COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..77535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(759..1061) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene rplW CDS complement(1061..1675) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene rplD CDS complement(1690..2319) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene rplC CDS complement(2346..2654) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rpsJ CDS complement(2900..3865) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS complement(3959..5344) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene glmU CDS complement(5378..6214) product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene purR CDS complement(6352..6594) product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(6672..7559) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene rsmA CDS complement(7549..8112) product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene rnmV CDS complement(8096..8869) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(8869..10857) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene metG assembly_gap 9359..9368 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(10972..13671) product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene mgtA CDS complement(13991..14560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(14557..15030) product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(15052..16071) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene trpS tRNA 16222..16294 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(16325..16987) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 17110..17424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(17749..19050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(19047..19355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(19380..19622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 19754..20455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 20456..21256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 21258..21896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(22007..22468) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene greA CDS 22454..23104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 23085..24533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 24584..25894 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(26040..27989) product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(28104..29324) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(29427..30140) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene nrdG CDS complement(30165..32354) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene nrdD CDS complement(32578..32895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(33076..33789) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(33808..35643) product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene glpO CDS complement(35646..37166) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene glpK CDS complement(37294..38709) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905175.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(38703..40019) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922251.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(40219..41478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(41496..43445) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene asnB CDS complement(43511..44902) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(44955..45437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(45523..45999) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 46148..46948 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 47136..48056 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 48191..48805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 48802..49575 product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 49679..50542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 50895..51554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(51664..53241) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(53547..53945) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(54038..55198) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene nagA CDS 55286..58240 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(58323..59072) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(59084..60169) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(60189..60857) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(60882..61964) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 62198..63637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 64075..64470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 64472..65092 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 65199..65678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(65715..65885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(65968..66252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(66341..67111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(67631..68494) product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(68808..69554) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(69547..70287) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(70294..71199) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(71192..72340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(72513..72638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 73302..73619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 note possible pseudo, frameshifted CDS 73609..74190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00720 note possible pseudo, frameshifted CDS complement(74210..74818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(74819..76024) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(76477..77301) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548592.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 sequence002 source 1..53960 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2338..4299) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene gyrB CDS complement(4300..5421) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene recF CDS complement(5425..5670) product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 gene yaaA CDS complement(5872..7002) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene dnaN CDS complement(7174..8535) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene dnaA CDS 9014..9154 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene rpmH CDS 9204..9575 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rnpA CDS 9577..10452 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 10552..11937 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene mnmE CDS 11949..13841 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene mnmG CDS complement(13930..16107) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene nrdE CDS complement(16097..16522) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167010.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene nrdI CDS complement(16524..17537) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene nrdF CDS complement(17790..18626) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 18750..19271 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 19277..19969 product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 19989..20816 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 20934..22385 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 22477..23829 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene brnQ CDS 23879..24790 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 25063..25323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(25534..25821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 26056..27405 product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene guaD CDS 27429..28766 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 tRNA complement(28815..28889) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 29095..29799 product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene yycF CDS 29841..31679 product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene walK CDS 31669..33003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 32993..33829 product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 33854..34651 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 34687..35859 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 36377..36892 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene rlmH CDS complement(36895..37551) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(37565..38938) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(38913..39461) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(39666..40559) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene htpX CDS complement(40562..41113) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(41129..42235) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 42443..42814 product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 42871..43005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 43119..43766 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 43767..44687 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 44867..46570 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(46630..47385) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(47378..48985) product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(49369..50814) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene cls CDS 50895..51545 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(51628..52050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01220 note possible pseudo, internal stop codon, frameshifted CDS complement(52568..53449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 note possible pseudo, frameshifted CDS complement(53380..53943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 sequence003 source 1..42301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..1205 product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 1233..2027 product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702189.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 2052..2981 product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 2983..3342 product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 3570..4943 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 5227..6864 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(7242..8252) product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene asnA CDS 8715..9626 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 9810..12524 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(12679..13614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 13709..13861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(13817..15202) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(15192..15863) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 16031..16807 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 16901..17854 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 18020..19681 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 19696..21444 product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 21419..21568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 21552..23825 product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 23810..24472 product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene pgmB CDS 24492..25595 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene ugpC CDS 25698..26912 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 26975..28324 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 28330..29199 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(29278..30657) product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(30681..32093) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 32191..32412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 32425..32982 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 32976..33536 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 33554..34339 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 35066..35785 product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rsmG CDS 35806..36651 product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene noc CDS 36654..37427 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 37411..38289 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 38304..38555 product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 38568..39671 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene ychF assembly_gap 39371..39380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 39683..40459 product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(40512..41063) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 41146..41781 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548812.