) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(9956..10765) product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051476.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene nucS CDS complement(10853..11149) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(11152..12636) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene atpD CDS complement(12645..13595) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 misc_feature complement(13599..>14323) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051480.1:F0F1 ATP synthase subunit alpha locus_tag LOCUS_05600 sequence026 source 1..14181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1379 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390374.1:alpha-galactosidase locus_tag LOCUS_05610 CDS complement(1402..2685) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 2873..4195 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 4195..5154 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 5156..6055 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 6143..8053 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 8216..10681 product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 11133..12398 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene ilvA CDS complement(12477..12725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(13081..13752) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 sequence027 source 1..13759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..2529) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 2802..3284 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812311.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene mraZ CDS 3296..4387 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene rsmH CDS 4384..4866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 4863..6644 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 6691..7572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 7582..9108 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 9183..10286 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene mraY CDS 10366..11805 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389662.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene murD CDS 11789..13012 product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 sequence028 source 1..13636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(412..1263) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813341.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene tsf CDS complement(1291..2175) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816510.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene rpsB CDS complement(2386..2868) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115099.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene def CDS complement(2872..4875) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(4893..5447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(5647..6771) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 6935..8185 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 8392..9996 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(9966..11801) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(11912..12577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 misc_feature complement(12773..>13636) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068745.1:alpha-N-arabinofuranosidase locus_tag LOCUS_05910 sequence029 source 1..13590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..569 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390091.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA locus_tag LOCUS_05920 CDS 616..1110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(1142..1861) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 1962..4667 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 4775..5380 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058588.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene pgsA CDS 5377..5946 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068035.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 6113..6631 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 6881..7114 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 7343..8497 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene recA CDS 9030..9455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 10054..10728 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene raiA sequence030 source 1..13361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1001..1534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(1531..2463) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(2460..3410) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(3561..4349) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 4500..5144 product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 5314..5517 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 5835..7454 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene groL CDS complement(7658..7951) product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 7994..8812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 8817..9575 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 9652..11520 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 11607..11996 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 12065..13051 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 sequence031 source 1..13308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1682 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390132.1:beta-galactosidase locus_tag LOCUS_06160 CDS complement(1639..2436) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 2582..4228 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 4225..5208 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 5208..6242 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 6245..7039 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 7026..7847 product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 8065..8430 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357453.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 8427..9287 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 9494..10246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 10338..12356 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene recQ CDS 12419..12901 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 sequence032 source 1..13305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..1389 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(1413..2498) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene sepH CDS 2666..2959 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 2959..3423 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene dut CDS 3506..5866 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(6019..7632) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 7720..9048 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene hisS CDS 9088..10890 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene aspS CDS 11036..11890 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162094060.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 11913..12764 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 sequence033 source 1..12422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 636..2762 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(2759..4030) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene purD CDS complement(4050..5099) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene purM CDS complement(5138..6655) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene purF CDS complement(6673..10452) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(10532..11284) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 misc_feature complement(11362..>12422) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053649.1:formate-dependent phosphoribosylglycinamide formyltransferase locus_tag LOCUS_06440 sequence034 source 1..12241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..607 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970007.1:M20 family metallopeptidase locus_tag LOCUS_06450 CDS 700..1896 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(2145..3668) product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(3718..5010) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(5272..6351) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(6407..6742) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112383.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 6943..8460 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 8447..9625 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene dusB CDS 9857..11029 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene ftsZ CDS 11048..11515 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 11557..11841 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 sequence035 source 1..12129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..1037 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111995.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene pstB CDS 1106..2092 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(2097..2300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 2520..3920 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(4554..5537) product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(5711..6055) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene trxA CDS 6227..6856 product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 6880..7737 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811981.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 7734..8771 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene nudC CDS 8853..10457 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 10497..10910 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gcvH CDS 10921..12111 product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 sequence036 source 1..12039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 768..1349 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene dcd CDS 1600..5658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 5648..7096 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 7087..8175 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 8194..8964 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 9079..10071 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rlmB CDS complement(10178..11854) product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068617.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 sequence037 source 1..11801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..741) product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113661.