>Feature sequence001 478 1920 gene locus_tag LOCUS_00010 478 1920 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 protein_id gnl|my_center|LOCUS_00010 2222 3664 gene locus_tag LOCUS_00020 2222 3664 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102230.1 protein_id gnl|my_center|LOCUS_00020 3791 5176 gene locus_tag LOCUS_00030 gene araE 3791 5176 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_00030 5216 5890 gene locus_tag LOCUS_00040 5216 5890 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102108.1 protein_id gnl|my_center|LOCUS_00040 6020 6107 gene locus_tag LOCUS_t00010 6020 6107 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8267 6618 gene locus_tag LOCUS_00050 8267 6618 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144178156.1 protein_id gnl|my_center|LOCUS_00050 10975 8588 gene locus_tag LOCUS_00060 10975 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11220 12008 gene locus_tag LOCUS_00070 11220 12008 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180334577.1 protein_id gnl|my_center|LOCUS_00070 13671 13369 gene locus_tag LOCUS_00080 13671 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14297 14109 gene locus_tag LOCUS_00090 14297 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14568 14966 gene locus_tag LOCUS_00100 14568 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14963 17236 gene locus_tag LOCUS_00110 14963 17236 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987096.1 protein_id gnl|my_center|LOCUS_00110 18033 17263 gene locus_tag LOCUS_00120 18033 17263 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812168.1 protein_id gnl|my_center|LOCUS_00120 18383 19003 gene locus_tag LOCUS_00130 18383 19003 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389798.1 protein_id gnl|my_center|LOCUS_00130 19768 19022 gene locus_tag LOCUS_00140 19768 19022 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 protein_id gnl|my_center|LOCUS_00140 19990 20913 gene locus_tag LOCUS_00150 19990 20913 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776102.1 protein_id gnl|my_center|LOCUS_00150 20917 22968 gene locus_tag LOCUS_00160 20917 22968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_00160 23789 22941 gene locus_tag LOCUS_00170 23789 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24089 25414 gene locus_tag LOCUS_00180 24089 25414 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_00180 25894 31341 gene locus_tag LOCUS_00190 25894 31341 CDS product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207553109.1 protein_id gnl|my_center|LOCUS_00190 31638 32963 gene locus_tag LOCUS_00200 31638 32963 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068762.1 protein_id gnl|my_center|LOCUS_00200 33095 34051 gene locus_tag LOCUS_00210 33095 34051 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829947.1 protein_id gnl|my_center|LOCUS_00210 34051 34956 gene locus_tag LOCUS_00220 34051 34956 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068764.1 protein_id gnl|my_center|LOCUS_00220 35005 37200 gene locus_tag LOCUS_00230 gene gnpA 35005 37200 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389475.1 protein_id gnl|my_center|LOCUS_00230 37187 38266 gene locus_tag LOCUS_00240 gene nahK 37187 38266 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_00240 38263 39795 gene locus_tag LOCUS_00250 38263 39795 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389960.1 protein_id gnl|my_center|LOCUS_00250 39855 40595 gene locus_tag LOCUS_00260 39855 40595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_00260 40686 41078 gene locus_tag LOCUS_00270 40686 41078 CDS product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674081.1 protein_id gnl|my_center|LOCUS_00270 41168 41872 gene locus_tag LOCUS_00280 41168 41872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 42320 41859 gene locus_tag LOCUS_00290 42320 41859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 42669 42376 gene locus_tag LOCUS_00300 42669 42376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 43223 42759 gene locus_tag LOCUS_00310 43223 42759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 43168 47928 gene locus_tag LOCUS_00320 43168 47928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 48160 48576 gene locus_tag LOCUS_00330 48160 48576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 49871 48687 gene locus_tag LOCUS_00340 49871 48687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 50314 49868 gene locus_tag LOCUS_00350 50314 49868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 50489 50274 gene locus_tag LOCUS_00360 50489 50274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 50836 50549 gene locus_tag LOCUS_00370 50836 50549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 51041 50796 gene locus_tag LOCUS_00380 51041 50796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00380 51671 51126 gene locus_tag LOCUS_00390 51671 51126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00390 55726 52232 gene locus_tag LOCUS_00400 55726 52232 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389461.1 protein_id gnl|my_center|LOCUS_00400 55887 57359 gene locus_tag LOCUS_00410 55887 57359 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674808.1 protein_id gnl|my_center|LOCUS_00410 57461 58696 gene locus_tag LOCUS_00420 57461 58696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814091.1 protein_id gnl|my_center|LOCUS_00420 58693 59724 gene locus_tag LOCUS_00430 58693 59724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 59807 60712 gene locus_tag LOCUS_00440 59807 60712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 61347 60691 gene locus_tag LOCUS_00450 61347 60691 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_00450 61479 63071 gene locus_tag LOCUS_00460 gene zwf 61479 63071 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_00460 63068 64075 gene locus_tag LOCUS_00470 63068 64075 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054721.1 protein_id gnl|my_center|LOCUS_00470 64156 64947 gene locus_tag LOCUS_00480 gene pgl 64156 64947 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 protein_id gnl|my_center|LOCUS_00480 65693 64977 gene locus_tag LOCUS_00490 65693 64977 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 protein_id gnl|my_center|LOCUS_00490 65986 67431 gene locus_tag LOCUS_00500 65986 67431 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_00500 67468 67974 gene locus_tag LOCUS_00510 67468 67974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00510 67952 68146 gene locus_tag LOCUS_00520 67952 68146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 68234 69112 gene locus_tag LOCUS_00530 gene gnd 68234 69112 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118197.1 protein_id gnl|my_center|LOCUS_00530 69208 69390 gene locus_tag LOCUS_00540 69208 69390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 70916 69450 gene locus_tag LOCUS_00550 gene gndA 70916 69450 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814647.1 protein_id gnl|my_center|LOCUS_00550 73233 71029 gene locus_tag LOCUS_00560 73233 71029 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 protein_id gnl|my_center|LOCUS_00560 74482 73526 gene locus_tag LOCUS_00570 74482 73526 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 protein_id gnl|my_center|LOCUS_00570 >Feature sequence002 2492 429 gene locus_tag LOCUS_00580 2492 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 2669 4021 gene locus_tag LOCUS_00590 2669 4021 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 protein_id gnl|my_center|LOCUS_00590 4140 4736 gene locus_tag LOCUS_00600 4140 4736 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814265.1 protein_id gnl|my_center|LOCUS_00600 4751 5458 gene locus_tag LOCUS_00610 4751 5458 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438129.1 protein_id gnl|my_center|LOCUS_00610 5455 6402 gene locus_tag LOCUS_00620 5455 6402 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152349884.1 protein_id gnl|my_center|LOCUS_00620 6591 7388 gene locus_tag LOCUS_00630 6591 7388 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993690.1 protein_id gnl|my_center|LOCUS_00630 7432 7728 gene locus_tag LOCUS_00640 gene gatC 7432 7728 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815962.1 protein_id gnl|my_center|LOCUS_00640 7733 9286 gene locus_tag LOCUS_00650 gene gatA 7733 9286 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 protein_id gnl|my_center|LOCUS_00650 9311 10813 gene locus_tag LOCUS_00660 gene gatB 9311 10813 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051530.1 protein_id gnl|my_center|LOCUS_00660 10945 12111 gene locus_tag LOCUS_00670 10945 12111 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 protein_id gnl|my_center|LOCUS_00670 12108 12422 gene locus_tag LOCUS_00680 12108 12422 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 protein_id gnl|my_center|LOCUS_00680 12560 14149 gene locus_tag LOCUS_00690 12560 14149 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_00690 14872 14210 gene locus_tag LOCUS_00700 14872 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15068 16960 gene locus_tag LOCUS_00710 gene rho 15068 16960 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056503.1 protein_id gnl|my_center|LOCUS_00710 17328 17687 gene locus_tag LOCUS_00720 17328 17687 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814292.1 protein_id gnl|my_center|LOCUS_00720 20768 18027 gene locus_tag LOCUS_00730 gene valS 20768 18027 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390284.1 protein_id gnl|my_center|LOCUS_00730 22345 20813 gene locus_tag LOCUS_00740 22345 20813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390283.1 protein_id gnl|my_center|LOCUS_00740 23072 22356 gene locus_tag LOCUS_00750 gene nth 23072 22356 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_00750 23895 23065 gene locus_tag LOCUS_00760 23895 23065 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 protein_id gnl|my_center|LOCUS_00760 24059 24721 gene locus_tag LOCUS_00770 24059 24721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 25286 24723 gene locus_tag LOCUS_00780 25286 24723 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390280.1 protein_id gnl|my_center|LOCUS_00780 26197 25553 gene locus_tag LOCUS_00790 26197 25553 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368017.1 protein_id gnl|my_center|LOCUS_00790 26647 26201 gene locus_tag LOCUS_00800 26647 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 27290 26799 gene locus_tag LOCUS_00810 27290 26799 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054759.1 protein_id gnl|my_center|LOCUS_00810 27448 31341 gene locus_tag LOCUS_00820 27448 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 31869 32825 gene locus_tag LOCUS_00830 31869 32825 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324319.1 protein_id gnl|my_center|LOCUS_00830 33970 32963 gene locus_tag LOCUS_00840 33970 32963 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_00840 34756 35013 gene locus_tag LOCUS_00850 34756 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35132 36658 gene locus_tag LOCUS_00860 35132 36658 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_00860 36950 37777 gene locus_tag LOCUS_00870 36950 37777 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_00870 38006 37779 gene locus_tag LOCUS_00880 38006 37779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 38806 38003 gene locus_tag LOCUS_00890 38806 38003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 39040 38816 gene locus_tag LOCUS_00900 39040 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 41729 40227 gene locus_tag LOCUS_00910 41729 40227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 43837 41726 gene locus_tag LOCUS_00920 43837 41726 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101626140.1 protein_id gnl|my_center|LOCUS_00920 44263 43970 gene locus_tag LOCUS_00930 44263 43970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 44649 44266 gene locus_tag LOCUS_00940 44649 44266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068459.1 protein_id gnl|my_center|LOCUS_00940 45076 44642 gene locus_tag LOCUS_00950 45076 44642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068458.1 protein_id gnl|my_center|LOCUS_00950 45449 45096 gene locus_tag LOCUS_00960 45449 45096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068457.1 protein_id gnl|my_center|LOCUS_00960 45775 45446 gene locus_tag LOCUS_00970 45775 45446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068456.1 protein_id gnl|my_center|LOCUS_00970 47337 45772 gene locus_tag LOCUS_00980 47337 45772 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068455.1 protein_id gnl|my_center|LOCUS_00980 48436 47324 gene locus_tag LOCUS_00990 48436 47324 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 protein_id gnl|my_center|LOCUS_00990 49997 48552 gene locus_tag LOCUS_01000 49997 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 protein_id gnl|my_center|LOCUS_01000 50299 49994 gene locus_tag LOCUS_01010 50299 49994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 51148 50411 gene locus_tag LOCUS_01020 51148 50411 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 protein_id gnl|my_center|LOCUS_01020 51339 51148 gene locus_tag LOCUS_01030 51339 51148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 51691 51329 gene locus_tag LOCUS_01040 51691 51329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 51975 51691 gene locus_tag LOCUS_01050 51975 51691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 52571 52371 gene locus_tag LOCUS_01060 52571 52371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 52861 52601 gene locus_tag LOCUS_01070 52861 52601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 53279 53205 gene locus_tag LOCUS_t00020 53279 53205 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53375 54421 gene locus_tag LOCUS_01080 gene metA 53375 54421 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_01080 54613 55428 gene locus_tag LOCUS_01090 gene atpB 54613 55428 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814317.1 protein_id gnl|my_center|LOCUS_01090 55560 55787 gene locus_tag LOCUS_01100 gene atpE 55560 55787 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_01100 55838 56380 gene locus_tag LOCUS_01110 55838 56380 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 protein_id gnl|my_center|LOCUS_01110 56432 57259 gene locus_tag LOCUS_01120 56432 57259 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819067.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence003 1720 224 gene locus_tag LOCUS_01130 1720 224 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811466.1 protein_id gnl|my_center|LOCUS_01130 3773 1806 gene locus_tag LOCUS_01140 3773 1806 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_01140 5842 3944 gene locus_tag LOCUS_01150 5842 3944 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 protein_id gnl|my_center|LOCUS_01150 6074 7372 gene locus_tag LOCUS_01160 gene tgt 6074 7372 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 protein_id gnl|my_center|LOCUS_01160 7431 7514 gene locus_tag LOCUS_t00030 7431 7514 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8224 7589 gene locus_tag LOCUS_01170 8224 7589 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028272.1 protein_id gnl|my_center|LOCUS_01170 9131 8322 gene locus_tag LOCUS_01180 9131 8322 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_01180 9385 10476 gene locus_tag LOCUS_01190 gene rmgQ 9385 10476 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_01190 11837 10473 gene locus_tag LOCUS_01200 11837 10473 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389943.1 protein_id gnl|my_center|LOCUS_01200 12284 12003 gene locus_tag LOCUS_01210 12284 12003 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 protein_id gnl|my_center|LOCUS_01210 12400 15273 gene locus_tag LOCUS_01220 12400 15273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 16386 15295 gene locus_tag LOCUS_01230 16386 15295 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389392.1 protein_id gnl|my_center|LOCUS_01230 18753 16423 gene locus_tag LOCUS_01240 18753 16423 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389391.1 protein_id gnl|my_center|LOCUS_01240 21386 18753 gene locus_tag LOCUS_01250 21386 18753 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_01250 22970 21663 gene locus_tag LOCUS_01260 22970 21663 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390064.1 protein_id gnl|my_center|LOCUS_01260 25456 23027 gene locus_tag LOCUS_01270 25456 23027 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144418951.1 protein_id gnl|my_center|LOCUS_01270 25796 26659 gene locus_tag LOCUS_01280 25796 26659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 26859 27563 gene locus_tag LOCUS_01290 26859 27563 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_01290 27597 28115 gene locus_tag LOCUS_01300 27597 28115 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 protein_id gnl|my_center|LOCUS_01300 28122 29690 gene locus_tag LOCUS_01310 28122 29690 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051709.1 protein_id gnl|my_center|LOCUS_01310 29693 31237 gene locus_tag LOCUS_01320 29693 31237 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811411.1 protein_id gnl|my_center|LOCUS_01320 31227 32696 gene locus_tag LOCUS_01330 31227 32696 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 protein_id gnl|my_center|LOCUS_01330 32693 33685 gene locus_tag LOCUS_01340 32693 33685 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 protein_id gnl|my_center|LOCUS_01340 33682 35841 gene locus_tag