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene pcp sequence004 source 1..40898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..1639) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 1834..2535 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 2545..4986 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(5038..7323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(7316..7555) product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene dltC CDS complement(7601..8818) product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene dltB CDS complement(8815..10332) product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene dltA CDS complement(10351..10506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(10569..10865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(10882..12030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 12184..12675 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 12861..14021 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(14069..14716) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(14734..16044) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(16066..16731) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(16744..17388) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(17509..18213) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene nagB CDS 18389..19882 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 20058..21014 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene hemH CDS complement(21044..22000) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(22000..23112) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(23121..24659) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(24709..25797) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(25933..27030) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 27375..28685 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 28697..30007 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(30167..31717) product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(31785..33173) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene gndA tRNA complement(33340..33412) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 33560..34246 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 34253..35419 product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(35452..36825) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene dnaB CDS complement(36831..37286) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene rplI CDS complement(37302..39317) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(39485..39721) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rpsR CDS complement(39750..40205) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene ssb CDS complement(40241..40537) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene rpsF sequence005 source 1..36257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..697 product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene ebrB CDS complement(712..1290) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 1434..2123 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 2138..3025 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 3049..3285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 3288..3488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 3490..4167 product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 4231..5166 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(5207..6553) product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene pepC CDS 6701..7252 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 7252..8631 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene radA CDS 8705..10210 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene gltX CDS 10331..11743 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene cysS CDS 11730..12173 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 12154..12930 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene rlmB CDS 13042..13587 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(13701..14966) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 15105..15254 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene rpmG CDS 15260..15427 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene secE CDS 15505..16056 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene nusG CDS 16198..16623 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rplK CDS 16720..16992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 note possible pseudo, frameshifted assembly_gap 16916..16925 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 17046..17384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 note possible pseudo, frameshifted CDS 17627..18127 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene rplJ CDS 18172..18450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 assembly_gap 18421..18430 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(18500..19783) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(19783..20361) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 20700..22253 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene guaA CDS 22378..22623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 22714..22938 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 22939..24963 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 24957..26423 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 26440..27390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 27769..28722 product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 28940..29950 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(29952..30722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(30873..32201) product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 32515..32766 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 32905..34272 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 34288..35751 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 35874..36230 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene acpS sequence006 source 1..27104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..2443) product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene helD CDS complement(2626..4716) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene fusA CDS complement(4749..5219) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene rpsG CDS complement(5235..5642) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene rpsL CDS 5816..6322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(6314..7033) product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029714299.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(7045..8235) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(8391..9092) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(9240..9791) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 9884..10171 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 10279..10452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 10787..10987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 11017..12588 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 12609..14180 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(14667..15386) product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(15445..16710) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(16842..18464) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(18572..19117) product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene rpoE CDS complement(19137..19568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 19708..21084 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(21113..21805) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 21994..22437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 22505..23305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(23342..24160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 tRNA complement(24246..24318) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(24377..25630) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene tyrS CDS complement(25871..26485) product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 misc_feature complement(26491..>27104) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548816.1:LCP family protein locus_tag LOCUS_02670 sequence007 source 1..23624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..791 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550009.1:type I pantothenate kinase locus_tag LOCUS_02680 CDS 804..1364 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene efp CDS 1523..2803 product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene pepT CDS 2823..3734 product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(3798..4715) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 4887..5795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 5817..6659 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(6709..7488) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 7633..8232 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 8236..8733 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 8978..10288 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene serS CDS 10692..12035 product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 12119..13741 product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 14073..14879 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 14857..15366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 15371..15856 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 15997..16521 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 16525..17580 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 17603..18280 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(18283..18999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 19146..20015 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 20018..20932 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene pstC CDS 20935..21828 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641001.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene pstA CDS 21828..22595 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene pstB CDS 22607..23359 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene pstB sequence008 source 1..19422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 176..3070 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 3139..3250 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA 3259..3332 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(3608..4981) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 5311..7905 product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene adhE CDS 8071..9252 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(9308..10297) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene galE CDS 10460..11554 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 11554..12417 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 12419..13237 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 13221..14510 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 14549..15838 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 16236..16568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(16575..17090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(17090..17953) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 18041..18736 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 sequence009 source 1..17782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2119 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546265.1:calcium-translocating P-type ATPase, PMCA-type locus_tag LOCUS_03060 CDS 2267..3409 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 tRNA 3481..3566 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 3625..4236 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 4239..4850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 4952..7180 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene pcrA CDS 7194..9212 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene ligA CDS 9218..10348 product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 10359..10661 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene gatC CDS 10661..12100 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene gatA CDS 12104..13546 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene gatB assembly_gap 12285..12294 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13566..14474 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 14562..15233 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(15276..15989) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(16065..17444) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene nhaC sequence010 source 1..17713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 791..2137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 2311..3090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 3222..4082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(4119..4544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(4606..5100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 5317..5715 product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene spxA CDS 5797..6582 product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 6660..7529 product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(7522..8139) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(8204..8818) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 8896..9522 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 9519..10328 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 10321..11223 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(11263..12096) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(12105..13103) product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 assembly_gap 13087..13096 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 13270..13650 product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101685.