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(885..2258) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476263.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(2390..3991) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene purH CDS complement(4044..5420) product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(5417..6340) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389936.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene sucD CDS complement(6337..7551) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene sucC CDS complement(7574..8158) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(8267..8887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(8954..10030) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ruvB CDS complement(10034..10645) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817463.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene ruvA CDS complement(10688..11269) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene ruvC misc_feature complement(11274..>11801) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052855.1:YebC/PmpR family DNA-binding transcriptional regulator locus_tag LOCUS_06860 sequence038 source 1..11650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..1230) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene metK CDS complement(1293..1577) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812470.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rpoZ CDS 1780..3615 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene ilvD CDS complement(3709..4863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(4863..5849) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(6009..6686) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(6767..9193) product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(9554..10300) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(10387..11292) product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 sequence039 source 1..11627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1326 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814786.1:energy-dependent translational throttle protein EttA locus_tag LOCUS_06960 CDS 1366..2280 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(2364..2921) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068792.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(2918..4000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(4083..6197) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene ftsH CDS complement(6194..6529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 note possible pseudo, frameshifted CDS complement(6483..6797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 note possible pseudo, frameshifted CDS complement(6784..7893) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene tilS CDS complement(7913..9418) product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(9451..11082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 misc_feature complement(11079..>11627) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582910.1:ABC transporter ATP-binding protein locus_tag LOCUS_07060 sequence040 source 1..11156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..670 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051227.1:amino acid ABC transporter ATP-binding protein locus_tag LOCUS_07070 CDS complement(693..1751) product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 assembly_gap 1766..1774 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1925..3010) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(2994..3497) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rbfA note possible pseudo, frameshifted CDS complement(3627..6398) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068747.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene infB CDS complement(6582..7640) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815687.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene nusA CDS 7781..8596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 tRNA complement(9063..9152) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(9259..10200) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene truA CDS complement(10300..10944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 sequence041 source 1..11001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 assembly_gap 501..518 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(862..2043) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(2122..2892) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 3087..3866 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053236.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 3991..4704 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 5361..5966 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 5988..8432 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(8847..9395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 note possible pseudo, frameshifted misc_feature complement(9392..>11001) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816398.1:ATP-dependent Clp protease ATP-binding subunit note possible pseudo, frameshifted locus_tag LOCUS_07240 assembly_gap 9406..9415 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence042 source 1..10922 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(671..2341) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(2338..3306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(3312..4292) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(4385..6031) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 6365..7477 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(7558..9204) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 9269..9457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(9454..9990) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 misc_feature complement(10037..>10922) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390361.1:DnaJ C-terminal domain-containing protein locus_tag LOCUS_07330 sequence043 source 1..10660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..3068 product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(3088..3777) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(4114..4722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 5530..5688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 6178..6378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 6332..6523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(7146..8129) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(8184..9218) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 sequence044 source 1..9790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1690 product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(1743..2207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117689.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 2167..2319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 2462..4261 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(4388..5242) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 6402..6893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(7040..9133) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 sequence045 source 1..9609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 274..348 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(494..871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 1713..2162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 2168..2473 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935998.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 2470..3876 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162861356.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 4125..4856 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 5175..6425 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 6535..7554 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 7796..8608 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 8675..9490 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 sequence046 source 1..8997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(279..1217) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(1288..2601) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene clpX CDS complement(2746..3414) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(3424..4041) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(4191..5567) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene tig CDS complement(5617..6903) product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(7155..8036) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene pflA misc_feature complement(8135..>8997) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112605.1:formate C-acetyltransferase locus_tag LOCUS_07650 sequence047 source 1..8875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(240..1211) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 1610..2260 product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 2446..3129 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 tRNA 3237..3310 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(3522..4709) product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(5108..8770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 sequence048 source 1..8868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1313 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783044.1:serine/threonine-protein kinase locus_tag LOCUS_07710 CDS 1375..2298 product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 tRNA 2409..2483 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 2899..4308 product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 4341..5222 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene rsmA CDS 5219..6139 product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 6150..6764 product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(6860..8086) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 note possible pseudo, frameshifted assembly_gap 8134..8143 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence049 source 1..8757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3091..3759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(3790..4815) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 4961..5560 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389580.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(5576..6940) product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(6951..7223) product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(7333..8595) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene galK sequence050 source 1..8633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 261..584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(540..