>Feature sequence001 1061 759 gene locus_tag LOCUS_00010 gene rplW 1061 759 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_00010 1675 1061 gene locus_tag LOCUS_00020 gene rplD 1675 1061 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549025.1 protein_id gnl|my_center|LOCUS_00020 2319 1690 gene locus_tag LOCUS_00030 gene rplC 2319 1690 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549024.1 protein_id gnl|my_center|LOCUS_00030 2654 2346 gene locus_tag LOCUS_00040 gene rpsJ 2654 2346 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_00040 3865 2900 gene locus_tag LOCUS_00050 3865 2900 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254080.1 protein_id gnl|my_center|LOCUS_00050 5344 3959 gene locus_tag LOCUS_00060 gene glmU 5344 3959 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548882.1 protein_id gnl|my_center|LOCUS_00060 6214 5378 gene locus_tag LOCUS_00070 gene purR 6214 5378 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548880.1 protein_id gnl|my_center|LOCUS_00070 6594 6352 gene locus_tag LOCUS_00080 6594 6352 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548879.1 protein_id gnl|my_center|LOCUS_00080 7559 6672 gene locus_tag LOCUS_00090 gene rsmA 7559 6672 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548878.1 protein_id gnl|my_center|LOCUS_00090 8112 7549 gene locus_tag LOCUS_00100 gene rnmV 8112 7549 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548877.1 protein_id gnl|my_center|LOCUS_00100 8869 8096 gene locus_tag LOCUS_00110 8869 8096 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548876.1 protein_id gnl|my_center|LOCUS_00110 10857 8869 gene locus_tag LOCUS_00120 gene metG 10857 8869 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254078.1 protein_id gnl|my_center|LOCUS_00120 9359 9368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13671 10972 gene locus_tag LOCUS_00130 gene mgtA 13671 10972 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548873.1 protein_id gnl|my_center|LOCUS_00130 14560 13991 gene locus_tag LOCUS_00140 14560 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15030 14557 gene locus_tag LOCUS_00150 15030 14557 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548871.1 protein_id gnl|my_center|LOCUS_00150 16071 15052 gene locus_tag LOCUS_00160 gene trpS 16071 15052 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548870.1 protein_id gnl|my_center|LOCUS_00160 16222 16294 gene locus_tag LOCUS_t00010 16222 16294 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16987 16325 gene locus_tag LOCUS_00170 16987 16325 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254077.1 protein_id gnl|my_center|LOCUS_00170 17110 17424 gene locus_tag LOCUS_00180 17110 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19050 17749 gene locus_tag LOCUS_00190 19050 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19355 19047 gene locus_tag LOCUS_00200 19355 19047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19622 19380 gene locus_tag LOCUS_00210 19622 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19754 20455 gene locus_tag LOCUS_00220 19754 20455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20456 21256 gene locus_tag LOCUS_00230 20456 21256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21258 21896 gene locus_tag LOCUS_00240 21258 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22468 22007 gene locus_tag LOCUS_00250 gene greA 22468 22007 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548866.1 protein_id gnl|my_center|LOCUS_00250 22454 23104 gene locus_tag LOCUS_00260 22454 23104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23085 24533 gene locus_tag LOCUS_00270 23085 24533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24584 25894 gene locus_tag LOCUS_00280 24584 25894 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254075.1 protein_id gnl|my_center|LOCUS_00280 27989 26040 gene locus_tag LOCUS_00290 27989 26040 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548782.1 protein_id gnl|my_center|LOCUS_00290 29324 28104 gene locus_tag LOCUS_00300 29324 28104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548780.1 protein_id gnl|my_center|LOCUS_00300 30140 29427 gene locus_tag LOCUS_00310 gene nrdG 30140 29427 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548777.1 protein_id gnl|my_center|LOCUS_00310 32354 30165 gene locus_tag LOCUS_00320 gene nrdD 32354 30165 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254061.1 protein_id gnl|my_center|LOCUS_00320 32895 32578 gene locus_tag LOCUS_00330 32895 32578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33789 33076 gene locus_tag LOCUS_00340 33789 33076 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641945.1 protein_id gnl|my_center|LOCUS_00340 35643 33808 gene locus_tag LOCUS_00350 gene glpO 35643 33808 CDS product type 1 glycerol-3-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837394.1 protein_id gnl|my_center|LOCUS_00350 37166 35646 gene locus_tag LOCUS_00360 gene glpK 37166 35646 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775048.1 protein_id gnl|my_center|LOCUS_00360 38709 37294 gene locus_tag LOCUS_00370 38709 37294 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905175.1 protein_id gnl|my_center|LOCUS_00370 40019 38703 gene locus_tag LOCUS_00380 40019 38703 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922251.1 protein_id gnl|my_center|LOCUS_00380 41478 40219 gene locus_tag LOCUS_00390 41478 40219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_00390 43445 41496 gene locus_tag LOCUS_00400 gene asnB 43445 41496 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548773.1 protein_id gnl|my_center|LOCUS_00400 44902 43511 gene locus_tag LOCUS_00410 44902 43511 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_00410 45437 44955 gene locus_tag LOCUS_00420 45437 44955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548767.1 protein_id gnl|my_center|LOCUS_00420 45999 45523 gene locus_tag LOCUS_00430 45999 45523 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548753.1 protein_id gnl|my_center|LOCUS_00430 46148 46948 gene locus_tag LOCUS_00440 46148 46948 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548752.1 protein_id gnl|my_center|LOCUS_00440 47136 48056 gene locus_tag LOCUS_00450 47136 48056 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016723.1 protein_id gnl|my_center|LOCUS_00450 48191 48805 gene locus_tag LOCUS_00460 48191 48805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48802 49575 gene locus_tag LOCUS_00470 48802 49575 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861932.1 protein_id gnl|my_center|LOCUS_00470 49679 50542 gene locus_tag LOCUS_00480 49679 50542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50895 51554 gene locus_tag LOCUS_00490 50895 51554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53241 51664 gene locus_tag LOCUS_00500 53241 51664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_00500 53945 53547 gene locus_tag LOCUS_00510 53945 53547 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194089.1 protein_id gnl|my_center|LOCUS_00510 55198 54038 gene locus_tag LOCUS_00520 gene nagA 55198 54038 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254054.1 protein_id gnl|my_center|LOCUS_00520 55286 58240 gene locus_tag LOCUS_00530 55286 58240 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548741.1 protein_id gnl|my_center|LOCUS_00530 59072 58323 gene locus_tag LOCUS_00540 59072 58323 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548732.1 protein_id gnl|my_center|LOCUS_00540 60169 59084 gene locus_tag LOCUS_00550 60169 59084 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548730.1 protein_id gnl|my_center|LOCUS_00550 60857 60189 gene locus_tag LOCUS_00560 60857 60189 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254052.1 protein_id gnl|my_center|LOCUS_00560 61964 60882 gene locus_tag LOCUS_00570 61964 60882 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548727.1 protein_id gnl|my_center|LOCUS_00570 62198 63637 gene locus_tag LOCUS_00580 62198 63637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64075 64470 gene locus_tag LOCUS_00590 64075 64470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64472 65092 gene locus_tag LOCUS_00600 64472 65092 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476045.1 protein_id gnl|my_center|LOCUS_00600 65199 65678 gene locus_tag LOCUS_00610 65199 65678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 65885 65715 gene locus_tag LOCUS_00620 65885 65715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 66252 65968 gene locus_tag LOCUS_00630 66252 65968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 67111 66341 gene locus_tag LOCUS_00640 67111 66341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 68494 67631 gene locus_tag LOCUS_00650 68494 67631 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263840.1 protein_id gnl|my_center|LOCUS_00650 69554 68808 gene locus_tag LOCUS_00660 69554 68808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 protein_id gnl|my_center|LOCUS_00660 70287 69547 gene locus_tag LOCUS_00670 70287 69547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703143.1 protein_id gnl|my_center|LOCUS_00670 71199 70294 gene locus_tag LOCUS_00680 71199 70294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262197.1 protein_id gnl|my_center|LOCUS_00680 72340 71192 gene locus_tag LOCUS_00690 72340 71192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72638 72513 gene locus_tag LOCUS_00700 72638 72513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73302 73619 gene locus_tag LOCUS_00710 73302 73619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 73609 74190 gene locus_tag LOCUS_00720 73609 74190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00720 74818 74210 gene locus_tag LOCUS_00730 74818 74210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 76024 74819 gene locus_tag LOCUS_00740 76024 74819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687010.1 protein_id gnl|my_center|LOCUS_00740 77301 76477 gene locus_tag LOCUS_00750 77301 76477 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548592.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence002 4299 2338 gene locus_tag LOCUS_00760 gene gyrB 4299 2338 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549374.1 protein_id gnl|my_center|LOCUS_00760 5421 4300 gene locus_tag LOCUS_00770 gene recF 5421 4300 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_00770 5670 5425 gene locus_tag LOCUS_00780 gene yaaA 5670 5425 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254000.1 protein_id gnl|my_center|LOCUS_00780 7002 5872 gene locus_tag LOCUS_00790 gene dnaN 7002 5872 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549381.1 protein_id gnl|my_center|LOCUS_00790 8535 7174 gene locus_tag LOCUS_00800 gene dnaA 8535 7174 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011253999.1 protein_id gnl|my_center|LOCUS_00800 9014 9154 gene locus_tag LOCUS_00810 gene rpmH 9014 9154 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_00810 9204 9575 gene locus_tag LOCUS_00820 gene rnpA 9204 9575 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549413.1 protein_id gnl|my_center|LOCUS_00820 9577 10452 gene locus_tag LOCUS_00830 9577 10452 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254638.1 protein_id gnl|my_center|LOCUS_00830 10552 11937 gene locus_tag LOCUS_00840 gene mnmE 10552 11937 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549418.1 protein_id gnl|my_center|LOCUS_00840 11949 13841 gene locus_tag LOCUS_00850 gene mnmG 11949 13841 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549419.1 protein_id gnl|my_center|LOCUS_00850 16107 13930 gene locus_tag LOCUS_00860 gene nrdE 16107 13930 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194382.1 protein_id gnl|my_center|LOCUS_00860 16522 16097 gene locus_tag LOCUS_00870 gene nrdI 16522 16097 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167010.1 protein_id gnl|my_center|LOCUS_00870 17537 16524 gene locus_tag LOCUS_00880 gene nrdF 17537 16524 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192437.1 protein_id gnl|my_center|LOCUS_00880 18626 17790 gene locus_tag LOCUS_00890 18626 17790 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476577.1 protein_id gnl|my_center|LOCUS_00890 18750 19271 gene locus_tag LOCUS_00900 18750 19271 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_00900 19277 19969 gene locus_tag LOCUS_00910 19277 19969 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079808.1 protein_id gnl|my_center|LOCUS_00910 19989 20816 gene locus_tag LOCUS_00920 19989 20816 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549252.1 protein_id gnl|my_center|LOCUS_00920 20934 22385 gene locus_tag LOCUS_00930 20934 22385 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549250.1 protein_id gnl|my_center|LOCUS_00930 22477 23829 gene locus_tag LOCUS_00940 gene brnQ 22477 23829 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476479.1 protein_id gnl|my_center|LOCUS_00940 23879 24790 gene locus_tag LOCUS_00950 23879 24790 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550037.1 protein_id gnl|my_center|LOCUS_00950 25063 25323 gene locus_tag LOCUS_00960 25063 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 25821 25534 gene locus_tag LOCUS_00970 25821 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 26056 27405 gene locus_tag LOCUS_00980 gene guaD 26056 27405 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 protein_id gnl|my_center|LOCUS_00980 27429 28766 gene locus_tag LOCUS_00990 27429 28766 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 protein_id gnl|my_center|LOCUS_00990 28889 28815 gene locus_tag LOCUS_t00020 28889 28815 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29095 29799 gene locus_tag LOCUS_01000 gene yycF 29095 29799 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548578.1 protein_id gnl|my_center|LOCUS_01000 29841 31679 gene locus_tag LOCUS_01010 gene walK 29841 31679 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254027.1 protein_id gnl|my_center|LOCUS_01010 31669 33003 gene locus_tag LOCUS_01020 31669 33003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548582.1 protein_id gnl|my_center|LOCUS_01020 32993 33829 gene locus_tag LOCUS_01030 32993 33829 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548584.1 protein_id gnl|my_center|LOCUS_01030 33854 34651 gene locus_tag LOCUS_01040 33854 34651 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254029.1 protein_id gnl|my_center|LOCUS_01040 34687 35859 gene locus_tag LOCUS_01050 34687 35859 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_01050 36377 36892 gene locus_tag LOCUS_01060 gene rlmH 36377 36892 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_01060 37551 36895 gene locus_tag LOCUS_01070 37551 36895 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548607.1 protein_id gnl|my_center|LOCUS_01070 38938 37565 gene locus_tag LOCUS_01080 38938 37565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548609.1 protein_id gnl|my_center|LOCUS_01080 39461 38913 gene locus_tag LOCUS_01090 39461 38913 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643692.1 protein_id gnl|my_center|LOCUS_01090 40559 39666 gene locus_tag LOCUS_01100 gene htpX 40559 39666 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254032.1 protein_id gnl|my_center|LOCUS_01100 41113 40562 gene locus_tag LOCUS_01110 41113 40562 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254033.1 protein_id gnl|my_center|LOCUS_01110 42235 41129 gene locus_tag LOCUS_01120 42235 41129 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254034.1 protein_id gnl|my_center|LOCUS_01120 42443 42814 gene locus_tag LOCUS_01130 42443 42814 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548621.1 protein_id gnl|my_center|LOCUS_01130 42871 43005 gene locus_tag LOCUS_01140 42871 43005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548644.1 protein_id gnl|my_center|LOCUS_01140 43119 43766 gene locus_tag LOCUS_01150 43119 43766 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254040.1 protein_id gnl|my_center|LOCUS_01150 43767 44687 gene locus_tag LOCUS_01160 43767 44687 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254041.1 protein_id gnl|my_center|LOCUS_01160 44867 46570 gene locus_tag LOCUS_01170 44867 46570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_01170 47385 46630 gene locus_tag LOCUS_01180 47385 46630 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548674.1 protein_id gnl|my_center|LOCUS_01180 48985 47378 gene locus_tag LOCUS_01190 48985 47378 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254042.1 protein_id gnl|my_center|LOCUS_01190 50814 49369 gene locus_tag LOCUS_01200 gene cls 50814 49369 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548687.1 protein_id gnl|my_center|LOCUS_01200 50895 51545 gene locus_tag LOCUS_01210 50895 51545 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 protein_id gnl|my_center|LOCUS_01210 52050 51628 gene locus_tag LOCUS_01220 52050 51628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01220 53449 52568 gene locus_tag LOCUS_01230 53449 52568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 53943 53380 gene locus_tag LOCUS_01240 53943 53380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 >Feature sequence003 216 1205 gene locus_tag LOCUS_01250 216 1205 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 protein_id gnl|my_center|LOCUS_01250 1233 2027 gene locus_tag LOCUS_01260 1233 2027 