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 13660..14802 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 14903..15415 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 15426..15833 product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 sequence011 source 1..17521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..521 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254134.1:dTMP kinase locus_tag LOCUS_03390 CDS 538..1395 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 1411..1764 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene yabA CDS 1767..2621 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene rsmI CDS 2631..3350 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 3364..4101 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene tsaB CDS 4130..4612 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rimI CDS 4632..5678 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene tsaD CDS 5710..6399 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 6389..7570 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 7605..9164 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 9188..9934 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(9987..10679) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(10682..12070) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(12745..13899) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(13889..14467) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(14991..16493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 sequence012 source 1..15515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 890..1207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 1234..2550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(2933..3637) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(3914..5479) product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(5498..5815) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102242.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(5824..6294) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 6457..7221 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(7366..7932) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(7956..9584) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(9606..12020) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene leuS CDS complement(12317..13720) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(13776..14981) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene metK CDS complement(14938..15087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 tRNA complement(15101..15175) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(15178..15251) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(15349..15440) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 sequence013 source 1..15446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..421 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene rpmD CDS 452..892 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rplO CDS 892..2196 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene secY CDS 2206..2856 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 2932..3153 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene infA CDS 3317..3667 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rpsM CDS 3688..4077 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rpsK CDS 4123..5061 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 5086..5469 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene rplQ CDS 5654..6502 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 6478..7329 product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 7330..8127 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 8128..8910 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene truA CDS 8907..9455 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene rplM CDS 9469..9864 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene rpsI sequence014 source 1..14950 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(809..2026) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(2412..2582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(3332..3685) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 4190..4615 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 4612..4842 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002334012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 5308..5511 product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 5593..6810 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(6995..7468) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(7526..7810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(8065..9372) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(9446..10057) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene rpsD CDS 10340..12043 product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene ezrA CDS 12144..12638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 note possible pseudo, frameshifted assembly_gap 12610..12619 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 12661..13287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03980 note possible pseudo, frameshifted CDS 13298..14515 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene thiI sequence015 source 1..13520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(847..1773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(1745..1966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(1975..2829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(2856..3839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(3832..4905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(5023..5184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 5372..5932 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(6208..7404) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene coaBC CDS complement(7527..11192) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene rpoC misc_feature complement(11211..>13520) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254108.1:DNA-directed RNA polymerase subunit beta locus_tag LOCUS_04100 sequence016 source 1..12896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..2332) product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(2337..2648) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082802.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(3064..4071) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(4064..5737) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701646.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(5734..6156) product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700930.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(6171..7007) product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(7000..7788) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700927.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(7791..8282) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(8577..9824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 note possible pseudo, frameshifted CDS complement(9788..11644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 note possible pseudo, frameshifted CDS 11721..12425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 sequence017 source 1..12719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 89..970 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(1152..1430) product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(1485..3626) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 3757..3930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 4058..4324 product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 4324..6060 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene ptsP CDS complement(6189..6665) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 6867..8426 product cholesterol-dependent cytolysin vaginolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene vly CDS 8658..10166 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 10156..10602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 10602..11615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 11728..12717 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 sequence018 source 1..12495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..823) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(839..1396) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene frr CDS complement(1396..2121) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene pyrH CDS complement(2277..3917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(4058..5092) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 5152..5766 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(5814..7610) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(7600..9366) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(9441..9656) product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(9722..9967) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 10091..10675 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene lexA CDS complement(10842..11501) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 note possible pseudo, frameshifted CDS complement(11639..11989) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene rplS CDS complement(12108..12407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 note possible pseudo, internal stop codon sequence019 source 1..12451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(81..782) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene lgt CDS complement(930..1868) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene hprK CDS complement(1872..2168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(2185..3183) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene prfB CDS complement(3343..5742) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene secA CDS complement(5905..6462) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene raiA CDS complement(6543..7226) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(7204..8490) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 8534..9199 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(9246..10382) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(10477..12117) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rny assembly_gap 11969..11978 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence020 source 1..12390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(988..2379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(2511..4478) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(4478..5233) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(5334..6251) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(6256..6924) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(7024..8316) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 tRNA complement(8513..8587) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(8726..10669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 repeat_region 8982..9103 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgctagttactacacctgc CDS complement(10864..12390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 sequence021 source 1..12350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 684..1919 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene codA CDS complement(1989..2720) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(2903..3694) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(3675..3848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(4225..4521) product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565490.