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(779..1000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 note possible pseudo, frameshifted CDS complement(1071..1520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 note possible pseudo, internal stop codon, frameshifted CDS complement(1530..1895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 note possible pseudo, internal stop codon CDS complement(2090..3466) product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 3677..4573 product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 5065..5793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 5793..7379 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 sequence051 source 1..8422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(931..1725) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812239.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(1729..2451) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene recO CDS complement(2467..4119) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(4221..5450) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene ispG CDS complement(5447..6730) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053294.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene dxr CDS complement(6743..8404) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 sequence052 source 1..8405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 306..890 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 887..3148 product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 3239..4108 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 4105..5088 product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 5209..6000 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 6023..6742 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 sequence053 source 1..8315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..1680 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994095.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(1789..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(5532..8285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 sequence054 source 1..7856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(962..1789) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(1866..4367) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 4782..5684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 5705..7177 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 sequence055 source 1..7653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(454..849) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(927..2798) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 3049..3846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 3846..4664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 4661..5509 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 5506..6324 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 6359..7282 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene rihC sequence056 source 1..6999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..880 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814621.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) locus_tag LOCUS_08190 CDS 941..2047 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 2153..2851 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene rpiA CDS complement(3143..3793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 3884..5293 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene radA CDS 5418..6281 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 sequence057 source 1..6874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..1650) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363154.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene galT CDS complement(1733..2533) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(2810..3559) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(3562..4923) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 misc_feature complement(5057..>6874) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399464.1:transglycosylase domain-containing protein locus_tag LOCUS_08290 sequence058 source 1..6533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 23..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 669..1679 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(1703..2833) product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(2927..3808) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(3829..4764) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(4796..6106) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 sequence059 source 1..6437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(351..872) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene rplJ CDS complement(1099..3804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(3859..4752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(4756..5655) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 assembly_gap 5674..5683 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence060 source 1..6429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..758 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389710.1:alpha/beta hydrolase locus_tag LOCUS_08400 CDS 831..2276 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816427.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene purB CDS 2279..4750 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 4920..5207 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 misc_feature complement(5307..>6429) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389708.1:Pup--protein ligase locus_tag LOCUS_08440 sequence061 source 1..6364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 594..1613 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene trpD CDS complement(1697..2242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 2291..2980 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390082.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(2993..5230) product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 misc_feature complement(5223..>6364) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055156.1:polyprenyl synthetase family protein locus_tag LOCUS_08490 sequence062 source 1..6325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..3996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(4050..6278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 sequence063 source 1..6140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..2272) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(2532..4067) product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(4121..5662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 sequence064 source 1..6126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..1442) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143567.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 1693..2370 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646512.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene sdaAB CDS 2505..3257 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703459.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene sdaAA CDS 3295..4617 product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 4728..6014 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574367.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene serS sequence065 source 1..6043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..607 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017143234.1:ABC transporter permease subunit locus_tag LOCUS_08600 CDS 628..1980 product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 2218..2628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 2625..3005 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(3039..4046) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(4168..4950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(5026..5826) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389401.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 sequence066 source 1..5930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..2469 product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 2466..3548 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 sequence067 source 1..5915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2377..3687 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene xseA CDS 3771..4106 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(4115..5140) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 tRNA 5335..5408 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(5369..5803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 sequence068 source 1..5799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..500 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 1517..2461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 2490..3467 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816492.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 3464..4066 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene tsaE CDS 4063..4851 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene tsaB CDS 4848..5360 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene rimI sequence069 source 1..5723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 232..402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(766..2424) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 2574..3503 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene rsmI CDS complement(3467..3775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(3937..4548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052934.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 sequence070 source 1..5698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 312..1211 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 1390..2361 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(2572..3162) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(3143..4780) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene trpE sequence071 source 1..5688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 310..319 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 702..1697 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 1851..3317 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 3310..4278 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(4378..5469) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 sequence072 source 1..5662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 886..2550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 assembly_gap 2309..2404 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2519..2890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(3268..3603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 note possible pseudo, internal stop codon, frameshifted CDS complement(3861..4055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 misc_feature complement(4330..