LOCUS_01350 gene pknB 33682 35841 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 protein_id gnl|my_center|LOCUS_01350 37208 36093 gene locus_tag LOCUS_01360 37208 36093 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362941.1 protein_id gnl|my_center|LOCUS_01360 37967 37209 gene locus_tag LOCUS_01370 37967 37209 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 protein_id gnl|my_center|LOCUS_01370 38052 38492 gene locus_tag LOCUS_01380 gene crgA 38052 38492 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389385.1 protein_id gnl|my_center|LOCUS_01380 39791 38958 gene locus_tag LOCUS_01390 39791 38958 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362938.1 protein_id gnl|my_center|LOCUS_01390 39873 40103 gene locus_tag LOCUS_01400 39873 40103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125969027.1 protein_id gnl|my_center|LOCUS_01400 40237 40656 gene locus_tag LOCUS_01410 40237 40656 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 protein_id gnl|my_center|LOCUS_01410 41203 40820 gene locus_tag LOCUS_01420 41203 40820 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815101.1 protein_id gnl|my_center|LOCUS_01420 41357 42442 gene locus_tag LOCUS_01430 gene trpS 41357 42442 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 protein_id gnl|my_center|LOCUS_01430 44448 42439 gene locus_tag LOCUS_01440 44448 42439 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362859.1 protein_id gnl|my_center|LOCUS_01440 44641 47400 gene locus_tag LOCUS_01450 44641 47400 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 protein_id gnl|my_center|LOCUS_01450 48095 47811 gene locus_tag LOCUS_01460 48095 47811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 48236 48541 gene locus_tag LOCUS_01470 48236 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 49451 49278 gene locus_tag LOCUS_01480 49451 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 <51222 49705 gene locus_tag LOCUS_01490 <51222 49705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007056574.1:FAD-dependent oxidoreductase >Feature sequence004 1482 91 gene locus_tag LOCUS_01500 1482 91 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 protein_id gnl|my_center|LOCUS_01500 1824 3239 gene locus_tag LOCUS_01510 gene dnaB 1824 3239 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171023377.1 protein_id gnl|my_center|LOCUS_01510 3244 4635 gene locus_tag LOCUS_01520 3244 4635 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_01520 4662 5462 gene locus_tag LOCUS_01530 4662 5462 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815981.1 protein_id gnl|my_center|LOCUS_01530 5726 6136 gene locus_tag LOCUS_01540 5726 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 7219 6359 gene locus_tag LOCUS_01550 7219 6359 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_01550 7403 8482 gene locus_tag LOCUS_01560 7403 8482 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057441.1 protein_id gnl|my_center|LOCUS_01560 10526 8451 gene locus_tag LOCUS_01570 10526 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 11740 11102 gene locus_tag LOCUS_01580 gene upp 11740 11102 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 protein_id gnl|my_center|LOCUS_01580 12707 11988 gene locus_tag LOCUS_01590 12707 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_01590 13776 12697 gene locus_tag LOCUS_01600 13776 12697 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143625.1 protein_id gnl|my_center|LOCUS_01600 16084 13838 gene locus_tag LOCUS_01610 16084 13838 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 protein_id gnl|my_center|LOCUS_01610 16925 17746 gene locus_tag LOCUS_01620 16925 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363999.1 protein_id gnl|my_center|LOCUS_01620 17743 18855 gene locus_tag LOCUS_01630 17743 18855 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363998.1 protein_id gnl|my_center|LOCUS_01630 18845 19507 gene locus_tag LOCUS_01640 gene tadB 18845 19507 CDS product Flp pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054679.1 protein_id gnl|my_center|LOCUS_01640 19498 20040 gene locus_tag LOCUS_01650 19498 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 20346 20606 gene locus_tag LOCUS_01660 20346 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 20593 20970 gene locus_tag LOCUS_01670 20593 20970 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004573653.1 protein_id gnl|my_center|LOCUS_01670 20974 21369 gene locus_tag LOCUS_01680 20974 21369 CDS product flp pilus-assembly TadE/G-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410434.1 protein_id gnl|my_center|LOCUS_01680 21441 24353 gene locus_tag LOCUS_01690 21441 24353 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 protein_id gnl|my_center|LOCUS_01690 24353 24955 gene locus_tag LOCUS_01700 gene recR 24353 24955 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 protein_id gnl|my_center|LOCUS_01700 25286 26119 gene locus_tag LOCUS_01710 25286 26119 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051616.1 protein_id gnl|my_center|LOCUS_01710 26116 26679 gene locus_tag LOCUS_01720 26116 26679 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 protein_id gnl|my_center|LOCUS_01720 26699 27787 gene locus_tag LOCUS_01730 26699 27787 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994594.1 protein_id gnl|my_center|LOCUS_01730 27830 28450 gene locus_tag LOCUS_01740 27830 28450 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816090.1 protein_id gnl|my_center|LOCUS_01740 28710 30620 gene locus_tag LOCUS_01750 gene leuA 28710 30620 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 protein_id gnl|my_center|LOCUS_01750 32950 30704 gene locus_tag LOCUS_01760 32950 30704 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 protein_id gnl|my_center|LOCUS_01760 33144 34286 gene locus_tag LOCUS_01770 33144 34286 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 protein_id gnl|my_center|LOCUS_01770 35704 34526 gene locus_tag LOCUS_01780 gene glf 35704 34526 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 protein_id gnl|my_center|LOCUS_01780 36132 37151 gene locus_tag LOCUS_01790 36132 37151 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414672.1 protein_id gnl|my_center|LOCUS_01790 37300 40176 gene locus_tag LOCUS_01800 gene topA 37300 40176 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390327.1 protein_id gnl|my_center|LOCUS_01800 40173 41180 gene locus_tag LOCUS_01810 40173 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 41177 42337 gene locus_tag LOCUS_01820 41177 42337 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 protein_id gnl|my_center|LOCUS_01820 43414 42356 gene locus_tag LOCUS_01830 43414 42356 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817399.1 protein_id gnl|my_center|LOCUS_01830 43742 43467 gene locus_tag LOCUS_01840 43742 43467 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence005 2031 700 gene locus_tag LOCUS_01850 gene murA 2031 700 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811644.1 protein_id gnl|my_center|LOCUS_01850 3210 2173 gene locus_tag LOCUS_01860 3210 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4309 3329 gene locus_tag LOCUS_01870 4309 3329 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225431769.1 protein_id gnl|my_center|LOCUS_01870 4235 4483 gene locus_tag LOCUS_01880 4235 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6513 5554 gene locus_tag LOCUS_01890 6513 5554 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811640.1 protein_id gnl|my_center|LOCUS_01890 7313 6627 gene locus_tag LOCUS_01900 gene leuD 7313 6627 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817545.1 protein_id gnl|my_center|LOCUS_01900 8763 7360 gene locus_tag LOCUS_01910 gene leuC 8763 7360 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811629.1 protein_id gnl|my_center|LOCUS_01910 8915 9703 gene locus_tag LOCUS_01920 8915 9703 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192829039.1 protein_id gnl|my_center|LOCUS_01920 11197 9731 gene locus_tag LOCUS_01930 11197 9731 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_01930 11426 12385 gene locus_tag LOCUS_01940 11426 12385 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566889.1 protein_id gnl|my_center|LOCUS_01940 14122 12629 gene locus_tag LOCUS_01950 14122 12629 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674819.1 protein_id gnl|my_center|LOCUS_01950 16243 14384 gene locus_tag LOCUS_01960 gene cydC 16243 14384 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641327.1 protein_id gnl|my_center|LOCUS_01960 18233 16263 gene locus_tag LOCUS_01970 18233 16263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 19347 18295 gene locus_tag LOCUS_01980 gene cydB 19347 18295 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003571229.1 protein_id gnl|my_center|LOCUS_01980 19616 19344 gene locus_tag LOCUS_01990 19616 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 20833 19670 gene locus_tag LOCUS_02000 20833 19670 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 protein_id gnl|my_center|LOCUS_02000 21232 21160 gene locus_tag LOCUS_t00040 21232 21160 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 21346 21273 gene locus_tag LOCUS_t00050 21346 21273 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22215 21415 gene locus_tag LOCUS_02010 22215 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 22942 22121 gene locus_tag LOCUS_02020 22942 22121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02020 23721 22999 gene locus_tag LOCUS_02030 gene nrdG 23721 22999 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389607.1 protein_id gnl|my_center|LOCUS_02030 26202 23791 gene locus_tag LOCUS_02040 gene nrdD 26202 23791 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112200.1 protein_id gnl|my_center|LOCUS_02040 27552 26548 gene locus_tag LOCUS_02050 27552 26548 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947091.1 protein_id gnl|my_center|LOCUS_02050 27954 28970 gene locus_tag LOCUS_02060 27954 28970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 protein_id gnl|my_center|LOCUS_02060 28967 29755 gene locus_tag LOCUS_02070 28967 29755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389454.1 protein_id gnl|my_center|LOCUS_02070 29935 30942 gene locus_tag LOCUS_02080 29935 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 31861 30995 gene locus_tag LOCUS_02090 31861 30995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 protein_id gnl|my_center|LOCUS_02090 32593 31937 gene locus_tag LOCUS_02100 32593 31937 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389452.1 protein_id gnl|my_center|LOCUS_02100 32807 34144 gene locus_tag LOCUS_02110 32807 34144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054697.1 protein_id gnl|my_center|LOCUS_02110 34205 34729 gene locus_tag LOCUS_02120 34205 34729 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_02120 34839 35186 gene locus_tag LOCUS_02130 34839 35186 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_02130 35789 35340 gene locus_tag LOCUS_02140 gene rplI 35789 35340 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117309.1 protein_id gnl|my_center|LOCUS_02140 36052 35804 gene locus_tag LOCUS_02150 gene rpsR 36052 35804 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051545.1 protein_id gnl|my_center|LOCUS_02150 36706 36089 gene locus_tag LOCUS_02160 36706 36089 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068475.1 protein_id gnl|my_center|LOCUS_02160 37131 36835 gene locus_tag LOCUS_02170 gene rpsF 37131 36835 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811753.1 protein_id gnl|my_center|LOCUS_02170 38266 37271 gene locus_tag LOCUS_02180 gene rfbB 38266 37271 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109056741.1 protein_id gnl|my_center|LOCUS_02180 <39458 38900 gene locus_tag LOCUS_02190 <39458 38900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068683.1:ABC transporter ATP-binding protein >Feature sequence006 396 2249 gene locus_tag LOCUS_02200 396 2249 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 protein_id gnl|my_center|LOCUS_02200 3392 2337 gene locus_tag LOCUS_02210 3392 2337 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980817.1 protein_id gnl|my_center|LOCUS_02210 4278 3520 gene locus_tag LOCUS_02220 4278 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 4492 7107 gene locus_tag LOCUS_02230 gene pepN 4492 7107 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 protein_id gnl|my_center|LOCUS_02230 7205 8581 gene locus_tag LOCUS_02240 gene glmM 7205 8581 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 protein_id gnl|my_center|LOCUS_02240 8612 9265 gene locus_tag LOCUS_02250 8612 9265 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051298.1 protein_id gnl|my_center|LOCUS_02250 9945 9214 gene locus_tag LOCUS_02260 9945 9214 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389990.1 protein_id gnl|my_center|LOCUS_02260 10171 11289 gene locus_tag LOCUS_02270 10171 11289 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_02270 12528 11398 gene locus_tag LOCUS_02280 12528 11398 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150382938.1 protein_id gnl|my_center|LOCUS_02280 13854 12556 gene locus_tag LOCUS_02290 13854 12556 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 protein_id gnl|my_center|LOCUS_02290 14055 15245 gene locus_tag LOCUS_02300 14055 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 15995 15276 gene locus_tag LOCUS_02310 15995 15276 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389601.1 protein_id gnl|my_center|LOCUS_02310 16169 17215 gene locus_tag LOCUS_02320 16169 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17329 17532 gene locus_tag LOCUS_02330 17329 17532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 17881 17582 gene locus_tag LOCUS_02340 17881 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18225 19181 gene locus_tag LOCUS_02350 18225 19181 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_02350 19233 20621 gene locus_tag LOCUS_02360 19233 20621 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 protein_id gnl|my_center|LOCUS_02360 24532 21125 gene locus_tag LOCUS_02370 24532 21125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 24693 25037 gene locus_tag LOCUS_02380 24693 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 27457 25070 gene locus_tag LOCUS_02390 27457 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 28154 28333 gene locus_tag LOCUS_02400 28154 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 29349 29705 gene locus_tag LOCUS_02410 29349 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 30631 30068 gene locus_tag LOCUS_02420 30631 30068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 32404 30986 gene locus_tag LOCUS_02430 32404 30986 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_02430 32850 32401 gene locus_tag LOCUS_02440 32850 32401 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130017.1 protein_id gnl|my_center|LOCUS_02440 34131 33073 gene locus_tag LOCUS_02450 34131 33073 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_02450 34338 35261 gene locus_tag LOCUS_02460 34338 35261 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_02460 35258 36226 gene locus_tag LOCUS_02470 35258 36226 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 protein_id gnl|my_center|LOCUS_02470 36331 37692 gene locus_tag LOCUS_02480 36331 37692 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068327.