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 4791..5663 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(5715..6065) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene crcB CDS complement(6065..6463) product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(6483..8003) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(8110..9921) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene glmS CDS complement(10112..11413) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene glmM CDS complement(11437..11904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 note possible pseudo, frameshifted assembly_gap 11965..11974 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence022 source 1..11608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..565 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546776.1:rod shape-determining protein locus_tag LOCUS_04800 CDS 615..1463 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 gene mreC CDS 1463..1990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 2282..2617 product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 2781..3212 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene mraZ CDS 3209..4153 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene rsmH CDS 4181..4546 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene ftsL CDS 4543..5145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 note possible pseudo, frameshifted assembly_gap 5121..5130 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5180..6709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 note possible pseudo, frameshifted CDS 6718..7677 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene mraY CDS 7691..7951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 note possible pseudo, frameshifted CDS 7911..9053 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene murD note possible pseudo, frameshifted assembly_gap 7917..7926 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9056..10168 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene murG CDS 10197..11033 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 sequence023 source 1..10786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(583..825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, internal stop codon, frameshifted CDS complement(907..1353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, internal stop codon CDS complement(1399..1851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 note possible pseudo, internal stop codon CDS complement(1848..2462) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(2961..3920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 4386..4565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 4656..4919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 note possible pseudo, internal stop codon, frameshifted CDS 4946..5179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 note possible pseudo, internal stop codon, frameshifted CDS 5213..5395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 note possible pseudo, internal stop codon CDS complement(5449..6063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 note possible pseudo, frameshifted CDS 6642..7049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 7042..7263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 7438..7776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 7854..8339 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 8537..8971 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 9140..9721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 9778..9942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 note possible pseudo, internal stop codon, frameshifted CDS 9920..10096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 note possible pseudo, internal stop codon, frameshifted CDS complement(10291..10476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 sequence024 source 1..10315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1267 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262245.1:ABC transporter permease/substrate-binding protein locus_tag LOCUS_05130 CDS 1385..3322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(3328..5586) product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 tRNA 5709..5795 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 5891..6445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 6590..7759 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene eno assembly_gap 7065..7074 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7895..9766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 9784..10032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 note possible pseudo, internal stop codon sequence025 source 1..10249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1209..1475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(1512..1724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 1923..2357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 2470..4542 product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 4656..5840 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675074.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(5899..6690) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(6694..7347) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(7370..8158) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(8237..8416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 8737..8946 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(9037..10152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 sequence026 source 1..9940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(783..1124) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(1229..2908) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene recN CDS complement(2921..3733) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(3733..4599) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(4602..4844) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(4837..6195) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene xseA CDS complement(6185..7039) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(7091..7492) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene nusB CDS complement(7492..7680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 note possible pseudo, frameshifted CDS complement(7710..7895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 assembly_gap 7764..7773 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7928..8488) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene efp CDS complement(8572..9381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 note possible pseudo, frameshifted CDS complement(9432..9689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 note possible pseudo, frameshifted assembly_gap 9435..9444 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence027 source 1..9203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(608..1216) product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(1339..1497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(1671..1838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(1825..2172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(2451..2648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(2653..2898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 tmRNA complement(3564..3926) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(3964..5175) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 assembly_gap 5185..5194 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5196..6197) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(6288..6467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(6445..6936) product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(6923..7141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(7131..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(7546..7872) product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene comGC CDS complement(7886..8884) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 sequence028 source 1..9150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..594 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546733.1:Mur ligase family protein locus_tag LOCUS_05580 CDS complement(597..1610) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 tRNA 1736..1809 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 1813..1885 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(1948..3177) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(3174..4067) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(4159..5499) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 5721..7901 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(8017..8730) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(8732..9121) product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 sequence029 source 1..9124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1594..2700 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(2732..3316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 3501..3890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 3883..4479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 note possible pseudo, frameshifted assembly_gap 4425..4434 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4448..4672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 note possible pseudo, frameshifted CDS 4674..5126 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 5428..5889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 5912..6541 product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 6587..7201 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 7220..7696 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene tadA sequence030 source 1..9080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1153..1902) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 1993..2430 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 2442..2753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 2844..3737 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(3864..4841) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(4843..7239) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(7223..8446) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(8456..8806) product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 sequence031 source 1..8990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(1322..2932) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108415.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(2964..3734) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(3752..4510) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(4500..5390) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(5392..8061) product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene lanKC sequence032 source 1..8799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 392..2956 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene mutS CDS 2962..4839 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene mutL CDS 4861..5445 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene ruvA CDS 5462..6466 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene ruvB CDS 6527..6883 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene yajC CDS 6988..8436 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene zwf sequence033 source 1..8628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 assembly_gap 3159..3168 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence034 source 1..8615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..543 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254264.1:translational GTPase TypA locus_tag LOCUS_05970 CDS 687..1889 product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 1867..2199 product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 2202..2750 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene rsmD CDS 2737..3234 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene coaD CDS 3236..4267 product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 4310..4942 product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 4911..7190 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 7187..8173 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene holA CDS complement(8224..8478) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene rpsT sequence035 source 1..8428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1815..2993) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(3111..3620) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(3610..4464) product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262821.