>5662) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389613.1:ABC transporter ATP-binding protein locus_tag LOCUS_08960 sequence073 source 1..5546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(550..1239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 note possible pseudo, frameshifted CDS complement(1239..1748) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene coaD CDS 1811..2122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(2148..3167) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(3167..4513) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 4542..5258 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 sequence074 source 1..5370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..1466 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene fbaA CDS 1895..2317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 2460..3761 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 3771..4739 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740908.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 sequence075 source 1..4938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..1486 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene alr CDS 1557..2015 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 2034..3317 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 sequence076 source 1..4790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..725 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(878..1063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 note possible pseudo, frameshifted CDS complement(1056..2321) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene pyk CDS complement(2433..3455) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 misc_feature complement(3605..>4790) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389776.1:excinuclease ABC subunit UvrB locus_tag LOCUS_09140 sequence077 source 1..4675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(672..745) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 956..1141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 misc_feature complement(1717..>4675) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390269.1:type I polyketide synthase locus_tag LOCUS_09160 sequence078 source 1..4562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(371..826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(846..1790) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1792..2718) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(2715..3974) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 sequence079 source 1..4546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 394..1008 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 1001..1957 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 1959..2291 product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 2296..3129 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993988.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 3136..3579 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 3594..4190 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 sequence080 source 1..4447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1149 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389794.1:ABC transporter permease locus_tag LOCUS_09280 CDS 1271..1843 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1933..3213) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111709.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(3210..3896) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 sequence081 source 1..4387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(606..695) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 924..2195 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene dinB CDS complement(2179..3345) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390233.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene dapC CDS complement(3416..3733) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 misc_feature complement(3790..>4387) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053015.1:amino acid permease locus_tag LOCUS_09350 sequence082 source 1..4375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1092 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390022.1:acetylornithine transaminase locus_tag LOCUS_09360 CDS 1147..2121 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene argF CDS 2121..2657 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 2654..3952 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813515.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 sequence083 source 1..4341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(677..1468) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1550..2833) product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 2984..4039 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 sequence084 source 1..4339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 551..3316 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene adhE CDS 3604..3912 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene rpsJ sequence085 source 1..4305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..897 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811990.1:3-isopropylmalate dehydrogenase locus_tag LOCUS_09450 CDS 1555..1842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1839..3071 product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 3196..3915 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811992.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 sequence086 source 1..4104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..689 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein locus_tag LOCUS_09490 CDS 682..1353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1529..2578 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(2542..3909) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(3906..4103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 sequence087 source 1..3998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 121..1098 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene msrB CDS 1245..3134 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene asnB sequence088 source 1..3896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 641..2581 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 2596..3150 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene ilvN CDS 3181..3840 product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 sequence089 source 1..3895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(51..124) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(161..235) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 340..948 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1428..2195 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(2299..3522) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 sequence090 source 1..3836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 407..1948 product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 2001..3536 product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 sequence091 source 1..3695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(577..1983) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene uxaC CDS complement(2173..3204) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 sequence092 source 1..3620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 511..1875 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 sequence093 source 1..3603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1935..3320) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 sequence094 source 1..3447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2573 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390389.1:lipid II flippase MurJ locus_tag LOCUS_09680 sequence095 source 1..3443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2148 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein locus_tag LOCUS_09690 sequence096 source 1..3372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..1975) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 misc_feature complement(2003..>3372) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820794.1:arginine--tRNA ligase locus_tag LOCUS_09710 sequence097 source 1..3285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1096) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811687.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene thrB CDS complement(1096..2427) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389478.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 assembly_gap 2059..2068 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(2538..>3285) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389477.1:diaminopimelate decarboxylase locus_tag LOCUS_09740 sequence098 source 1..3241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1928 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389778.1:DNA polymerase I locus_tag LOCUS_09750 CDS 1977..2894 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 sequence099 source 1..3138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1298 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399464.1:transglycosylase domain-containing protein locus_tag LOCUS_09770 CDS 1319..2794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 sequence100 source 1..3121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(86..1315) product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1312..1599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 1654..1887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 misc_feature complement(2314..>3121) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811990.1:3-isopropylmalate dehydrogenase locus_tag LOCUS_09820 sequence101 source 1..3110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 197..865 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 958..1389 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 1389..1628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 sequence102 source 1..3072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1789..2541) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 misc_feature complement(2551..