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence007 3276 304 gene locus_tag LOCUS_02490 3276 304 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_02490 3250 7389 gene locus_tag LOCUS_02500 3250 7389 CDS product bacterial Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583001.1 protein_id gnl|my_center|LOCUS_02500 7409 11125 gene locus_tag LOCUS_02510 7409 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12181 11258 gene locus_tag LOCUS_02520 12181 11258 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729575.1 protein_id gnl|my_center|LOCUS_02520 12887 13951 gene locus_tag LOCUS_02530 12887 13951 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_02530 15287 14271 gene locus_tag LOCUS_02540 15287 14271 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033892099.1 protein_id gnl|my_center|LOCUS_02540 16207 15323 gene locus_tag LOCUS_02550 16207 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 16493 16233 gene locus_tag LOCUS_02560 16493 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16666 16971 gene locus_tag LOCUS_02570 16666 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 16989 19133 gene locus_tag LOCUS_02580 16989 19133 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618516.1 protein_id gnl|my_center|LOCUS_02580 19218 19574 gene locus_tag LOCUS_02590 19218 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19789 20283 gene locus_tag LOCUS_02600 19789 20283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 20280 21020 gene locus_tag LOCUS_02610 20280 21020 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225856.1 protein_id gnl|my_center|LOCUS_02610 21061 22368 gene locus_tag LOCUS_02620 21061 22368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23449 22358 gene locus_tag LOCUS_02630 23449 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052829080.1 protein_id gnl|my_center|LOCUS_02630 24347 23439 gene locus_tag LOCUS_02640 24347 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 26169 24310 gene locus_tag LOCUS_02650 26169 24310 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068079.1 protein_id gnl|my_center|LOCUS_02650 26752 26204 gene locus_tag LOCUS_02660 26752 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 27493 26852 gene locus_tag LOCUS_02670 27493 26852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 29095 27536 gene locus_tag LOCUS_02680 29095 27536 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_02680 30616 29111 gene locus_tag LOCUS_02690 30616 29111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_02690 32721 30616 gene locus_tag LOCUS_02700 32721 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068084.1 protein_id gnl|my_center|LOCUS_02700 33160 32762 gene locus_tag LOCUS_02710 33160 32762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 33302 33589 gene locus_tag LOCUS_02720 33302 33589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 34415 33723 gene locus_tag LOCUS_02730 34415 33723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 35644 34883 gene locus_tag LOCUS_02740 35644 34883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 <37634 35960 gene locus_tag LOCUS_02750 <37634 35960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068089.1:LPXTG cell wall anchor domain-containing protein >Feature sequence008 <1 726 gene locus_tag LOCUS_02760 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812880.1:CTP synthase 943 2442 gene locus_tag LOCUS_02770 gene sufB 943 2442 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994877.1 protein_id gnl|my_center|LOCUS_02770 2442 3668 gene locus_tag LOCUS_02780 gene sufD 2442 3668 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 protein_id gnl|my_center|LOCUS_02780 3670 4449 gene locus_tag LOCUS_02790 gene sufC 3670 4449 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053376.1 protein_id gnl|my_center|LOCUS_02790 4471 5745 gene locus_tag LOCUS_02800 4471 5745 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 protein_id gnl|my_center|LOCUS_02800 5806 6393 gene locus_tag LOCUS_02810 5806 6393 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 protein_id gnl|my_center|LOCUS_02810 6390 7112 gene locus_tag LOCUS_02820 6390 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7214 8530 gene locus_tag LOCUS_02830 7214 8530 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_02830 9599 8733 gene locus_tag LOCUS_02840 9599 8733 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_02840 9962 9873 gene locus_tag LOCUS_t00060 9962 9873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10082 10882 gene locus_tag LOCUS_02850 10082 10882 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 protein_id gnl|my_center|LOCUS_02850 10954 11301 gene locus_tag LOCUS_02860 10954 11301 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 protein_id gnl|my_center|LOCUS_02860 11342 12517 gene locus_tag LOCUS_02870 11342 12517 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 protein_id gnl|my_center|LOCUS_02870 12514 13068 gene locus_tag LOCUS_02880 gene ybeY 12514 13068 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 protein_id gnl|my_center|LOCUS_02880 13061 14473 gene locus_tag LOCUS_02890 13061 14473 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 protein_id gnl|my_center|LOCUS_02890 14470 15423 gene locus_tag LOCUS_02900 gene era 14470 15423 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816894.1 protein_id gnl|my_center|LOCUS_02900 17367 15430 gene locus_tag LOCUS_02910 17367 15430 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 protein_id gnl|my_center|LOCUS_02910 17687 18310 gene locus_tag LOCUS_02920 17687 18310 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812918.1 protein_id gnl|my_center|LOCUS_02920 18498 19625 gene locus_tag LOCUS_02930 18498 19625 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068176.1 protein_id gnl|my_center|LOCUS_02930 19809 20603 gene locus_tag LOCUS_02940 19809 20603 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053361.1 protein_id gnl|my_center|LOCUS_02940 20904 20644 gene locus_tag LOCUS_02950 gene rpsT 20904 20644 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 protein_id gnl|my_center|LOCUS_02950 21050 22927 gene locus_tag LOCUS_02960 gene lepA 21050 22927 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363424.1 protein_id gnl|my_center|LOCUS_02960 22932 24275 gene locus_tag LOCUS_02970 gene hemW 22932 24275 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545203.1 protein_id gnl|my_center|LOCUS_02970 24399 28973 gene locus_tag LOCUS_02980 gene gltB 24399 28973 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033496496.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence009 96 1460 gene locus_tag LOCUS_02990 96 1460 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389479.1 protein_id gnl|my_center|LOCUS_02990 2468 1500 gene locus_tag LOCUS_03000 2468 1500 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_03000 2679 3818 gene locus_tag LOCUS_03010 gene dapE 2679 3818 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 protein_id gnl|my_center|LOCUS_03010 4055 6730 gene locus_tag LOCUS_03020 4055 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6886 7194 gene locus_tag LOCUS_03030 gene rplU 6886 7194 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811712.1 protein_id gnl|my_center|LOCUS_03030 7227 7478 gene locus_tag LOCUS_03040 gene rpmA 7227 7478 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_03040 7619 9286 gene locus_tag LOCUS_03050 gene obgE 7619 9286 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815401.1 protein_id gnl|my_center|LOCUS_03050 9283 10425 gene locus_tag LOCUS_03060 gene proB 9283 10425 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811720.1 protein_id gnl|my_center|LOCUS_03060 10463 11677 gene locus_tag LOCUS_03070 10463 11677 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 protein_id gnl|my_center|LOCUS_03070 11798 11873 gene locus_tag LOCUS_t00070 11798 11873 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 11912 12142 gene locus_tag LOCUS_03080 11912 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 12173 13006 gene locus_tag LOCUS_03090 gene nusG 12173 13006 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055071.1 protein_id gnl|my_center|LOCUS_03090 13145 13576 gene locus_tag LOCUS_03100 gene rplK 13145 13576 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053055.1 protein_id gnl|my_center|LOCUS_03100 13641 14330 gene locus_tag LOCUS_03110 gene rplA 13641 14330 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112012.1 protein_id gnl|my_center|LOCUS_03110 15653 14421 gene locus_tag LOCUS_03120 15653 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 17491 15650 gene locus_tag LOCUS_03130 17491 15650 CDS product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 protein_id gnl|my_center|LOCUS_03130 18215 18826 gene locus_tag LOCUS_03140 18215 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 18892 20727 gene locus_tag LOCUS_03150 18892 20727 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053766.1 protein_id gnl|my_center|LOCUS_03150 20724 22295 gene locus_tag LOCUS_03160 20724 22295 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390270.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence010 58 2646 gene locus_tag LOCUS_03170 gene ligA 58 2646 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 protein_id gnl|my_center|LOCUS_03170 2716 3912 gene locus_tag LOCUS_03180 2716 3912 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363328.1 protein_id gnl|my_center|LOCUS_03180 5409 4063 gene locus_tag LOCUS_03190 5409 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7046 5610 gene locus_tag LOCUS_03200 gene glnA 7046 5610 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 protein_id gnl|my_center|LOCUS_03200 7926 7192 gene locus_tag LOCUS_03210 7926 7192 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 protein_id gnl|my_center|LOCUS_03210 9462 7975 gene locus_tag LOCUS_03220 9462 7975 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 protein_id gnl|my_center|LOCUS_03220 10230 9604 gene locus_tag LOCUS_03230 10230 9604 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 protein_id gnl|my_center|LOCUS_03230 10297 11673 gene locus_tag LOCUS_03240 10297 11673 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112492.1 protein_id gnl|my_center|LOCUS_03240 11811 12539 gene locus_tag LOCUS_03250 11811 12539 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 protein_id gnl|my_center|LOCUS_03250 12550 15045 gene locus_tag LOCUS_03260 12550 15045 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 protein_id gnl|my_center|LOCUS_03260 15772 15152 gene locus_tag LOCUS_03270 15772 15152 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731275.1 protein_id gnl|my_center|LOCUS_03270 16205 15954 gene locus_tag LOCUS_03280 16205 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 16116 16913 gene locus_tag LOCUS_03290 16116 16913 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 protein_id gnl|my_center|LOCUS_03290 16983 18050 gene locus_tag LOCUS_03300 gene pheS 16983 18050 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813536.1 protein_id gnl|my_center|LOCUS_03300 18064 20664 gene locus_tag LOCUS_03310 gene pheT 18064 20664 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390025.1 protein_id gnl|my_center|LOCUS_03310 20690 21298 gene locus_tag LOCUS_03320 20690 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 protein_id gnl|my_center|LOCUS_03320 21322 21912 gene locus_tag LOCUS_03330 21322 21912 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275226.1 protein_id gnl|my_center|LOCUS_03330 22021 23115 gene locus_tag LOCUS_03340 gene argC 22021 23115 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence011 984 568 gene locus_tag LOCUS_03350 984 568 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_03350 1815 1036 gene locus_tag LOCUS_03360 1815 1036 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 protein_id gnl|my_center|LOCUS_03360 1997 3619 gene locus_tag LOCUS_03370 1997 3619 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 protein_id gnl|my_center|LOCUS_03370 5146 3656 gene locus_tag LOCUS_03380 5146 3656 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067953.1 protein_id gnl|my_center|LOCUS_03380 5250 6908 gene locus_tag LOCUS_03390 5250 6908 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389618.1 protein_id gnl|my_center|LOCUS_03390 6998 7237 gene locus_tag LOCUS_03400 6998 7237 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804752.1 protein_id gnl|my_center|LOCUS_03400 8210 7302 gene locus_tag LOCUS_03410 8210 7302 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389617.1 protein_id gnl|my_center|LOCUS_03410 8283 8915 gene locus_tag LOCUS_03420 8283 8915 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 protein_id gnl|my_center|LOCUS_03420 9854 8916 gene locus_tag LOCUS_03430 gene dapF 9854 8916 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389615.1 protein_id gnl|my_center|LOCUS_03430 9949 10734 gene locus_tag LOCUS_03440 gene murI 9949 10734 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 protein_id gnl|my_center|LOCUS_03440 10803 11654 gene locus_tag LOCUS_03450 10803 11654 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_03450 12682 11717 gene locus_tag LOCUS_03460 12682 11717 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 protein_id gnl|my_center|LOCUS_03460 12850 13797 gene locus_tag LOCUS_03470 12850 13797 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920493.1 protein_id gnl|my_center|LOCUS_03470 17260 13916 gene locus_tag LOCUS_03480 gene ileS 17260 13916 CDS product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 protein_id gnl|my_center|LOCUS_03480 18809 17535 gene locus_tag LOCUS_03490 18809 17535 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821099.1 protein_id gnl|my_center|LOCUS_03490 21247 18947 gene locus_tag LOCUS_03500 21247 18947 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_03500 22380 21727 gene locus_tag LOCUS_03510 22380 21727 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053629.1 protein_id gnl|my_center|LOCUS_03510 <23005 22464 gene locus_tag LOCUS_03520 <23005 22464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068820.1:acyl-CoA dehydratase activase-related protein >Feature sequence012 <1 678 gene locus_tag LOCUS_03530 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013410658.1:AzlC family ABC transporter permease 675 1031 gene locus_tag LOCUS_03540 gene azlD 675 1031 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_03540 1072 1839 gene locus_tag LOCUS_03550 1072 1839 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_03550 1882 2307 gene locus_tag LOCUS_03560 1882 2307 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_03560 2497 3552 gene locus_tag LOCUS_03570 gene gap 2497 3552 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112995.1 protein_id gnl|my_center|LOCUS_03570 4222 3626 gene locus_tag LOCUS_03580 4222 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4300 4806 gene locus_tag LOCUS_03590 gene ybaK 4300 4806 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054439.1 protein_id gnl|my_center|LOCUS_03590 5899 4826 gene locus_tag LOCUS_03600 5899 4826 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014483607.1 protein_id gnl|my_center|LOCUS_03600 6072 7040 gene locus_tag LOCUS_03610 6072 7040 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068009.1 protein_id gnl|my_center|LOCUS_03610 7619 7332 gene locus_tag LOCUS_03620 7619 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8408 7659 gene locus_tag LOCUS_03630 8408 7659 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 protein_id gnl|my_center|LOCUS_03630 8433 9191 gene locus_tag LOCUS_03640 8433 9191 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113025.1 protein_id gnl|my_center|LOCUS_03640 9366 10934 gene locus_tag LOCUS_03650 9366 10934 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_03650 11021 12265 gene locus_tag LOCUS_03660 11021 12265 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 protein_id gnl|my_center|LOCUS_03660 12262 13005 gene locus_tag LOCUS_03670 12262 13005 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812371.1 protein_id gnl|my_center|LOCUS_03670 16576 12938 gene locus_tag LOCUS_03680 gene smc 16576 12938 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389674.1 protein_id gnl|my_center|LOCUS_03680 17997 16576 gene locus_tag LOCUS_03690 17997 16576 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 protein_id gnl|my_center|LOCUS_03690 18153 19754 gene locus_tag LOCUS_03700 18153 19754 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 protein_id gnl|my_center|LOCUS_03700 19757 20311 gene locus_tag LOCUS_03710 19757 20311 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 protein_id gnl|my_center|LOCUS_03710 21656 20421 gene locus_tag LOCUS_03720 21656 20421 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence013 1279 359 gene locus_tag LOCUS_03730 1279 359 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100494330.1 protein_id gnl|my_center|LOCUS_03730 2614 1352 gene locus_tag LOCUS_03740 2614 1352 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_03740 3127 4047 gene locus_tag LOCUS_03750 3127 4047 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226355.1 protein_id gnl|my_center|LOCUS_03750 5562 4099 gene locus_tag LOCUS_03760 gene uxaC 5562 4099 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_03760 6706 5696 gene locus_tag LOCUS_03770 6706 5696 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_03770 7770 6703 gene locus_tag LOCUS_03780 7770 6703 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_03780 8015 9658 gene locus_tag LOCUS_03790 8015 9658 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129429.1 protein_id gnl|my_center|LOCUS_03790 9732 10859 gene locus_tag LOCUS_03800 gene uxuA 9732 10859 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_03800 12673 11228 gene locus_tag LOCUS_03810 12673 11228 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286004.1 protein_id gnl|my_center|LOCUS_03810 13435 12770 gene locus_tag LOCUS_03820 13435 12770 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263803.1 protein_id gnl|my_center|LOCUS_03820 14532 13528 gene locus_tag LOCUS_03830 14532 13528 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550371.1 protein_id gnl|my_center|LOCUS_03830 16010 14772 gene locus_tag LOCUS_03840 16010 14772 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 protein_id gnl|my_center|LOCUS_03840 16389 17453 gene locus_tag LOCUS_03850 16389 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 17504 18694 gene locus_tag LOCUS_03860 17504 18694 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 protein_id gnl|my_center|LOCUS_03860 18704 20524 gene locus_tag LOCUS_03870 18704 20524 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965650.