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 tRNA complement(4478..4553) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(4591..4662) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(4716..6227) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene lysS CDS complement(6245..7180) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene dusB CDS complement(7320..8426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 sequence036 source 1..8221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1335 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116440412.1:CRISPR-associated helicase Cas3' locus_tag LOCUS_06130 CDS 1322..3010 product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 3020..3607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 3610..4686 product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene cas7e CDS 4703..5440 product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene cas5e CDS 5449..6108 product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene cas6e CDS 6105..6485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 note possible pseudo, frameshifted CDS 6463..7032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, frameshifted CDS 7033..7932 product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene cas2e repeat_region 7987..8198 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatttcccgcacatgcgggggtgatcct sequence037 source 1..8207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 495..1490 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene dhaK CDS 1503..2087 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548127.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene dhaL CDS 2084..2452 product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene dhaM CDS complement(2633..3505) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576514.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(3689..4366) product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674235.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(4379..4954) product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674238.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene lacB CDS complement(4972..5400) product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573960.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene lacA CDS complement(5410..6168) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(6285..7277) product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(7378..8205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 sequence038 source 1..7999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..395 product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 395..826 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ruvX CDS 833..1144 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 1252..3612 product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 3709..4020 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene trxA CDS complement(4147..4545) product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 4641..5426 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene murI CDS 5444..6064 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(6090..6935) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 7060..7497 product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 7512..7841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 sequence039 source 1..7990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 149..1057 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 tRNA 1168..1251 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 1257..1330 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1461..2162 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(2262..3515) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(3744..4133) product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene tagD CDS 4271..5404 product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 5419..6846 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 6850..7575 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 sequence040 source 1..7768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1598..2680) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene carA CDS complement(2680..3957) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(3957..4898) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(5037..5579) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene pyrR CDS complement(5625..6545) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 misc_feature complement(6551..>7768) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288985.1:MFS transporter locus_tag LOCUS_06550 sequence041 source 1..6995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1199..3739 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 tRNA 3817..3890 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 4064..4213 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rpmG CDS 4270..4821 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 4835..5533 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 5533..5751 product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 5786..6187 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(6242..6421) product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 sequence042 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(575..3559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(3665..5236) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(5236..6111) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 6191..6664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 sequence043 source 1..6970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(437..2458) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene recG CDS complement(2460..3749) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 note possible pseudo, frameshifted CDS complement(3809..4123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted CDS complement(4147..4506) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 4682..4867 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene rpmB CDS complement(5043..5702) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(5712..6350) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 misc_feature complement(6347..>6970) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546367.1:transporter substrate-binding domain-containing protein locus_tag LOCUS_06740 sequence044 source 1..6844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1356..2228 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(2322..2918) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(3094..3360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 note possible pseudo, frameshifted CDS 3575..3727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 assembly_gap 3628..3637 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3840..4004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(4291..4725) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185623697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(4905..5432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(5433..6524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 sequence045 source 1..6818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(628..1572) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene fmt CDS complement(1595..1810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 note possible pseudo, frameshifted CDS complement(1803..3977) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene priA assembly_gap 1829..1838 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4035..4253) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene rpoZ CDS complement(4255..4881) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene gmk CDS complement(5010..5300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(5303..5725) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene sepF misc_feature complement(5748..>6818) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546805.1:cell division protein FtsZ locus_tag LOCUS_06900 sequence046 source 1..6703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 303..713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(1272..2237) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 2372..3178 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 3208..3864 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 3953..4942 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 5099..5764 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 5772..6599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 sequence047 source 1..6536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 239..1078 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 1189..2343 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 2734..4107 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene brnQ CDS 4386..4670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(4743..5303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 sequence048 source 1..6514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1140 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548413.1:UDP-N-acetylmuramate--L-alanine ligase locus_tag LOCUS_07030 CDS 1262..6103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 sequence049 source 1..6496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1047) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(1048..1380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 1488..2855 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 2870..4267 product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene pepV CDS complement(4347..5348) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 sequence050 source 1..6339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1133 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101678.1:cysteine desulfurase family protein locus_tag LOCUS_07100 CDS 1275..1610 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene folB CDS 1607..2122 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene folK CDS 2091..2663 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene folE CDS 2669..3931 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 3924..4523 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene rdgB CDS 4523..5659 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene folP CDS 5718..6137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 sequence051 source 1..6327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 518..1756 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 1746..2195 product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 2197..3600 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene sufB CDS 3678..4145 product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 4325..4510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 4670..5800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 sequence052 source 1..6228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1620..2441) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(2553..3977) product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(4004..5017) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene ftsY CDS complement(5025..6215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 sequence053 source 1..6143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 602..2278 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene argS CDS 2374..3288 product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene fba CDS complement(3375..4253) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 sequence054 source 1..6065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2599..3552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(3778..4842) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(5058..5660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 sequence055 source 1..6048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(761..2059) product HP1165 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 2364..2663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(2759..3376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(3446..3919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(4676..5701) product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 sequence056 source 1..5938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..762 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549172.1:DNA polymerase IV locus_tag LOCUS_07410 CDS 818..1774 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 1761..3143 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 sequence057 source 1..5650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..2245) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(2304..3314) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(3314..4357) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(4359..5513) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 sequence058 source 1..5622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1561) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(1565..2386) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene map CDS 2519..2965 product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(3032..4174) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254552.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene wecB CDS 4287..4466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 tRNA 4518..4590 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 misc_feature complement(4609..>5622) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546440.1:DEAD/DEAH box helicase locus_tag LOCUS_07530 sequence059 source 1..5595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1871..2716) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene dprA CDS complement(2765..3517) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(3514..4353) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene ylqF misc_feature complement(4566..>5595) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101574.1:S41 family peptidase locus_tag LOCUS_07570 sequence060 source 1..5410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..934 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546586.1:excinuclease ABC subunit UvrB locus_tag LOCUS_07580 CDS 959..3778 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene uvrA CDS 3826..4701 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene rapZ sequence061 source 1..5377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..720 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254190.1:multidrug efflux MFS transporter locus_tag LOCUS_07610 CDS 918..2231 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(2284..3084) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(3071..4000) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(4241..5377) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence062 source 1..5275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..3963) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 4032..4952 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene mvk sequence063 source 1..5218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 525..1631 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 1618..2430 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 2427..3227 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 3224..4297 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 4336..5178 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene cdaA sequence064 source 1..5121 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1439..1996) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene pth CDS 2135..3106 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 3246..3929 product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene cbpA misc_feature complement(4006..>5121) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548996.1:alanine racemase locus_tag LOCUS_07760 sequence065 source 1..5100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..1067 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 1089..1589 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 1620..1955 product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 1966..3093 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene mnmA CDS 3122..3778 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 3778..4410 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 sequence066 source 1..4873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(578..1870) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene tilS CDS complement(1901..2239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(2239..2613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(2696..2938) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 misc_feature complement(2952..>4873) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254101.1:transcription-repair coupling factor locus_tag LOCUS_07870 sequence067 source 1..4841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..474 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene nrdR CDS 478..1824 product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 1841..2740 product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene dnaI CDS 3009..3167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 note possible pseudo, frameshifted assembly_gap 3149..3158 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence068 source 1..4789 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(791..1237) product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(1234..1665) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 1816..2307 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 sequence069 source 1..4754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1212..1937) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(2053..2580) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(2581..3741) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(3751..4095) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene rsfS CDS complement(4107..4715) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene yqeK sequence070 source 1..4738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..716 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674550.1:Stk1 family PASTA domain-containing Ser/Thr kinase locus_tag LOCUS_08000 CDS 716..1609 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rsgA CDS 1617..2267 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rpe CDS 2252..2965 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(2985..3620) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene udk sequence071 source 1..4729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..1095) product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene ribF CDS complement(1113..2006) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene truB CDS complement(2067..2423) product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 misc_feature complement(2457..>4729) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254396.1:translation initiation factor IF-2 locus_tag LOCUS_08080 sequence072 source 1..4677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(949..1788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(1804..2343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(2351..3562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 misc_feature complement(3580..>4677) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350502.1:ABC transporter ATP-binding protein locus_tag LOCUS_08120 sequence073 source 1..4627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(777..1568) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene sufC CDS complement(1629..2252) product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(2262..3314) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(3435..4175) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 sequence074 source 1..4608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1633..2502) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 tRNA 2583..2666 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(2878..3159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(3324..3740) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(3724..3918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 sequence075 source 1..4594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1699..2184) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene greA CDS complement(2257..3357) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene mltG misc_feature complement(3381..>4594) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548294.1:phenylalanine--tRNA ligase subunit beta locus_tag LOCUS_08230 sequence076 source 1..4558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1400..1684) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene groES CDS complement(1810..2439) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 2626..4539 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 sequence077 source 1..4468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..206) product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(222..824) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene lepB CDS 912..1658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 1645..2631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 2624..4033 product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 sequence078 source 1..4402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1226) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene yidC CDS 1369..2136 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 2209..2556 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 2847..3896 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene pheS sequence079 source 1..4388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..1298 product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene whiA CDS 1291..2787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 2803..4059 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 sequence080 source 1..4327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 427..1650 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 1759..2835 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 2838..3416 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene pgsA sequence081 source 1..4325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(469..1305) product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene nadE CDS complement(1308..2786) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(2837..3535) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 misc_feature complement(3598..>4325) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546257.1:glycosyltransferase family 4 protein locus_tag LOCUS_08450 sequence082 source 1..4325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 361..1329 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 1331..2293 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 2308..3237 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 sequence083 source 1..4254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1157..3007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 note possible pseudo, frameshifted assembly_gap 2538..2547 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3028..3669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 note possible pseudo, frameshifted assembly_gap 3033..3042 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 3748..3757 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence084 source 1..4236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..590) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(608..1024) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(1169..3751) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 sequence085 source 1..4172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2296 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547478.1:DNA topoisomerase IV subunit A locus_tag LOCUS_08550 CDS 2375..3310 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 3553..3780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 3722..3931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 note possible pseudo, frameshifted sequence086 source 1..4160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1091..1324) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene secG CDS complement(1443..2741) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene eno CDS complement(2792..3547) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene tpiA misc_feature complement(3565..