>3072) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004114934.1:glutamine--fructose-6-phosphate transaminase (isomerizing) locus_tag LOCUS_09870 sequence103 source 1..3068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(431..1039) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1111..1998 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389617.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(2064..2303) product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 sequence104 source 1..2997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(374..>2997) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390389.1:lipid II flippase MurJ locus_tag LOCUS_09910 sequence105 source 1..2942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence106 source 1..2607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS complement(402..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 sequence107 source 1..2604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 811..2169 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948741.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene glpT sequence108 source 1..2547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(84..2279) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389703.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 sequence109 source 1..2416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..2326 product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 sequence110 source 1..2369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..675 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390284.1:valine--tRNA ligase locus_tag LOCUS_09970 sequence111 source 1..2327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 470..1162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 note possible pseudo, frameshifted assembly_gap 920..929 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1104..1361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 note possible pseudo, frameshifted assembly_gap 1530..1539 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1621..2268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 note possible pseudo, frameshifted sequence112 source 1..2253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051791.1:CCA tRNA nucleotidyltransferase locus_tag LOCUS_10020 misc_feature complement(1320..>2253) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein locus_tag LOCUS_10030 sequence113 source 1..2120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..899 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390353.1:methionine--tRNA ligase locus_tag LOCUS_10040 sequence114 source 1..2027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..1294) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 tRNA 1418..1491 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1531..1612 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence115 source 1..2020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1772..1781 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence116 source 1..1975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1946 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173361541.1:DUF6049 family protein locus_tag LOCUS_10060 sequence117 source 1..1760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(667..>1760) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054128.1:glycoside hydrolase family 43 protein locus_tag LOCUS_10070 sequence118 source 1..1721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence119 source 1..1697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence120 source 1..1616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..1598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 sequence122 source 1..1532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence123 source 1..1464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence124 source 1..1362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1348 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052863.1:DUF6350 family protein locus_tag LOCUS_10090 sequence125 source 1..1246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..1227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..525 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051227.1:amino acid ABC transporter ATP-binding protein locus_tag LOCUS_10100 misc_feature complement(547..>1227) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003823255.1:riboflavin kinase locus_tag LOCUS_10110 sequence127 source 1..1207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence128 source 1..1207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..705 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein locus_tag LOCUS_10120 sequence129 source 1..1135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 note possible pseudo, frameshifted assembly_gap 654..663 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence130 source 1..1068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 334..343 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 576..585 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence131 source 1..1066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(43..504) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 sequence132 source 1..1054 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..702 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027779.1:polyprenol monophosphomannose synthase locus_tag LOCUS_10150 sequence134 source 1..959 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..832) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene murI sequence135 source 1..911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence136 source 1..898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence137 source 1..897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..703 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390353.1:methionine--tRNA ligase locus_tag LOCUS_10170 sequence138 source 1..896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..893 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 sequence139 source 1..843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence140 source 1..809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(169..>803) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776146.1:mannose-1-phosphate guanylyltransferase locus_tag LOCUS_10190 sequence142 source 1..783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..763 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068355.1:NAD(+) diphosphatase locus_tag LOCUS_10200 sequence143 source 1..763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence144 source 1..730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence145 source 1..712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence147 source 1..707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence149 source 1..705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(236..307) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(308..382) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(549..621) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 sequence150 source 1..692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 347..356 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence151 source 1..679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence152 source 1..673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence153 source 1..644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(54..266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 note possible pseudo, frameshifted CDS complement(215..643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 note possible pseudo, frameshifted assembly_gap 288..296 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence154 source 1..643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence155 source 1..641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence156 source 1..633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence157 source 1..628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence158 source 1..625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence159 source 1..617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(6..>617) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052919.1:ABC transporter ATP-binding protein locus_tag LOCUS_10230 sequence160 source 1..616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence161 source 1..608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence162 source 1..600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence163 source 1..594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence164 source 1..590 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence165 source 1..587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence166 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence167 source 1..574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 283..292 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 348..533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 note possible pseudo, frameshifted sequence168 source 1..569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence169 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence170 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence171 source 1..553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence172 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 257..421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 sequence173 source 1..549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence174 source 1..547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..514 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcatccgcggggatgatcc sequence175 source 1..545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence176 source 1..540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence177 source 1..538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 285..294 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence178 source 1..537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..524 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068603.1:G5 domain-containing protein locus_tag LOCUS_10260 sequence179 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence180 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence181 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence182 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence183 source 1..517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence184 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence185 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence186 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence187 source 1..511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence188 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 sequence189 source 1..505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@