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence014 208 2736 gene locus_tag LOCUS_03880 208 2736 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217062444.1 protein_id gnl|my_center|LOCUS_03880 3669 2764 gene locus_tag LOCUS_03890 3669 2764 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389509.1 protein_id gnl|my_center|LOCUS_03890 4118 3666 gene locus_tag LOCUS_03900 4118 3666 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831666.1 protein_id gnl|my_center|LOCUS_03900 4311 4988 gene locus_tag LOCUS_03910 4311 4988 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_03910 5760 4948 gene locus_tag LOCUS_03920 5760 4948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223290.1 protein_id gnl|my_center|LOCUS_03920 6197 7222 gene locus_tag LOCUS_03930 6197 7222 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811813.1 protein_id gnl|my_center|LOCUS_03930 7347 7541 gene locus_tag LOCUS_03940 gene rpmB 7347 7541 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105392.1 protein_id gnl|my_center|LOCUS_03940 7642 10116 gene locus_tag LOCUS_03950 7642 10116 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994858.1 protein_id gnl|my_center|LOCUS_03950 10133 10732 gene locus_tag LOCUS_03960 10133 10732 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 protein_id gnl|my_center|LOCUS_03960 11700 10756 gene locus_tag LOCUS_03970 gene trmD 11700 10756 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389536.1 protein_id gnl|my_center|LOCUS_03970 11979 13382 gene locus_tag LOCUS_03980 11979 13382 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101177.1 protein_id gnl|my_center|LOCUS_03980 14429 13413 gene locus_tag LOCUS_03990 14429 13413 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152580630.1 protein_id gnl|my_center|LOCUS_03990 14789 15607 gene locus_tag LOCUS_04000 14789 15607 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570970.1 protein_id gnl|my_center|LOCUS_04000 15604 17109 gene locus_tag LOCUS_04010 15604 17109 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674742.1 protein_id gnl|my_center|LOCUS_04010 17106 17810 gene locus_tag LOCUS_04020 17106 17810 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674741.1 protein_id gnl|my_center|LOCUS_04020 18535 17930 gene locus_tag LOCUS_04030 gene rimM 18535 17930 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 protein_id gnl|my_center|LOCUS_04030 18765 18532 gene locus_tag LOCUS_04040 18765 18532 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051427.1 protein_id gnl|my_center|LOCUS_04040 19260 18802 gene locus_tag LOCUS_04050 gene rpsP 19260 18802 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819603.1 protein_id gnl|my_center|LOCUS_04050 20393 19431 gene locus_tag LOCUS_04060 20393 19431 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068417.1 protein_id gnl|my_center|LOCUS_04060 <22012 20426 gene locus_tag LOCUS_04070 <22012 20426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022527326.1:signal recognition particle protein >Feature sequence015 38 1735 gene locus_tag LOCUS_04080 gene pgi 38 1735 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068403.1 protein_id gnl|my_center|LOCUS_04080 1958 2329 gene locus_tag LOCUS_04090 gene rplS 1958 2329 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 protein_id gnl|my_center|LOCUS_04090 2475 3239 gene locus_tag LOCUS_04100 2475 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3247 3954 gene locus_tag LOCUS_04110 3247 3954 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_04110 3993 5114 gene locus_tag LOCUS_04120 3993 5114 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 protein_id gnl|my_center|LOCUS_04120 5217 6830 gene locus_tag LOCUS_04130 5217 6830 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051390.1 protein_id gnl|my_center|LOCUS_04130 6895 7587 gene locus_tag LOCUS_04140 6895 7587 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389560.1 protein_id gnl|my_center|LOCUS_04140 7619 9133 gene locus_tag LOCUS_04150 gene araA 7619 9133 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051388.1 protein_id gnl|my_center|LOCUS_04150 9377 11347 gene locus_tag LOCUS_04160 9377 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 11541 12368 gene locus_tag LOCUS_04170 11541 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 12528 14066 gene locus_tag LOCUS_04180 12528 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14196 15044 gene locus_tag LOCUS_04190 14196 15044 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815359.1 protein_id gnl|my_center|LOCUS_04190 15099 15896 gene locus_tag LOCUS_04200 15099 15896 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 protein_id gnl|my_center|LOCUS_04200 17609 16038 gene locus_tag LOCUS_04210 17609 16038 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 protein_id gnl|my_center|LOCUS_04210 17983 19086 gene locus_tag LOCUS_04220 gene pstS 17983 19086 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 protein_id gnl|my_center|LOCUS_04220 19083 20036 gene locus_tag LOCUS_04230 gene pstC 19083 20036 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence016 1478 531 gene locus_tag LOCUS_04240 1478 531 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813106.1 protein_id gnl|my_center|LOCUS_04240 2320 1475 gene locus_tag LOCUS_04250 2320 1475 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389895.1 protein_id gnl|my_center|LOCUS_04250 3378 2317 gene locus_tag LOCUS_04260 gene pyrF 3378 2317 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_04260 4760 3381 gene locus_tag LOCUS_04270 4760 3381 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389893.1 protein_id gnl|my_center|LOCUS_04270 5175 4762 gene locus_tag LOCUS_04280 5175 4762 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 protein_id gnl|my_center|LOCUS_04280 6113 5172 gene locus_tag LOCUS_04290 gene pyrB 6113 5172 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 protein_id gnl|my_center|LOCUS_04290 7290 6250 gene locus_tag LOCUS_04300 7290 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 9331 7367 gene locus_tag LOCUS_04310 9331 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04310 9306 9683 gene locus_tag LOCUS_04320 9306 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 9690 9929 gene locus_tag LOCUS_04330 9690 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9986 10321 gene locus_tag LOCUS_04340 9986 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11263 10382 gene locus_tag LOCUS_04350 gene metF 11263 10382 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389889.1 protein_id gnl|my_center|LOCUS_04350 13592 11256 gene locus_tag LOCUS_04360 gene metE 13592 11256 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389888.1 protein_id gnl|my_center|LOCUS_04360 14331 13771 gene locus_tag LOCUS_04370 14331 13771 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389849.1 protein_id gnl|my_center|LOCUS_04370 15545 14412 gene locus_tag LOCUS_04380 15545 14412 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068134.1 protein_id gnl|my_center|LOCUS_04380 17498 15552 gene locus_tag LOCUS_04390 17498 15552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_04390 19262 17499 gene locus_tag LOCUS_04400 19262 17499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence017 681 253 gene locus_tag LOCUS_04410 681 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 833 1648 gene locus_tag LOCUS_04420 gene lexA 833 1648 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812299.1 protein_id gnl|my_center|LOCUS_04420 2616 1753 gene locus_tag LOCUS_04430 2616 1753 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 protein_id gnl|my_center|LOCUS_04430 3663 2755 gene locus_tag LOCUS_04440 3663 2755 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812295.1 protein_id gnl|my_center|LOCUS_04440 5369 3816 gene locus_tag LOCUS_04450 gene hflX 5369 3816 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812294.1 protein_id gnl|my_center|LOCUS_04450 5517 6179 gene locus_tag LOCUS_04460 5517 6179 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_04460 6176 10264 gene locus_tag LOCUS_04470 gene hrpA 6176 10264 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389653.1 protein_id gnl|my_center|LOCUS_04470 10261 11148 gene locus_tag LOCUS_04480 10261 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389652.1 protein_id gnl|my_center|LOCUS_04480 12495 11158 gene locus_tag LOCUS_04490 gene glnA 12495 11158 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812280.1 protein_id gnl|my_center|LOCUS_04490 13273 12542 gene locus_tag LOCUS_04500 gene priA 13273 12542 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054385.1 protein_id gnl|my_center|LOCUS_04500 14048 13275 gene locus_tag LOCUS_04510 gene hisH 14048 13275 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812274.1 protein_id gnl|my_center|LOCUS_04510 14859 14056 gene locus_tag LOCUS_04520 14859 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 protein_id gnl|my_center|LOCUS_04520 15458 14856 gene locus_tag LOCUS_04530 gene hisB 15458 14856 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389647.1 protein_id gnl|my_center|LOCUS_04530 16737 15589 gene locus_tag LOCUS_04540 16737 15589 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 protein_id gnl|my_center|LOCUS_04540 18107 16734 gene locus_tag LOCUS_04550 gene hisD 18107 16734 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 protein_id gnl|my_center|LOCUS_04550 <18963 18214 gene locus_tag LOCUS_04560 <18963 18214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582833.1:DNA polymerase III subunit alpha >Feature sequence018 1317 343 gene locus_tag LOCUS_04570 1317 343 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 protein_id gnl|my_center|LOCUS_04570 1570 2367 gene locus_tag LOCUS_04580 1570 2367 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_04580 2805 2377 gene locus_tag LOCUS_04590 2805 2377 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056534.1 protein_id gnl|my_center|LOCUS_04590 5600 2865 gene locus_tag LOCUS_04600 5600 2865 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_04600 6174 8393 gene locus_tag LOCUS_04610 6174 8393 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390373.1 protein_id gnl|my_center|LOCUS_04610 9122 8400 gene locus_tag LOCUS_04620 9122 8400 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783033.1 protein_id gnl|my_center|LOCUS_04620 9996 9187 gene locus_tag LOCUS_04630 9996 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 10421 10188 gene locus_tag LOCUS_04640 10421 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 11896 11825 gene locus_tag LOCUS_t00080 11896 11825 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13138 12020 gene locus_tag LOCUS_04650 13138 12020 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817042.1 protein_id gnl|my_center|LOCUS_04650 13444 13779 gene locus_tag LOCUS_04660 13444 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 13849 14892 gene locus_tag LOCUS_04670 13849 14892 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389961.1 protein_id gnl|my_center|LOCUS_04670 14889 17024 gene locus_tag LOCUS_04680 14889 17024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence019 2413 416 gene locus_tag LOCUS_04690 2413 416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783117.1 protein_id gnl|my_center|LOCUS_04690 3429 2425 gene locus_tag LOCUS_04700 3429 2425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 protein_id gnl|my_center|LOCUS_04700 4372 3446 gene locus_tag LOCUS_04710 4372 3446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 protein_id gnl|my_center|LOCUS_04710 6224 4563 gene locus_tag LOCUS_04720 6224 4563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 protein_id gnl|my_center|LOCUS_04720 8024 6354 gene locus_tag LOCUS_04730 8024 6354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 protein_id gnl|my_center|LOCUS_04730 9130 8198 gene locus_tag LOCUS_04740 9130 8198 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 protein_id gnl|my_center|LOCUS_04740 9242 9520 gene locus_tag LOCUS_04750 9242 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052610.1 protein_id gnl|my_center|LOCUS_04750 10619 9510 gene locus_tag LOCUS_04760 10619 9510 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 protein_id gnl|my_center|LOCUS_04760 11599 10613 gene locus_tag LOCUS_04770 11599 10613 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 protein_id gnl|my_center|LOCUS_04770 12060 11596 gene locus_tag LOCUS_04780 12060 11596 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052607.1 protein_id gnl|my_center|LOCUS_04780 14052 12133 gene locus_tag LOCUS_04790 gene typA 14052 12133 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114597.1 protein_id gnl|my_center|LOCUS_04790 14829 14167 gene locus_tag LOCUS_04800 gene scpB 14829 14167 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 protein_id gnl|my_center|LOCUS_04800 15629 14826 gene locus_tag LOCUS_04810 15629 14826 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 protein_id gnl|my_center|LOCUS_04810 16465 15626 gene locus_tag LOCUS_04820 16465 15626 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 protein_id gnl|my_center|LOCUS_04820 <17376 16511 gene locus_tag LOCUS_04830 <17376 16511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068014.1:site-specific tyrosine recombinase XerD >Feature sequence020 560 294 gene locus_tag LOCUS_04840 560 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04840 1367 585 gene locus_tag LOCUS_04850 1367 585 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_04850 3204 1396 gene locus_tag LOCUS_04860 3204 1396 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052234.1 protein_id gnl|my_center|LOCUS_04860 3447 4136 gene locus_tag LOCUS_04870 3447 4136 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804184.1 protein_id gnl|my_center|LOCUS_04870 5853 4252 gene locus_tag LOCUS_04880 5853 4252 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813299.1 protein_id gnl|my_center|LOCUS_04880 6703 5960 gene locus_tag LOCUS_04890 6703 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_04890 7148 6924 gene locus_tag LOCUS_04900 7148 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7413 7964 gene locus_tag LOCUS_04910 7413 7964 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166578.1 protein_id gnl|my_center|LOCUS_04910 8070 11048 gene locus_tag LOCUS_04920 gene uvrA 8070 11048 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 protein_id gnl|my_center|LOCUS_04920 11045 13345 gene locus_tag LOCUS_04930 gene uvrC 11045 13345 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389954.1 protein_id gnl|my_center|LOCUS_04930 13629 14435 gene locus_tag LOCUS_04940 13629 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14432 15331 gene locus_tag LOCUS_04950 gene rapZ 14432 15331 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 protein_id gnl|my_center|LOCUS_04950 15452 16411 gene locus_tag LOCUS_04960 gene whiA 15452 16411 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence021 411 1115 gene locus_tag LOCUS_04970 411 1115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 protein_id gnl|my_center|LOCUS_04970 1118 4576 gene locus_tag LOCUS_04980 1118 4576 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775222.1 protein_id gnl|my_center|LOCUS_04980 4672 7497 gene locus_tag LOCUS_04990 4672 7497 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 protein_id gnl|my_center|LOCUS_04990 7579 8451 gene locus_tag LOCUS_05000 7579 8451 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659770.1 protein_id gnl|my_center|LOCUS_05000 8577 8960 gene locus_tag LOCUS_05010 8577 8960 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971989.1 protein_id gnl|my_center|LOCUS_05010 10648 9035 gene locus_tag LOCUS_05020 gene ptsP 10648 9035 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_05020 10905 10645 gene locus_tag LOCUS_05030 10905 10645 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_05030 11665 10916 gene locus_tag LOCUS_05040 gene alsE 11665 10916 CDS product D-allulose 6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185669695.1 protein_id gnl|my_center|LOCUS_05040 12810 11692 gene locus_tag LOCUS_05050 12810 11692 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366291.1 protein_id gnl|my_center|LOCUS_05050 13159 12848 gene locus_tag LOCUS_05060 13159 12848 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_05060 13663 13199 gene locus_tag LOCUS_05070 13663 13199 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355546.1 protein_id gnl|my_center|LOCUS_05070 14163 13663 gene locus_tag LOCUS_05080 14163 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 15662 14160 gene locus_tag LOCUS_05090 15662 14160 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989904.