>4160) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546602.1:phosphoglycerate kinase locus_tag LOCUS_08620 sequence087 source 1..4134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..2209 product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene glyS CDS 2228..4030 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene dnaG sequence088 source 1..4095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..764 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 764..1558 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 1568..3934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 sequence089 source 1..4094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..883) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 assembly_gap 805..814 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(883..1383) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene atpF CDS complement(1428..1640) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene atpE CDS complement(1659..2375) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene atpB CDS complement(2470..3099) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene upp misc_feature complement(3197..>4094) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546737.1:L-threonylcarbamoyladenylate synthase locus_tag LOCUS_08730 sequence090 source 1..3999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1559 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254441.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_08740 CDS complement(1682..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 1928..2806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 2799..3452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 3439..3975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 sequence091 source 1..3972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1648 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371500.1:tetracycline resistance ribosomal protection protein Tet(M) locus_tag LOCUS_08790 assembly_gap 1775..1784 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2010..2255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 note possible pseudo, frameshifted CDS 2252..2587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 2600..2968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 2955..3254 product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(3372..3971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 sequence092 source 1..3962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1302 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080388512.1:hyperosmolarity resistance protein Ebh locus_tag LOCUS_08850 CDS 1471..1695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 1697..2119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 sequence093 source 1..3911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(577..1494) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene prmA assembly_gap 1306..1315 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 1527..1536 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1557..2063 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene ybaK CDS complement(2118..3497) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 sequence094 source 1..3735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(598..669) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 897..1928 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 1985..3001 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene gap sequence095 source 1..3705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1227..2444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(2484..3398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 note possible pseudo, frameshifted assembly_gap 3415..3424 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence096 source 1..3694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254355.1:carbamoyl phosphate synthase large subunit locus_tag LOCUS_08950 misc_feature complement(3144..>3694) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547519.1:NFACT RNA binding domain-containing protein locus_tag LOCUS_08960 sequence097 source 1..3597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1083 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003627067.1:type I glutamate--ammonia ligase locus_tag LOCUS_08970 CDS 1186..2361 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 2401..3354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 sequence098 source 1..3535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1361..2086) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(2086..3018) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 sequence099 source 1..3499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(625..2373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 2635..3480 product quorum-sensing system transcriptional regulator Rgg2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990747.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene rgg2 sequence100 source 1..3479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..1414) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 1606..2895 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 assembly_gap 3142..3151 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence101 source 1..3385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1083) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(1088..2023) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS complement(2031..2507) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene lspA misc_feature complement(2508..>3385) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254358.1:formate--tetrahydrofolate ligase locus_tag LOCUS_09090 sequence102 source 1..3377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(436..954) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1073..2260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 note possible pseudo, frameshifted CDS complement(2233..2964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 note possible pseudo, frameshifted sequence103 source 1..3374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1035 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549861.1:GTPase HflX locus_tag LOCUS_09130 CDS complement(1152..1907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1904..2563) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 misc_feature complement(2677..>3374) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254607.1:adenylosuccinate lyase locus_tag LOCUS_09160 sequence104 source 1..3341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(698..1147) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1244..1420) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rpsU CDS 1622..2455 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 misc_feature complement(2507..>3341) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547719.1:YitT family protein locus_tag LOCUS_09200 sequence105 source 1..3319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 286..1566 product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene trmFO CDS 1569..2492 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 2496..3020 product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene hslV sequence106 source 1..3318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..607 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546749.1:rod shape-determining protein locus_tag LOCUS_09240 CDS 609..893 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene yidD CDS 907..1134 product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 1151..2344 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 2702..3016 product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 sequence107 source 1..3316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(963..1484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS complement(1594..2052) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene smpB misc_feature complement(2055..>3316) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550136.1:ribonuclease R locus_tag LOCUS_09310 sequence108 source 1..3311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..609 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254308.1:ATP-dependent protease ATPase subunit HslU locus_tag LOCUS_09320 CDS 626..1516 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1549..2241) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene plsY sequence109 source 1..3132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 469..478 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(559..1356) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(1343..2026) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 misc_feature complement(2087..>3132) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254377.1:RNA polymerase sigma factor RpoD locus_tag LOCUS_09370 sequence110 source 1..2961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1671) product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(1847..2041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 note possible pseudo, internal stop codon CDS 2530..2835 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 sequence111 source 1..2956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence112 source 1..2923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2697..2873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 sequence113 source 1..2915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(530..781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(774..1337) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(1343..1561) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 misc_feature complement(1561..>2915) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254260.1:isoleucine--tRNA ligase locus_tag LOCUS_09450 sequence114 source 1..2905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(722..1225) product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 misc_feature complement(1222..>2905) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254365.1:helicase C-terminal domain-containing protein locus_tag LOCUS_09470 sequence115 source 1..2821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 331..867 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene cobC CDS 1210..1797 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1794..2636 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 sequence116 source 1..2775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1647 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546584.1:phospho-sugar mutase locus_tag LOCUS_09510 sequence117 source 1..2773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence118 source 1..2764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 751..1695 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 misc_feature complement(1761..>2764) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263274.1:amidase locus_tag LOCUS_09530 sequence119 source 1..2757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..740 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene rimP CDS 760..1665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 note possible pseudo, frameshifted assembly_gap 1613..1622 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1628..1858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 note possible pseudo, frameshifted CDS 1883..2179 product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 2181..2486 product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 sequence120 source 1..2740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..624 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546864.1:ATP-dependent Clp protease ATP-binding subunit ClpX locus_tag LOCUS_09590 CDS 614..1201 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene yihA CDS 1273..1791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1872..2531 product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 sequence121 source 1..2738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(363..1346) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rpoN note possible pseudo, frameshifted CDS complement(1343..1642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1656..2360) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 sequence122 source 1..2644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1468 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254247.1:F0F1 ATP synthase subunit beta locus_tag LOCUS_09670 CDS 1480..1914 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1964..2197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 sequence123 source 1..2552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..1105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1275..2465 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene tuf sequence124 source 1..2523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(225..1163) product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rbsK CDS 1317..1583 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 sequence125 source 1..2492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..586 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546467.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD locus_tag LOCUS_09740 CDS complement(829..1782) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1870..2163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 sequence126 source 1..2459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..419 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene rpsS CDS 438..791 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene rplV CDS 806..1480 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rpsC CDS 1483..1920 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rplP CDS 1910..2095 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene rpmC CDS 2118..2384 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene rpsQ sequence127 source 1..2444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..922 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547790.1:molecular chaperone DnaJ locus_tag LOCUS_09830 sequence128 source 1..2440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..678 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547078.1:segregation/condensation protein A locus_tag LOCUS_09840 CDS 671..1246 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene scpB CDS 1265..1984 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 sequence129 source 1..2399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1406..1960 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene def CDS 2097..2321 product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 sequence130 source 1..2337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(956..2164) product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 sequence131 source 1..2325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(495..1172) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 note possible pseudo, frameshifted assembly_gap 525..534 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(1316..1672) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rplT CDS complement(1709..1909) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene rpmI sequence132 source 1..2294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546834.1:ribonuclease J locus_tag LOCUS_09930 assembly_gap 587..596 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(603..2279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 sequence133 source 1..2283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..692 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549016.1:ATP-dependent Clp protease ATP-binding subunit locus_tag LOCUS_09950 sequence134 source 1..2277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..542 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 assembly_gap 574..583 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 642..1904 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 sequence135 source 1..2262 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..1070 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1063..1824 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245086.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 sequence136 source 1..2260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1263 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547819.1:proline--tRNA ligase locus_tag LOCUS_10000 sequence137 source 1..2248 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547039.1:aspartate--tRNA ligase note possible pseudo, frameshifted locus_tag LOCUS_10010 CDS 747..1088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 note possible pseudo, frameshifted CDS 1073..1417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 note possible pseudo, frameshifted CDS 1498..2070 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 sequence138 source 1..2234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1037..1723) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 misc_feature complement(1725..>2234) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254395.1:translation elongation factor 4 locus_tag LOCUS_10060 sequence139 source 1..2221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..781 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014565583.1:NAD(P)/FAD-dependent oxidoreductase locus_tag LOCUS_10070 CDS 809..1453 product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(1583..1768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 repeat_region 1950..>2221 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggatcacccccgcatgtgcgggaaatac sequence140 source 1..2218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10100 note possible pseudo, frameshifted CDS 897..1490 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 sequence141 source 1..2215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..1856) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene uvrC sequence142 source 1..2137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 688..1539 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1548..1775 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 sequence143 source 1..2100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(312..671) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene rplR CDS complement(698..1228) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene rplF CDS complement(1253..1651) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rpsH CDS complement(1678..1863) product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 sequence144 source 1..2078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1091 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254246.1:F0F1 ATP synthase subunit alpha locus_tag LOCUS_10190 CDS 1109..2062 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 sequence145 source 1..1978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1427) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene rnz misc_feature complement(1434..>1978) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025015105.1:acyltransferase family protein locus_tag LOCUS_10220 sequence146 source 1..1962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..868 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254292.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase locus_tag LOCUS_10230 CDS 868..1305 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene dtd sequence147 source 1..1936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1028..>1936) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254297.1:GTPase ObgE locus_tag LOCUS_10250 sequence148 source 1..1912 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..686 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene trmB CDS 705..1025 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1041..1694 product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 sequence149 source 1..1911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..421) product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(418..1017) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene recR CDS complement(1017..1346) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 misc_feature complement(1392..>1911) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549111.1:DNA polymerase III subunit gamma/tau locus_tag LOCUS_10320 sequence150 source 1..1891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1559..1828) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene rpsO sequence151 source 1..1884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 431..1480 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 sequence152 source 1..1864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1085..1693) product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 sequence153 source 1..1851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..946 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1024..1500) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene tsaE sequence154 source 1..1827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(585..1814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 sequence155 source 1..1796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..1164 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene era sequence156 source 1..1790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..647 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254272.1:nucleoside hydrolase locus_tag LOCUS_10400 CDS complement(835..1212) product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1249..1563) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 sequence157 source 1..1784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..1477) product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 sequence158 source 1..1775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 299..970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1127..1537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 note possible pseudo, frameshifted assembly_gap 1504..1513 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence159 source 1..1764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..1424 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 sequence160 source 1..1762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 527..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 830..979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1139..1318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 sequence161 source 1..1652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(129..>1652) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254252.1:valine--tRNA ligase locus_tag LOCUS_10500 sequence162 source 1..1640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..1465 product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 sequence163 source 1..1629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence164 source 1..1626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..759 product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene recU sequence165 source 1..1604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..981) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene trxB misc_feature complement(1001..>1604) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546563.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase locus_tag LOCUS_10540 sequence166 source 1..1587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..581 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547533.1:class I SAM-dependent RNA methyltransferase locus_tag LOCUS_10550 CDS 674..1021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 sequence167 source 1..1571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 345..626 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 632..754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10590 misc_feature complement(883..>1571) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962520.1:GIY-YIG nuclease family protein locus_tag LOCUS_10600 sequence168 source 1..1567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1138 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254253.1:folylpolyglutamate synthase/dihydrofolate synthase family protein locus_tag LOCUS_10610 sequence169 source 1..1553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 242..757 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(779..934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 misc_feature complement(994..>1553) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153437736.1:ISNCY family transposase locus_tag LOCUS_10640 sequence170 source 1..1538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..1271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 sequence171 source 1..1528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..775 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene acpP sequence172 source 1..1521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(56..>1521) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548351.1:DNA polymerase I locus_tag LOCUS_10670 sequence173 source 1..1504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..698 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547606.1:peptidase T locus_tag LOCUS_10680 CDS 1009..1383 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690