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702189.1 protein_id gnl|my_center|LOCUS_01260 2052 2981 gene locus_tag LOCUS_01270 2052 2981 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_01270 2983 3342 gene locus_tag LOCUS_01280 2983 3342 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568234.1 protein_id gnl|my_center|LOCUS_01280 3570 4943 gene locus_tag LOCUS_01290 3570 4943 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_01290 5227 6864 gene locus_tag LOCUS_01300 5227 6864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673980.1 protein_id gnl|my_center|LOCUS_01300 8252 7242 gene locus_tag LOCUS_01310 gene asnA 8252 7242 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_01310 8715 9626 gene locus_tag LOCUS_01320 8715 9626 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549600.1 protein_id gnl|my_center|LOCUS_01320 9810 12524 gene locus_tag LOCUS_01330 9810 12524 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 protein_id gnl|my_center|LOCUS_01330 13614 12679 gene locus_tag LOCUS_01340 13614 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 13709 13861 gene locus_tag LOCUS_01350 13709 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 15202 13817 gene locus_tag LOCUS_01360 15202 13817 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_01360 15863 15192 gene locus_tag LOCUS_01370 15863 15192 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549605.1 protein_id gnl|my_center|LOCUS_01370 16031 16807 gene locus_tag LOCUS_01380 16031 16807 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549621.1 protein_id gnl|my_center|LOCUS_01380 16901 17854 gene locus_tag LOCUS_01390 16901 17854 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564289.1 protein_id gnl|my_center|LOCUS_01390 18020 19681 gene locus_tag LOCUS_01400 18020 19681 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254601.1 protein_id gnl|my_center|LOCUS_01400 19696 21444 gene locus_tag LOCUS_01410 19696 21444 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549626.1 protein_id gnl|my_center|LOCUS_01410 21419 21568 gene locus_tag LOCUS_01420 21419 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 21552 23825 gene locus_tag LOCUS_01430 21552 23825 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549627.1 protein_id gnl|my_center|LOCUS_01430 23810 24472 gene locus_tag LOCUS_01440 gene pgmB 23810 24472 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549628.1 protein_id gnl|my_center|LOCUS_01440 24492 25595 gene locus_tag LOCUS_01450 gene ugpC 24492 25595 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546234.1 protein_id gnl|my_center|LOCUS_01450 25698 26912 gene locus_tag LOCUS_01460 25698 26912 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549630.1 protein_id gnl|my_center|LOCUS_01460 26975 28324 gene locus_tag LOCUS_01470 26975 28324 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549632.1 protein_id gnl|my_center|LOCUS_01470 28330 29199 gene locus_tag LOCUS_01480 28330 29199 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549634.1 protein_id gnl|my_center|LOCUS_01480 30657 29278 gene locus_tag LOCUS_01490 30657 29278 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_01490 32093 30681 gene locus_tag LOCUS_01500 32093 30681 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549685.1 protein_id gnl|my_center|LOCUS_01500 32191 32412 gene locus_tag LOCUS_01510 32191 32412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126009.1 protein_id gnl|my_center|LOCUS_01510 32425 32982 gene locus_tag LOCUS_01520 32425 32982 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549688.1 protein_id gnl|my_center|LOCUS_01520 32976 33536 gene locus_tag LOCUS_01530 32976 33536 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549689.1 protein_id gnl|my_center|LOCUS_01530 33554 34339 gene locus_tag LOCUS_01540 33554 34339 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_01540 35066 35785 gene locus_tag LOCUS_01550 gene rsmG 35066 35785 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_01550 35806 36651 gene locus_tag LOCUS_01560 gene noc 35806 36651 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_01560 36654 37427 gene locus_tag LOCUS_01570 36654 37427 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254587.1 protein_id gnl|my_center|LOCUS_01570 37411 38289 gene locus_tag LOCUS_01580 37411 38289 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549701.1 protein_id gnl|my_center|LOCUS_01580 38304 38555 gene locus_tag LOCUS_01590 38304 38555 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549703.1 protein_id gnl|my_center|LOCUS_01590 38568 39671 gene locus_tag LOCUS_01600 gene ychF 38568 39671 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549709.1 protein_id gnl|my_center|LOCUS_01600 39371 39380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 39683 40459 gene locus_tag LOCUS_01610 39683 40459 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363563.1 protein_id gnl|my_center|LOCUS_01610 41063 40512 gene locus_tag LOCUS_01620 41063 40512 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_01620 41146 41781 gene locus_tag LOCUS_01630 gene pcp 41146 41781 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548812.1 protein_id gnl|my_center|LOCUS_01630 >Feature sequence004 1639 224 gene locus_tag LOCUS_01640 1639 224 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_01640 1834 2535 gene locus_tag LOCUS_01650 1834 2535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549550.1 protein_id gnl|my_center|LOCUS_01650 2545 4986 gene locus_tag LOCUS_01660 2545 4986 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613435.1 protein_id gnl|my_center|LOCUS_01660 7323 5038 gene locus_tag LOCUS_01670 7323 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7555 7316 gene locus_tag LOCUS_01680 gene dltC 7555 7316 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549523.1 protein_id gnl|my_center|LOCUS_01680 8818 7601 gene locus_tag LOCUS_01690 gene dltB 8818 7601 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254621.1 protein_id gnl|my_center|LOCUS_01690 10332 8815 gene locus_tag LOCUS_01700 gene dltA 10332 8815 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549519.1 protein_id gnl|my_center|LOCUS_01700 10506 10351 gene locus_tag LOCUS_01710 10506 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 10865 10569 gene locus_tag LOCUS_01720 10865 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12030 10882 gene locus_tag LOCUS_01730 12030 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549513.1 protein_id gnl|my_center|LOCUS_01730 12184 12675 gene locus_tag LOCUS_01740 12184 12675 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549510.1 protein_id gnl|my_center|LOCUS_01740 12861 14021 gene locus_tag LOCUS_01750 12861 14021 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_01750 14716 14069 gene locus_tag LOCUS_01760 14716 14069 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_01760 16044 14734 gene locus_tag LOCUS_01770 16044 14734 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549459.1 protein_id gnl|my_center|LOCUS_01770 16731 16066 gene locus_tag LOCUS_01780 16731 16066 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549464.1 protein_id gnl|my_center|LOCUS_01780 17388 16744 gene locus_tag LOCUS_01790 17388 16744 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549467.1 protein_id gnl|my_center|LOCUS_01790 18213 17509 gene locus_tag LOCUS_01800 gene nagB 18213 17509 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549469.1 protein_id gnl|my_center|LOCUS_01800 18389 19882 gene locus_tag LOCUS_01810 18389 19882 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_01810 20058 21014 gene locus_tag LOCUS_01820 gene hemH 20058 21014 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101341.1 protein_id gnl|my_center|LOCUS_01820 22000 21044 gene locus_tag LOCUS_01830 22000 21044 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549473.1 protein_id gnl|my_center|LOCUS_01830 23112 22000 gene locus_tag LOCUS_01840 23112 22000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549477.1 protein_id gnl|my_center|LOCUS_01840 24659 23121 gene locus_tag LOCUS_01850 24659 23121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549479.1 protein_id gnl|my_center|LOCUS_01850 25797 24709 gene locus_tag LOCUS_01860 25797 24709 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_01860 27030 25933 gene locus_tag LOCUS_01870 27030 25933 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_01870 27375 28685 gene locus_tag LOCUS_01880 27375 28685 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025014283.1 protein_id gnl|my_center|LOCUS_01880 28697 30007 gene locus_tag LOCUS_01890 28697 30007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_01890 31717 30167 gene locus_tag LOCUS_01900 31717 30167 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549425.1 protein_id gnl|my_center|LOCUS_01900 33173 31785 gene locus_tag LOCUS_01910 gene gndA 33173 31785 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254636.1 protein_id gnl|my_center|LOCUS_01910 33412 33340 gene locus_tag LOCUS_t00030 33412 33340 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33560 34246 gene locus_tag LOCUS_01920 33560 34246 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_01920 34253 35419 gene locus_tag LOCUS_01930 34253 35419 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254005.1 protein_id gnl|my_center|LOCUS_01930 36825 35452 gene locus_tag LOCUS_01940 gene dnaB 36825 35452 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549341.1 protein_id gnl|my_center|LOCUS_01940 37286 36831 gene locus_tag LOCUS_01950 gene rplI 37286 36831 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549343.1 protein_id gnl|my_center|LOCUS_01950 39317 37302 gene locus_tag LOCUS_01960 39317 37302 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549345.1 protein_id gnl|my_center|LOCUS_01960 39721 39485 gene locus_tag LOCUS_01970 gene rpsR 39721 39485 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 protein_id gnl|my_center|LOCUS_01970 40205 39750 gene locus_tag LOCUS_01980 gene ssb 40205 39750 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_01980 40537 40241 gene locus_tag LOCUS_01990 gene rpsF 40537 40241 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549370.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence005 374 697 gene locus_tag LOCUS_02000 gene ebrB 374 697 CDS product multidrug efflux SMR transporter subunit EbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245163.1 protein_id gnl|my_center|LOCUS_02000 1290 712 gene locus_tag LOCUS_02010 1290 712 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549069.1 protein_id gnl|my_center|LOCUS_02010 1434 2123 gene locus_tag LOCUS_02020 1434 2123 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549072.1 protein_id gnl|my_center|LOCUS_02020 2138 3025 gene locus_tag LOCUS_02030 2138 3025 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549073.1 protein_id gnl|my_center|LOCUS_02030 3049 3285 gene locus_tag LOCUS_02040 3049 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3288 3488 gene locus_tag LOCUS_02050 3288 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3490 4167 gene locus_tag LOCUS_02060 3490 4167 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721658.1 protein_id gnl|my_center|LOCUS_02060 4231 5166 gene locus_tag LOCUS_02070 4231 5166 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549076.1 protein_id gnl|my_center|LOCUS_02070 6553 5207 gene locus_tag LOCUS_02080 gene pepC 6553 5207 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_02080 6701 7252 gene locus_tag LOCUS_02090 6701 7252 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254121.1 protein_id gnl|my_center|LOCUS_02090 7252 8631 gene locus_tag LOCUS_02100 gene radA 7252 8631 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549080.1 protein_id gnl|my_center|LOCUS_02100 8705 10210 gene locus_tag LOCUS_02110 gene gltX 8705 10210 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254122.1 protein_id gnl|my_center|LOCUS_02110 10331 11743 gene locus_tag LOCUS_02120 gene cysS 10331 11743 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549082.1 protein_id gnl|my_center|LOCUS_02120 11730 12173 gene locus_tag LOCUS_02130 11730 12173 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549083.1 protein_id gnl|my_center|LOCUS_02130 12154 12930 gene locus_tag LOCUS_02140 gene rlmB 12154 12930 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254123.1 protein_id gnl|my_center|LOCUS_02140 13042 13587 gene locus_tag LOCUS_02150 13042 13587 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 protein_id gnl|my_center|LOCUS_02150 14966 13701 gene locus_tag LOCUS_02160 14966 13701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_02160 15105 15254 gene locus_tag LOCUS_02170 gene rpmG 15105 15254 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549092.1 protein_id gnl|my_center|LOCUS_02170 15260 15427 gene locus_tag LOCUS_02180 gene secE 15260 15427 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549093.1 protein_id gnl|my_center|LOCUS_02180 15505 16056 gene locus_tag LOCUS_02190 gene nusG 15505 16056 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549094.1 protein_id gnl|my_center|LOCUS_02190 16198 16623 gene locus_tag LOCUS_02200 gene rplK 16198 16623 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549095.1 protein_id gnl|my_center|LOCUS_02200 16720 16992 gene locus_tag LOCUS_02210 16720 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02210 16916 16925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17046 17384 gene locus_tag LOCUS_02220 17046 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 17627 18127 gene locus_tag LOCUS_02230 gene rplJ 17627 18127 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549105.1 protein_id gnl|my_center|LOCUS_02230 18172 18450 gene locus_tag LOCUS_02240 18172 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 18421 18430 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19783 18500 gene locus_tag LOCUS_02250 19783 18500 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548915.1 protein_id gnl|my_center|LOCUS_02250 20361 19783 gene locus_tag LOCUS_02260 20361 19783 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 protein_id gnl|my_center|LOCUS_02260 20700 22253 gene locus_tag LOCUS_02270 gene guaA 20700 22253 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_02270 22378 22623 gene locus_tag LOCUS_02280 22378 22623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 22714 22938 gene locus_tag LOCUS_02290 22714 22938 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214020.1 protein_id gnl|my_center|LOCUS_02290 22939 24963 gene locus_tag LOCUS_02300 22939 24963 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_02300 24957 26423 gene locus_tag LOCUS_02310 24957 26423 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_02310 26440 27390 gene locus_tag LOCUS_02320 26440 27390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 27769 28722 gene locus_tag LOCUS_02330 27769 28722 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_02330 28940 29950 gene locus_tag LOCUS_02340 28940 29950 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_02340 30722 29952 gene locus_tag LOCUS_02350 30722 29952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 32201 30873 gene locus_tag LOCUS_02360 32201 30873 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703075.1 protein_id gnl|my_center|LOCUS_02360 32515 32766 gene locus_tag LOCUS_02370 32515 32766 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548978.1 protein_id gnl|my_center|LOCUS_02370 32905 34272 gene locus_tag LOCUS_02380 32905 34272 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548990.1 protein_id gnl|my_center|LOCUS_02380 34288 35751 gene locus_tag LOCUS_02390 34288 35751 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548992.1 protein_id gnl|my_center|LOCUS_02390 35874 36230 gene locus_tag LOCUS_02400 gene acpS 35874 36230 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254099.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence006 2443 152 gene locus_tag LOCUS_02410 gene helD 2443 152 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627819.1 protein_id gnl|my_center|LOCUS_02410 4716 2626 gene locus_tag LOCUS_02420 gene fusA 4716 2626 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549022.1 protein_id gnl|my_center|LOCUS_02420 5219 4749 gene locus_tag LOCUS_02430 gene rpsG 5219 4749 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549021.1 protein_id gnl|my_center|LOCUS_02430 5642 5235 gene locus_tag LOCUS_02440 gene rpsL 5642 5235 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549020.1 protein_id gnl|my_center|LOCUS_02440 5816 6322 gene locus_tag LOCUS_02450 5816 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7033 6314 gene locus_tag LOCUS_02460 7033 6314 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029714299.1 protein_id gnl|my_center|LOCUS_02460 8235 7045 gene locus_tag LOCUS_02470 8235 7045 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549671.1 protein_id gnl|my_center|LOCUS_02470 9092 8391 gene locus_tag LOCUS_02480 9092 8391 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549854.1 protein_id gnl|my_center|LOCUS_02480 9791 9240 gene locus_tag LOCUS_02490 9791 9240 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041814911.1 protein_id gnl|my_center|LOCUS_02490 9884 10171 gene locus_tag LOCUS_02500 9884 10171 CDS product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549842.1 protein_id gnl|my_center|LOCUS_02500 10279 10452 gene locus_tag LOCUS_02510 10279 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 10787 10987 gene locus_tag LOCUS_02520 10787 10987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11017 12588 gene locus_tag LOCUS_02530 11017 12588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 protein_id gnl|my_center|LOCUS_02530 12609 14180 gene locus_tag LOCUS_02540 12609 14180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254025.1 protein_id gnl|my_center|LOCUS_02540 15386 14667 gene locus_tag LOCUS_02550 15386 14667 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_02550 16710 15445 gene locus_tag LOCUS_02560 16710 15445 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254086.1 protein_id gnl|my_center|LOCUS_02560 18464 16842 gene locus_tag LOCUS_02570 18464 16842 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254085.1 protein_id gnl|my_center|LOCUS_02570 19117 18572 gene locus_tag LOCUS_02580 gene rpoE 19117 18572 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548904.1 protein_id gnl|my_center|LOCUS_02580 19568 19137 gene locus_tag LOCUS_02590 19568 19137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19708 21084 gene locus_tag LOCUS_02600 19708 21084 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_02600 21805 21113 gene locus_tag LOCUS_02610 21805 21113 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_02610 21994 22437 gene locus_tag LOCUS_02620 21994 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 22505 23305 gene locus_tag LOCUS_02630 22505 23305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 24160 23342 gene locus_tag LOCUS_02640 24160 23342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 24318 24246 gene locus_tag LOCUS_t00040 24318 24246 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25630 24377 gene locus_tag LOCUS_02650 gene tyrS 25630 24377 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548823.1 protein_id gnl|my_center|LOCUS_02650 26485 25871 gene locus_tag LOCUS_02660 26485 25871 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548818.1 protein_id gnl|my_center|LOCUS_02660 <27104 26491 gene locus_tag LOCUS_02670 <27104 26491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548816.1:LCP family protein >Feature sequence007 <1 791 gene locus_tag LOCUS_02680 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550009.1:type I pantothenate kinase 804 1364 gene locus_tag LOCUS_02690 gene efp 804 1364 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550017.1 protein_id gnl|my_center|LOCUS_02690 1523 2803 gene locus_tag LOCUS_02700 gene pepT 1523 2803 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548288.1 protein_id gnl|my_center|LOCUS_02700 2823 3734 gene locus_tag LOCUS_02710 2823 3734 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550055.1 protein_id gnl|my_center|LOCUS_02710 4715 3798 gene locus_tag LOCUS_02720 4715 3798 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548278.1 protein_id gnl|my_center|LOCUS_02720 4887 5795 gene locus_tag LOCUS_02730 4887 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 5817 6659 gene locus_tag LOCUS_02740 5817 6659 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550081.1 protein_id gnl|my_center|LOCUS_02740 7488 6709 gene locus_tag LOCUS_02750 7488 6709 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254520.1 protein_id gnl|my_center|LOCUS_02750 7633 8232 gene locus_tag LOCUS_02760 7633 8232 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550094.1 protein_id gnl|my_center|LOCUS_02760 8236 8733 gene locus_tag LOCUS_02770 8236 8733 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550097.1 protein_id gnl|my_center|LOCUS_02770 8978 10288 gene locus_tag LOCUS_02780 gene serS 8978 10288 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254519.1 protein_id gnl|my_center|LOCUS_02780 10692 12035 gene locus_tag LOCUS_02790 10692 12035 CDS product maltose-6'-phosphate glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549970.1 protein_id gnl|my_center|LOCUS_02790 12119 13741 gene locus_tag LOCUS_02800 12119 13741 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546418.1 protein_id gnl|my_center|LOCUS_02800 14073 14879 gene locus_tag LOCUS_02810 14073 14879 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_02810 14857 15366 gene locus_tag LOCUS_02820 14857 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 15371 15856 gene locus_tag LOCUS_02830 15371 15856 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546424.1 protein_id gnl|my_center|LOCUS_02830 15997 16521 gene locus_tag LOCUS_02840 15997 16521 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254592.1 protein_id gnl|my_center|LOCUS_02840 16525 17580 gene locus_tag LOCUS_02850 16525 17580 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254591.1 protein_id gnl|my_center|LOCUS_02850 17603 18280 gene locus_tag LOCUS_02860 17603 18280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254590.1 protein_id gnl|my_center|LOCUS_02860 18999 18283 gene locus_tag LOCUS_02870 18999 18283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 19146 20015 gene locus_tag LOCUS_02880 19146 20015 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701554.1 protein_id gnl|my_center|LOCUS_02880 20018 20932 gene locus_tag LOCUS_02890 gene pstC 20018 20932 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674325.1 protein_id gnl|my_center|LOCUS_02890 20935 21828 gene locus_tag LOCUS_02900 gene pstA 20935 21828 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641001.1 protein_id gnl|my_center|LOCUS_02900 21828 22595 gene locus_tag LOCUS_02910 gene pstB 21828 22595 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 protein_id gnl|my_center|LOCUS_02910 22607 23359 gene locus_tag LOCUS_02920 gene pstB 22607 23359 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549101.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence008 176 3070 gene locus_tag LOCUS_r00010 176 3070 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3139 3250 gene locus_tag LOCUS_r00020 3139 3250 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3259 3332 gene locus_tag LOCUS_t00050 3259 3332 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4981 3608 gene locus_tag LOCUS_02930 4981 3608 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_02930 5311 7905 gene locus_tag LOCUS_02940 gene adhE 5311 7905 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546132.1 protein_id gnl|my_center|LOCUS_02940 8071 9252 gene locus_tag LOCUS_02950 8071 9252 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 protein_id gnl|my_center|LOCUS_02950 10297 9308 gene locus_tag LOCUS_02960 gene galE 10297 9308 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548187.1 protein_id gnl|my_center|LOCUS_02960 10460 11554 gene locus_tag LOCUS_02970 10460 11554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254531.1 protein_id gnl|my_center|LOCUS_02970 11554 12417 gene locus_tag LOCUS_02980 11554 12417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_02980 12419 13237 gene locus_tag LOCUS_02990 12419 13237 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254529.1 protein_id gnl|my_center|LOCUS_02990 13221 14510 gene locus_tag LOCUS_03000 13221 14510 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550067.1 protein_id gnl|my_center|LOCUS_03000 14549 15838 gene locus_tag LOCUS_03010 14549 15838 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_03010 16236 16568 gene locus_tag LOCUS_03020 16236 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 17090 16575 gene locus_tag LOCUS_03030 17090 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 17953 17090 gene locus_tag LOCUS_03040 17953 17090 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546611.1 protein_id gnl|my_center|LOCUS_03040 18041 18736 gene locus_tag LOCUS_03050 18041 18736 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence009 <1 2119 gene locus_tag LOCUS_03060 <1 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546265.1:calcium-translocating P-type ATPase, PMCA-type 2267 3409 gene locus_tag LOCUS_03070 2267 3409 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_03070 3481 3566 gene locus_tag LOCUS_t00060 3481 3566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3625 4236 gene locus_tag LOCUS_03080 3625 4236 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254627.1 protein_id gnl|my_center|LOCUS_03080 4239 4850 gene locus_tag LOCUS_03090 4239 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4952 7180 gene locus_tag LOCUS_03100 gene pcrA 4952 7180 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_03100 7194 9212 gene locus_tag LOCUS_03110 gene ligA 7194 9212 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546277.1 protein_id gnl|my_center|LOCUS_03110 9218 10348 gene locus_tag LOCUS_03120 9218 10348 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546280.1 protein_id gnl|my_center|LOCUS_03120 10359 10661 gene locus_tag LOCUS_03130 gene gatC 10359 10661 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546283.1 protein_id gnl|my_center|LOCUS_03130 10661 12100 gene locus_tag LOCUS_03140 gene gatA 10661 12100 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546285.1 protein_id gnl|my_center|LOCUS_03140 12104 13546 gene locus_tag LOCUS_03150 gene gatB 12104 13546 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254176.1 protein_id gnl|my_center|LOCUS_03150 12285 12294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13566 14474 gene locus_tag LOCUS_03160 13566 14474 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546288.1 protein_id gnl|my_center|LOCUS_03160 14562 15233 gene locus_tag LOCUS_03170 14562 15233 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548465.1 protein_id gnl|my_center|LOCUS_03170 15989 15276 gene locus_tag LOCUS_03180 15989 15276 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640270.1 protein_id gnl|my_center|LOCUS_03180 17444 16065 gene locus_tag LOCUS_03190 gene nhaC 17444 16065 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546295.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence010 791 2137 gene locus_tag LOCUS_03200 791 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2311 3090 gene locus_tag LOCUS_03210 2311 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3222 4082 gene locus_tag LOCUS_03220 3222 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4544 4119 gene locus_tag LOCUS_03230 4544 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5100 4606 gene locus_tag LOCUS_03240 5100 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5317 5715 gene locus_tag LOCUS_03250 gene spxA 5317 5715 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_03250 5797 6582 gene locus_tag LOCUS_03260 5797 6582 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_03260 6660 7529 gene locus_tag LOCUS_03270 6660 7529 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_03270 8139 7522 gene locus_tag LOCUS_03280 8139 7522 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_03280 8818 8204 gene locus_tag LOCUS_03290 8818 8204 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_03290 8896 9522 gene locus_tag LOCUS_03300 8896 9522 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_03300 9519 10328 gene locus_tag LOCUS_03310 9519 10328 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_03310 10321 11223 gene locus_tag LOCUS_03320 10321 11223 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_03320 12096 11263 gene locus_tag LOCUS_03330 12096 11263 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 protein_id gnl|my_center|LOCUS_03330 13103 12105 gene locus_tag LOCUS_03340 13103 12105 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_03340 13087 13096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13270 13650 gene locus_tag LOCUS_03350 13270 13650 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101685.1 protein_id gnl|my_center|LOCUS_03350 13660 14802 gene locus_tag LOCUS_03360 13660 14802 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_03360 14903 15415 gene locus_tag LOCUS_03370 14903 15415 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_03370 15426 15833 gene locus_tag LOCUS_03380 15426 15833 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence011 <1 521 gene locus_tag LOCUS_03390 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254134.1:dTMP kinase 538 1395 gene locus_tag LOCUS_03400 538 1395 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549117.1 protein_id gnl|my_center|LOCUS_03400 1411 1764 gene locus_tag LOCUS_03410 gene yabA 1411 1764 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254135.1 protein_id gnl|my_center|LOCUS_03410 1767 2621 gene locus_tag LOCUS_03420 gene rsmI 1767 2621 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549119.1 protein_id gnl|my_center|LOCUS_03420 2631 3350 gene locus_tag LOCUS_03430 2631 3350 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254136.1 protein_id gnl|my_center|LOCUS_03430 3364 4101 gene locus_tag LOCUS_03440 gene tsaB 3364 4101 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549123.1 protein_id gnl|my_center|LOCUS_03440 4130 4612 gene locus_tag LOCUS_03450 gene rimI 4130 4612 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549125.1 protein_id gnl|my_center|LOCUS_03450 4632 5678 gene locus_tag LOCUS_03460 gene tsaD 4632 5678 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549127.1 protein_id gnl|my_center|LOCUS_03460 5710 6399 gene locus_tag LOCUS_03470 5710 6399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549720.1 protein_id gnl|my_center|LOCUS_03470 6389 7570 gene locus_tag LOCUS_03480 6389 7570 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549721.1 protein_id gnl|my_center|LOCUS_03480 7605 9164 gene locus_tag LOCUS_03490 7605 9164 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254584.1 protein_id gnl|my_center|LOCUS_03490 9188 9934 gene locus_tag LOCUS_03500 9188 9934 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549723.1 protein_id gnl|my_center|LOCUS_03500 10679 9987 gene locus_tag LOCUS_03510 10679 9987 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_03510 12070 10682 gene locus_tag LOCUS_03520 12070 10682 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_03520 13899 12745 gene locus_tag LOCUS_03530 13899 12745 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705504.1 protein_id gnl|my_center|LOCUS_03530 14467 13889 gene locus_tag LOCUS_03540 14467 13889 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254070.1 protein_id gnl|my_center|LOCUS_03540 16493 14991 gene locus_tag LOCUS_03550 16493 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence012 128 847 gene locus_tag LOCUS_03560 128 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 890 1207 gene locus_tag LOCUS_03570 890 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1234 2550 gene locus_tag LOCUS_03580 1234 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3637 2933 gene locus_tag LOCUS_03590 3637 2933 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102245.1 protein_id gnl|my_center|LOCUS_03590 5479 3914 gene locus_tag LOCUS_03600 5479 3914 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102243.1 protein_id gnl|my_center|LOCUS_03600 5815 5498 gene locus_tag LOCUS_03610 5815 5498 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102242.1 protein_id gnl|my_center|LOCUS_03610 6294 5824 gene locus_tag LOCUS_03620 6294 5824 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102241.1 protein_id gnl|my_center|LOCUS_03620 6457 7221 gene locus_tag LOCUS_03630 6457 7221 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102240.1 protein_id gnl|my_center|LOCUS_03630 7932 7366 gene locus_tag LOCUS_03640 7932 7366 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_03640 9584 7956 gene locus_tag LOCUS_03650 9584 7956 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548498.1 protein_id gnl|my_center|LOCUS_03650 12020 9606 gene locus_tag LOCUS_03660 gene leuS 12020 9606 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548508.1 protein_id gnl|my_center|LOCUS_03660 13720 12317 gene locus_tag LOCUS_03670 13720 12317 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548513.1 protein_id gnl|my_center|LOCUS_03670 14981 13776 gene locus_tag LOCUS_03680 gene metK 14981 13776 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548514.1 protein_id gnl|my_center|LOCUS_03680 15087 14938 gene locus_tag LOCUS_03690 15087 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 15175 15101 gene locus_tag LOCUS_t00070 15175 15101 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15251 15178 gene locus_tag LOCUS_t00080 15251 15178 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15440 15349 gene locus_tag LOCUS_t00090 15440 15349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence013 236 421 gene locus_tag LOCUS_03700 gene rpmD 236 421 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549042.1 protein_id gnl|my_center|LOCUS_03700 452 892 gene locus_tag LOCUS_03710 gene rplO 452 892 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549043.1 protein_id gnl|my_center|LOCUS_03710 892 2196 gene locus_tag LOCUS_03720 gene secY 892 2196 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549044.1 protein_id gnl|my_center|LOCUS_03720 2206 2856 gene locus_tag LOCUS_03730 2206 2856 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549045.1 protein_id gnl|my_center|LOCUS_03730 2932 3153 gene locus_tag LOCUS_03740 gene infA 2932 3153 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878178.1 protein_id gnl|my_center|LOCUS_03740 3317 3667 gene locus_tag LOCUS_03750 gene rpsM 3317 3667 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549046.1 protein_id gnl|my_center|LOCUS_03750 3688 4077 gene locus_tag LOCUS_03760 gene rpsK 3688 4077 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613292.1 protein_id gnl|my_center|LOCUS_03760 4123 5061 gene locus_tag LOCUS_03770 4123 5061 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549048.1 protein_id gnl|my_center|LOCUS_03770 5086 5469 gene locus_tag LOCUS_03780 gene rplQ 5086 5469 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549049.1 protein_id gnl|my_center|LOCUS_03780 5654 6502 gene locus_tag LOCUS_03790 5654 6502 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549050.1 protein_id gnl|my_center|LOCUS_03790 6478 7329 gene locus_tag LOCUS_03800 6478 7329 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549051.1 protein_id gnl|my_center|LOCUS_03800 7330 8127 gene locus_tag LOCUS_03810 7330 8127 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288724.1 protein_id gnl|my_center|LOCUS_03810 8128 8910 gene locus_tag LOCUS_03820 gene truA 8128 8910 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549053.1 protein_id gnl|my_center|LOCUS_03820 8907 9455 gene locus_tag LOCUS_03830 gene rplM 8907 9455 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549054.1 protein_id gnl|my_center|LOCUS_03830 9469 9864 gene locus_tag LOCUS_03840 gene rpsI 9469 9864 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence014 2026 809 gene locus_tag LOCUS_03850 2026 809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_03850 2582 2412 gene locus_tag LOCUS_03860 2582 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3685 3332 gene locus_tag LOCUS_03870 3685 3332 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227347.1 protein_id gnl|my_center|LOCUS_03870 4190 4615 gene locus_tag LOCUS_03880 4190 4615 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804885.1 protein_id gnl|my_center|LOCUS_03880 4612 4842 gene locus_tag LOCUS_03890 4612 4842 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002334012.1 protein_id gnl|my_center|LOCUS_03890 5308 5511 gene locus_tag LOCUS_03900 5308 5511 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814511.1 protein_id gnl|my_center|LOCUS_03900 5593 6810 gene locus_tag LOCUS_03910 5593 6810 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291561.1 protein_id gnl|my_center|LOCUS_03910 7468 6995 gene locus_tag LOCUS_03920 7468 6995 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_03920 7810 7526 gene locus_tag LOCUS_03930 7810 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 9372 8065 gene locus_tag LOCUS_03940 9372 8065 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_03940 10057 9446 gene locus_tag LOCUS_03950 gene rpsD 10057 9446 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_03950 10340 12043 gene locus_tag LOCUS_03960 gene ezrA 10340 12043 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_03960 12144 12638 gene locus_tag LOCUS_03970 12144 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 12610 12619 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12661 13287 gene locus_tag LOCUS_03980 12661 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 13298 14515 gene locus_tag LOCUS_03990 gene thiI 13298 14515 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence015 884 123 gene locus_tag LOCUS_04000 884 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1773 847 gene locus_tag LOCUS_04010 1773 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1966 1745 gene locus_tag LOCUS_04020 1966 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2829 1975 gene locus_tag LOCUS_04030 2829 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3839 2856 gene locus_tag LOCUS_04040 3839 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4905 3832 gene locus_tag LOCUS_04050 4905 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5184 5023 gene locus_tag LOCUS_04060 5184 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5372 5932 gene locus_tag LOCUS_04070 5372 5932 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896831.1 protein_id gnl|my_center|LOCUS_04070 7404 6208 gene locus_tag LOCUS_04080 gene coaBC 7404 6208 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_04080 11192 7527 gene locus_tag LOCUS_04090 gene rpoC 11192 7527 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254109.1 protein_id gnl|my_center|LOCUS_04090 <13520 11211 gene locus_tag LOCUS_04100 <13520 11211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254108.1:DNA-directed RNA polymerase subunit beta >Feature sequence016 2332 641 gene locus_tag LOCUS_04110 2332 641 CDS product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027021.1 protein_id gnl|my_center|LOCUS_04110 2648 2337 gene locus_tag LOCUS_04120 2648 2337 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082802.1 protein_id gnl|my_center|LOCUS_04120 4071 3064 gene locus_tag LOCUS_04130 4071 3064 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476534.1 protein_id gnl|my_center|LOCUS_04130 5737 4064 gene locus_tag LOCUS_04140 5737 4064 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701646.1 protein_id gnl|my_center|LOCUS_04140 6156 5734 gene locus_tag LOCUS_04150 6156 5734 CDS product PTS N-acetylglucosamine transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700930.1 protein_id gnl|my_center|LOCUS_04150 7007 6171 gene locus_tag LOCUS_04160 7007 6171 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476535.1 protein_id gnl|my_center|LOCUS_04160 7788 7000 gene locus_tag LOCUS_04170 7788 7000 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700927.1 protein_id gnl|my_center|LOCUS_04170 8282 7791 gene locus_tag LOCUS_04180 8282 7791 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700926.1 protein_id gnl|my_center|LOCUS_04180 9824 8577 gene locus_tag LOCUS_04190 9824 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 11644 9788 gene locus_tag LOCUS_04200 11644 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 11721 12425 gene locus_tag LOCUS_04210 11721 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence017 89 970 gene locus_tag LOCUS_04220 89 970 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_04220 1430 1152 gene locus_tag LOCUS_04230 1430 1152 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_04230 3626 1485 gene locus_tag LOCUS_04240 3626 1485 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_04240 3757 3930 gene locus_tag LOCUS_04250 3757 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4058 4324 gene locus_tag LOCUS_04260 4058 4324 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_04260 4324 6060 gene locus_tag LOCUS_04270 gene ptsP 4324 6060 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_04270 6665 6189 gene locus_tag LOCUS_04280 6665 6189 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_04280 6867 8426 gene locus_tag LOCUS_04290 gene vly 6867 8426 CDS product cholesterol-dependent cytolysin vaginolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947087.1 protein_id gnl|my_center|LOCUS_04290 8658 10166 gene locus_tag LOCUS_04300 8658 10166 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_04300 10156 10602 gene locus_tag LOCUS_04310 10156 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 10602 11615 gene locus_tag LOCUS_04320 10602 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 11728 12717 gene locus_tag LOCUS_04330 11728 12717 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence018 823 104 gene locus_tag LOCUS_04340 823 104 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_04340 1396 839 gene locus_tag LOCUS_04350 gene frr 1396 839 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_04350 2121 1396 gene locus_tag LOCUS_04360 gene pyrH 2121 1396 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_04360 3917 2277 gene locus_tag LOCUS_04370 3917 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5092 4058 gene locus_tag LOCUS_04380 5092 4058 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_04380 5152 5766 gene locus_tag LOCUS_04390 5152 5766 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_04390 7610 5814 gene locus_tag LOCUS_04400 7610 5814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_04400 9366 7600 gene locus_tag LOCUS_04410 9366 7600 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_04410 9656 9441 gene locus_tag LOCUS_04420 9656 9441 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_04420 9967 9722 gene locus_tag LOCUS_04430 9967 9722 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_04430 10091 10675 gene locus_tag LOCUS_04440 gene lexA 10091 10675 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_04440 11501 10842 gene locus_tag LOCUS_04450 11501 10842 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644407.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 11989 11639 gene locus_tag LOCUS_04460 gene rplS 11989 11639 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_04460 12407 12108 gene locus_tag LOCUS_04470 12407 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04470 >Feature sequence019 782 81 gene locus_tag LOCUS_04480 gene lgt 782 81 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_04480 1868 930 gene locus_tag LOCUS_04490 gene hprK 1868 930 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_04490 2168 1872 gene locus_tag LOCUS_04500 2168 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3183 2185 gene locus_tag LOCUS_04510 gene prfB 3183 2185 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_04510 5742 3343 gene locus_tag LOCUS_04520 gene secA 5742 3343 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_04520 6462 5905 gene locus_tag LOCUS_04530 gene raiA 6462 5905 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_04530 7226 6543 gene locus_tag LOCUS_04540 7226 6543 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_04540 8490 7204 gene locus_tag LOCUS_04550 8490 7204 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_04550 8534 9199 gene locus_tag LOCUS_04560 8534 9199 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_04560 10382 9246 gene locus_tag LOCUS_04570 10382 9246 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_04570 12117 10477 gene locus_tag LOCUS_04580 gene rny 12117 10477 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_04580 11969 11978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence020 2379 988 gene locus_tag LOCUS_04590 2379 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4478 2511 gene locus_tag LOCUS_04600 4478 2511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489378.1 protein_id gnl|my_center|LOCUS_04600 5233 4478 gene locus_tag LOCUS_04610 5233 4478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_04610 6251 5334 gene locus_tag LOCUS_04620 6251 5334 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 protein_id gnl|my_center|LOCUS_04620 6924 6256 gene locus_tag LOCUS_04630 6924 6256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027525.1 protein_id gnl|my_center|LOCUS_04630 8316 7024 gene locus_tag LOCUS_04640 8316 7024 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550069.1 protein_id gnl|my_center|LOCUS_04640 8587 8513 gene locus_tag LOCUS_t00100 8587 8513 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10669 8726 gene locus_tag LOCUS_04650 10669 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8982 9103 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgctagttactacacctgc 12390 10864 gene locus_tag LOCUS_04660 12390 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence021 1 672 gene locus_tag LOCUS_04670 1 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 684 1919 gene locus_tag LOCUS_04680 gene codA 684 1919 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 protein_id gnl|my_center|LOCUS_04680 2720 1989 gene locus_tag LOCUS_04690 2720 1989 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_04690 3694 2903 gene locus_tag LOCUS_04700 3694 2903 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_04700 3848 3675 gene locus_tag LOCUS_04710 3848 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4521 4225 gene locus_tag LOCUS_04720 4521 4225 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565490.1 protein_id gnl|my_center|LOCUS_04720 4791 5663 gene locus_tag LOCUS_04730 4791 5663 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254571.1 protein_id gnl|my_center|LOCUS_04730 6065 5715 gene locus_tag LOCUS_04740 gene crcB 6065 5715 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_04740 6463 6065 gene locus_tag LOCUS_04750 6463 6065 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_04750 8003 6483 gene locus_tag LOCUS_04760 8003 6483 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549839.1 protein_id gnl|my_center|LOCUS_04760 9921 8110 gene locus_tag LOCUS_04770 gene glmS 9921 8110 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_04770 11413 10112 gene locus_tag LOCUS_04780 gene glmM 11413 10112 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_04780 11904 11437 gene locus_tag LOCUS_04790 11904 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04790 11965 11974 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence022 <1 565 gene locus_tag LOCUS_04800 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546776.1:rod shape-determining protein 615 1463 gene locus_tag LOCUS_04810 gene mreC 615 1463 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_04810 1463 1990 gene locus_tag LOCUS_04820 1463 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2282 2617 gene locus_tag LOCUS_04830 2282 2617 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_04830 2781 3212 gene locus_tag LOCUS_04840 gene mraZ 2781 3212 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_04840 3209 4153 gene locus_tag LOCUS_04850 gene rsmH 3209 4153 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_04850 4181 4546 gene locus_tag LOCUS_04860 gene ftsL 4181 4546 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_04860 4543 5145 gene locus_tag LOCUS_04870 4543 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 5121 5130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5180 6709 gene locus_tag LOCUS_04880 5180 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 6718 7677 gene locus_tag LOCUS_04890 gene mraY 6718 7677 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_04890 7691 7951 gene locus_tag LOCUS_04900 7691 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 7911 9053 gene locus_tag LOCUS_04910 gene murD 7911 9053 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 7917 7926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9056 10168 gene locus_tag LOCUS_04920 gene murG 9056 10168 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_04920 10197 11033 gene locus_tag LOCUS_04930 10197 11033 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence023 825 583 gene locus_tag LOCUS_04940 825 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04940 1353 907 gene locus_tag LOCUS_04950 1353 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 1851 1399 gene locus_tag LOCUS_04960 1851 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04960 2462 1848 gene locus_tag LOCUS_04970 2462 1848 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 protein_id gnl|my_center|LOCUS_04970 3920 2961 gene locus_tag LOCUS_04980 3920 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4386 4565 gene locus_tag LOCUS_04990 4386 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4656 4919 gene locus_tag LOCUS_05000 4656 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05000 4946 5179 gene locus_tag LOCUS_05010 4946 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05010 5213 5395 gene locus_tag LOCUS_05020 5213 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05020 6063 5449 gene locus_tag LOCUS_05030 6063 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05030 6642 7049 gene locus_tag LOCUS_05040 6642 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7042 7263 gene locus_tag LOCUS_05050 7042 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7438 7776 gene locus_tag LOCUS_05060 7438 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 7854 8339 gene locus_tag LOCUS_05070 7854 8339 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574859.1 protein_id gnl|my_center|LOCUS_05070 8537 8971 gene locus_tag LOCUS_05080 8537 8971 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_05080 9140 9721 gene locus_tag LOCUS_05090 9140 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_05090 9778 9942 gene locus_tag LOCUS_05100 9778 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05100 9920 10096 gene locus_tag LOCUS_05110 9920 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05110 10476 10291 gene locus_tag LOCUS_05120 10476 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence024 <1 1267 gene locus_tag LOCUS_05130 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262245.1:ABC transporter permease/substrate-binding protein 1385 3322 gene locus_tag LOCUS_05140 1385 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5586 3328 gene locus_tag LOCUS_05150 5586 3328 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_05150 5709 5795 gene locus_tag LOCUS_t00110 5709 5795 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5891 6445 gene locus_tag LOCUS_05160 5891 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6590 7759 gene locus_tag LOCUS_05170 gene eno 6590 7759 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546959.1 protein_id gnl|my_center|LOCUS_05170 7065 7074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7895 9766 gene locus_tag LOCUS_05180 7895 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9784 10032 gene locus_tag LOCUS_05190 9784 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 >Feature sequence025 1475 1209 gene locus_tag LOCUS_05200 1475 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1724 1512 gene locus_tag LOCUS_05210 1724 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1923 2357 gene locus_tag LOCUS_05220 1923 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548785.1 protein_id gnl|my_center|LOCUS_05220 2470 4542 gene locus_tag LOCUS_05230 2470 4542 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254197.1 protein_id gnl|my_center|LOCUS_05230 4656 5840 gene locus_tag LOCUS_05240 4656 5840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675074.1 protein_id gnl|my_center|LOCUS_05240 6690 5899 gene locus_tag LOCUS_05250 6690 5899 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613417.1 protein_id gnl|my_center|LOCUS_05250 7347 6694 gene locus_tag LOCUS_05260 7347 6694 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254570.1 protein_id gnl|my_center|LOCUS_05260 8158 7370 gene locus_tag LOCUS_05270 8158 7370 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367542.1 protein_id gnl|my_center|LOCUS_05270 8416 8237 gene locus_tag LOCUS_05280 8416 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 8737 8946 gene locus_tag LOCUS_05290 8737 8946 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_05290 10152 9037 gene locus_tag LOCUS_05300 10152 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence026 1124 783 gene locus_tag LOCUS_05310 1124 783 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_05310 2908 1229 gene locus_tag LOCUS_05320 gene recN 2908 1229 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_05320 3733 2921 gene locus_tag LOCUS_05330 3733 2921 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_05330 4599 3733 gene locus_tag LOCUS_05340 4599 3733 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_05340 4844 4602 gene locus_tag LOCUS_05350 4844 4602 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_05350 6195 4837 gene locus_tag LOCUS_05360 gene xseA 6195 4837 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_05360 7039 6185 gene locus_tag LOCUS_05370 7039 6185 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_05370 7492 7091 gene locus_tag LOCUS_05380 gene nusB 7492 7091 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_05380 7680 7492 gene locus_tag LOCUS_05390 7680 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 7895 7710 gene locus_tag LOCUS_05400 7895 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 7764 7773 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8488 7928 gene locus_tag LOCUS_05410 gene efp 8488 7928 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_05410 9381 8572 gene locus_tag LOCUS_05420 9381 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05420 9689 9432 gene locus_tag LOCUS_05430 9689 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05430 9435 9444 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence027 1216 608 gene locus_tag LOCUS_05440 1216 608 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368971.1 protein_id gnl|my_center|LOCUS_05440 1497 1339 gene locus_tag LOCUS_05450 1497 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1838 1671 gene locus_tag LOCUS_05460 1838 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 2172 1825 gene locus_tag LOCUS_05470 2172 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2648 2451 gene locus_tag LOCUS_05480 2648 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2898 2653 gene locus_tag LOCUS_05490 2898 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3926 3564 gene locus_tag LOCUS_tm00010 3926 3564 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5175 3964 gene locus_tag LOCUS_05500 5175 3964 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548234.1 protein_id gnl|my_center|LOCUS_05500 5185 5194 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6197 5196 gene locus_tag LOCUS_05510 6197 5196 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_05510 6467 6288 gene locus_tag LOCUS_05520 6467 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6936 6445 gene locus_tag LOCUS_05530 6936 6445 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_05530 7141 6923 gene locus_tag LOCUS_05540 7141 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 7562 7131 gene locus_tag LOCUS_05550 7562 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 7872 7546 gene locus_tag LOCUS_05560 gene comGC 7872 7546 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_05560 8884 7886 gene locus_tag LOCUS_05570 8884 7886 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence028 <1 594 gene locus_tag LOCUS_05580 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546733.1:Mur ligase family protein 1610 597 gene locus_tag LOCUS_05590 1610 597 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_05590 1736 1809 gene locus_tag LOCUS_t00120 1736 1809 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1813 1885 gene locus_tag LOCUS_t00130 1813 1885 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3177 1948 gene locus_tag LOCUS_05600 3177 1948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549790.1 protein_id gnl|my_center|LOCUS_05600 4067 3174 gene locus_tag LOCUS_05610 4067 3174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549788.1 protein_id gnl|my_center|LOCUS_05610 5499 4159 gene locus_tag LOCUS_05620 5499 4159 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_05620 5721 7901 gene locus_tag LOCUS_05630 5721 7901 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_05630 8730 8017 gene locus_tag LOCUS_05640 8730 8017 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254236.1 protein_id gnl|my_center|LOCUS_05640 9121 8732 gene locus_tag LOCUS_05650 9121 8732 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584155.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence029 1594 2700 gene locus_tag LOCUS_05660 1594 2700 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549814.1 protein_id gnl|my_center|LOCUS_05660 3316 2732 gene locus_tag LOCUS_05670 3316 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3501 3890 gene locus_tag LOCUS_05680 3501 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549816.1 protein_id gnl|my_center|LOCUS_05680 3883 4479 gene locus_tag LOCUS_05690 3883 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 4425 4434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4448 4672 gene locus_tag LOCUS_05700 4448 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05700 4674 5126 gene locus_tag LOCUS_05710 4674 5126 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549820.1 protein_id gnl|my_center|LOCUS_05710 5428 5889 gene locus_tag LOCUS_05720 5428 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254564.1 protein_id gnl|my_center|LOCUS_05720 5912 6541 gene locus_tag LOCUS_05730 5912 6541 CDS product LVIS_2131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549837.1 protein_id gnl|my_center|LOCUS_05730 6587 7201 gene locus_tag LOCUS_05740 6587 7201 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254130.1 protein_id gnl|my_center|LOCUS_05740 7220 7696 gene locus_tag LOCUS_05750 gene tadA 7220 7696 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence030 1902 1153 gene locus_tag LOCUS_05760 1902 1153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_05760 1993 2430 gene locus_tag LOCUS_05770 1993 2430 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_05770 2442 2753 gene locus_tag LOCUS_05780 2442 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2844 3737 gene locus_tag LOCUS_05790 2844 3737 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_05790 4841 3864 gene locus_tag LOCUS_05800 4841 3864 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_05800 7239 4843 gene locus_tag LOCUS_05810 7239 4843 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_05810 8446 7223 gene locus_tag LOCUS_05820 8446 7223 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_05820 8806 8456 gene locus_tag LOCUS_05830 8806 8456 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence031 955 659 gene locus_tag LOCUS_05840 955 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2932 1322 gene locus_tag LOCUS_05850 2932 1322 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108415.1 protein_id gnl|my_center|LOCUS_05850 3734 2964 gene locus_tag LOCUS_05860 3734 2964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485509.1 protein_id gnl|my_center|LOCUS_05860 4510 3752 gene locus_tag LOCUS_05870 4510 3752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645053.1 protein_id gnl|my_center|LOCUS_05870 5390 4500 gene locus_tag LOCUS_05880 5390 4500 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287087.1 protein_id gnl|my_center|LOCUS_05880 8061 5392 gene locus_tag LOCUS_05890 gene lanKC 8061 5392 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127742798.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence032 392 2956 gene locus_tag LOCUS_05900 gene mutS 392 2956 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_05900 2962 4839 gene locus_tag LOCUS_05910 gene mutL 2962 4839 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_05910 4861 5445 gene locus_tag LOCUS_05920 gene ruvA 4861 5445 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_05920 5462 6466 gene locus_tag LOCUS_05930 gene ruvB 5462 6466 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_05930 6527 6883 gene locus_tag LOCUS_05940 gene yajC 6527 6883 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 protein_id gnl|my_center|LOCUS_05940 6988 8436 gene locus_tag LOCUS_05950 gene zwf 6988 8436 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence033 135 509 gene locus_tag LOCUS_05960 135 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3159 3168 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence034 <1 543 gene locus_tag LOCUS_05970 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254264.1:translational GTPase TypA 687 1889 gene locus_tag LOCUS_05980 687 1889 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_05980 1867 2199 gene locus_tag LOCUS_05990 1867 2199 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_05990 2202 2750 gene locus_tag LOCUS_06000 gene rsmD 2202 2750 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_06000 2737 3234 gene locus_tag LOCUS_06010 gene coaD 2737 3234 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_06010 3236 4267 gene locus_tag LOCUS_06020 3236 4267 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_06020 4310 4942 gene locus_tag LOCUS_06030 4310 4942 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_06030 4911 7190 gene locus_tag LOCUS_06040 4911 7190 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_06040 7187 8173 gene locus_tag LOCUS_06050 gene holA 7187 8173 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_06050 8478 8224 gene locus_tag LOCUS_06060 gene rpsT 8478 8224 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence035 2993 1815 gene locus_tag LOCUS_06070 2993 1815 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 protein_id gnl|my_center|LOCUS_06070 3620 3111 gene locus_tag LOCUS_06080 3620 3111 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700992.1 protein_id gnl|my_center|LOCUS_06080 4464 3610 gene locus_tag LOCUS_06090 4464 3610 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262821.1 protein_id gnl|my_center|LOCUS_06090 4553 4478 gene locus_tag LOCUS_t00140 4553 4478 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4662 4591 gene locus_tag LOCUS_t00150 4662 4591 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6227 4716 gene locus_tag LOCUS_06100 gene lysS 6227 4716 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254107.1 protein_id gnl|my_center|LOCUS_06100 7180 6245 gene locus_tag LOCUS_06110 gene dusB 7180 6245 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254106.1 protein_id gnl|my_center|LOCUS_06110 8426 7320 gene locus_tag LOCUS_06120 8426 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 >Feature sequence036 <1 1335 gene locus_tag LOCUS_06130 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116440412.1:CRISPR-associated helicase Cas3' 1322 3010 gene locus_tag LOCUS_06140 1322 3010 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_06140 3020 3607 gene locus_tag LOCUS_06150 3020 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3610 4686 gene locus_tag LOCUS_06160 gene cas7e 3610 4686 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_06160 4703 5440 gene locus_tag LOCUS_06170 gene cas5e 4703 5440 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994022.1 protein_id gnl|my_center|LOCUS_06170 5449 6108 gene locus_tag LOCUS_06180 gene cas6e 5449 6108 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 protein_id gnl|my_center|LOCUS_06180 6105 6485 gene locus_tag LOCUS_06190 6105 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 6463 7032 gene locus_tag LOCUS_06200 6463 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 7033 7932 gene locus_tag LOCUS_06210 gene cas2e 7033 7932 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_06210 7987 8198 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtatttcccgcacatgcgggggtgatcct >Feature sequence037 495 1490 gene locus_tag LOCUS_06220 gene dhaK 495 1490 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 protein_id gnl|my_center|LOCUS_06220 1503 2087 gene locus_tag LOCUS_06230 gene dhaL 1503 2087 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548127.1 protein_id gnl|my_center|LOCUS_06230 2084 2452 gene locus_tag LOCUS_06240 gene dhaM 2084 2452 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 protein_id gnl|my_center|LOCUS_06240 3505 2633 gene locus_tag LOCUS_06250 3505 2633 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576514.1 protein_id gnl|my_center|LOCUS_06250 4366 3689 gene locus_tag LOCUS_06260 4366 3689 CDS product DUF4867 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674235.1 protein_id gnl|my_center|LOCUS_06260 4954 4379 gene locus_tag LOCUS_06270 gene lacB 4954 4379 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674238.1 protein_id gnl|my_center|LOCUS_06270 5400 4972 gene locus_tag LOCUS_06280 gene lacA 5400 4972 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573960.1 protein_id gnl|my_center|LOCUS_06280 6168 5410 gene locus_tag LOCUS_06290 6168 5410 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 protein_id gnl|my_center|LOCUS_06290 7277 6285 gene locus_tag LOCUS_06300 7277 6285 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567744.1 protein_id gnl|my_center|LOCUS_06300 8205 7378 gene locus_tag LOCUS_06310 8205 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence038 138 395 gene locus_tag LOCUS_06320 138 395 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_06320 395 826 gene locus_tag LOCUS_06330 gene ruvX 395 826 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_06330 833 1144 gene locus_tag LOCUS_06340 833 1144 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_06340 1252 3612 gene locus_tag LOCUS_06350 1252 3612 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_06350 3709 4020 gene locus_tag LOCUS_06360 gene trxA 3709 4020 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_06360 4545 4147 gene locus_tag LOCUS_06370 4545 4147 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_06370 4641 5426 gene locus_tag LOCUS_06380 gene murI 4641 5426 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_06380 5444 6064 gene locus_tag LOCUS_06390 5444 6064 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_06390 6935 6090 gene locus_tag LOCUS_06400 6935 6090 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_06400 7060 7497 gene locus_tag LOCUS_06410 7060 7497 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129531.1 protein_id gnl|my_center|LOCUS_06410 7512 7841 gene locus_tag LOCUS_06420 7512 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence039 149 1057 gene locus_tag LOCUS_06430 149 1057 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_06430 1168 1251 gene locus_tag LOCUS_t00160 1168 1251 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1257 1330 gene locus_tag LOCUS_t00170 1257 1330 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1461 2162 gene locus_tag LOCUS_06440 1461 2162 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546250.1 protein_id gnl|my_center|LOCUS_06440 3515 2262 gene locus_tag LOCUS_06450 3515 2262 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775182.1 protein_id gnl|my_center|LOCUS_06450 4133 3744 gene locus_tag LOCUS_06460 gene tagD 4133 3744 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254173.1 protein_id gnl|my_center|LOCUS_06460 4271 5404 gene locus_tag LOCUS_06470 4271 5404 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546266.1 protein_id gnl|my_center|LOCUS_06470 5419 6846 gene locus_tag LOCUS_06480 5419 6846 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254175.1 protein_id gnl|my_center|LOCUS_06480 6850 7575 gene locus_tag LOCUS_06490 6850 7575 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546254.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence040 2680 1598 gene locus_tag LOCUS_06500 gene carA 2680 1598 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548026.1 protein_id gnl|my_center|LOCUS_06500 3957 2680 gene locus_tag LOCUS_06510 3957 2680 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254442.1 protein_id gnl|my_center|LOCUS_06510 4898 3957 gene locus_tag LOCUS_06520 4898 3957 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548032.1 protein_id gnl|my_center|LOCUS_06520 5579 5037 gene locus_tag LOCUS_06530 gene pyrR 5579 5037 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548034.1 protein_id gnl|my_center|LOCUS_06530 6545 5625 gene locus_tag LOCUS_06540 6545 5625 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_06540 <7768 6551 gene locus_tag LOCUS_06550 <7768 6551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288985.1:MFS transporter >Feature sequence041 1199 3739 gene locus_tag LOCUS_06560 1199 3739 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 protein_id gnl|my_center|LOCUS_06560 3817 3890 gene locus_tag LOCUS_t00180 3817 3890 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4064 4213 gene locus_tag LOCUS_06570 gene rpmG 4064 4213 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_06570 4270 4821 gene locus_tag LOCUS_06580 4270 4821 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 protein_id gnl|my_center|LOCUS_06580 4835 5533 gene locus_tag LOCUS_06590 4835 5533 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_06590 5533 5751 gene locus_tag LOCUS_06600 5533 5751 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 protein_id gnl|my_center|LOCUS_06600 5786 6187 gene locus_tag LOCUS_06610 5786 6187 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_06610 6421 6242 gene locus_tag LOCUS_06620 6421 6242 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564621.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence042 3559 575 gene locus_tag LOCUS_06630 3559 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5236 3665 gene locus_tag LOCUS_06640 5236 3665 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_06640 6111 5236 gene locus_tag LOCUS_06650 6111 5236 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_06650 6191 6664 gene locus_tag LOCUS_06660 6191 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence043 2458 437 gene locus_tag LOCUS_06670 gene recG 2458 437 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_06670 3749 2460 gene locus_tag LOCUS_06680 3749 2460 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 4123 3809 gene locus_tag LOCUS_06690 4123 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 4506 4147 gene locus_tag LOCUS_06700 4506 4147 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_06700 4682 4867 gene locus_tag LOCUS_06710 gene rpmB 4682 4867 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_06710 5702 5043 gene locus_tag LOCUS_06720 5702 5043 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546369.1 protein_id gnl|my_center|LOCUS_06720 6350 5712 gene locus_tag LOCUS_06730 6350 5712 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 protein_id gnl|my_center|LOCUS_06730 <6970 6347 gene locus_tag LOCUS_06740 <6970 6347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546367.1:transporter substrate-binding domain-containing protein >Feature sequence044 1356 2228 gene locus_tag LOCUS_06750 1356 2228 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_06750 2918 2322 gene locus_tag LOCUS_06760 2918 2322 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_06760 3360 3094 gene locus_tag LOCUS_06770 3360 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06770 3575 3727 gene locus_tag LOCUS_06780 3575 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3628 3637 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4004 3840 gene locus_tag LOCUS_06790 4004 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 4725 4291 gene locus_tag LOCUS_06800 4725 4291 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185623697.1 protein_id gnl|my_center|LOCUS_06800 5432 4905 gene locus_tag LOCUS_06810 5432 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6524 5433 gene locus_tag LOCUS_06820 6524 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence045 1572 628 gene locus_tag LOCUS_06830 gene fmt 1572 628 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_06830 1810 1595 gene locus_tag LOCUS_06840 1810 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06840 3977 1803 gene locus_tag LOCUS_06850 gene priA 3977 1803 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_06850 1829 1838 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4253 4035 gene locus_tag LOCUS_06860 gene rpoZ 4253 4035 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_06860 4881 4255 gene locus_tag LOCUS_06870 gene gmk 4881 4255 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_06870 5300 5010 gene locus_tag LOCUS_06880 5300 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5725 5303 gene locus_tag LOCUS_06890 gene sepF 5725 5303 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_06890 <6818 5748 gene locus_tag LOCUS_06900 <6818 5748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546805.1:cell division protein FtsZ >Feature sequence046 303 713 gene locus_tag LOCUS_06910 303 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2237 1272 gene locus_tag LOCUS_06920 2237 1272 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548693.1 protein_id gnl|my_center|LOCUS_06920 2372 3178 gene locus_tag LOCUS_06930 2372 3178 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254046.1 protein_id gnl|my_center|LOCUS_06930 3208 3864 gene locus_tag LOCUS_06940 3208 3864 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254047.1 protein_id gnl|my_center|LOCUS_06940 3953 4942 gene locus_tag LOCUS_06950 3953 4942 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548712.1 protein_id gnl|my_center|LOCUS_06950 5099 5764 gene locus_tag LOCUS_06960 5099 5764 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254049.1 protein_id gnl|my_center|LOCUS_06960 5772 6599 gene locus_tag LOCUS_06970 5772 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence047 239 1078 gene locus_tag LOCUS_06980 239 1078 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475539.1 protein_id gnl|my_center|LOCUS_06980 1189 2343 gene locus_tag LOCUS_06990 1189 2343 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 protein_id gnl|my_center|LOCUS_06990 2734 4107 gene locus_tag LOCUS_07000 gene brnQ 2734 4107 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254324.1 protein_id gnl|my_center|LOCUS_07000 4386 4670 gene locus_tag LOCUS_07010 4386 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5303 4743 gene locus_tag LOCUS_07020 5303 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence048 <1 1140 gene locus_tag LOCUS_07030 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548413.1:UDP-N-acetylmuramate--L-alanine ligase 1262 6103 gene locus_tag LOCUS_07040 1262 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence049 1047 502 gene locus_tag LOCUS_07050 1047 502 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_07050 1380 1048 gene locus_tag LOCUS_07060 1380 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_07060 1488 2855 gene locus_tag LOCUS_07070 1488 2855 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_07070 2870 4267 gene locus_tag LOCUS_07080 gene pepV 2870 4267 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_07080 5348 4347 gene locus_tag LOCUS_07090 5348 4347 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence050 <1 1133 gene locus_tag LOCUS_07100 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101678.1:cysteine desulfurase family protein 1275 1610 gene locus_tag LOCUS_07110 gene folB 1275 1610 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643485.1 protein_id gnl|my_center|LOCUS_07110 1607 2122 gene locus_tag LOCUS_07120 gene folK 1607 2122 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642516.1 protein_id gnl|my_center|LOCUS_07120 2091 2663 gene locus_tag LOCUS_07130 gene folE 2091 2663 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642515.1 protein_id gnl|my_center|LOCUS_07130 2669 3931 gene locus_tag LOCUS_07140 2669 3931 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643484.1 protein_id gnl|my_center|LOCUS_07140 3924 4523 gene locus_tag LOCUS_07150 gene rdgB 3924 4523 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932022.1 protein_id gnl|my_center|LOCUS_07150 4523 5659 gene locus_tag LOCUS_07160 gene folP 4523 5659 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642512.1 protein_id gnl|my_center|LOCUS_07160 5718 6137 gene locus_tag LOCUS_07170 5718 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence051 1 552 gene locus_tag LOCUS_07180 1 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 518 1756 gene locus_tag LOCUS_07190 518 1756 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_07190 1746 2195 gene locus_tag LOCUS_07200 1746 2195 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640266.1 protein_id gnl|my_center|LOCUS_07200 2197 3600 gene locus_tag LOCUS_07210 gene sufB 2197 3600 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014567504.1 protein_id gnl|my_center|LOCUS_07210 3678 4145 gene locus_tag LOCUS_07220 3678 4145 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354782.1 protein_id gnl|my_center|LOCUS_07220 4325 4510 gene locus_tag LOCUS_07230 4325 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4670 5800 gene locus_tag LOCUS_07240 4670 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence052 2441 1620 gene locus_tag LOCUS_07250 2441 1620 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_07250 3977 2553 gene locus_tag LOCUS_07260 3977 2553 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_07260 5017 4004 gene locus_tag LOCUS_07270 gene ftsY 5017 4004 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 protein_id gnl|my_center|LOCUS_07270 6215 5025 gene locus_tag LOCUS_07280 6215 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence053 602 2278 gene locus_tag LOCUS_07290 gene argS 602 2278 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_07290 2374 3288 gene locus_tag LOCUS_07300 gene fba 2374 3288 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_07300 4253 3375 gene locus_tag LOCUS_07310 4253 3375 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence054 3552 2599 gene locus_tag LOCUS_07320 3552 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4842 3778 gene locus_tag LOCUS_07330 4842 3778 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_07330 5660 5058 gene locus_tag LOCUS_07340 5660 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114736.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence055 490 170 gene locus_tag LOCUS_07350 490 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2059 761 gene locus_tag LOCUS_07360 2059 761 CDS product HP1165 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944753.1 protein_id gnl|my_center|LOCUS_07360 2364 2663 gene locus_tag LOCUS_07370 2364 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3376 2759 gene locus_tag LOCUS_07380 3376 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3919 3446 gene locus_tag LOCUS_07390 3919 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5701 4676 gene locus_tag LOCUS_07400 5701 4676 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence056 <1 762 gene locus_tag LOCUS_07410 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549172.1:DNA polymerase IV 818 1774 gene locus_tag LOCUS_07420 818 1774 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_07420 1761 3143 gene locus_tag LOCUS_07430 1761 3143 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence057 2245 176 gene locus_tag LOCUS_07440 2245 176 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 protein_id gnl|my_center|LOCUS_07440 3314 2304 gene locus_tag LOCUS_07450 3314 2304 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_07450 4357 3314 gene locus_tag LOCUS_07460 4357 3314 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_07460 5513 4359 gene locus_tag LOCUS_07470 5513 4359 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence058 1561 641 gene locus_tag LOCUS_07480 1561 641 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_07480 2386 1565 gene locus_tag LOCUS_07490 gene map 2386 1565 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_07490 2519 2965 gene locus_tag LOCUS_07500 2519 2965 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_07500 4174 3032 gene locus_tag LOCUS_07510 gene wecB 4174 3032 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254552.1 protein_id gnl|my_center|LOCUS_07510 4287 4466 gene locus_tag LOCUS_07520 4287 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4518 4590 gene locus_tag LOCUS_t00190 4518 4590 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <5622 4609 gene locus_tag LOCUS_07530 <5622 4609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546440.1:DEAD/DEAH box helicase >Feature sequence059 2716 1871 gene locus_tag LOCUS_07540 gene dprA 2716 1871 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_07540 3517 2765 gene locus_tag LOCUS_07550 3517 2765 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_07550 4353 3514 gene locus_tag LOCUS_07560 gene ylqF 4353 3514 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_07560 <5595 4566 gene locus_tag LOCUS_07570 <5595 4566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101574.1:S41 family peptidase >Feature sequence060 <1 934 gene locus_tag LOCUS_07580 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546586.1:excinuclease ABC subunit UvrB 959 3778 gene locus_tag LOCUS_07590 gene uvrA 959 3778 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_07590 3826 4701 gene locus_tag LOCUS_07600 gene rapZ 3826 4701 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence061 <1 720 gene locus_tag LOCUS_07610 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254190.1:multidrug efflux MFS transporter 918 2231 gene locus_tag LOCUS_07620 918 2231 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_07620 3084 2284 gene locus_tag LOCUS_07630 3084 2284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146599.1 protein_id gnl|my_center|LOCUS_07630 4000 3071 gene locus_tag LOCUS_07640 4000 3071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524830.1 protein_id gnl|my_center|LOCUS_07640 5377 4241 gene locus_tag LOCUS_07650 5377 4241 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254182.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence062 3963 490 gene locus_tag LOCUS_07660 3963 490 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_07660 4032 4952 gene locus_tag LOCUS_07670 gene mvk 4032 4952 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence063 525 1631 gene locus_tag LOCUS_07680 525 1631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_07680 1618 2430 gene locus_tag LOCUS_07690 1618 2430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_07690 2427 3227 gene locus_tag LOCUS_07700 2427 3227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_07700 3224 4297 gene locus_tag LOCUS_07710 3224 4297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_07710 4336 5178 gene locus_tag LOCUS_07720 gene cdaA 4336 5178 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence064 1996 1439 gene locus_tag LOCUS_07730 gene pth 1996 1439 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549001.1 protein_id gnl|my_center|LOCUS_07730 2135 3106 gene locus_tag LOCUS_07740 2135 3106 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549000.1 protein_id gnl|my_center|LOCUS_07740 3246 3929 gene locus_tag LOCUS_07750 gene cbpA 3246 3929 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254100.1 protein_id gnl|my_center|LOCUS_07750 <5121 4006 gene locus_tag LOCUS_07760 <5121 4006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548996.1:alanine racemase >Feature sequence065 111 1067 gene locus_tag LOCUS_07770 111 1067 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_07770 1089 1589 gene locus_tag LOCUS_07780 1089 1589 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546982.1 protein_id gnl|my_center|LOCUS_07780 1620 1955 gene locus_tag LOCUS_07790 1620 1955 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_07790 1966 3093 gene locus_tag LOCUS_07800 gene mnmA 1966 3093 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_07800 3122 3778 gene locus_tag LOCUS_07810 3122 3778 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_07810 3778 4410 gene locus_tag LOCUS_07820 3778 4410 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence066 1870 578 gene locus_tag LOCUS_07830 gene tilS 1870 578 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549010.1 protein_id gnl|my_center|LOCUS_07830 2239 1901 gene locus_tag LOCUS_07840 2239 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2613 2239 gene locus_tag LOCUS_07850 2613 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2938 2696 gene locus_tag LOCUS_07860 2938 2696 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_07860 <4873 2952 gene locus_tag LOCUS_07870 <4873 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254101.1:transcription-repair coupling factor >Feature sequence067 7 474 gene locus_tag LOCUS_07880 gene nrdR 7 474 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_07880 478 1824 gene locus_tag LOCUS_07890 478 1824 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_07890 1841 2740 gene locus_tag LOCUS_07900 gene dnaI 1841 2740 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_07900 3009 3167 gene locus_tag LOCUS_07910 3009 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07910 3149 3158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence068 1237 791 gene locus_tag LOCUS_07920 1237 791 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793164.1 protein_id gnl|my_center|LOCUS_07920 1665 1234 gene locus_tag LOCUS_07930 1665 1234 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700966.1 protein_id gnl|my_center|LOCUS_07930 1816 2307 gene locus_tag LOCUS_07940 1816 2307 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence069 1937 1212 gene locus_tag LOCUS_07950 1937 1212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_07950 2580 2053 gene locus_tag LOCUS_07960 2580 2053 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_07960 3741 2581 gene locus_tag LOCUS_07970 3741 2581 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_07970 4095 3751 gene locus_tag LOCUS_07980 gene rsfS 4095 3751 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_07980 4715 4107 gene locus_tag LOCUS_07990 gene yqeK 4715 4107 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence070 <1 716 gene locus_tag LOCUS_08000 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674550.1:Stk1 family PASTA domain-containing Ser/Thr kinase 716 1609 gene locus_tag LOCUS_08010 gene rsgA 716 1609 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_08010 1617 2267 gene locus_tag LOCUS_08020 gene rpe 1617 2267 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_08020 2252 2965 gene locus_tag LOCUS_08030 2252 2965 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_08030 3620 2985 gene locus_tag LOCUS_08040 gene udk 3620 2985 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence071 1095 166 gene locus_tag LOCUS_08050 gene ribF 1095 166 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_08050 2006 1113 gene locus_tag LOCUS_08060 gene truB 2006 1113 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_08060 2423 2067 gene locus_tag LOCUS_08070 2423 2067 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_08070 <4729 2457 gene locus_tag LOCUS_08080 <4729 2457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254396.1:translation initiation factor IF-2 >Feature sequence072 1788 949 gene locus_tag LOCUS_08090 1788 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2343 1804 gene locus_tag LOCUS_08100 2343 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3562 2351 gene locus_tag LOCUS_08110 3562 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 <4677 3580 gene locus_tag LOCUS_08120 <4677 3580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350502.1:ABC transporter ATP-binding protein >Feature sequence073 1568 777 gene locus_tag LOCUS_08130 gene sufC 1568 777 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004894681.1 protein_id gnl|my_center|LOCUS_08130 2252 1629 gene locus_tag LOCUS_08140 2252 1629 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_08140 3314 2262 gene locus_tag LOCUS_08150 3314 2262 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_08150 4175 3435 gene locus_tag LOCUS_08160 4175 3435 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254050.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence074 2502 1633 gene locus_tag LOCUS_08170 2502 1633 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_08170 2583 2666 gene locus_tag LOCUS_t00200 2583 2666 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3159 2878 gene locus_tag LOCUS_08180 3159 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3740 3324 gene locus_tag LOCUS_08190 3740 3324 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_08190 3918 3724 gene locus_tag LOCUS_08200 3918 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence075 2184 1699 gene locus_tag LOCUS_08210 gene greA 2184 1699 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_08210 3357 2257 gene locus_tag LOCUS_08220 gene mltG 3357 2257 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 protein_id gnl|my_center|LOCUS_08220 <4594 3381 gene locus_tag LOCUS_08230 <4594 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548294.1:phenylalanine--tRNA ligase subunit beta >Feature sequence076 1684 1400 gene locus_tag LOCUS_08240 gene groES 1684 1400 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549156.1 protein_id gnl|my_center|LOCUS_08240 2439 1810 gene locus_tag LOCUS_08250 2439 1810 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_08250 2626 4539 gene locus_tag LOCUS_08260 2626 4539 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549141.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence077 206 21 gene locus_tag LOCUS_08270 206 21 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_08270 824 222 gene locus_tag LOCUS_08280 gene lepB 824 222 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_08280 912 1658 gene locus_tag LOCUS_08290 912 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_08290 1645 2631 gene locus_tag LOCUS_08300 1645 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2624 4033 gene locus_tag LOCUS_08310 2624 4033 CDS product RsmF rRNA methyltransferase first C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254371.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence078 1226 267 gene locus_tag LOCUS_08320 gene yidC 1226 267 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_08320 1369 2136 gene locus_tag LOCUS_08330 1369 2136 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_08330 2209 2556 gene locus_tag LOCUS_08340 2209 2556 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_08340 2847 3896 gene locus_tag LOCUS_08350 gene pheS 2847 3896 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence079 354 1298 gene locus_tag LOCUS_08360 gene whiA 354 1298 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_08360 1291 2787 gene locus_tag LOCUS_08370 1291 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2803 4059 gene locus_tag LOCUS_08380 2803 4059 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence080 427 1650 gene locus_tag LOCUS_08390 427 1650 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_08390 1759 2835 gene locus_tag LOCUS_08400 1759 2835 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546527.1 protein_id gnl|my_center|LOCUS_08400 2838 3416 gene locus_tag LOCUS_08410 gene pgsA 2838 3416 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence081 1305 469 gene locus_tag LOCUS_08420 gene nadE 1305 469 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546262.1 protein_id gnl|my_center|LOCUS_08420 2786 1308 gene locus_tag LOCUS_08430 2786 1308 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254174.1 protein_id gnl|my_center|LOCUS_08430 3535 2837 gene locus_tag LOCUS_08440 3535 2837 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546270.1 protein_id gnl|my_center|LOCUS_08440 <4325 3598 gene locus_tag LOCUS_08450 <4325 3598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546257.1:glycosyltransferase family 4 protein >Feature sequence082 1 351 gene locus_tag LOCUS_08460 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 361 1329 gene locus_tag LOCUS_08470 361 1329 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_08470 1331 2293 gene locus_tag LOCUS_08480 1331 2293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_08480 2308 3237 gene locus_tag LOCUS_08490 2308 3237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence083 3007 1157 gene locus_tag LOCUS_08500 3007 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 2538 2547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3669 3028 gene locus_tag LOCUS_08510 3669 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 3033 3042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3748 3757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 590 99 gene locus_tag LOCUS_08520 590 99 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632643.1 protein_id gnl|my_center|LOCUS_08520 1024 608 gene locus_tag LOCUS_08530 1024 608 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989935.1 protein_id gnl|my_center|LOCUS_08530 3751 1169 gene locus_tag LOCUS_08540 3751 1169 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304269.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence085 <1 2296 gene locus_tag LOCUS_08550 <1 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547478.1:DNA topoisomerase IV subunit A 2375 3310 gene locus_tag LOCUS_08560 2375 3310 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_08560 3553 3780 gene locus_tag LOCUS_08570 3553 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3722 3931 gene locus_tag LOCUS_08580 3722 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 >Feature sequence086 1324 1091 gene locus_tag LOCUS_08590 gene secG 1324 1091 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_08590 2741 1443 gene locus_tag LOCUS_08600 gene eno 2741 1443 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564271.1 protein_id gnl|my_center|LOCUS_08600 3547 2792 gene locus_tag LOCUS_08610 gene tpiA 3547 2792 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_08610 <4160 3565 gene locus_tag LOCUS_08620 <4160 3565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546602.1:phosphoglycerate kinase >Feature sequence087 140 2209 gene locus_tag LOCUS_08630 gene glyS 140 2209 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_08630 2228 4030 gene locus_tag LOCUS_08640 gene dnaG 2228 4030 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence088 93 764 gene locus_tag LOCUS_08650 93 764 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_08650 764 1558 gene locus_tag LOCUS_08660 764 1558 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_08660 1568 3934 gene locus_tag LOCUS_08670 1568 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence089 883 317 gene locus_tag LOCUS_08680 883 317 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_08680 805 814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1383 883 gene locus_tag LOCUS_08690 gene atpF 1383 883 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_08690 1640 1428 gene locus_tag LOCUS_08700 gene atpE 1640 1428 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_08700 2375 1659 gene locus_tag LOCUS_08710 gene atpB 2375 1659 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_08710 3099 2470 gene locus_tag LOCUS_08720 gene upp 3099 2470 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_08720 <4094 3197 gene locus_tag LOCUS_08730 <4094 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546737.1:L-threonylcarbamoyladenylate synthase >Feature sequence090 <1 1559 gene locus_tag LOCUS_08740 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254441.1:carbamoyl-phosphate synthase large subunit 1843 1682 gene locus_tag LOCUS_08750 1843 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1928 2806 gene locus_tag LOCUS_08760 1928 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2799 3452 gene locus_tag LOCUS_08770 2799 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3439 3975 gene locus_tag LOCUS_08780 3439 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence091 <1 1648 gene locus_tag LOCUS_08790 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371500.1:tetracycline resistance ribosomal protection protein Tet(M) 1775 1784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2010 2255 gene locus_tag LOCUS_08800 2010 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 2252 2587 gene locus_tag LOCUS_08810 2252 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2600 2968 gene locus_tag LOCUS_08820 2600 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567199.1 protein_id gnl|my_center|LOCUS_08820 2955 3254 gene locus_tag LOCUS_08830 2955 3254 CDS product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072464.1 protein_id gnl|my_center|LOCUS_08830 3971 3372 gene locus_tag LOCUS_08840 3971 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence092 <1 1302 gene locus_tag LOCUS_08850 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080388512.1:hyperosmolarity resistance protein Ebh 1471 1695 gene locus_tag LOCUS_08860 1471 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1697 2119 gene locus_tag LOCUS_08870 1697 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence093 1494 577 gene locus_tag LOCUS_08880 gene prmA 1494 577 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_08880 1306 1315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1527 1536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1557 2063 gene locus_tag LOCUS_08890 gene ybaK 1557 2063 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_08890 3497 2118 gene locus_tag LOCUS_08900 3497 2118 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence094 669 598 gene locus_tag LOCUS_t00210 669 598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 897 1928 gene locus_tag LOCUS_08910 897 1928 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_08910 1985 3001 gene locus_tag LOCUS_08920 gene gap 1985 3001 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence095 1227 2444 gene locus_tag LOCUS_08930 1227 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3398 2484 gene locus_tag LOCUS_08940 3398 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08940 3415 3424 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence096 <1 3076 gene locus_tag LOCUS_08950 <1 3076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254355.1:carbamoyl phosphate synthase large subunit <3694 3144 gene locus_tag LOCUS_08960 <3694 3144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547519.1:NFACT RNA binding domain-containing protein >Feature sequence097 <1 1083 gene locus_tag LOCUS_08970 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003627067.1:type I glutamate--ammonia ligase 1186 2361 gene locus_tag LOCUS_08980 1186 2361 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548117.1 protein_id gnl|my_center|LOCUS_08980 2401 3354 gene locus_tag LOCUS_08990 2401 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence098 2086 1361 gene locus_tag LOCUS_09000 2086 1361 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_09000 3018 2086 gene locus_tag LOCUS_09010 3018 2086 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence099 2373 625 gene locus_tag LOCUS_09020 2373 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2635 3480 gene locus_tag LOCUS_09030 gene rgg2 2635 3480 CDS product quorum-sensing system transcriptional regulator Rgg2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990747.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence100 1414 422 gene locus_tag LOCUS_09040 1414 422 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254608.1 protein_id gnl|my_center|LOCUS_09040 1606 2895 gene locus_tag LOCUS_09050 1606 2895 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549585.1 protein_id gnl|my_center|LOCUS_09050 3142 3151 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence101 1083 22 gene locus_tag LOCUS_09060 1083 22 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_09060 2023 1088 gene locus_tag LOCUS_09070 2023 1088 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_09070 2507 2031 gene locus_tag LOCUS_09080 gene lspA 2507 2031 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_09080 <3385 2508 gene locus_tag LOCUS_09090 <3385 2508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254358.1:formate--tetrahydrofolate ligase >Feature sequence102 954 436 gene locus_tag LOCUS_09100 954 436 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_09100 2260 1073 gene locus_tag LOCUS_09110 2260 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 2964 2233 gene locus_tag LOCUS_09120 2964 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 >Feature sequence103 <1 1035 gene locus_tag LOCUS_09130 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549861.1:GTPase HflX 1907 1152 gene locus_tag LOCUS_09140 1907 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2563 1904 gene locus_tag LOCUS_09150 2563 1904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_09150 <3374 2677 gene locus_tag LOCUS_09160 <3374 2677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254607.1:adenylosuccinate lyase >Feature sequence104 1147 698 gene locus_tag LOCUS_09170 1147 698 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547630.1 protein_id gnl|my_center|LOCUS_09170 1420 1244 gene locus_tag LOCUS_09180 gene rpsU 1420 1244 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_09180 1622 2455 gene locus_tag LOCUS_09190 1622 2455 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_09190 <3341 2507 gene locus_tag LOCUS_09200 <3341 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547719.1:YitT family protein >Feature sequence105 286 1566 gene locus_tag LOCUS_09210 gene trmFO 286 1566 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_09210 1569 2492 gene locus_tag LOCUS_09220 1569 2492 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_09220 2496 3020 gene locus_tag LOCUS_09230 gene hslV 2496 3020 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence106 <1 607 gene locus_tag LOCUS_09240 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546749.1:rod shape-determining protein 609 893 gene locus_tag LOCUS_09250 gene yidD 609 893 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_09250 907 1134 gene locus_tag LOCUS_09260 907 1134 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_09260 1151 2344 gene locus_tag LOCUS_09270 1151 2344 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_09270 2702 3016 gene locus_tag LOCUS_09280 2702 3016 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420682.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence107 1484 963 gene locus_tag LOCUS_09290 1484 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2052 1594 gene locus_tag LOCUS_09300 gene smpB 2052 1594 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_09300 <3316 2055 gene locus_tag LOCUS_09310 <3316 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003550136.1:ribonuclease R >Feature sequence108 <1 609 gene locus_tag LOCUS_09320 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254308.1:ATP-dependent protease ATPase subunit HslU 626 1516 gene locus_tag LOCUS_09330 626 1516 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_09330 2241 1549 gene locus_tag LOCUS_09340 gene plsY 2241 1549 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence109 469 478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1356 559 gene locus_tag LOCUS_09350 1356 559 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_09350 2026 1343 gene locus_tag LOCUS_09360 2026 1343 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_09360 <3132 2087 gene locus_tag LOCUS_09370 <3132 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254377.1:RNA polymerase sigma factor RpoD >Feature sequence110 1671 193 gene locus_tag LOCUS_09380 1671 193 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113321.1 protein_id gnl|my_center|LOCUS_09380 2041 1847 gene locus_tag LOCUS_09390 2041 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09390 2530 2835 gene locus_tag LOCUS_09400 2530 2835 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence111 >Feature sequence112 2697 2873 gene locus_tag LOCUS_09410 2697 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence113 781 530 gene locus_tag LOCUS_09420 781 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1337 774 gene locus_tag LOCUS_09430 1337 774 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_09430 1561 1343 gene locus_tag LOCUS_09440 1561 1343 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_09440 <2915 1561 gene locus_tag LOCUS_09450 <2915 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254260.1:isoleucine--tRNA ligase >Feature sequence114 1225 722 gene locus_tag LOCUS_09460 1225 722 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 protein_id gnl|my_center|LOCUS_09460 <2905 1222 gene locus_tag LOCUS_09470 <2905 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254365.1:helicase C-terminal domain-containing protein >Feature sequence115 331 867 gene locus_tag LOCUS_09480 gene cobC 331 867 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_09480 1210 1797 gene locus_tag LOCUS_09490 1210 1797 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_09490 1794 2636 gene locus_tag LOCUS_09500 1794 2636 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence116 <1 1647 gene locus_tag LOCUS_09510 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546584.1:phospho-sugar mutase >Feature sequence117 >Feature sequence118 751 1695 gene locus_tag LOCUS_09520 751 1695 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_09520 <2764 1761 gene locus_tag LOCUS_09530 <2764 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263274.1:amidase >Feature sequence119 264 740 gene locus_tag LOCUS_09540 gene rimP 264 740 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_09540 760 1665 gene locus_tag LOCUS_09550 760 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09550 1613 1622 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1628 1858 gene locus_tag LOCUS_09560 1628 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 1883 2179 gene locus_tag LOCUS_09570 1883 2179 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_09570 2181 2486 gene locus_tag LOCUS_09580 2181 2486 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence120 <1 624 gene locus_tag LOCUS_09590 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546864.1:ATP-dependent Clp protease ATP-binding subunit ClpX 614 1201 gene locus_tag LOCUS_09600 gene yihA 614 1201 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_09600 1273 1791 gene locus_tag LOCUS_09610 1273 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546897.1 protein_id gnl|my_center|LOCUS_09610 1872 2531 gene locus_tag LOCUS_09620 1872 2531 CDS product serine dehydratase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254449.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence121 2 289 gene locus_tag LOCUS_09630 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1346 363 gene locus_tag LOCUS_09640 gene rpoN 1346 363 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242595.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 1642 1343 gene locus_tag LOCUS_09650 1642 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2360 1656 gene locus_tag LOCUS_09660 2360 1656 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355354.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence122 <1 1468 gene locus_tag LOCUS_09670 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254247.1:F0F1 ATP synthase subunit beta 1480 1914 gene locus_tag LOCUS_09680 1480 1914 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_09680 1964 2197 gene locus_tag LOCUS_09690 1964 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence123 236 1105 gene locus_tag LOCUS_09700 236 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_09700 1275 2465 gene locus_tag LOCUS_09710 gene tuf 1275 2465 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence124 1163 225 gene locus_tag LOCUS_09720 gene rbsK 1163 225 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563212.1 protein_id gnl|my_center|LOCUS_09720 1317 1583 gene locus_tag LOCUS_09730 1317 1583 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence125 <1 586 gene locus_tag LOCUS_09740 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546467.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1782 829 gene locus_tag LOCUS_09750 1782 829 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_09750 1870 2163 gene locus_tag LOCUS_09760 1870 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence126 135 419 gene locus_tag LOCUS_09770 gene rpsS 135 419 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567557.1 protein_id gnl|my_center|LOCUS_09770 438 791 gene locus_tag LOCUS_09780 gene rplV 438 791 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_09780 806 1480 gene locus_tag LOCUS_09790 gene rpsC 806 1480 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254113.1 protein_id gnl|my_center|LOCUS_09790 1483 1920 gene locus_tag LOCUS_09800 gene rplP 1483 1920 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549031.1 protein_id gnl|my_center|LOCUS_09800 1910 2095 gene locus_tag LOCUS_09810 gene rpmC 1910 2095 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549032.1 protein_id gnl|my_center|LOCUS_09810 2118 2384 gene locus_tag LOCUS_09820 gene rpsQ 2118 2384 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence127 <1 922 gene locus_tag LOCUS_09830 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547790.1:molecular chaperone DnaJ >Feature sequence128 <1 678 gene locus_tag LOCUS_09840 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547078.1:segregation/condensation protein A 671 1246 gene locus_tag LOCUS_09850 gene scpB 671 1246 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_09850 1265 1984 gene locus_tag LOCUS_09860 1265 1984 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence129 1406 1960 gene locus_tag LOCUS_09870 gene def 1406 1960 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_09870 2097 2321 gene locus_tag LOCUS_09880 2097 2321 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence130 2164 956 gene locus_tag LOCUS_09890 2164 956 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence131 1172 495 gene locus_tag LOCUS_09900 1172 495 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549794.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 525 534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1672 1316 gene locus_tag LOCUS_09910 gene rplT 1672 1316 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_09910 1909 1709 gene locus_tag LOCUS_09920 gene rpmI 1909 1709 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence132 <1 582 gene locus_tag LOCUS_09930 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546834.1:ribonuclease J 587 596 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2279 603 gene locus_tag LOCUS_09940 2279 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence133 <1 692 gene locus_tag LOCUS_09950 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549016.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence134 267 542 gene locus_tag LOCUS_09960 267 542 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_09960 574 583 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 642 1904 gene locus_tag LOCUS_09970 642 1904 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence135 171 1070 gene locus_tag LOCUS_09980 171 1070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 protein_id gnl|my_center|LOCUS_09980 1063 1824 gene locus_tag LOCUS_09990 1063 1824 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245086.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence136 <1 1263 gene locus_tag LOCUS_10000 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547819.1:proline--tRNA ligase >Feature sequence137 <1 750 gene locus_tag LOCUS_10010 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547039.1:aspartate--tRNA ligase note possible pseudo, frameshifted 747 1088 gene locus_tag LOCUS_10020 747 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10020 1073 1417 gene locus_tag LOCUS_10030 1073 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 1498 2070 gene locus_tag LOCUS_10040 1498 2070 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence138 1723 1037 gene locus_tag LOCUS_10050 1723 1037 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_10050 <2234 1725 gene locus_tag LOCUS_10060 <2234 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254395.1:translation elongation factor 4 >Feature sequence139 <1 781 gene locus_tag LOCUS_10070 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014565583.1:NAD(P)/FAD-dependent oxidoreductase 809 1453 gene locus_tag LOCUS_10080 809 1453 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_10080 1768 1583 gene locus_tag LOCUS_10090 1768 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1950 >2221 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggatcacccccgcatgtgcgggaaatac >Feature sequence140 767 396 gene locus_tag LOCUS_10100 767 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10100 897 1490 gene locus_tag LOCUS_10110 897 1490 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence141 1856 114 gene locus_tag LOCUS_10120 gene uvrC 1856 114 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence142 688 1539 gene locus_tag LOCUS_10130 688 1539 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_10130 1548 1775 gene locus_tag LOCUS_10140 1548 1775 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence143 671 312 gene locus_tag LOCUS_10150 gene rplR 671 312 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_10150 1228 698 gene locus_tag LOCUS_10160 gene rplF 1228 698 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549039.1 protein_id gnl|my_center|LOCUS_10160 1651 1253 gene locus_tag LOCUS_10170 gene rpsH 1651 1253 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_10170 1863 1678 gene locus_tag LOCUS_10180 1863 1678 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549037.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence144 <1 1091 gene locus_tag LOCUS_10190 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254246.1:F0F1 ATP synthase subunit alpha 1109 2062 gene locus_tag LOCUS_10200 1109 2062 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence145 1427 501 gene locus_tag LOCUS_10210 gene rnz 1427 501 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_10210 <1978 1434 gene locus_tag LOCUS_10220 <1978 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025015105.1:acyltransferase family protein >Feature sequence146 <1 868 gene locus_tag LOCUS_10230 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254292.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 868 1305 gene locus_tag LOCUS_10240 gene dtd 868 1305 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence147 <1936 1028 gene locus_tag LOCUS_10250 <1936 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254297.1:GTPase ObgE >Feature sequence148 36 686 gene locus_tag LOCUS_10260 gene trmB 36 686 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_10260 705 1025 gene locus_tag LOCUS_10270 705 1025 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_10270 1041 1694 gene locus_tag LOCUS_10280 1041 1694 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence149 421 188 gene locus_tag LOCUS_10290 421 188 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549114.1 protein_id gnl|my_center|LOCUS_10290 1017 418 gene locus_tag LOCUS_10300 gene recR 1017 418 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549113.1 protein_id gnl|my_center|LOCUS_10300 1346 1017 gene locus_tag LOCUS_10310 1346 1017 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549112.1 protein_id gnl|my_center|LOCUS_10310 <1911 1392 gene locus_tag LOCUS_10320 <1911 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549111.1:DNA polymerase III subunit gamma/tau >Feature sequence150 1828 1559 gene locus_tag LOCUS_10330 gene rpsO 1828 1559 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence151 431 1480 gene locus_tag LOCUS_10340 431 1480 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence152 1693 1085 gene locus_tag LOCUS_10350 1693 1085 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence153 413 946 gene locus_tag LOCUS_10360 413 946 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_10360 1500 1024 gene locus_tag LOCUS_10370 gene tsaE 1500 1024 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence154 1814 585 gene locus_tag LOCUS_10380 1814 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence155 262 1164 gene locus_tag LOCUS_10390 gene era 262 1164 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence156 <1 647 gene locus_tag LOCUS_10400 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254272.1:nucleoside hydrolase 1212 835 gene locus_tag LOCUS_10410 1212 835 CDS product DUF1828 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547028.1 protein_id gnl|my_center|LOCUS_10410 1563 1249 gene locus_tag LOCUS_10420 1563 1249 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence157 1477 377 gene locus_tag LOCUS_10430 1477 377 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254618.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence158 299 970 gene locus_tag LOCUS_10440 299 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1127 1537 gene locus_tag LOCUS_10450 1127 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 1504 1513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence159 48 1424 gene locus_tag LOCUS_10460 48 1424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence160 527 664 gene locus_tag LOCUS_10470 527 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 830 979 gene locus_tag LOCUS_10480 830 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1139 1318 gene locus_tag LOCUS_10490 1139 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence161 <1652 129 gene locus_tag LOCUS_10500 <1652 129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254252.1:valine--tRNA ligase >Feature sequence162 377 1465 gene locus_tag LOCUS_10510 377 1465 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence163 >Feature sequence164 169 759 gene locus_tag LOCUS_10520 gene recU 169 759 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence165 981 55 gene locus_tag LOCUS_10530 gene trxB 981 55 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_10530 <1604 1001 gene locus_tag LOCUS_10540 <1604 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546563.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence166 <1 581 gene locus_tag LOCUS_10550 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547533.1:class I SAM-dependent RNA methyltransferase 674 1021 gene locus_tag LOCUS_10560 674 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence167 283 119 gene locus_tag LOCUS_10570 283 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 345 626 gene locus_tag LOCUS_10580 345 626 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_10580 632 754 gene locus_tag LOCUS_10590 632 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 <1571 883 gene locus_tag LOCUS_10600 <1571 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962520.1:GIY-YIG nuclease family protein >Feature sequence168 <1 1138 gene locus_tag LOCUS_10610 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254253.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence169 242 757 gene locus_tag LOCUS_10620 242 757 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549649.1 protein_id gnl|my_center|LOCUS_10620 934 779 gene locus_tag LOCUS_10630 934 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 <1553 994 gene locus_tag LOCUS_10640 <1553 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_153437736.1:ISNCY family transposase >Feature sequence170 1271 528 gene locus_tag LOCUS_10650 1271 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence171 533 775 gene locus_tag LOCUS_10660 gene acpP 533 775 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence172 <1521 56 gene locus_tag LOCUS_10670 <1521 56 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548351.1:DNA polymerase I >Feature sequence173 <1 698 gene locus_tag LOCUS_10680 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547606.1:peptidase T 1009 1383 gene locus_tag LOCUS_10690 1009 1383 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_10690