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence022 <1 1009 gene locus_tag LOCUS_05100 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068002.1:aminopeptidase P family protein 1013 1582 gene locus_tag LOCUS_05110 1013 1582 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 protein_id gnl|my_center|LOCUS_05110 2844 1609 gene locus_tag LOCUS_05120 2844 1609 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052436.1 protein_id gnl|my_center|LOCUS_05120 3038 4591 gene locus_tag LOCUS_05130 3038 4591 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 protein_id gnl|my_center|LOCUS_05130 7841 4611 gene locus_tag LOCUS_05140 gene lacZ 7841 4611 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_05140 9445 8102 gene locus_tag LOCUS_05150 gene xylA 9445 8102 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053874.1 protein_id gnl|my_center|LOCUS_05150 10076 11353 gene locus_tag LOCUS_05160 10076 11353 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067997.1 protein_id gnl|my_center|LOCUS_05160 11343 12242 gene locus_tag LOCUS_05170 11343 12242 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 protein_id gnl|my_center|LOCUS_05170 13811 12336 gene locus_tag LOCUS_05180 13811 12336 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964898.1 protein_id gnl|my_center|LOCUS_05180 14114 15736 gene locus_tag LOCUS_05190 14114 15736 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence023 1541 621 gene locus_tag LOCUS_05200 1541 621 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 protein_id gnl|my_center|LOCUS_05200 1891 2766 gene locus_tag LOCUS_05210 1891 2766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819774.1 protein_id gnl|my_center|LOCUS_05210 2763 3590 gene locus_tag LOCUS_05220 2763 3590 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812712.1 protein_id gnl|my_center|LOCUS_05220 4076 3597 gene locus_tag LOCUS_05230 gene ispF 4076 3597 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389773.1 protein_id gnl|my_center|LOCUS_05230 4711 4091 gene locus_tag LOCUS_05240 4711 4091 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812708.1 protein_id gnl|my_center|LOCUS_05240 4935 5672 gene locus_tag LOCUS_05250 4935 5672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 protein_id gnl|my_center|LOCUS_05250 5682 6821 gene locus_tag LOCUS_05260 5682 6821 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 protein_id gnl|my_center|LOCUS_05260 6892 7509 gene locus_tag LOCUS_05270 6892 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7506 8858 gene locus_tag LOCUS_05280 7506 8858 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_05280 9559 8855 gene locus_tag LOCUS_05290 9559 8855 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143341.1 protein_id gnl|my_center|LOCUS_05290 10547 9684 gene locus_tag LOCUS_05300 10547 9684 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_05300 10601 11047 gene locus_tag LOCUS_05310 10601 11047 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545171.1 protein_id gnl|my_center|LOCUS_05310 12580 11057 gene locus_tag LOCUS_05320 12580 11057 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389767.1 protein_id gnl|my_center|LOCUS_05320 15615 12577 gene locus_tag LOCUS_05330 15615 12577 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389766.1 protein_id gnl|my_center|LOCUS_05330 16030 15773 gene locus_tag LOCUS_05340 16030 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence024 1495 473 gene locus_tag LOCUS_05350 gene yidC 1495 473 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819388.1 protein_id gnl|my_center|LOCUS_05350 1809 1498 gene locus_tag LOCUS_05360 gene yidD 1809 1498 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051770.1 protein_id gnl|my_center|LOCUS_05360 2126 1806 gene locus_tag LOCUS_05370 2126 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2470 2336 gene locus_tag LOCUS_05380 gene rpmH 2470 2336 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051768.1 protein_id gnl|my_center|LOCUS_05380 2802 4547 gene locus_tag LOCUS_05390 gene dnaA 2802 4547 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 protein_id gnl|my_center|LOCUS_05390 4962 6086 gene locus_tag LOCUS_05400 gene dnaN 4962 6086 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 protein_id gnl|my_center|LOCUS_05400 6116 7378 gene locus_tag LOCUS_05410 6116 7378 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 protein_id gnl|my_center|LOCUS_05410 7375 7872 gene locus_tag LOCUS_05420 7375 7872 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815036.1 protein_id gnl|my_center|LOCUS_05420 8084 10204 gene locus_tag LOCUS_05430 gene gyrB 8084 10204 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815936.1 protein_id gnl|my_center|LOCUS_05430 10249 12966 gene locus_tag LOCUS_05440 gene gyrA 10249 12966 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 protein_id gnl|my_center|LOCUS_05440 13014 13697 gene locus_tag LOCUS_05450 13014 13697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence025 314 1207 gene locus_tag LOCUS_05460 314 1207 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 protein_id gnl|my_center|LOCUS_05460 1429 2322 gene locus_tag LOCUS_05470 1429 2322 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_05470 2503 4161 gene locus_tag LOCUS_05480 2503 4161 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015605.1 protein_id gnl|my_center|LOCUS_05480 4581 4171 gene locus_tag LOCUS_05490 4581 4171 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812258.1 protein_id gnl|my_center|LOCUS_05490 4771 6060 gene locus_tag LOCUS_05500 4771 6060 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055349.1 protein_id gnl|my_center|LOCUS_05500 6818 6267 gene locus_tag LOCUS_05510 6818 6267 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390315.1 protein_id gnl|my_center|LOCUS_05510 7758 6820 gene locus_tag LOCUS_05520 7758 6820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_05520 8425 7751 gene locus_tag LOCUS_05530 8425 7751 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053272.1 protein_id gnl|my_center|LOCUS_05530 9065 8412 gene locus_tag LOCUS_05540 9065 8412 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 protein_id gnl|my_center|LOCUS_05540 9719 9477 gene locus_tag LOCUS_05550 9719 9477 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051803.1 protein_id gnl|my_center|LOCUS_05550 10765 9956 gene locus_tag LOCUS_05560 gene nucS 10765 9956 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051476.1 protein_id gnl|my_center|LOCUS_05560 11149 10853 gene locus_tag LOCUS_05570 11149 10853 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_05570 12636 11152 gene locus_tag LOCUS_05580 gene atpD 12636 11152 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_05580 13595 12645 gene locus_tag LOCUS_05590 13595 12645 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 protein_id gnl|my_center|LOCUS_05590 <14323 13599 gene locus_tag LOCUS_05600 <14323 13599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051480.1:F0F1 ATP synthase subunit alpha >Feature sequence026 <1 1379 gene locus_tag LOCUS_05610 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390374.1:alpha-galactosidase 2685 1402 gene locus_tag LOCUS_05620 2685 1402 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 protein_id gnl|my_center|LOCUS_05620 2873 4195 gene locus_tag LOCUS_05630 2873 4195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_05630 4195 5154 gene locus_tag LOCUS_05640 4195 5154 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_05640 5156 6055 gene locus_tag LOCUS_05650 5156 6055 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_05650 6143 8053 gene locus_tag LOCUS_05660 6143 8053 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_05660 8216 10681 gene locus_tag LOCUS_05670 8216 10681 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_05670 11133 12398 gene locus_tag LOCUS_05680 gene ilvA 11133 12398 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 protein_id gnl|my_center|LOCUS_05680 12725 12477 gene locus_tag LOCUS_05690 12725 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 13752 13081 gene locus_tag LOCUS_05700 13752 13081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905030.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence027 2529 295 gene locus_tag LOCUS_05710 2529 295 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 protein_id gnl|my_center|LOCUS_05710 2802 3284 gene locus_tag LOCUS_05720 gene mraZ 2802 3284 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812311.1 protein_id gnl|my_center|LOCUS_05720 3296 4387 gene locus_tag LOCUS_05730 gene rsmH 3296 4387 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 protein_id gnl|my_center|LOCUS_05730 4384 4866 gene locus_tag LOCUS_05740 4384 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 protein_id gnl|my_center|LOCUS_05740 4863 6644 gene locus_tag LOCUS_05750 4863 6644 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052544.1 protein_id gnl|my_center|LOCUS_05750 6691 7572 gene locus_tag LOCUS_05760 6691 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389660.1 protein_id gnl|my_center|LOCUS_05760 7582 9108 gene locus_tag LOCUS_05770 7582 9108 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 protein_id gnl|my_center|LOCUS_05770 9183 10286 gene locus_tag LOCUS_05780 gene mraY 9183 10286 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 protein_id gnl|my_center|LOCUS_05780 10366 11805 gene locus_tag LOCUS_05790 gene murD 10366 11805 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389662.1 protein_id gnl|my_center|LOCUS_05790 11789 13012 gene locus_tag LOCUS_05800 11789 13012 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence028 1263 412 gene locus_tag LOCUS_05810 gene tsf 1263 412 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813341.1 protein_id gnl|my_center|LOCUS_05810 2175 1291 gene locus_tag LOCUS_05820 gene rpsB 2175 1291 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816510.1 protein_id gnl|my_center|LOCUS_05820 2868 2386 gene locus_tag LOCUS_05830 gene def 2868 2386 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115099.1 protein_id gnl|my_center|LOCUS_05830 4875 2872 gene locus_tag LOCUS_05840 4875 2872 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389965.1 protein_id gnl|my_center|LOCUS_05840 5447 4893 gene locus_tag LOCUS_05850 5447 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6771 5647 gene locus_tag LOCUS_05860 6771 5647 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813354.1 protein_id gnl|my_center|LOCUS_05860 6935 8185 gene locus_tag LOCUS_05870 6935 8185 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 protein_id gnl|my_center|LOCUS_05870 8392 9996 gene locus_tag LOCUS_05880 8392 9996 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389967.1 protein_id gnl|my_center|LOCUS_05880 11801 9966 gene locus_tag LOCUS_05890 11801 9966 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 protein_id gnl|my_center|LOCUS_05890 12577 11912 gene locus_tag LOCUS_05900 12577 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 <13636 12773 gene locus_tag LOCUS_05910 <13636 12773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068745.1:alpha-N-arabinofuranosidase >Feature sequence029 <1 569 gene locus_tag LOCUS_05920 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390091.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 616 1110 gene locus_tag LOCUS_05930 616 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1861 1142 gene locus_tag LOCUS_05940 1861 1142 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390090.1 protein_id gnl|my_center|LOCUS_05940 1962 4667 gene locus_tag LOCUS_05950 1962 4667 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052638.1 protein_id gnl|my_center|LOCUS_05950 4775 5380 gene locus_tag LOCUS_05960 gene pgsA 4775 5380 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058588.1 protein_id gnl|my_center|LOCUS_05960 5377 5946 gene locus_tag LOCUS_05970 5377 5946 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068035.1 protein_id gnl|my_center|LOCUS_05970 6113 6631 gene locus_tag LOCUS_05980 6113 6631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815448.1 protein_id gnl|my_center|LOCUS_05980 6881 7114 gene locus_tag LOCUS_05990 6881 7114 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 protein_id gnl|my_center|LOCUS_05990 7343 8497 gene locus_tag LOCUS_06000 gene recA 7343 8497 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_06000 9030 9455 gene locus_tag LOCUS_06010 9030 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 10054 10728 gene locus_tag LOCUS_06020 gene raiA 10054 10728 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052648.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence030 1534 1001 gene locus_tag LOCUS_06030 1534 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2463 1531 gene locus_tag LOCUS_06040 2463 1531 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 protein_id gnl|my_center|LOCUS_06040 3410 2460 gene locus_tag LOCUS_06050 3410 2460 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 protein_id gnl|my_center|LOCUS_06050 4349 3561 gene locus_tag LOCUS_06060 4349 3561 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 protein_id gnl|my_center|LOCUS_06060 4500 5144 gene locus_tag LOCUS_06070 4500 5144 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055622.1 protein_id gnl|my_center|LOCUS_06070 5314 5517 gene locus_tag LOCUS_06080 5314 5517 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 protein_id gnl|my_center|LOCUS_06080 5835 7454 gene locus_tag LOCUS_06090 gene groL 5835 7454 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812522.1 protein_id gnl|my_center|LOCUS_06090 7951 7658 gene locus_tag LOCUS_06100 7951 7658 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 protein_id gnl|my_center|LOCUS_06100 7994 8812 gene locus_tag LOCUS_06110 7994 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 8817 9575 gene locus_tag LOCUS_06120 8817 9575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 protein_id gnl|my_center|LOCUS_06120 9652 11520 gene locus_tag LOCUS_06130 9652 11520 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812532.1 protein_id gnl|my_center|LOCUS_06130 11607 11996 gene locus_tag LOCUS_06140 11607 11996 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_06140 12065 13051 gene locus_tag LOCUS_06150 12065 13051 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389721.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence031 <1 1682 gene locus_tag LOCUS_06160 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390132.1:beta-galactosidase 2436 1639 gene locus_tag LOCUS_06170 2436 1639 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814936.1 protein_id gnl|my_center|LOCUS_06170 2582 4228 gene locus_tag LOCUS_06180 2582 4228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 protein_id gnl|my_center|LOCUS_06180 4225 5208 gene locus_tag LOCUS_06190 4225 5208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 protein_id gnl|my_center|LOCUS_06190 5208 6242 gene locus_tag LOCUS_06200 5208 6242 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068324.1 protein_id gnl|my_center|LOCUS_06200 6245 7039 gene locus_tag LOCUS_06210 6245 7039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 protein_id gnl|my_center|LOCUS_06210 7026 7847 gene locus_tag LOCUS_06220 7026 7847 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783136.1 protein_id gnl|my_center|LOCUS_06220 8065 8430 gene locus_tag LOCUS_06230 8065 8430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357453.1 protein_id gnl|my_center|LOCUS_06230 8427 9287 gene locus_tag LOCUS_06240 8427 9287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366745.1 protein_id gnl|my_center|LOCUS_06240 9494 10246 gene locus_tag LOCUS_06250 9494 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 10338 12356 gene locus_tag LOCUS_06260 gene recQ 10338 12356 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_06260 12419 12901 gene locus_tag LOCUS_06270 12419 12901 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence032 166 1389 gene locus_tag LOCUS_06280 166 1389 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 protein_id gnl|my_center|LOCUS_06280 2498 1413 gene locus_tag LOCUS_06290 gene sepH 2498 1413 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 protein_id gnl|my_center|LOCUS_06290 2666 2959 gene locus_tag LOCUS_06300 2666 2959 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052669.1 protein_id gnl|my_center|LOCUS_06300 2959 3423 gene locus_tag LOCUS_06310 gene dut 2959 3423 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 protein_id gnl|my_center|LOCUS_06310 3506 5866 gene locus_tag LOCUS_06320 3506 5866 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390076.1 protein_id gnl|my_center|LOCUS_06320 7632 6019 gene locus_tag LOCUS_06330 7632 6019 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 protein_id gnl|my_center|LOCUS_06330 7720 9048 gene locus_tag LOCUS_06340 gene hisS 7720 9048 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812547.1 protein_id gnl|my_center|LOCUS_06340 9088 10890 gene locus_tag LOCUS_06350 gene aspS 9088 10890 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816387.1 protein_id gnl|my_center|LOCUS_06350 11036 11890 gene locus_tag LOCUS_06360 11036 11890 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162094060.1 protein_id gnl|my_center|LOCUS_06360 11913 12764 gene locus_tag LOCUS_06370 11913 12764 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363315.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence033 636 2762 gene locus_tag LOCUS_06380 636 2762 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068304.1 protein_id gnl|my_center|LOCUS_06380 4030 2759 gene locus_tag LOCUS_06390 gene purD 4030 2759 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051230.1 protein_id gnl|my_center|LOCUS_06390 5099 4050 gene locus_tag LOCUS_06400 gene purM 5099 4050 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_06400 6655 5138 gene locus_tag LOCUS_06410 gene purF 6655 5138 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390105.1 protein_id gnl|my_center|LOCUS_06410 10452 6673 gene locus_tag LOCUS_06420 10452 6673 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390101.1 protein_id gnl|my_center|LOCUS_06420 11284 10532 gene locus_tag LOCUS_06430 11284 10532 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994280.1 protein_id gnl|my_center|LOCUS_06430 <12422 11362 gene locus_tag LOCUS_06440 <12422 11362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053649.1:formate-dependent phosphoribosylglycinamide formyltransferase >Feature sequence034 <1 607 gene locus_tag LOCUS_06450 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970007.1:M20 family metallopeptidase 700 1896 gene locus_tag LOCUS_06460 700 1896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368095.1 protein_id gnl|my_center|LOCUS_06460 3668 2145 gene locus_tag LOCUS_06470 3668 2145 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 protein_id gnl|my_center|LOCUS_06470 5010 3718 gene locus_tag LOCUS_06480 5010 3718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 protein_id gnl|my_center|LOCUS_06480 6351 5272 gene locus_tag LOCUS_06490 6351 5272 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817320.1 protein_id gnl|my_center|LOCUS_06490 6742 6407 gene locus_tag LOCUS_06500 6742 6407 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112383.1 protein_id gnl|my_center|LOCUS_06500 6943 8460 gene locus_tag LOCUS_06510 6943 8460 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363202.1 protein_id gnl|my_center|LOCUS_06510 8447 9625 gene locus_tag LOCUS_06520 gene dusB 8447 9625 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 protein_id gnl|my_center|LOCUS_06520 9857 11029 gene locus_tag LOCUS_06530 gene ftsZ 9857 11029 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112391.1 protein_id gnl|my_center|LOCUS_06530 11048 11515 gene locus_tag LOCUS_06540 11048 11515 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812187.1 protein_id gnl|my_center|LOCUS_06540 11557 11841 gene locus_tag LOCUS_06550 11557 11841 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence035 258 1037 gene locus_tag LOCUS_06560 gene pstB 258 1037 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111995.1 protein_id gnl|my_center|LOCUS_06560 1106 2092 gene locus_tag LOCUS_06570 1106 2092 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068404.1 protein_id gnl|my_center|LOCUS_06570 2300 2097 gene locus_tag LOCUS_06580 2300 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2520 3920 gene locus_tag LOCUS_06590 2520 3920 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 protein_id gnl|my_center|LOCUS_06590 5537 4554 gene locus_tag LOCUS_06600 5537 4554 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 protein_id gnl|my_center|LOCUS_06600 6055 5711 gene locus_tag LOCUS_06610 gene trxA 6055 5711 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 protein_id gnl|my_center|LOCUS_06610 6227 6856 gene locus_tag LOCUS_06620 6227 6856 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363143.1 protein_id gnl|my_center|LOCUS_06620 6880 7737 gene locus_tag LOCUS_06630 6880 7737 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811981.1 protein_id gnl|my_center|LOCUS_06630 7734 8771 gene locus_tag LOCUS_06640 gene nudC 7734 8771 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 protein_id gnl|my_center|LOCUS_06640 8853 10457 gene locus_tag LOCUS_06650 8853 10457 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 protein_id gnl|my_center|LOCUS_06650 10497 10910 gene locus_tag LOCUS_06660 gene gcvH 10497 10910 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811987.1 protein_id gnl|my_center|LOCUS_06660 10921 12111 gene locus_tag LOCUS_06670 10921 12111 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811988.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence036 768 1349 gene locus_tag LOCUS_06680 gene dcd 768 1349 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814973.1 protein_id gnl|my_center|LOCUS_06680 1600 5658 gene locus_tag LOCUS_06690 1600 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5648 7096 gene locus_tag LOCUS_06700 5648 7096 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096978.1 protein_id gnl|my_center|LOCUS_06700 7087 8175 gene locus_tag LOCUS_06710 7087 8175 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_06710 8194 8964 gene locus_tag LOCUS_06720 8194 8964 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_06720 9079 10071 gene locus_tag LOCUS_06730 gene rlmB 9079 10071 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132439.1 protein_id gnl|my_center|LOCUS_06730 11854 10178 gene locus_tag LOCUS_06740 11854 10178 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068617.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence037 741 376 gene locus_tag LOCUS_06750 741 376 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113661.1 protein_id gnl|my_center|LOCUS_06750 2258 885 gene locus_tag LOCUS_06760 2258 885 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476263.1 protein_id gnl|my_center|LOCUS_06760 3991 2390 gene locus_tag LOCUS_06770 gene purH 3991 2390 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389934.1 protein_id gnl|my_center|LOCUS_06770 5420 4044 gene locus_tag LOCUS_06780 5420 4044 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052863.1 protein_id gnl|my_center|LOCUS_06780 6340 5417 gene locus_tag LOCUS_06790 gene sucD 6340 5417 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389936.1 protein_id gnl|my_center|LOCUS_06790 7551 6337 gene locus_tag LOCUS_06800 gene sucC 7551 6337 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389937.1 protein_id gnl|my_center|LOCUS_06800 8158 7574 gene locus_tag LOCUS_06810 8158 7574 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 protein_id gnl|my_center|LOCUS_06810 8887 8267 gene locus_tag LOCUS_06820 8887 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 10030 8954 gene locus_tag LOCUS_06830 gene ruvB 10030 8954 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 protein_id gnl|my_center|LOCUS_06830 10645 10034 gene locus_tag LOCUS_06840 gene ruvA 10645 10034 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817463.1 protein_id gnl|my_center|LOCUS_06840 11269 10688 gene locus_tag LOCUS_06850 gene ruvC 11269 10688 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813230.1 protein_id gnl|my_center|LOCUS_06850 <11801 11274 gene locus_tag LOCUS_06860 <11801 11274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052855.1:YebC/PmpR family DNA-binding transcriptional regulator >Feature sequence038 1230 10 gene locus_tag LOCUS_06870 gene metK 1230 10 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 protein_id gnl|my_center|LOCUS_06870 1577 1293 gene locus_tag LOCUS_06880 gene rpoZ 1577 1293 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812470.1 protein_id gnl|my_center|LOCUS_06880 1780 3615 gene locus_tag LOCUS_06890 gene ilvD 1780 3615 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 protein_id gnl|my_center|LOCUS_06890 4863 3709 gene locus_tag LOCUS_06900 4863 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5849 4863 gene locus_tag LOCUS_06910 5849 4863 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721732.1 protein_id gnl|my_center|LOCUS_06910 6686 6009 gene locus_tag LOCUS_06920 6686 6009 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_06920 9193 6767 gene locus_tag LOCUS_06930 9193 6767 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_06930 10300 9554 gene locus_tag LOCUS_06940 10300 9554 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991277.1 protein_id gnl|my_center|LOCUS_06940 11292 10387 gene locus_tag LOCUS_06950 11292 10387 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence039 <1 1326 gene locus_tag LOCUS_06960 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814786.1:energy-dependent translational throttle protein EttA 1366 2280 gene locus_tag LOCUS_06970 1366 2280 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 protein_id gnl|my_center|LOCUS_06970 2921 2364 gene locus_tag LOCUS_06980 2921 2364 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068792.1 protein_id gnl|my_center|LOCUS_06980 4000 2918 gene locus_tag LOCUS_06990 4000 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6197 4083 gene locus_tag LOCUS_07000 gene ftsH 6197 4083 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363794.1 protein_id gnl|my_center|LOCUS_07000 6529 6194 gene locus_tag LOCUS_07010 6529 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 6797 6483 gene locus_tag LOCUS_07020 6797 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 7893 6784 gene locus_tag LOCUS_07030 gene tilS 7893 6784 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_07030 9418 7913 gene locus_tag LOCUS_07040 9418 7913 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390179.1 protein_id gnl|my_center|LOCUS_07040 11082 9451 gene locus_tag LOCUS_07050 11082 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068786.1 protein_id gnl|my_center|LOCUS_07050 <11627 11079 gene locus_tag LOCUS_07060 <11627 11079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013582910.1:ABC transporter ATP-binding protein >Feature sequence040 <1 670 gene locus_tag LOCUS_07070 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051227.1:amino acid ABC transporter ATP-binding protein 1751 693 gene locus_tag LOCUS_07080 1751 693 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 protein_id gnl|my_center|LOCUS_07080 1766 1774 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3010 1925 gene locus_tag LOCUS_07090 3010 1925 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 protein_id gnl|my_center|LOCUS_07090 3497 2994 gene locus_tag LOCUS_07100 gene rbfA 3497 2994 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814603.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 6398 3627 gene locus_tag LOCUS_07110 gene infB 6398 3627 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068747.1 protein_id gnl|my_center|LOCUS_07110 7640 6582 gene locus_tag LOCUS_07120 gene nusA 7640 6582 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815687.1 protein_id gnl|my_center|LOCUS_07120 7781 8596 gene locus_tag LOCUS_07130 7781 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 9152 9063 gene locus_tag LOCUS_t00090 9152 9063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10200 9259 gene locus_tag LOCUS_07140 gene truA 10200 9259 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053050.1 protein_id gnl|my_center|LOCUS_07140 10944 10300 gene locus_tag LOCUS_07150 10944 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence041 730 446 gene locus_tag LOCUS_07160 730 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 501 518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2043 862 gene locus_tag LOCUS_07170 2043 862 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054004.1 protein_id gnl|my_center|LOCUS_07170 2892 2122 gene locus_tag LOCUS_07180 2892 2122 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_07180 3087 3866 gene locus_tag LOCUS_07190 3087 3866 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053236.1 protein_id gnl|my_center|LOCUS_07190 3991 4704 gene locus_tag LOCUS_07200 3991 4704 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732658.1 protein_id gnl|my_center|LOCUS_07200 5361 5966 gene locus_tag LOCUS_07210 5361 5966 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_07210 5988 8432 gene locus_tag LOCUS_07220 5988 8432 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 protein_id gnl|my_center|LOCUS_07220 9395 8847 gene locus_tag LOCUS_07230 9395 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07230 <11001 9392 gene locus_tag LOCUS_07240 <11001 9392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816398.1:ATP-dependent Clp protease ATP-binding subunit note possible pseudo, frameshifted 9406 9415 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence042 2341 671 gene locus_tag LOCUS_07250 2341 671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086124.1 protein_id gnl|my_center|LOCUS_07250 3306 2338 gene locus_tag LOCUS_07260 3306 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4292 3312 gene locus_tag LOCUS_07270 4292 3312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_07270 6031 4385 gene locus_tag LOCUS_07280 6031 4385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_07280 6365 7477 gene locus_tag LOCUS_07290 6365 7477 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_07290 9204 7558 gene locus_tag LOCUS_07300 9204 7558 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390158.1 protein_id gnl|my_center|LOCUS_07300 9269 9457 gene locus_tag LOCUS_07310 9269 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 9990 9454 gene locus_tag LOCUS_07320 9990 9454 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 protein_id gnl|my_center|LOCUS_07320 <10922 10037 gene locus_tag LOCUS_07330 <10922 10037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390361.1:DnaJ C-terminal domain-containing protein >Feature sequence043 414 3068 gene locus_tag LOCUS_07340 414 3068 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068207.1 protein_id gnl|my_center|LOCUS_07340 3777 3088 gene locus_tag LOCUS_07350 3777 3088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052073.1 protein_id gnl|my_center|LOCUS_07350 4722 4114 gene locus_tag LOCUS_07360 4722 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5530 5688 gene locus_tag LOCUS_07370 5530 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 6178 6378 gene locus_tag LOCUS_07380 6178 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 6332 6523 gene locus_tag LOCUS_07390 6332 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 8129 7146 gene locus_tag LOCUS_07400 8129 7146 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_07400 9218 8184 gene locus_tag LOCUS_07410 9218 8184 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947091.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence044 284 1690 gene locus_tag LOCUS_07420 284 1690 CDS product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 protein_id gnl|my_center|LOCUS_07420 2207 1743 gene locus_tag LOCUS_07430 2207 1743 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117689.1 protein_id gnl|my_center|LOCUS_07430 2167 2319 gene locus_tag LOCUS_07440 2167 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2462 4261 gene locus_tag LOCUS_07450 2462 4261 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947071.1 protein_id gnl|my_center|LOCUS_07450 5242 4388 gene locus_tag LOCUS_07460 5242 4388 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722957.1 protein_id gnl|my_center|LOCUS_07460 6402 6893 gene locus_tag LOCUS_07470 6402 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 9133 7040 gene locus_tag LOCUS_07480 9133 7040 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence045 274 348 gene locus_tag LOCUS_t00100 274 348 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 871 494 gene locus_tag LOCUS_07490 871 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1713 2162 gene locus_tag LOCUS_07500 1713 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2168 2473 gene locus_tag LOCUS_07510 2168 2473 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935998.1 protein_id gnl|my_center|LOCUS_07510 2470 3876 gene locus_tag LOCUS_07520 2470 3876 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162861356.1 protein_id gnl|my_center|LOCUS_07520 4125 4856 gene locus_tag LOCUS_07530 4125 4856 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994124.1 protein_id gnl|my_center|LOCUS_07530 5175 6425 gene locus_tag LOCUS_07540 5175 6425 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_07540 6535 7554 gene locus_tag LOCUS_07550 6535 7554 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 protein_id gnl|my_center|LOCUS_07550 7796 8608 gene locus_tag LOCUS_07560 7796 8608 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389501.1 protein_id gnl|my_center|LOCUS_07560 8675 9490 gene locus_tag LOCUS_07570 8675 9490 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582957.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence046 1217 279 gene locus_tag LOCUS_07580 1217 279 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 protein_id gnl|my_center|LOCUS_07580 2601 1288 gene locus_tag LOCUS_07590 gene clpX 2601 1288 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 protein_id gnl|my_center|LOCUS_07590 3414 2746 gene locus_tag LOCUS_07600 3414 2746 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 protein_id gnl|my_center|LOCUS_07600 4041 3424 gene locus_tag LOCUS_07610 4041 3424 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112615.1 protein_id gnl|my_center|LOCUS_07610 5567 4191 gene locus_tag LOCUS_07620 gene tig 5567 4191 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390065.1 protein_id gnl|my_center|LOCUS_07620 6903 5617 gene locus_tag LOCUS_07630 6903 5617 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390066.1 protein_id gnl|my_center|LOCUS_07630 8036 7155 gene locus_tag LOCUS_07640 gene pflA 8036 7155 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390067.1 protein_id gnl|my_center|LOCUS_07640 <8997 8135 gene locus_tag LOCUS_07650 <8997 8135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004112605.1:formate C-acetyltransferase >Feature sequence047 1211 240 gene locus_tag LOCUS_07660 1211 240 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_07660 1610 2260 gene locus_tag LOCUS_07670 1610 2260 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710135.1 protein_id gnl|my_center|LOCUS_07670 2446 3129 gene locus_tag LOCUS_07680 2446 3129 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_07680 3237 3310 gene locus_tag LOCUS_t00110 3237 3310 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4709 3522 gene locus_tag LOCUS_07690 4709 3522 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_07690 8770 5108 gene locus_tag LOCUS_07700 8770 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence048 <1 1313 gene locus_tag LOCUS_07710 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783044.1:serine/threonine-protein kinase 1375 2298 gene locus_tag LOCUS_07720 1375 2298 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 protein_id gnl|my_center|LOCUS_07720 2409 2483 gene locus_tag LOCUS_t00120 2409 2483 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2899 4308 gene locus_tag LOCUS_07730 2899 4308 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068603.1 protein_id gnl|my_center|LOCUS_07730 4341 5222 gene locus_tag LOCUS_07740 gene rsmA 4341 5222 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068602.1 protein_id gnl|my_center|LOCUS_07740 5219 6139 gene locus_tag LOCUS_07750 5219 6139 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051793.1 protein_id gnl|my_center|LOCUS_07750 6150 6764 gene locus_tag LOCUS_07760 6150 6764 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815003.1 protein_id gnl|my_center|LOCUS_07760 8086 6860 gene locus_tag LOCUS_07770 8086 6860 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 8134 8143 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence049 3759 3091 gene locus_tag LOCUS_07780 3759 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4815 3790 gene locus_tag LOCUS_07790 4815 3790 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053737.1 protein_id gnl|my_center|LOCUS_07790 4961 5560 gene locus_tag LOCUS_07800 4961 5560 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389580.1 protein_id gnl|my_center|LOCUS_07800 6940 5576 gene locus_tag LOCUS_07810 6940 5576 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_07810 7223 6951 gene locus_tag LOCUS_07820 7223 6951 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_07820 8595 7333 gene locus_tag LOCUS_07830 gene galK 8595 7333 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence050 261 584 gene locus_tag LOCUS_07840 261 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 782 540 gene locus_tag LOCUS_07850 782 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 1000 779 gene locus_tag LOCUS_07860 1000 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 1520 1071 gene locus_tag LOCUS_07870 1520 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 1895 1530 gene locus_tag LOCUS_07880 1895 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 3466 2090 gene locus_tag LOCUS_07890 3466 2090 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363634.1 protein_id gnl|my_center|LOCUS_07890 3677 4573 gene locus_tag LOCUS_07900 3677 4573 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 protein_id gnl|my_center|LOCUS_07900 5065 5793 gene locus_tag LOCUS_07910 5065 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5793 7379 gene locus_tag LOCUS_07920 5793 7379 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence051 1725 931 gene locus_tag LOCUS_07930 1725 931 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812239.1 protein_id gnl|my_center|LOCUS_07930 2451 1729 gene locus_tag LOCUS_07940 gene recO 2451 1729 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_07940 4119 2467 gene locus_tag LOCUS_07950 4119 2467 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 protein_id gnl|my_center|LOCUS_07950 5450 4221 gene locus_tag LOCUS_07960 gene ispG 5450 4221 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 protein_id gnl|my_center|LOCUS_07960 6730 5447 gene locus_tag LOCUS_07970 gene dxr 6730 5447 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053294.1 protein_id gnl|my_center|LOCUS_07970 8404 6743 gene locus_tag LOCUS_07980 8404 6743 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence052 306 890 gene locus_tag LOCUS_07990 306 890 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_07990 887 3148 gene locus_tag LOCUS_08000 887 3148 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390263.1 protein_id gnl|my_center|LOCUS_08000 3239 4108 gene locus_tag LOCUS_08010 3239 4108 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814383.1 protein_id gnl|my_center|LOCUS_08010 4105 5088 gene locus_tag LOCUS_08020 4105 5088 CDS product polyphenol oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068427.1 protein_id gnl|my_center|LOCUS_08020 5209 6000 gene locus_tag LOCUS_08030 5209 6000 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068426.1 protein_id gnl|my_center|LOCUS_08030 6023 6742 gene locus_tag LOCUS_08040 6023 6742 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence053 175 1680 gene locus_tag LOCUS_08050 175 1680 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994095.1 protein_id gnl|my_center|LOCUS_08050 5517 1789 gene locus_tag LOCUS_08060 5517 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 8285 5532 gene locus_tag LOCUS_08070 8285 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence054 1789 962 gene locus_tag LOCUS_08080 1789 962 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_08080 4367 1866 gene locus_tag LOCUS_08090 4367 1866 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_08090 4782 5684 gene locus_tag LOCUS_08100 4782 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5705 7177 gene locus_tag LOCUS_08110 5705 7177 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence055 849 454 gene locus_tag LOCUS_08120 849 454 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_08120 2798 927 gene locus_tag LOCUS_08130 2798 927 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819456.1 protein_id gnl|my_center|LOCUS_08130 3049 3846 gene locus_tag LOCUS_08140 3049 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3846 4664 gene locus_tag LOCUS_08150 3846 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4661 5509 gene locus_tag LOCUS_08160 4661 5509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 protein_id gnl|my_center|LOCUS_08160 5506 6324 gene locus_tag LOCUS_08170 5506 6324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922273.1 protein_id gnl|my_center|LOCUS_08170 6359 7282 gene locus_tag LOCUS_08180 gene rihC 6359 7282 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence056 <1 880 gene locus_tag LOCUS_08190 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814621.1:phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) 941 2047 gene locus_tag LOCUS_08200 941 2047 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390211.1 protein_id gnl|my_center|LOCUS_08200 2153 2851 gene locus_tag LOCUS_08210 gene rpiA 2153 2851 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814612.1 protein_id gnl|my_center|LOCUS_08210 3793 3143 gene locus_tag LOCUS_08220 3793 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 protein_id gnl|my_center|LOCUS_08220 3884 5293 gene locus_tag LOCUS_08230 gene radA 3884 5293 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 protein_id gnl|my_center|LOCUS_08230 5418 6281 gene locus_tag LOCUS_08240 5418 6281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence057 1650 367 gene locus_tag LOCUS_08250 gene galT 1650 367 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363154.1 protein_id gnl|my_center|LOCUS_08250 2533 1733 gene locus_tag LOCUS_08260 2533 1733 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 protein_id gnl|my_center|LOCUS_08260 3559 2810 gene locus_tag LOCUS_08270 3559 2810 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 protein_id gnl|my_center|LOCUS_08270 4923 3562 gene locus_tag LOCUS_08280 4923 3562 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389578.1 protein_id gnl|my_center|LOCUS_08280 <6874 5057 gene locus_tag LOCUS_08290 <6874 5057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399464.1:transglycosylase domain-containing protein >Feature sequence058 23 664 gene locus_tag LOCUS_08300 23 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 669 1679 gene locus_tag LOCUS_08310 669 1679 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973334.1 protein_id gnl|my_center|LOCUS_08310 2833 1703 gene locus_tag LOCUS_08320 2833 1703 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_08320 3808 2927 gene locus_tag LOCUS_08330 3808 2927 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803807.1 protein_id gnl|my_center|LOCUS_08330 4764 3829 gene locus_tag LOCUS_08340 4764 3829 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803806.1 protein_id gnl|my_center|LOCUS_08340 6106 4796 gene locus_tag LOCUS_08350 6106 4796 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803805.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence059 872 351 gene locus_tag LOCUS_08360 gene rplJ 872 351 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112001.1 protein_id gnl|my_center|LOCUS_08360 3804 1099 gene locus_tag LOCUS_08370 3804 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4752 3859 gene locus_tag LOCUS_08380 4752 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5655 4756 gene locus_tag LOCUS_08390 5655 4756 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_08390 5674 5683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence060 <1 758 gene locus_tag LOCUS_08400 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389710.1:alpha/beta hydrolase 831 2276 gene locus_tag LOCUS_08410 gene purB 831 2276 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816427.1 protein_id gnl|my_center|LOCUS_08410 2279 4750 gene locus_tag LOCUS_08420 2279 4750 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389709.1 protein_id gnl|my_center|LOCUS_08420 4920 5207 gene locus_tag LOCUS_08430 4920 5207 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112617.1 protein_id gnl|my_center|LOCUS_08430 <6429 5307 gene locus_tag LOCUS_08440 <6429 5307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389708.1:Pup--protein ligase >Feature sequence061 594 1613 gene locus_tag LOCUS_08450 gene trpD 594 1613 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 protein_id gnl|my_center|LOCUS_08450 2242 1697 gene locus_tag LOCUS_08460 2242 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 protein_id gnl|my_center|LOCUS_08460 2291 2980 gene locus_tag LOCUS_08470 2291 2980 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390082.1 protein_id gnl|my_center|LOCUS_08470 5230 2993 gene locus_tag LOCUS_08480 5230 2993 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068042.1 protein_id gnl|my_center|LOCUS_08480 <6364 5223 gene locus_tag LOCUS_08490 <6364 5223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007055156.1:polyprenyl synthetase family protein >Feature sequence062 91 3996 gene locus_tag LOCUS_08500 91 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6278 4050 gene locus_tag LOCUS_08510 6278 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence063 2272 755 gene locus_tag LOCUS_08520 2272 755 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053003.1 protein_id gnl|my_center|LOCUS_08520 4067 2532 gene locus_tag LOCUS_08530 4067 2532 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_08530 5662 4121 gene locus_tag LOCUS_08540 5662 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence064 1442 348 gene locus_tag LOCUS_08550 1442 348 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143567.1 protein_id gnl|my_center|LOCUS_08550 1693 2370 gene locus_tag LOCUS_08560 gene sdaAB 1693 2370 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646512.1 protein_id gnl|my_center|LOCUS_08560 2505 3257 gene locus_tag LOCUS_08570 gene sdaAA 2505 3257 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703459.1 protein_id gnl|my_center|LOCUS_08570 3295 4617 gene locus_tag LOCUS_08580 3295 4617 CDS product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642044.1 protein_id gnl|my_center|LOCUS_08580 4728 6014 gene locus_tag LOCUS_08590 gene serS 4728 6014 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574367.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence065 <1 607 gene locus_tag LOCUS_08600 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017143234.1:ABC transporter permease subunit 628 1980 gene locus_tag LOCUS_08610 628 1980 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389555.1 protein_id gnl|my_center|LOCUS_08610 2218 2628 gene locus_tag LOCUS_08620 2218 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2625 3005 gene locus_tag LOCUS_08630 2625 3005 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 protein_id gnl|my_center|LOCUS_08630 4046 3039 gene locus_tag LOCUS_08640 4046 3039 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 protein_id gnl|my_center|LOCUS_08640 4950 4168 gene locus_tag LOCUS_08650 4950 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5826 5026 gene locus_tag LOCUS_08660 5826 5026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389401.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence066 244 2469 gene locus_tag LOCUS_08670 244 2469 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068664.1 protein_id gnl|my_center|LOCUS_08670 2466 3548 gene locus_tag LOCUS_08680 2466 3548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068665.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence067 2377 3687 gene locus_tag LOCUS_08690 gene xseA 2377 3687 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 protein_id gnl|my_center|LOCUS_08690 3771 4106 gene locus_tag LOCUS_08700 3771 4106 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 protein_id gnl|my_center|LOCUS_08700 5140 4115 gene locus_tag LOCUS_08710 5140 4115 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389605.1 protein_id gnl|my_center|LOCUS_08710 5335 5408 gene locus_tag LOCUS_t00130 5335 5408 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5803 5369 gene locus_tag LOCUS_08720 5803 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence068 3 500 gene locus_tag LOCUS_08730 3 500 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054369.1 protein_id gnl|my_center|LOCUS_08730 1517 2461 gene locus_tag LOCUS_08740 1517 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2490 3467 gene locus_tag LOCUS_08750 2490 3467 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816492.1 protein_id gnl|my_center|LOCUS_08750 3464 4066 gene locus_tag LOCUS_08760 gene tsaE 3464 4066 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 protein_id gnl|my_center|LOCUS_08760 4063 4851 gene locus_tag LOCUS_08770 gene tsaB 4063 4851 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 protein_id gnl|my_center|LOCUS_08770 4848 5360 gene locus_tag LOCUS_08780 gene rimI 4848 5360 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783284.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence069 232 402 gene locus_tag LOCUS_08790 232 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2424 766 gene locus_tag LOCUS_08800 2424 766 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_08800 2574 3503 gene locus_tag LOCUS_08810 gene rsmI 2574 3503 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783206.1 protein_id gnl|my_center|LOCUS_08810 3775 3467 gene locus_tag LOCUS_08820 3775 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 4548 3937 gene locus_tag LOCUS_08830 4548 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052934.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence070 312 1211 gene locus_tag LOCUS_08840 312 1211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013802.1 protein_id gnl|my_center|LOCUS_08840 1390 2361 gene locus_tag LOCUS_08850 1390 2361 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_08850 3162 2572 gene locus_tag LOCUS_08860 3162 2572 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_08860 4780 3143 gene locus_tag LOCUS_08870 gene trpE 4780 3143 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence071 310 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 702 1697 gene locus_tag LOCUS_08880 702 1697 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_08880 1851 3317 gene locus_tag LOCUS_08890 1851 3317 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 protein_id gnl|my_center|LOCUS_08890 3310 4278 gene locus_tag LOCUS_08900 3310 4278 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230703.1 protein_id gnl|my_center|LOCUS_08900 5469 4378 gene locus_tag LOCUS_08910 5469 4378 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence072 886 2550 gene locus_tag LOCUS_08920 886 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2309 2404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2519 2890 gene locus_tag LOCUS_08930 2519 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3603 3268 gene locus_tag LOCUS_08940 3603 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08940 4055 3861 gene locus_tag LOCUS_08950 4055 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 <5662 4330 gene locus_tag LOCUS_08960 <5662 4330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389613.1:ABC transporter ATP-binding protein >Feature sequence073 1239 550 gene locus_tag LOCUS_08970 1239 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08970 1748 1239 gene locus_tag LOCUS_08980 gene coaD 1748 1239 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051410.1 protein_id gnl|my_center|LOCUS_08980 1811 2122 gene locus_tag LOCUS_08990 1811 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3167 2148 gene locus_tag LOCUS_09000 3167 2148 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051408.1 protein_id gnl|my_center|LOCUS_09000 4513 3167 gene locus_tag LOCUS_09010 4513 3167 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 protein_id gnl|my_center|LOCUS_09010 4542 5258 gene locus_tag LOCUS_09020 4542 5258 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence074 402 1466 gene locus_tag LOCUS_09030 gene fbaA 402 1466 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 protein_id gnl|my_center|LOCUS_09030 1895 2317 gene locus_tag LOCUS_09040 1895 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2460 3761 gene locus_tag LOCUS_09050 2460 3761 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114149.1 protein_id gnl|my_center|LOCUS_09050 3771 4739 gene locus_tag LOCUS_09060 3771 4739 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740908.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence075 128 1486 gene locus_tag LOCUS_09070 gene alr 128 1486 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813965.1 protein_id gnl|my_center|LOCUS_09070 1557 2015 gene locus_tag LOCUS_09080 1557 2015 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_09080 2034 3317 gene locus_tag LOCUS_09090 2034 3317 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence076 132 725 gene locus_tag LOCUS_09100 132 725 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051922.1 protein_id gnl|my_center|LOCUS_09100 1063 878 gene locus_tag LOCUS_09110 1063 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 2321 1056 gene locus_tag LOCUS_09120 gene pyk 2321 1056 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 protein_id gnl|my_center|LOCUS_09120 3455 2433 gene locus_tag LOCUS_09130 3455 2433 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 protein_id gnl|my_center|LOCUS_09130 <4790 3605 gene locus_tag LOCUS_09140 <4790 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389776.1:excinuclease ABC subunit UvrB >Feature sequence077 745 672 gene locus_tag LOCUS_t00140 745 672 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 956 1141 gene locus_tag LOCUS_09150 956 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 <4675 1717 gene locus_tag LOCUS_09160 <4675 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390269.1:type I polyketide synthase >Feature sequence078 826 371 gene locus_tag LOCUS_09170 826 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1790 846 gene locus_tag LOCUS_09180 1790 846 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_09180 2718 1792 gene locus_tag LOCUS_09190 2718 1792 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_09190 3974 2715 gene locus_tag LOCUS_09200 3974 2715 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence079 3 389 gene locus_tag LOCUS_09210 3 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 394 1008 gene locus_tag LOCUS_09220 394 1008 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 protein_id gnl|my_center|LOCUS_09220 1001 1957 gene locus_tag LOCUS_09230 1001 1957 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729941.1 protein_id gnl|my_center|LOCUS_09230 1959 2291 gene locus_tag LOCUS_09240 1959 2291 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 protein_id gnl|my_center|LOCUS_09240 2296 3129 gene locus_tag LOCUS_09250 2296 3129 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993988.1 protein_id gnl|my_center|LOCUS_09250 3136 3579 gene locus_tag LOCUS_09260 3136 3579 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821296.1 protein_id gnl|my_center|LOCUS_09260 3594 4190 gene locus_tag LOCUS_09270 3594 4190 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821294.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence080 <1 1149 gene locus_tag LOCUS_09280 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389794.1:ABC transporter permease 1271 1843 gene locus_tag LOCUS_09290 1271 1843 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_09290 3213 1933 gene locus_tag LOCUS_09300 3213 1933 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111709.1 protein_id gnl|my_center|LOCUS_09300 3896 3210 gene locus_tag LOCUS_09310 3896 3210 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389464.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence081 695 606 gene locus_tag LOCUS_t00150 695 606 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 924 2195 gene locus_tag LOCUS_09320 gene dinB 924 2195 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 protein_id gnl|my_center|LOCUS_09320 3345 2179 gene locus_tag LOCUS_09330 gene dapC 3345 2179 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390233.1 protein_id gnl|my_center|LOCUS_09330 3733 3416 gene locus_tag LOCUS_09340 3733 3416 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814463.1 protein_id gnl|my_center|LOCUS_09340 <4387 3790 gene locus_tag LOCUS_09350 <4387 3790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007053015.1:amino acid permease >Feature sequence082 <1 1092 gene locus_tag LOCUS_09360 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390022.1:acetylornithine transaminase 1147 2121 gene locus_tag LOCUS_09370 gene argF 1147 2121 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 protein_id gnl|my_center|LOCUS_09370 2121 2657 gene locus_tag LOCUS_09380 2121 2657 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068276.1 protein_id gnl|my_center|LOCUS_09380 2654 3952 gene locus_tag LOCUS_09390 2654 3952 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813515.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence083 1468 677 gene locus_tag LOCUS_09400 1468 677 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111884.1 protein_id gnl|my_center|LOCUS_09400 2833 1550 gene locus_tag LOCUS_09410 2833 1550 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399559.1 protein_id gnl|my_center|LOCUS_09410 2984 4039 gene locus_tag LOCUS_09420 2984 4039 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111881.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence084 551 3316 gene locus_tag LOCUS_09430 gene adhE 551 3316 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 protein_id gnl|my_center|LOCUS_09430 3604 3912 gene locus_tag LOCUS_09440 gene rpsJ 3604 3912 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808013.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence085 <1 897 gene locus_tag LOCUS_09450 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811990.1:3-isopropylmalate dehydrogenase 1555 1842 gene locus_tag LOCUS_09460 1555 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1839 3071 gene locus_tag LOCUS_09470 1839 3071 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 protein_id gnl|my_center|LOCUS_09470 3196 3915 gene locus_tag LOCUS_09480 3196 3915 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811992.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence086 <1 689 gene locus_tag LOCUS_09490 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein 682 1353 gene locus_tag LOCUS_09500 682 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1529 2578 gene locus_tag LOCUS_09510 1529 2578 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 protein_id gnl|my_center|LOCUS_09510 3909 2542 gene locus_tag LOCUS_09520 3909 2542 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_09520 4103 3906 gene locus_tag LOCUS_09530 4103 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence087 121 1098 gene locus_tag LOCUS_09540 gene msrB 121 1098 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 protein_id gnl|my_center|LOCUS_09540 1245 3134 gene locus_tag LOCUS_09550 gene asnB 1245 3134 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence088 641 2581 gene locus_tag LOCUS_09560 641 2581 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054814.1 protein_id gnl|my_center|LOCUS_09560 2596 3150 gene locus_tag LOCUS_09570 gene ilvN 2596 3150 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_09570 3181 3840 gene locus_tag LOCUS_09580 3181 3840 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence089 124 51 gene locus_tag LOCUS_t00160 124 51 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 235 161 gene locus_tag LOCUS_t00170 235 161 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 340 948 gene locus_tag LOCUS_09590 340 948 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054570.1 protein_id gnl|my_center|LOCUS_09590 1428 2195 gene locus_tag LOCUS_09600 1428 2195 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_09600 3522 2299 gene locus_tag LOCUS_09610 3522 2299 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390061.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence090 407 1948 gene locus_tag LOCUS_09620 407 1948 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_09620 2001 3536 gene locus_tag LOCUS_09630 2001 3536 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence091 1983 577 gene locus_tag LOCUS_09640 gene uxaC 1983 577 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303177.1 protein_id gnl|my_center|LOCUS_09640 3204 2173 gene locus_tag LOCUS_09650 3204 2173 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168512796.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence092 511 1875 gene locus_tag LOCUS_09660 511 1875 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence093 3320 1935 gene locus_tag LOCUS_09670 3320 1935 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740565.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence094 <1 2573 gene locus_tag LOCUS_09680 <1 2573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390389.1:lipid II flippase MurJ >Feature sequence095 <1 2148 gene locus_tag LOCUS_09690 <1 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109240.1:DUF5107 domain-containing protein >Feature sequence096 1975 404 gene locus_tag LOCUS_09700 1975 404 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 protein_id gnl|my_center|LOCUS_09700 <3372 2003 gene locus_tag LOCUS_09710 <3372 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820794.1:arginine--tRNA ligase >Feature sequence097 1096 44 gene locus_tag LOCUS_09720 gene thrB 1096 44 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811687.1 protein_id gnl|my_center|LOCUS_09720 2427 1096 gene locus_tag LOCUS_09730 2427 1096 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389478.1 protein_id gnl|my_center|LOCUS_09730 2059 2068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3285 2538 gene locus_tag LOCUS_09740 <3285 2538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389477.1:diaminopimelate decarboxylase >Feature sequence098 <1 1928 gene locus_tag LOCUS_09750 <1 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389778.1:DNA polymerase I 1977 2894 gene locus_tag LOCUS_09760 1977 2894 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582492.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence099 <1 1298 gene locus_tag LOCUS_09770 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013399464.1:transglycosylase domain-containing protein 1319 2794 gene locus_tag LOCUS_09780 1319 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence100 1315 86 gene locus_tag LOCUS_09790 1315 86 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 protein_id gnl|my_center|LOCUS_09790 1599 1312 gene locus_tag LOCUS_09800 1599 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1654 1887 gene locus_tag LOCUS_09810 1654 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 <3121 2314 gene locus_tag LOCUS_09820 <3121 2314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811990.1:3-isopropylmalate dehydrogenase >Feature sequence101 197 865 gene locus_tag LOCUS_09830 197 865 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055085.1 protein_id gnl|my_center|LOCUS_09830 958 1389 gene locus_tag LOCUS_09840 958 1389 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 protein_id gnl|my_center|LOCUS_09840 1389 1628 gene locus_tag LOCUS_09850 1389 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence102 2541 1789 gene locus_tag LOCUS_09860 2541 1789 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389633.1 protein_id gnl|my_center|LOCUS_09860 <3072 2551 gene locus_tag LOCUS_09870 <3072 2551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004114934.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence103 1039 431 gene locus_tag LOCUS_09880 1039 431 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054040.1 protein_id gnl|my_center|LOCUS_09880 1111 1998 gene locus_tag LOCUS_09890 1111 1998 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389617.1 protein_id gnl|my_center|LOCUS_09890 2303 2064 gene locus_tag LOCUS_09900 2303 2064 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804752.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence104 <2997 374 gene locus_tag LOCUS_09910 <2997 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390389.1:lipid II flippase MurJ >Feature sequence105 >Feature sequence106 1 318 gene locus_tag LOCUS_09920 1 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2291 402 gene locus_tag LOCUS_09930 2291 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence107 811 2169 gene locus_tag LOCUS_09940 gene glpT 811 2169 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948741.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence108 2279 84 gene locus_tag LOCUS_09950 2279 84 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389703.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence109 113 2326 gene locus_tag LOCUS_09960 113 2326 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence110 <1 675 gene locus_tag LOCUS_09970 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390284.1:valine--tRNA ligase >Feature sequence111 209 436 gene locus_tag LOCUS_09980 209 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 470 1162 gene locus_tag LOCUS_09990 470 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 920 929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1104 1361 gene locus_tag LOCUS_10000 1104 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10000 1530 1539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1621 2268 gene locus_tag LOCUS_10010 1621 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10010 >Feature sequence112 <1 1210 gene locus_tag LOCUS_10020 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051791.1:CCA tRNA nucleotidyltransferase <2253 1320 gene locus_tag LOCUS_10030 <2253 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941906.1:choice-of-anchor D domain-containing protein >Feature sequence113 <1 899 gene locus_tag LOCUS_10040 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390353.1:methionine--tRNA ligase >Feature sequence114 1294 170 gene locus_tag LOCUS_10050 1294 170 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_10050 1418 1491 gene locus_tag LOCUS_t00180 1418 1491 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1531 1612 gene locus_tag LOCUS_t00190 1531 1612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 1772 1781 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence116 <1 1946 gene locus_tag LOCUS_10060 <1 1946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173361541.1:DUF6049 family protein >Feature sequence117 <1760 667 gene locus_tag LOCUS_10070 <1760 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054128.1:glycoside hydrolase family 43 protein >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 2 1456 gene locus_tag LOCUS_10080 2 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence122 >Feature sequence123 >Feature sequence124 <1 1348 gene locus_tag LOCUS_10090 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052863.1:DUF6350 family protein >Feature sequence125 >Feature sequence126 <1 525 gene locus_tag LOCUS_10100 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051227.1:amino acid ABC transporter ATP-binding protein <1227 547 gene locus_tag LOCUS_10110 <1227 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003823255.1:riboflavin kinase >Feature sequence127 >Feature sequence128 <1 705 gene locus_tag LOCUS_10120 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390053.1:FtsX-like permease family protein >Feature sequence129 389 889 gene locus_tag LOCUS_10130 389 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 654 663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence130 334 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 576 585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence131 504 43 gene locus_tag LOCUS_10140 504 43 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence132 >Feature sequence133 <1 702 gene locus_tag LOCUS_10150 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027779.1:polyprenol monophosphomannose synthase >Feature sequence134 832 47 gene locus_tag LOCUS_10160 gene murI 832 47 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053283.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence135 >Feature sequence136 >Feature sequence137 <1 703 gene locus_tag LOCUS_10170 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390353.1:methionine--tRNA ligase >Feature sequence138 105 893 gene locus_tag LOCUS_10180 105 893 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053184.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence139 >Feature sequence140 >Feature sequence141 <803 169 gene locus_tag LOCUS_10190 <803 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776146.1:mannose-1-phosphate guanylyltransferase >Feature sequence142 <1 763 gene locus_tag LOCUS_10200 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068355.1:NAD(+) diphosphatase >Feature sequence143 >Feature sequence144 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 >Feature sequence149 307 236 gene locus_tag LOCUS_t00200 307 236 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 382 308 gene locus_tag LOCUS_t00210 382 308 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 621 549 gene locus_tag LOCUS_t00220 621 549 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 347 356 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence151 >Feature sequence152 >Feature sequence153 266 54 gene locus_tag LOCUS_10210 266 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 643 215 gene locus_tag LOCUS_10220 643 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 288 296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence154 >Feature sequence155 >Feature sequence156 >Feature sequence157 >Feature sequence158 >Feature sequence159 <617 6 gene locus_tag LOCUS_10230 <617 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052919.1:ABC transporter ATP-binding protein >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 >Feature sequence164 >Feature sequence165 >Feature sequence166 >Feature sequence167 283 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 348 533 gene locus_tag LOCUS_10240 348 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10240 >Feature sequence168 >Feature sequence169 >Feature sequence170 >Feature sequence171 >Feature sequence172 257 421 gene locus_tag LOCUS_10250 257 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence173 >Feature sequence174 <1 514 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcatccgcggggatgatcc >Feature sequence175 >Feature sequence176 >Feature sequence177 285 294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 <1 524 gene locus_tag LOCUS_10260 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068603.1:G5 domain-containing protein >Feature sequence179 >Feature sequence180 >Feature sequence181 >Feature sequence182 >Feature sequence183 >Feature sequence184 >Feature sequence185 >Feature sequence186 >Feature sequence187 >Feature sequence188 22 471 gene locus_tag LOCUS_10270 22 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence189