>Feature sequence01 204 752 gene locus_tag LOCUS_0010 204 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 766 1584 gene locus_tag LOCUS_0020 766 1584 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548701.1 protein_id gnl|my_center|LOCUS_0020 1598 3175 gene locus_tag LOCUS_0030 1598 3175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547498.1 protein_id gnl|my_center|LOCUS_0030 3181 4758 gene locus_tag LOCUS_0040 3181 4758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547496.1 protein_id gnl|my_center|LOCUS_0040 4881 5114 gene locus_tag LOCUS_0050 4881 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 5186 5521 gene locus_tag LOCUS_0060 5186 5521 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547875.1 protein_id gnl|my_center|LOCUS_0060 5526 6953 gene locus_tag LOCUS_0070 gene ffh 5526 6953 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_0070 7043 7315 gene locus_tag LOCUS_0080 gene rpsP 7043 7315 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547870.1 protein_id gnl|my_center|LOCUS_0080 7386 7898 gene locus_tag LOCUS_0090 gene rimM 7386 7898 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254408.1 protein_id gnl|my_center|LOCUS_0090 7888 8619 gene locus_tag LOCUS_0100 gene trmD 7888 8619 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254407.1 protein_id gnl|my_center|LOCUS_0100 8726 9073 gene locus_tag LOCUS_0110 gene rplS 8726 9073 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003629071.1 protein_id gnl|my_center|LOCUS_0110 9227 11206 gene locus_tag LOCUS_0120 9227 11206 CDS product bacteriocin-associated integral membrane family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870829.1 protein_id gnl|my_center|LOCUS_0120 11221 11889 gene locus_tag LOCUS_0130 11221 11889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571283.1 protein_id gnl|my_center|LOCUS_0130 11886 12218 gene locus_tag LOCUS_0140 11886 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 12384 12253 gene locus_tag LOCUS_0150 12384 12253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 12657 13304 gene locus_tag LOCUS_0160 gene pcp 12657 13304 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592791.1 protein_id gnl|my_center|LOCUS_0160 14315 13335 gene locus_tag LOCUS_0170 14315 13335 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700709.1 protein_id gnl|my_center|LOCUS_0170 15766 14315 gene locus_tag LOCUS_0180 15766 14315 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475493.1 protein_id gnl|my_center|LOCUS_0180 16006 17952 gene locus_tag LOCUS_0190 16006 17952 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475494.1 protein_id gnl|my_center|LOCUS_0190 18238 19650 gene locus_tag LOCUS_0200 18238 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 19664 21844 gene locus_tag LOCUS_0210 19664 21844 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_0210 22057 23058 gene locus_tag LOCUS_0220 gene rbsR 22057 23058 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104055.1 protein_id gnl|my_center|LOCUS_0220 24102 23467 gene locus_tag LOCUS_0230 gene lexA 24102 23467 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_0230 24241 24489 gene locus_tag LOCUS_0240 24241 24489 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547851.1 protein_id gnl|my_center|LOCUS_0240 24507 24728 gene locus_tag LOCUS_0250 24507 24728 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547849.1 protein_id gnl|my_center|LOCUS_0250 24816 26570 gene locus_tag LOCUS_0260 24816 26570 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254403.1 protein_id gnl|my_center|LOCUS_0260 26563 28347 gene locus_tag LOCUS_0270 26563 28347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613381.1 protein_id gnl|my_center|LOCUS_0270 28991 28377 gene locus_tag LOCUS_0280 28991 28377 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547840.1 protein_id gnl|my_center|LOCUS_0280 29055 30065 gene locus_tag LOCUS_0290 29055 30065 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547839.1 protein_id gnl|my_center|LOCUS_0290 30235 31017 gene locus_tag LOCUS_0300 gene rpsB 30235 31017 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547837.1 protein_id gnl|my_center|LOCUS_0300 31051 31926 gene locus_tag LOCUS_0310 gene tsf 31051 31926 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565808.1 protein_id gnl|my_center|LOCUS_0310 32054 32779 gene locus_tag LOCUS_0320 gene pyrH 32054 32779 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254400.1 protein_id gnl|my_center|LOCUS_0320 32779 33336 gene locus_tag LOCUS_0330 gene frr 32779 33336 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095341972.1 protein_id gnl|my_center|LOCUS_0330 33340 34053 gene locus_tag LOCUS_0340 33340 34053 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547825.1 protein_id gnl|my_center|LOCUS_0340 34065 34871 gene locus_tag LOCUS_0350 34065 34871 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547823.1 protein_id gnl|my_center|LOCUS_0350 34874 36127 gene locus_tag LOCUS_0360 gene rseP 34874 36127 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547820.1 protein_id gnl|my_center|LOCUS_0360 36147 37844 gene locus_tag LOCUS_0370 36147 37844 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547819.1 protein_id gnl|my_center|LOCUS_0370 37854 42173 gene locus_tag LOCUS_0380 37854 42173 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547817.1 protein_id gnl|my_center|LOCUS_0380 42269 42745 gene locus_tag LOCUS_0390 gene rimP 42269 42745 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254398.1 protein_id gnl|my_center|LOCUS_0390 42766 43872 gene locus_tag LOCUS_0400 gene nusA 42766 43872 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254397.1 protein_id gnl|my_center|LOCUS_0400 43873 44178 gene locus_tag LOCUS_0410 43873 44178 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547812.1 protein_id gnl|my_center|LOCUS_0410 44179 44490 gene locus_tag LOCUS_0420 44179 44490 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_0420 44495 47194 gene locus_tag LOCUS_0430 gene infB 44495 47194 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254396.1 protein_id gnl|my_center|LOCUS_0430 47206 47562 gene locus_tag LOCUS_0440 47206 47562 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_0440 47600 48487 gene locus_tag LOCUS_0450 gene truB 47600 48487 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547805.1 protein_id gnl|my_center|LOCUS_0450 48506 49444 gene locus_tag LOCUS_0460 gene ribF 48506 49444 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547803.1 protein_id gnl|my_center|LOCUS_0460 49564 50607 gene locus_tag LOCUS_0470 gene hrcA 49564 50607 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547794.1 protein_id gnl|my_center|LOCUS_0470 50621 51202 gene locus_tag LOCUS_0480 gene grpE 50621 51202 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547792.1 protein_id gnl|my_center|LOCUS_0480 51254 53095 gene locus_tag LOCUS_0490 gene dnaK 51254 53095 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547791.1 protein_id gnl|my_center|LOCUS_0490 53167 54303 gene locus_tag LOCUS_0500 gene dnaJ 53167 54303 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547790.1 protein_id gnl|my_center|LOCUS_0500 54480 56318 gene locus_tag LOCUS_0510 gene lepA 54480 56318 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254395.1 protein_id gnl|my_center|LOCUS_0510 56320 57030 gene locus_tag LOCUS_0520 56320 57030 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547788.1 protein_id gnl|my_center|LOCUS_0520 57030 59291 gene locus_tag LOCUS_0530 gene recJ 57030 59291 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547786.1 protein_id gnl|my_center|LOCUS_0530 59309 59836 gene locus_tag LOCUS_0540 59309 59836 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547784.1 protein_id gnl|my_center|LOCUS_0540 62170 59894 gene locus_tag LOCUS_0550 62170 59894 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254392.1 protein_id gnl|my_center|LOCUS_0550 62743 62234 gene locus_tag LOCUS_0560 62743 62234 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_0560 62860 63690 gene locus_tag LOCUS_0570 62860 63690 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546960.1 protein_id gnl|my_center|LOCUS_0570 64768 64199 gene locus_tag LOCUS_0580 64768 64199 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546962.1 protein_id gnl|my_center|LOCUS_0580 64883 64969 gene locus_tag LOCUS_t0010 64883 64969 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66647 65109 gene locus_tag LOCUS_0590 66647 65109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352237.1 protein_id gnl|my_center|LOCUS_0590 66836 67522 gene locus_tag LOCUS_0600 66836 67522 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_0600 67623 69023 gene locus_tag LOCUS_0610 67623 69023 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_0610 69016 70398 gene locus_tag LOCUS_0620 69016 70398 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549564.1 protein_id gnl|my_center|LOCUS_0620 71325 70459 gene locus_tag LOCUS_0630 71325 70459 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_0630 71432 72388 gene locus_tag LOCUS_0640 71432 72388 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546979.1 protein_id gnl|my_center|LOCUS_0640 72398 72910 gene locus_tag LOCUS_0650 72398 72910 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475879.1 protein_id gnl|my_center|LOCUS_0650 72919 73335 gene locus_tag LOCUS_0660 72919 73335 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254406.1 protein_id gnl|my_center|LOCUS_0660 73445 74374 gene locus_tag LOCUS_0670 73445 74374 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547856.1 protein_id gnl|my_center|LOCUS_0670 74512 74658 gene locus_tag LOCUS_0680 74512 74658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 75571 74708 gene locus_tag LOCUS_0690 75571 74708 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547408.1 protein_id gnl|my_center|LOCUS_0690 76158 75571 gene locus_tag LOCUS_0700 76158 75571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547406.1 protein_id gnl|my_center|LOCUS_0700 76638 76273 gene locus_tag LOCUS_0710 gene mscL 76638 76273 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 protein_id gnl|my_center|LOCUS_0710 77031 77882 gene locus_tag LOCUS_0720 77031 77882 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_0720 77892 78950 gene locus_tag LOCUS_0730 77892 78950 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546989.1 protein_id gnl|my_center|LOCUS_0730 78943 79644 gene locus_tag LOCUS_0740 78943 79644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254285.1 protein_id gnl|my_center|LOCUS_0740 79816 81219 gene locus_tag LOCUS_0750 79816 81219 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546995.1 protein_id gnl|my_center|LOCUS_0750 81237 82628 gene locus_tag LOCUS_0760 81237 82628 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546997.1 protein_id gnl|my_center|LOCUS_0760 82798 84219 gene locus_tag LOCUS_0770 82798 84219 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_0770 84494 85948 gene locus_tag LOCUS_0780 84494 85948 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_0780 86071 87258 gene locus_tag LOCUS_0790 86071 87258 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476403.1 protein_id gnl|my_center|LOCUS_0790 87309 87848 gene locus_tag LOCUS_0800 gene citX 87309 87848 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057787567.1 protein_id gnl|my_center|LOCUS_0800 87946 89082 gene locus_tag LOCUS_0810 87946 89082 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_0810 89111 90034 gene locus_tag LOCUS_0820 89111 90034 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547001.1 protein_id gnl|my_center|LOCUS_0820 90081 90872 gene locus_tag LOCUS_0830 90081 90872 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547007.1 protein_id gnl|my_center|LOCUS_0830 91826 90873 gene locus_tag LOCUS_0840 91826 90873 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641300.1 protein_id gnl|my_center|LOCUS_0840 92020 93075 gene locus_tag LOCUS_0850 gene citC 92020 93075 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547009.1 protein_id gnl|my_center|LOCUS_0850 93065 93358 gene locus_tag LOCUS_0860 gene citD 93065 93358 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 protein_id gnl|my_center|LOCUS_0860 93359 94273 gene locus_tag LOCUS_0870 gene citE 93359 94273 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 protein_id gnl|my_center|LOCUS_0870 94263 95801 gene locus_tag LOCUS_0880 gene citF 94263 95801 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547016.1 protein_id gnl|my_center|LOCUS_0880 95975 96793 gene locus_tag LOCUS_0890 gene citG 95975 96793 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547775.1 protein_id gnl|my_center|LOCUS_0890 96793 98151 gene locus_tag LOCUS_0900 96793 98151 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547031.1 protein_id gnl|my_center|LOCUS_0900 98733 98227 gene locus_tag LOCUS_0910 gene ybaK 98733 98227 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254291.1 protein_id gnl|my_center|LOCUS_0910 98799 99743 gene locus_tag LOCUS_0920 gene prmA 98799 99743 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547033.1 protein_id gnl|my_center|LOCUS_0920 99788 100162 gene locus_tag LOCUS_0930 99788 100162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 100184 102418 gene locus_tag LOCUS_0940 100184 102418 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254292.1 protein_id gnl|my_center|LOCUS_0940 102418 102858 gene locus_tag LOCUS_0950 gene dtd 102418 102858 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547036.1 protein_id gnl|my_center|LOCUS_0950 103125 104405 gene locus_tag LOCUS_0960 gene hisS 103125 104405 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547037.1 protein_id gnl|my_center|LOCUS_0960 104423 106255 gene locus_tag LOCUS_0970 gene aspS 104423 106255 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547039.1 protein_id gnl|my_center|LOCUS_0970 106440 106706 gene locus_tag LOCUS_0980 106440 106706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 106706 107038 gene locus_tag LOCUS_0990 106706 107038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 107187 108773 gene locus_tag LOCUS_1000 107187 108773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254534.1 protein_id gnl|my_center|LOCUS_1000 109119 109304 gene locus_tag LOCUS_1010 109119 109304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 109357 109503 gene locus_tag LOCUS_1020 109357 109503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 109547 109795 gene locus_tag LOCUS_1030 109547 109795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 109789 110127 gene locus_tag LOCUS_1040 109789 110127 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125656.1 protein_id gnl|my_center|LOCUS_1040 110152 110364 gene locus_tag LOCUS_1050 110152 110364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 110447 110887 gene locus_tag LOCUS_1060 gene msrB 110447 110887 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548013.1 protein_id gnl|my_center|LOCUS_1060 110887 111417 gene locus_tag LOCUS_1070 gene msrA 110887 111417 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547717.1 protein_id gnl|my_center|LOCUS_1070 111495 112373 gene locus_tag LOCUS_1080 111495 112373 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547719.1 protein_id gnl|my_center|LOCUS_1080 113248 112424 gene locus_tag LOCUS_1090 113248 112424 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547712.1 protein_id gnl|my_center|LOCUS_1090 113394 113570 gene locus_tag LOCUS_1100 gene rpsU 113394 113570 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002880182.1 protein_id gnl|my_center|LOCUS_1100 113641 113814 gene locus_tag LOCUS_1110 113641 113814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 113922 114101 gene locus_tag LOCUS_1120 113922 114101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1120 114122 115075 gene locus_tag LOCUS_1130 114122 115075 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254379.1 protein_id gnl|my_center|LOCUS_1130 115075 115599 gene locus_tag LOCUS_1140 gene ybeY 115075 115599 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547628.1 protein_id gnl|my_center|LOCUS_1140 115599 116021 gene locus_tag LOCUS_1150 115599 116021 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_1150 116005 116913 gene locus_tag LOCUS_1160 gene era 116005 116913 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254378.1 protein_id gnl|my_center|LOCUS_1160 116913 117668 gene locus_tag LOCUS_1170 gene recO 116913 117668 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_1170 117912 118829 gene locus_tag LOCUS_1180 gene glyQ 117912 118829 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547621.1 protein_id gnl|my_center|LOCUS_1180 118822 120888 gene locus_tag LOCUS_1190 gene glyS 118822 120888 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547620.1 protein_id gnl|my_center|LOCUS_1190 120940 122727 gene locus_tag LOCUS_1200 gene dnaG 120940 122727 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547619.1 protein_id gnl|my_center|LOCUS_1200 122740 123834 gene locus_tag LOCUS_1210 gene rpoD 122740 123834 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254377.1 protein_id gnl|my_center|LOCUS_1210 123938 124627 gene locus_tag LOCUS_1220 123938 124627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547613.1 protein_id gnl|my_center|LOCUS_1220 124620 125417 gene locus_tag LOCUS_1230 124620 125417 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547612.1 protein_id gnl|my_center|LOCUS_1230 125434 126672 gene locus_tag LOCUS_1240 gene pepT 125434 126672 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547606.1 protein_id gnl|my_center|LOCUS_1240 126966 127334 gene locus_tag LOCUS_1250 126966 127334 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547604.1 protein_id gnl|my_center|LOCUS_1250 127334 128035 gene locus_tag LOCUS_1260 127334 128035 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547603.1 protein_id gnl|my_center|LOCUS_1260 128036 128848 gene locus_tag LOCUS_1270 128036 128848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 128863 129660 gene locus_tag LOCUS_1280 128863 129660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 129675 130433 gene locus_tag LOCUS_1290 129675 130433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 130494 131180 gene locus_tag LOCUS_1300 130494 131180 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549496.1 protein_id gnl|my_center|LOCUS_1300 131415 131230 gene locus_tag LOCUS_1310 131415 131230 CDS product LBP_cg2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547599.1 protein_id gnl|my_center|LOCUS_1310 132064 131486 gene locus_tag LOCUS_1320 gene lepB 132064 131486 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547598.1 protein_id gnl|my_center|LOCUS_1320 132151 132873 gene locus_tag LOCUS_1330 132151 132873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254372.1 protein_id gnl|my_center|LOCUS_1330 132923 135208 gene locus_tag LOCUS_1340 132923 135208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 136699 135677 gene locus_tag LOCUS_1350 gene fni 136699 135677 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254369.1 protein_id gnl|my_center|LOCUS_1350 137787 136699 gene locus_tag LOCUS_1360 137787 136699 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_1360 138788 137826 gene locus_tag LOCUS_1370 gene mvaD 138788 137826 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547574.1 protein_id gnl|my_center|LOCUS_1370 139702 138788 gene locus_tag LOCUS_1380 gene mvk 139702 138788 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547572.1 protein_id gnl|my_center|LOCUS_1380 139759 143214 gene locus_tag LOCUS_1390 139759 143214 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254367.1 protein_id gnl|my_center|LOCUS_1390 143207 146767 gene locus_tag LOCUS_1400 gene addA 143207 146767 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254366.1 protein_id gnl|my_center|LOCUS_1400 146850 149660 gene locus_tag LOCUS_1410 146850 149660 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254365.1 protein_id gnl|my_center|LOCUS_1410 149644 150135 gene locus_tag LOCUS_1420 149644 150135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254364.1 protein_id gnl|my_center|LOCUS_1420 150213 151511 gene locus_tag LOCUS_1430 gene asnS 150213 151511 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547544.1 protein_id gnl|my_center|LOCUS_1430 151579 152214 gene locus_tag LOCUS_1440 151579 152214 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547543.1 protein_id gnl|my_center|LOCUS_1440 152214 152867 gene locus_tag LOCUS_1450 gene nth 152214 152867 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254362.1 protein_id gnl|my_center|LOCUS_1450 152881 153690 gene locus_tag LOCUS_1460 152881 153690 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549308.1 protein_id gnl|my_center|LOCUS_1460 153641 153823 gene locus_tag LOCUS_1470 153641 153823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 156222 153886 gene locus_tag LOCUS_1480 156222 153886 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254361.1 protein_id gnl|my_center|LOCUS_1480 156843 156223 gene locus_tag LOCUS_1490 gene recU 156843 156223 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254360.1 protein_id gnl|my_center|LOCUS_1490 157007 157573 gene locus_tag LOCUS_1500 157007 157573 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547535.1 protein_id gnl|my_center|LOCUS_1500 157673 158098 gene locus_tag LOCUS_1510 157673 158098 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547534.1 protein_id gnl|my_center|LOCUS_1510 158570 159697 gene locus_tag LOCUS_1520 158570 159697 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547533.1 protein_id gnl|my_center|LOCUS_1520 159717 160961 gene locus_tag LOCUS_1530 159717 160961 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254359.1 protein_id gnl|my_center|LOCUS_1530 160949 162139 gene locus_tag LOCUS_1540 gene coaBC 160949 162139 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254293.1 protein_id gnl|my_center|LOCUS_1540 162465 165146 gene locus_tag LOCUS_1550 162465 165146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 >Feature sequence02 <1 652 gene locus_tag LOCUS_1560 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674231.1:galactose mutarotase 1000 722 gene locus_tag LOCUS_1570 1000 722 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546474.1 protein_id gnl|my_center|LOCUS_1570 3281 1098 gene locus_tag LOCUS_1580 3281 1098 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254211.1 protein_id gnl|my_center|LOCUS_1580 3441 3623 gene locus_tag LOCUS_1590 3441 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 3729 3995 gene locus_tag LOCUS_1600 3729 3995 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546482.1 protein_id gnl|my_center|LOCUS_1600 3995 5731 gene locus_tag LOCUS_1610 gene ptsP 3995 5731 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_1610 5944 6342 gene locus_tag LOCUS_1620 gene spxA 5944 6342 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_1620 6423 7103 gene locus_tag LOCUS_1630 6423 7103 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546487.1 protein_id gnl|my_center|LOCUS_1630 7163 8026 gene locus_tag LOCUS_1640 7163 8026 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254214.1 protein_id gnl|my_center|LOCUS_1640 8669 8037 gene locus_tag LOCUS_1650 8669 8037 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546492.1 protein_id gnl|my_center|LOCUS_1650 9362 8742 gene locus_tag LOCUS_1660 9362 8742 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546493.1 protein_id gnl|my_center|LOCUS_1660 9475 10101 gene locus_tag LOCUS_1670 9475 10101 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546495.1 protein_id gnl|my_center|LOCUS_1670 10101 10889 gene locus_tag LOCUS_1680 10101 10889 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254215.1 protein_id gnl|my_center|LOCUS_1680 10890 11783 gene locus_tag LOCUS_1690 10890 11783 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546500.1 protein_id gnl|my_center|LOCUS_1690 11886 12317 gene locus_tag LOCUS_1700 11886 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 12577 20685 gene locus_tag LOCUS_1710 12577 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 20576 21610 gene locus_tag LOCUS_1720 20576 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 20579 20678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21968 25750 gene locus_tag LOCUS_1730 21968 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 24603 24702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26032 25841 gene locus_tag LOCUS_1740 26032 25841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 26876 26046 gene locus_tag LOCUS_1750 26876 26046 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564150.1 protein_id gnl|my_center|LOCUS_1750 27909 26887 gene locus_tag LOCUS_1760 27909 26887 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546505.1 protein_id gnl|my_center|LOCUS_1760 28015 30753 gene locus_tag LOCUS_1770 28015 30753 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546507.1 protein_id gnl|my_center|LOCUS_1770 30834 32039 gene locus_tag LOCUS_1780 30834 32039 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546511.1 protein_id gnl|my_center|LOCUS_1780 32032 32589 gene locus_tag LOCUS_1790 32032 32589 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546513.1 protein_id gnl|my_center|LOCUS_1790 32591 32986 gene locus_tag LOCUS_1800 32591 32986 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546515.1 protein_id gnl|my_center|LOCUS_1800 33006 35393 gene locus_tag LOCUS_1810 33006 35393 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546517.1 protein_id gnl|my_center|LOCUS_1810 35383 36594 gene locus_tag LOCUS_1820 35383 36594 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254218.1 protein_id gnl|my_center|LOCUS_1820 36591 37826 gene locus_tag LOCUS_1830 36591 37826 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546521.1 protein_id gnl|my_center|LOCUS_1830 37837 38565 gene locus_tag LOCUS_1840 37837 38565 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546523.1 protein_id gnl|my_center|LOCUS_1840 38618 39682 gene locus_tag LOCUS_1850 38618 39682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 39690 40253 gene locus_tag LOCUS_1860 gene pgsA 39690 40253 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546529.1 protein_id gnl|my_center|LOCUS_1860 40430 41512 gene locus_tag LOCUS_1870 gene recA 40430 41512 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546531.1 protein_id gnl|my_center|LOCUS_1870 41636 43267 gene locus_tag LOCUS_1880 gene rny 41636 43267 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254219.1 protein_id gnl|my_center|LOCUS_1880 43373 44542 gene locus_tag LOCUS_1890 43373 44542 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546535.1 protein_id gnl|my_center|LOCUS_1890 45242 44580 gene locus_tag LOCUS_1900 45242 44580 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_1900 45290 46570 gene locus_tag LOCUS_1910 45290 46570 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546538.1 protein_id gnl|my_center|LOCUS_1910 46567 47244 gene locus_tag LOCUS_1920 46567 47244 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254220.1 protein_id gnl|my_center|LOCUS_1920 47324 47869 gene locus_tag LOCUS_1930 gene raiA 47324 47869 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254221.1 protein_id gnl|my_center|LOCUS_1930 48008 50410 gene locus_tag LOCUS_1940 gene secA 48008 50410 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254222.1 protein_id gnl|my_center|LOCUS_1940 50585 51583 gene locus_tag LOCUS_1950 gene prfB 50585 51583 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522727.1 protein_id gnl|my_center|LOCUS_1950 51596 51901 gene locus_tag LOCUS_1960 51596 51901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 51913 52854 gene locus_tag LOCUS_1970 gene hprK 51913 52854 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546560.1 protein_id gnl|my_center|LOCUS_1970 52874 53707 gene locus_tag LOCUS_1980 gene lgt 52874 53707 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613330.1 protein_id gnl|my_center|LOCUS_1980 53710 54732 gene locus_tag LOCUS_1990 53710 54732 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546563.1 protein_id gnl|my_center|LOCUS_1990 54802 55728 gene locus_tag LOCUS_2000 gene trxB 54802 55728 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254223.1 protein_id gnl|my_center|LOCUS_2000 55854 57578 gene locus_tag LOCUS_2010 55854 57578 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546584.1 protein_id gnl|my_center|LOCUS_2010 57676 59721 gene locus_tag LOCUS_2020 gene uvrB 57676 59721 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546586.1 protein_id gnl|my_center|LOCUS_2020 59708 62548 gene locus_tag LOCUS_2030 gene uvrA 59708 62548 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546588.1 protein_id gnl|my_center|LOCUS_2030 62645 63520 gene locus_tag LOCUS_2040 gene rapZ 62645 63520 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546593.1 protein_id gnl|my_center|LOCUS_2040 63530 64567 gene locus_tag LOCUS_2050 63530 64567 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546595.1 protein_id gnl|my_center|LOCUS_2050 64560 65498 gene locus_tag LOCUS_2060 gene whiA 64560 65498 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_2060 65639 66853 gene locus_tag LOCUS_2070 65639 66853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 66919 67911 gene locus_tag LOCUS_2080 66919 67911 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475675.1 protein_id gnl|my_center|LOCUS_2080 68059 69252 gene locus_tag LOCUS_2090 68059 69252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 69885 69304 gene locus_tag LOCUS_2100 gene clpP 69885 69304 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546597.1 protein_id gnl|my_center|LOCUS_2100 70431 69979 gene locus_tag LOCUS_2110 70431 69979 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 protein_id gnl|my_center|LOCUS_2110 71958 70534 gene locus_tag LOCUS_2120 71958 70534 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546599.1 protein_id gnl|my_center|LOCUS_2120 72127 73722 gene locus_tag LOCUS_2130 72127 73722 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254096.1 protein_id gnl|my_center|LOCUS_2130 73823 74149 gene locus_tag LOCUS_2140 73823 74149 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_2140 74260 74187 gene locus_tag LOCUS_t0020 74260 74187 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 74502 75533 gene locus_tag LOCUS_2150 74502 75533 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546600.1 protein_id gnl|my_center|LOCUS_2150 75591 76607 gene locus_tag LOCUS_2160 gene gap 75591 76607 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546601.1 protein_id gnl|my_center|LOCUS_2160 76713 77924 gene locus_tag LOCUS_2170 76713 77924 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546602.1 protein_id gnl|my_center|LOCUS_2170 77939 78694 gene locus_tag LOCUS_2180 gene tpiA 77939 78694 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_2180 78754 80052 gene locus_tag LOCUS_2190 gene eno 78754 80052 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643976.1 protein_id gnl|my_center|LOCUS_2190 80197 80430 gene locus_tag LOCUS_2200 gene secG 80197 80430 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254157.1 protein_id gnl|my_center|LOCUS_2200 80473 82815 gene locus_tag LOCUS_2210 gene rnr 80473 82815 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550136.1 protein_id gnl|my_center|LOCUS_2210 82828 83283 gene locus_tag LOCUS_2220 gene smpB 82828 83283 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550138.1 protein_id gnl|my_center|LOCUS_2220 83802 83287 gene locus_tag LOCUS_2230 83802 83287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254226.1 protein_id gnl|my_center|LOCUS_2230 83895 84584 gene locus_tag LOCUS_2240 83895 84584 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546612.1 protein_id gnl|my_center|LOCUS_2240 84596 85573 gene locus_tag LOCUS_2250 gene pta 84596 85573 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641060.1 protein_id gnl|my_center|LOCUS_2250 85573 86049 gene locus_tag LOCUS_2260 gene tsaE 85573 86049 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546616.1 protein_id gnl|my_center|LOCUS_2260 86628 86095 gene locus_tag LOCUS_2270 86628 86095 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546623.1 protein_id gnl|my_center|LOCUS_2270 86733 87644 gene locus_tag LOCUS_2280 gene murB 86733 87644 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_2280 87641 88741 gene locus_tag LOCUS_2290 87641 88741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546625.1 protein_id gnl|my_center|LOCUS_2290 88731 89543 gene locus_tag LOCUS_2300 88731 89543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546626.1 protein_id gnl|my_center|LOCUS_2300 89540 90349 gene locus_tag LOCUS_2310 89540 90349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254228.1 protein_id gnl|my_center|LOCUS_2310 90346 91419 gene locus_tag LOCUS_2320 90346 91419 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546630.1 protein_id gnl|my_center|LOCUS_2320 91456 92298 gene locus_tag LOCUS_2330 gene cdaA 91456 92298 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254229.1 protein_id gnl|my_center|LOCUS_2330 92295 93263 gene locus_tag LOCUS_2340 92295 93263 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546633.1 protein_id gnl|my_center|LOCUS_2340 93282 94634 gene locus_tag LOCUS_2350 gene glmM 93282 94634 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546635.1 protein_id gnl|my_center|LOCUS_2350 94734 95543 gene locus_tag LOCUS_2360 94734 95543 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546636.1 protein_id gnl|my_center|LOCUS_2360 95552 96385 gene locus_tag LOCUS_2370 95552 96385 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546639.1 protein_id gnl|my_center|LOCUS_2370 96466 96906 gene locus_tag LOCUS_2380 96466 96906 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549441.1 protein_id gnl|my_center|LOCUS_2380 96921 97289 gene locus_tag LOCUS_2390 96921 97289 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549440.1 protein_id gnl|my_center|LOCUS_2390 97289 99196 gene locus_tag LOCUS_2400 97289 99196 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_2400 99300 99683 gene locus_tag LOCUS_2410 99300 99683 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254309.1 protein_id gnl|my_center|LOCUS_2410 99680 100015 gene locus_tag LOCUS_2420 gene crcB 99680 100015 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_2420 100016 100723 gene locus_tag LOCUS_2430 100016 100723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 100773 101192 gene locus_tag LOCUS_2440 100773 101192 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_2440 101968 101240 gene locus_tag LOCUS_2450 101968 101240 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546668.1 protein_id gnl|my_center|LOCUS_2450 102566 102045 gene locus_tag LOCUS_2460 102566 102045 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254234.1 protein_id gnl|my_center|LOCUS_2460 102644 103522 gene locus_tag LOCUS_2470 102644 103522 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007126647.1 protein_id gnl|my_center|LOCUS_2470 103743 105356 gene locus_tag LOCUS_2480 103743 105356 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476248.1 protein_id gnl|my_center|LOCUS_2480 105456 106439 gene locus_tag LOCUS_2490 gene comGA 105456 106439 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546670.1 protein_id gnl|my_center|LOCUS_2490 106405 107406 gene locus_tag LOCUS_2500 106405 107406 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021721297.1 protein_id gnl|my_center|LOCUS_2500 107417 107746 gene locus_tag LOCUS_2510 gene comGC 107417 107746 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546673.1 protein_id gnl|my_center|LOCUS_2510 107724 108155 gene locus_tag LOCUS_2520 107724 108155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 108142 108354 gene locus_tag LOCUS_2530 108142 108354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 108344 108835 gene locus_tag LOCUS_2540 108344 108835 CDS product ComGF family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546679.1 protein_id gnl|my_center|LOCUS_2540 109036 110034 gene locus_tag LOCUS_2550 109036 110034 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546680.1 protein_id gnl|my_center|LOCUS_2550 110067 111254 gene locus_tag LOCUS_2560 110067 111254 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546683.1 protein_id gnl|my_center|LOCUS_2560 111311 111674 gene locus_tag LOCUS_tm0010 111311 111674 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 111963 112151 gene locus_tag LOCUS_2570 111963 112151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 112203 112436 gene locus_tag LOCUS_2580 112203 112436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 112620 112853 gene locus_tag LOCUS_2590 112620 112853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 113082 113219 gene locus_tag LOCUS_2600 113082 113219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 113259 113441 gene locus_tag LOCUS_2610 113259 113441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 113602 113808 gene locus_tag LOCUS_2620 113602 113808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 113852 114145 gene locus_tag LOCUS_2630 113852 114145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 114186 114365 gene locus_tag LOCUS_2640 114186 114365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 114475 114615 gene locus_tag LOCUS_2650 114475 114615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 114637 114768 gene locus_tag LOCUS_2660 114637 114768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 115015 115806 gene locus_tag LOCUS_2670 gene sufC 115015 115806 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702968.1 protein_id gnl|my_center|LOCUS_2670 115818 117047 gene locus_tag LOCUS_2680 gene sufD 115818 117047 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702957.1 protein_id gnl|my_center|LOCUS_2680 117037 118230 gene locus_tag LOCUS_2690 117037 118230 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921888.1 protein_id gnl|my_center|LOCUS_2690 118227 118670 gene locus_tag LOCUS_2700 118227 118670 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699481.1 protein_id gnl|my_center|LOCUS_2700 118670 120073 gene locus_tag LOCUS_2710 gene sufB 118670 120073 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702990.1 protein_id gnl|my_center|LOCUS_2710 120173 120748 gene locus_tag LOCUS_2720 120173 120748 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699485.1 protein_id gnl|my_center|LOCUS_2720 120927 121238 gene locus_tag LOCUS_2730 gene rplU 120927 121238 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_2730 121257 121556 gene locus_tag LOCUS_2740 gene rpmA 121257 121556 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254420.1 protein_id gnl|my_center|LOCUS_2740 121622 122728 gene locus_tag LOCUS_2750 121622 122728 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547949.1 protein_id gnl|my_center|LOCUS_2750 122797 123366 gene locus_tag LOCUS_2760 gene efp 122797 123366 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_2760 123391 123837 gene locus_tag LOCUS_2770 123391 123837 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547946.1 protein_id gnl|my_center|LOCUS_2770 123837 124238 gene locus_tag LOCUS_2780 gene nusB 123837 124238 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547945.1 protein_id gnl|my_center|LOCUS_2780 124285 125136 gene locus_tag LOCUS_2790 124285 125136 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_2790 125123 126484 gene locus_tag LOCUS_2800 gene xseA 125123 126484 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547941.1 protein_id gnl|my_center|LOCUS_2800 126468 126716 gene locus_tag LOCUS_2810 126468 126716 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547938.1 protein_id gnl|my_center|LOCUS_2810 126718 127584 gene locus_tag LOCUS_2820 126718 127584 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547935.1 protein_id gnl|my_center|LOCUS_2820 127584 128396 gene locus_tag LOCUS_2830 127584 128396 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547933.1 protein_id gnl|my_center|LOCUS_2830 128410 130095 gene locus_tag LOCUS_2840 gene recN 128410 130095 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547931.1 protein_id gnl|my_center|LOCUS_2840 130455 130150 gene locus_tag LOCUS_2850 130455 130150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 130668 131282 gene locus_tag LOCUS_2860 gene gmk 130668 131282 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_2860 131286 131504 gene locus_tag LOCUS_2870 gene rpoZ 131286 131504 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547927.1 protein_id gnl|my_center|LOCUS_2870 131559 133952 gene locus_tag LOCUS_2880 gene priA 131559 133952 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_2880 133969 134913 gene locus_tag LOCUS_2890 gene fmt 133969 134913 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547919.1 protein_id gnl|my_center|LOCUS_2890 134906 136219 gene locus_tag LOCUS_2900 gene rsmB 134906 136219 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254418.1 protein_id gnl|my_center|LOCUS_2900 136225 136974 gene locus_tag LOCUS_2910 136225 136974 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_2910 136971 138965 gene locus_tag LOCUS_2920 gene pknB 136971 138965 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938256.1 protein_id gnl|my_center|LOCUS_2920 138962 139849 gene locus_tag LOCUS_2930 gene rsgA 138962 139849 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547915.1 protein_id gnl|my_center|LOCUS_2930 139883 140545 gene locus_tag LOCUS_2940 gene rpe 139883 140545 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547914.1 protein_id gnl|my_center|LOCUS_2940 140532 141206 gene locus_tag LOCUS_2950 140532 141206 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254415.1 protein_id gnl|my_center|LOCUS_2950 141462 141277 gene locus_tag LOCUS_2960 gene rpmB 141462 141277 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547911.1 protein_id gnl|my_center|LOCUS_2960 141639 142001 gene locus_tag LOCUS_2970 141639 142001 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547910.1 protein_id gnl|my_center|LOCUS_2970 142022 143677 gene locus_tag LOCUS_2980 142022 143677 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547907.1 protein_id gnl|my_center|LOCUS_2980 143682 145706 gene locus_tag LOCUS_2990 gene recG 143682 145706 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254414.1 protein_id gnl|my_center|LOCUS_2990 145715 146719 gene locus_tag LOCUS_3000 gene plsX 145715 146719 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547901.1 protein_id gnl|my_center|LOCUS_3000 146777 147016 gene locus_tag LOCUS_3010 gene acpP 146777 147016 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294295.1 protein_id gnl|my_center|LOCUS_3010 147131 148147 gene locus_tag LOCUS_3020 147131 148147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547898.1 protein_id gnl|my_center|LOCUS_3020 148151 149119 gene locus_tag LOCUS_3030 148151 149119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547895.1 protein_id gnl|my_center|LOCUS_3030 149121 150080 gene locus_tag LOCUS_3040 149121 150080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547894.1 protein_id gnl|my_center|LOCUS_3040 150095 151009 gene locus_tag LOCUS_3050 150095 151009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547893.1 protein_id gnl|my_center|LOCUS_3050 151349 153121 gene locus_tag LOCUS_3060 151349 153121 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_3060 153308 155068 gene locus_tag LOCUS_3070 153308 155068 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254413.1 protein_id gnl|my_center|LOCUS_3070 155153 155845 gene locus_tag LOCUS_3080 gene rnc 155153 155845 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547887.1 protein_id gnl|my_center|LOCUS_3080 155855 159424 gene locus_tag LOCUS_3090 gene smc 155855 159424 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254411.1 protein_id gnl|my_center|LOCUS_3090 159424 160728 gene locus_tag LOCUS_3100 gene ftsY 159424 160728 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547883.1 protein_id gnl|my_center|LOCUS_3100 160739 162163 gene locus_tag LOCUS_3110 160739 162163 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254410.1 protein_id gnl|my_center|LOCUS_3110 >Feature sequence03 779 252 gene locus_tag LOCUS_3120 779 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 1616 969 gene locus_tag LOCUS_3130 1616 969 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548415.1 protein_id gnl|my_center|LOCUS_3130 1955 1635 gene locus_tag LOCUS_3140 1955 1635 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254504.1 protein_id gnl|my_center|LOCUS_3140 2670 2017 gene locus_tag LOCUS_3150 gene trmB 2670 2017 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548419.1 protein_id gnl|my_center|LOCUS_3150 3863 2679 gene locus_tag LOCUS_3160 3863 2679 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613400.1 protein_id gnl|my_center|LOCUS_3160 4599 3856 gene locus_tag LOCUS_3170 4599 3856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548423.1 protein_id gnl|my_center|LOCUS_3170 4684 5115 gene locus_tag LOCUS_3180 4684 5115 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548425.1 protein_id gnl|my_center|LOCUS_3180 5147 5500 gene locus_tag LOCUS_3190 5147 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 5697 6605 gene locus_tag LOCUS_3200 5697 6605 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254505.1 protein_id gnl|my_center|LOCUS_3200 7636 6662 gene locus_tag LOCUS_3210 7636 6662 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254506.1 protein_id gnl|my_center|LOCUS_3210 10060 7646 gene locus_tag LOCUS_3220 10060 7646 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254507.1 protein_id gnl|my_center|LOCUS_3220 11264 10041 gene locus_tag LOCUS_3230 11264 10041 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548436.1 protein_id gnl|my_center|LOCUS_3230 11629 11267 gene locus_tag LOCUS_3240 11629 11267 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548438.1 protein_id gnl|my_center|LOCUS_3240 13698 11641 gene locus_tag LOCUS_3250 13698 11641 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548440.1 protein_id gnl|my_center|LOCUS_3250 13783 14646 gene locus_tag LOCUS_3260 13783 14646 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548442.1 protein_id gnl|my_center|LOCUS_3260 15585 14674 gene locus_tag LOCUS_3270 gene fba 15585 14674 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254510.1 protein_id gnl|my_center|LOCUS_3270 17331 15655 gene locus_tag LOCUS_3280 gene argS 17331 15655 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548463.1 protein_id gnl|my_center|LOCUS_3280 19687 17591 gene locus_tag LOCUS_3290 19687 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 21031 19763 gene locus_tag LOCUS_3300 21031 19763 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_3300 21888 21043 gene locus_tag LOCUS_3310 21888 21043 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254511.1 protein_id gnl|my_center|LOCUS_3310 21961 22044 gene locus_tag LOCUS_t0030 21961 22044 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22204 22848 gene locus_tag LOCUS_3320 22204 22848 CDS product DUF3862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379690.1 protein_id gnl|my_center|LOCUS_3320 24571 22886 gene locus_tag LOCUS_3330 24571 22886 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254405.1 protein_id gnl|my_center|LOCUS_3330 25063 24653 gene locus_tag LOCUS_3340 25063 24653 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_3340 27540 25156 gene locus_tag LOCUS_3350 gene ppsA 27540 25156 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646028.1 protein_id gnl|my_center|LOCUS_3350 28140 28571 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttcaacttactgatttaacaaccttctaaaac 29273 28605 gene locus_tag LOCUS_3360 gene csn2 29273 28605 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475523.1 protein_id gnl|my_center|LOCUS_3360 29575 29270 gene locus_tag LOCUS_3370 gene cas2 29575 29270 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_3370 30461 29553 gene locus_tag LOCUS_3380 gene cas1 30461 29553 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475521.1 protein_id gnl|my_center|LOCUS_3380 34878 30691 gene locus_tag LOCUS_3390 gene cas9 34878 30691 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475518.1 protein_id gnl|my_center|LOCUS_3390 35980 35000 gene locus_tag LOCUS_3400 35980 35000 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703057.1 protein_id gnl|my_center|LOCUS_3400 36723 36055 gene locus_tag LOCUS_3410 36723 36055 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641684.1 protein_id gnl|my_center|LOCUS_3410 37514 36864 gene locus_tag LOCUS_3420 37514 36864 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702509.1 protein_id gnl|my_center|LOCUS_3420 37714 38541 gene locus_tag LOCUS_3430 37714 38541 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475543.1 protein_id gnl|my_center|LOCUS_3430 38551 39441 gene locus_tag LOCUS_3440 38551 39441 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702512.1 protein_id gnl|my_center|LOCUS_3440 40986 39493 gene locus_tag LOCUS_3450 40986 39493 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_3450 41773 41198 gene locus_tag LOCUS_3460 41773 41198 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_3460 42037 42654 gene locus_tag LOCUS_3470 42037 42654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 49287 43012 gene locus_tag LOCUS_3480 49287 43012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 49717 50739 gene locus_tag LOCUS_3490 49717 50739 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 protein_id gnl|my_center|LOCUS_3490 52008 50899 gene locus_tag LOCUS_3500 gene ugpC 52008 50899 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548138.1 protein_id gnl|my_center|LOCUS_3500 52863 52030 gene locus_tag LOCUS_3510 52863 52030 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254463.1 protein_id gnl|my_center|LOCUS_3510 53753 52878 gene locus_tag LOCUS_3520 53753 52878 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548142.1 protein_id gnl|my_center|LOCUS_3520 55024 53774 gene locus_tag LOCUS_3530 55024 53774 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254464.1 protein_id gnl|my_center|LOCUS_3530 55210 56247 gene locus_tag LOCUS_3540 55210 56247 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296414.1 protein_id gnl|my_center|LOCUS_3540 57684 56281 gene locus_tag LOCUS_3550 57684 56281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 59903 57717 gene locus_tag LOCUS_3560 59903 57717 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102184.1 protein_id gnl|my_center|LOCUS_3560 61071 60121 gene locus_tag LOCUS_3570 61071 60121 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549144.1 protein_id gnl|my_center|LOCUS_3570 61213 62658 gene locus_tag LOCUS_3580 gene gtfA 61213 62658 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254462.1 protein_id gnl|my_center|LOCUS_3580 64181 62754 gene locus_tag LOCUS_3590 gene arcD 64181 62754 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 protein_id gnl|my_center|LOCUS_3590 65715 64297 gene locus_tag LOCUS_3600 gene arcD 65715 64297 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286721.1 protein_id gnl|my_center|LOCUS_3600 66998 65772 gene locus_tag LOCUS_3610 gene arcA 66998 65772 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288439.1 protein_id gnl|my_center|LOCUS_3610 67959 67045 gene locus_tag LOCUS_3620 gene arcC 67959 67045 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074357.1 protein_id gnl|my_center|LOCUS_3620 68974 67973 gene locus_tag LOCUS_3630 gene argF 68974 67973 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793596.1 protein_id gnl|my_center|LOCUS_3630 69239 70090 gene locus_tag LOCUS_3640 69239 70090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 70741 70136 gene locus_tag LOCUS_3650 70741 70136 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254154.1 protein_id gnl|my_center|LOCUS_3650 71502 70738 gene locus_tag LOCUS_3660 71502 70738 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549224.1 protein_id gnl|my_center|LOCUS_3660 72066 71509 gene locus_tag LOCUS_3670 72066 71509 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549221.1 protein_id gnl|my_center|LOCUS_3670 73441 72053 gene locus_tag LOCUS_3680 73441 72053 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254152.1 protein_id gnl|my_center|LOCUS_3680 73768 73451 gene locus_tag LOCUS_3690 73768 73451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613308.1 protein_id gnl|my_center|LOCUS_3690 73848 75227 gene locus_tag LOCUS_3700 73848 75227 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549215.1 protein_id gnl|my_center|LOCUS_3700 75284 76690 gene locus_tag LOCUS_3710 gene pepV 75284 76690 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547162.1 protein_id gnl|my_center|LOCUS_3710 77730 76735 gene locus_tag LOCUS_3720 77730 76735 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549214.1 protein_id gnl|my_center|LOCUS_3720 77879 78991 gene locus_tag LOCUS_3730 77879 78991 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549213.1 protein_id gnl|my_center|LOCUS_3730 79360 79031 gene locus_tag LOCUS_3740 79360 79031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549212.1 protein_id gnl|my_center|LOCUS_3740 79807 79382 gene locus_tag LOCUS_3750 79807 79382 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549209.1 protein_id gnl|my_center|LOCUS_3750 79923 80744 gene locus_tag LOCUS_3760 79923 80744 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674287.1 protein_id gnl|my_center|LOCUS_3760 80952 80773 gene locus_tag LOCUS_3770 80952 80773 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547962.1 protein_id gnl|my_center|LOCUS_3770 81580 80963 gene locus_tag LOCUS_3780 81580 80963 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549206.1 protein_id gnl|my_center|LOCUS_3780 82377 81580 gene locus_tag LOCUS_3790 gene murI 82377 81580 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549203.1 protein_id gnl|my_center|LOCUS_3790 82466 82861 gene locus_tag LOCUS_3800 82466 82861 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549202.1 protein_id gnl|my_center|LOCUS_3800 83220 82909 gene locus_tag LOCUS_3810 gene trxA 83220 82909 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_3810 85672 83312 gene locus_tag LOCUS_3820 85672 83312 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549197.1 protein_id gnl|my_center|LOCUS_3820 86035 85721 gene locus_tag LOCUS_3830 86035 85721 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549194.1 protein_id gnl|my_center|LOCUS_3830 86465 86019 gene locus_tag LOCUS_3840 gene ruvX 86465 86019 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549192.1 protein_id gnl|my_center|LOCUS_3840 86722 86465 gene locus_tag LOCUS_3850 86722 86465 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_3850 89414 86778 gene locus_tag LOCUS_3860 gene alaS 89414 86778 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549179.1 protein_id gnl|my_center|LOCUS_3860 90999 89641 gene locus_tag LOCUS_3870 90999 89641 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549176.1 protein_id gnl|my_center|LOCUS_3870 91951 90992 gene locus_tag LOCUS_3880 91951 90992 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254146.1 protein_id gnl|my_center|LOCUS_3880 93130 92015 gene locus_tag LOCUS_3890 gene dinB 93130 92015 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549172.1 protein_id gnl|my_center|LOCUS_3890 94578 93130 gene locus_tag LOCUS_3900 gene zwf 94578 93130 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549170.1 protein_id gnl|my_center|LOCUS_3900 95046 94672 gene locus_tag LOCUS_3910 gene yajC 95046 94672 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613305.1 protein_id gnl|my_center|LOCUS_3910 96125 95115 gene locus_tag LOCUS_3920 gene ruvB 96125 95115 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549167.1 protein_id gnl|my_center|LOCUS_3920 96738 96157 gene locus_tag LOCUS_3930 gene ruvA 96738 96157 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549165.1 protein_id gnl|my_center|LOCUS_3930 98609 96741 gene locus_tag LOCUS_3940 gene mutL 98609 96741 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549162.1 protein_id gnl|my_center|LOCUS_3940 101191 98609 gene locus_tag LOCUS_3950 gene mutS 101191 98609 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254144.1 protein_id gnl|my_center|LOCUS_3950 101499 102098 gene locus_tag LOCUS_3960 101499 102098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 102483 102217 gene locus_tag LOCUS_3970 102483 102217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 102850 102485 gene locus_tag LOCUS_3980 102850 102485 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006307660.1 protein_id gnl|my_center|LOCUS_3980 >Feature sequence04 5117 4785 gene locus_tag LOCUS_3990 5117 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 6394 5267 gene locus_tag LOCUS_4000 gene mnmA 6394 5267 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546824.1 protein_id gnl|my_center|LOCUS_4000 6743 6408 gene locus_tag LOCUS_4010 6743 6408 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546822.1 protein_id gnl|my_center|LOCUS_4010 7958 6795 gene locus_tag LOCUS_4020 7958 6795 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101678.1 protein_id gnl|my_center|LOCUS_4020 8666 7977 gene locus_tag LOCUS_4030 8666 7977 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254262.1 protein_id gnl|my_center|LOCUS_4030 8958 8680 gene locus_tag LOCUS_4040 8958 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 9517 8951 gene locus_tag LOCUS_4050 9517 8951 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254261.1 protein_id gnl|my_center|LOCUS_4050 9738 9517 gene locus_tag LOCUS_4060 9738 9517 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546816.1 protein_id gnl|my_center|LOCUS_4060 12530 9738 gene locus_tag LOCUS_4070 gene ileS 12530 9738 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254260.1 protein_id gnl|my_center|LOCUS_4070 13478 12747 gene locus_tag LOCUS_4080 13478 12747 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254259.1 protein_id gnl|my_center|LOCUS_4080 14272 13448 gene locus_tag LOCUS_4090 14272 13448 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546811.1 protein_id gnl|my_center|LOCUS_4090 14603 14316 gene locus_tag LOCUS_4100 14603 14316 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906174.1 protein_id gnl|my_center|LOCUS_4100 15064 14603 gene locus_tag LOCUS_4110 gene sepF 15064 14603 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254258.1 protein_id gnl|my_center|LOCUS_4110 16453 15080 gene locus_tag LOCUS_4120 gene ftsZ 16453 15080 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546805.1 protein_id gnl|my_center|LOCUS_4120 17838 16468 gene locus_tag LOCUS_4130 gene ftsA 17838 16468 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254257.1 protein_id gnl|my_center|LOCUS_4130 18774 17920 gene locus_tag LOCUS_4140 18774 17920 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546801.1 protein_id gnl|my_center|LOCUS_4140 19917 18805 gene locus_tag LOCUS_4150 gene murG 19917 18805 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254256.1 protein_id gnl|my_center|LOCUS_4150 21290 19920 gene locus_tag LOCUS_4160 gene murD 21290 19920 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546797.1 protein_id gnl|my_center|LOCUS_4160 22255 21296 gene locus_tag LOCUS_4170 gene mraY 22255 21296 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546795.1 protein_id gnl|my_center|LOCUS_4170 24438 22276 gene locus_tag LOCUS_4180 24438 22276 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546793.1 protein_id gnl|my_center|LOCUS_4180 24815 24441 gene locus_tag LOCUS_4190 gene ftsL 24815 24441 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254255.1 protein_id gnl|my_center|LOCUS_4190 25781 24828 gene locus_tag LOCUS_4200 gene rsmH 25781 24828 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546789.1 protein_id gnl|my_center|LOCUS_4200 26209 25778 gene locus_tag LOCUS_4210 gene mraZ 26209 25778 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_4210 26736 26407 gene locus_tag LOCUS_4220 26736 26407 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254254.1 protein_id gnl|my_center|LOCUS_4220 26828 26947 gene locus_tag LOCUS_4230 26828 26947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 27535 26990 gene locus_tag LOCUS_4240 gene mreD 27535 26990 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546782.1 protein_id gnl|my_center|LOCUS_4240 28392 27535 gene locus_tag LOCUS_4250 gene mreC 28392 27535 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546779.1 protein_id gnl|my_center|LOCUS_4250 29448 28444 gene locus_tag LOCUS_4260 29448 28444 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546776.1 protein_id gnl|my_center|LOCUS_4260 30170 29547 gene locus_tag LOCUS_4270 gene radC 30170 29547 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546774.1 protein_id gnl|my_center|LOCUS_4270 30885 30205 gene locus_tag LOCUS_4280 30885 30205 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546772.1 protein_id gnl|my_center|LOCUS_4280 32131 30875 gene locus_tag LOCUS_4290 32131 30875 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254253.1 protein_id gnl|my_center|LOCUS_4290 34772 32133 gene locus_tag LOCUS_4300 34772 32133 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254252.1 protein_id gnl|my_center|LOCUS_4300 35748 35044 gene locus_tag LOCUS_4310 35748 35044 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_4310 36962 35748 gene locus_tag LOCUS_4320 gene thiI 36962 35748 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546762.1 protein_id gnl|my_center|LOCUS_4320 38126 36972 gene locus_tag LOCUS_4330 38126 36972 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546760.1 protein_id gnl|my_center|LOCUS_4330 39874 38213 gene locus_tag LOCUS_4340 gene ezrA 39874 38213 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546759.1 protein_id gnl|my_center|LOCUS_4340 40240 40851 gene locus_tag LOCUS_4350 gene rpsD 40240 40851 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254249.1 protein_id gnl|my_center|LOCUS_4350 40933 41400 gene locus_tag LOCUS_4360 40933 41400 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254248.1 protein_id gnl|my_center|LOCUS_4360 41397 42695 gene locus_tag LOCUS_4370 41397 42695 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546755.1 protein_id gnl|my_center|LOCUS_4370 43343 43783 gene locus_tag LOCUS_4380 43343 43783 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546753.1 protein_id gnl|my_center|LOCUS_4380 45033 43843 gene locus_tag LOCUS_4390 45033 43843 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546752.1 protein_id gnl|my_center|LOCUS_4390 45280 45053 gene locus_tag LOCUS_4400 45280 45053 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546751.1 protein_id gnl|my_center|LOCUS_4400 45576 45289 gene locus_tag LOCUS_4410 gene yidD 45576 45289 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564982.1 protein_id gnl|my_center|LOCUS_4410 46575 45586 gene locus_tag LOCUS_4420 46575 45586 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546749.1 protein_id gnl|my_center|LOCUS_4420 46892 46656 gene locus_tag LOCUS_4430 46892 46656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 47386 46943 gene locus_tag LOCUS_4440 47386 46943 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546746.1 protein_id gnl|my_center|LOCUS_4440 48840 47398 gene locus_tag LOCUS_4450 gene atpD 48840 47398 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254247.1 protein_id gnl|my_center|LOCUS_4450 49824 48862 gene locus_tag LOCUS_4460 49824 48862 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546744.1 protein_id gnl|my_center|LOCUS_4460 51349 49835 gene locus_tag LOCUS_4470 gene atpA 51349 49835 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254246.1 protein_id gnl|my_center|LOCUS_4470 51912 51364 gene locus_tag LOCUS_4480 51912 51364 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546742.1 protein_id gnl|my_center|LOCUS_4480 52421 51912 gene locus_tag LOCUS_4490 gene atpF 52421 51912 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546741.1 protein_id gnl|my_center|LOCUS_4490 52675 52460 gene locus_tag LOCUS_4500 gene atpE 52675 52460 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029779745.1 protein_id gnl|my_center|LOCUS_4500 53413 52697 gene locus_tag LOCUS_4510 gene atpB 53413 52697 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546739.1 protein_id gnl|my_center|LOCUS_4510 54174 53545 gene locus_tag LOCUS_4520 gene upp 54174 53545 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546738.1 protein_id gnl|my_center|LOCUS_4520 55261 54260 gene locus_tag LOCUS_4530 55261 54260 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546737.1 protein_id gnl|my_center|LOCUS_4530 56103 55261 gene locus_tag LOCUS_4540 gene prmC 56103 55261 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546736.1 protein_id gnl|my_center|LOCUS_4540 57184 56096 gene locus_tag LOCUS_4550 gene prfA 57184 56096 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546735.1 protein_id gnl|my_center|LOCUS_4550 57824 57219 gene locus_tag LOCUS_4560 57824 57219 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613340.1 protein_id gnl|my_center|LOCUS_4560 57963 59318 gene locus_tag LOCUS_4570 57963 59318 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546733.1 protein_id gnl|my_center|LOCUS_4570 60354 59347 gene locus_tag LOCUS_4580 60354 59347 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546711.1 protein_id gnl|my_center|LOCUS_4580 60446 60519 gene locus_tag LOCUS_t0040 60446 60519 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 60524 60596 gene locus_tag LOCUS_t0050 60524 60596 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 61026 60787 gene locus_tag LOCUS_4590 61026 60787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 62488 61118 gene locus_tag LOCUS_4600 62488 61118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254239.1 protein_id gnl|my_center|LOCUS_4600 63920 62583 gene locus_tag LOCUS_4610 63920 62583 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546706.1 protein_id gnl|my_center|LOCUS_4610 64614 63991 gene locus_tag LOCUS_4620 64614 63991 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254238.1 protein_id gnl|my_center|LOCUS_4620 64745 66943 gene locus_tag LOCUS_4630 64745 66943 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546703.1 protein_id gnl|my_center|LOCUS_4630 68260 66995 gene locus_tag LOCUS_4640 68260 66995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548775.1 protein_id gnl|my_center|LOCUS_4640 <69251 68446 gene locus_tag LOCUS_4650 <69251 68446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994450.1:FIVAR domain-containing protein >Feature sequence05 469 41 gene locus_tag LOCUS_4660 469 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 1960 500 gene locus_tag LOCUS_4670 1960 500 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674229.1 protein_id gnl|my_center|LOCUS_4670 2952 1957 gene locus_tag LOCUS_4680 gene galE 2952 1957 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674228.1 protein_id gnl|my_center|LOCUS_4680 4141 2975 gene locus_tag LOCUS_4690 4141 2975 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674227.1 protein_id gnl|my_center|LOCUS_4690 4852 4295 gene locus_tag LOCUS_4700 4852 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 6541 4970 gene locus_tag LOCUS_4710 6541 4970 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546473.1 protein_id gnl|my_center|LOCUS_4710 7404 6541 gene locus_tag LOCUS_4720 7404 6541 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546472.1 protein_id gnl|my_center|LOCUS_4720 7524 7985 gene locus_tag LOCUS_4730 7524 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 8464 7988 gene locus_tag LOCUS_4740 8464 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254210.1 protein_id gnl|my_center|LOCUS_4740 9290 8475 gene locus_tag LOCUS_4750 gene recX 9290 8475 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546469.1 protein_id gnl|my_center|LOCUS_4750 9431 10807 gene locus_tag LOCUS_4760 gene rlmD 9431 10807 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546467.1 protein_id gnl|my_center|LOCUS_4760 10915 11073 gene locus_tag LOCUS_4770 10915 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 12378 11221 gene locus_tag LOCUS_4780 12378 11221 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546460.1 protein_id gnl|my_center|LOCUS_4780 13592 12381 gene locus_tag LOCUS_4790 13592 12381 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546459.1 protein_id gnl|my_center|LOCUS_4790 14755 13610 gene locus_tag LOCUS_4800 14755 13610 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546457.1 protein_id gnl|my_center|LOCUS_4800 15750 14797 gene locus_tag LOCUS_4810 15750 14797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254232.1 protein_id gnl|my_center|LOCUS_4810 15922 16206 gene locus_tag LOCUS_4820 15922 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 17145 16243 gene locus_tag LOCUS_4830 gene galU 17145 16243 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546456.1 protein_id gnl|my_center|LOCUS_4830 18073 17213 gene locus_tag LOCUS_4840 18073 17213 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546451.1 protein_id gnl|my_center|LOCUS_4840 18893 18066 gene locus_tag LOCUS_4850 gene map 18893 18066 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254208.1 protein_id gnl|my_center|LOCUS_4850 19101 19547 gene locus_tag LOCUS_4860 19101 19547 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546448.1 protein_id gnl|my_center|LOCUS_4860 19540 20043 gene locus_tag LOCUS_4870 19540 20043 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546446.1 protein_id gnl|my_center|LOCUS_4870 20507 20073 gene locus_tag LOCUS_4880 20507 20073 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902601.1 protein_id gnl|my_center|LOCUS_4880 20950 20510 gene locus_tag LOCUS_4890 20950 20510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 22272 21130 gene locus_tag LOCUS_4900 gene wecB 22272 21130 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254207.1 protein_id gnl|my_center|LOCUS_4900 22341 22520 gene locus_tag LOCUS_4910 22341 22520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 22687 22983 gene locus_tag LOCUS_4920 22687 22983 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_4920 23118 23043 gene locus_tag LOCUS_t0060 23118 23043 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24507 23167 gene locus_tag LOCUS_4930 24507 23167 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546442.1 protein_id gnl|my_center|LOCUS_4930 25733 24507 gene locus_tag LOCUS_4940 25733 24507 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546440.1 protein_id gnl|my_center|LOCUS_4940 26446 25733 gene locus_tag LOCUS_4950 26446 25733 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546437.1 protein_id gnl|my_center|LOCUS_4950 26565 27860 gene locus_tag LOCUS_4960 26565 27860 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254206.1 protein_id gnl|my_center|LOCUS_4960 28472 27909 gene locus_tag LOCUS_4970 gene hpt 28472 27909 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254205.1 protein_id gnl|my_center|LOCUS_4970 29904 28564 gene locus_tag LOCUS_4980 29904 28564 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546431.1 protein_id gnl|my_center|LOCUS_4980 30627 29971 gene locus_tag LOCUS_4990 30627 29971 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546429.1 protein_id gnl|my_center|LOCUS_4990 33121 30752 gene locus_tag LOCUS_5000 33121 30752 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254199.1 protein_id gnl|my_center|LOCUS_5000 33984 33259 gene locus_tag LOCUS_5010 33984 33259 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546381.1 protein_id gnl|my_center|LOCUS_5010 34923 34000 gene locus_tag LOCUS_5020 34923 34000 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546379.1 protein_id gnl|my_center|LOCUS_5020 35707 35015 gene locus_tag LOCUS_5030 gene rpiA 35707 35015 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254196.1 protein_id gnl|my_center|LOCUS_5030 36630 35707 gene locus_tag LOCUS_5040 gene rbsK 36630 35707 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254195.1 protein_id gnl|my_center|LOCUS_5040 37503 36697 gene locus_tag LOCUS_5050 37503 36697 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546373.1 protein_id gnl|my_center|LOCUS_5050 37728 39023 gene locus_tag LOCUS_5060 37728 39023 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546372.1 protein_id gnl|my_center|LOCUS_5060 39722 39099 gene locus_tag LOCUS_5070 39722 39099 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356705.1 protein_id gnl|my_center|LOCUS_5070 40784 39735 gene locus_tag LOCUS_5080 40784 39735 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_5080 41525 40863 gene locus_tag LOCUS_5090 41525 40863 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476340.1 protein_id gnl|my_center|LOCUS_5090 41834 41541 gene locus_tag LOCUS_5100 41834 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5100 42171 41815 gene locus_tag LOCUS_5110 42171 41815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5110 42995 42168 gene locus_tag LOCUS_5120 42995 42168 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563836.1 protein_id gnl|my_center|LOCUS_5120 43745 43005 gene locus_tag LOCUS_5130 43745 43005 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546366.1 protein_id gnl|my_center|LOCUS_5130 45620 43863 gene locus_tag LOCUS_5140 45620 43863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254194.1 protein_id gnl|my_center|LOCUS_5140 47347 45620 gene locus_tag LOCUS_5150 47347 45620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254193.1 protein_id gnl|my_center|LOCUS_5150 47787 47344 gene locus_tag LOCUS_5160 47787 47344 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701464.1 protein_id gnl|my_center|LOCUS_5160 47930 48565 gene locus_tag LOCUS_5170 gene udk 47930 48565 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_5170 49577 48618 gene locus_tag LOCUS_5180 49577 48618 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645220.1 protein_id gnl|my_center|LOCUS_5180 51837 49594 gene locus_tag LOCUS_5190 51837 49594 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674254.1 protein_id gnl|my_center|LOCUS_5190 52014 53225 gene locus_tag LOCUS_5200 52014 53225 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254190.1 protein_id gnl|my_center|LOCUS_5200 53318 54757 gene locus_tag LOCUS_5210 53318 54757 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101523.1 protein_id gnl|my_center|LOCUS_5210 56299 54821 gene locus_tag LOCUS_5220 gene yjeM 56299 54821 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476675.1 protein_id gnl|my_center|LOCUS_5220 57131 56412 gene locus_tag LOCUS_5230 gene phoU 57131 56412 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549102.1 protein_id gnl|my_center|LOCUS_5230 57901 57149 gene locus_tag LOCUS_5240 gene pstB 57901 57149 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906105.1 protein_id gnl|my_center|LOCUS_5240 58797 57916 gene locus_tag LOCUS_5250 gene pstA 58797 57916 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549099.1 protein_id gnl|my_center|LOCUS_5250 59700 58801 gene locus_tag LOCUS_5260 gene pstC 59700 58801 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549098.1 protein_id gnl|my_center|LOCUS_5260 60571 59705 gene locus_tag LOCUS_5270 60571 59705 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873504.1 protein_id gnl|my_center|LOCUS_5270 60686 61402 gene locus_tag LOCUS_5280 60686 61402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_5280 61588 62850 gene locus_tag LOCUS_5290 61588 62850 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641437.1 protein_id gnl|my_center|LOCUS_5290 62982 64247 gene locus_tag LOCUS_5300 62982 64247 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644750.1 protein_id gnl|my_center|LOCUS_5300 >Feature sequence06 6611 6024 gene locus_tag LOCUS_5310 6611 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 22914 7147 gene locus_tag LOCUS_5320 22914 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 24395 23145 gene locus_tag LOCUS_5330 24395 23145 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547113.1 protein_id gnl|my_center|LOCUS_5330 24784 24509 gene locus_tag LOCUS_5340 24784 24509 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547110.1 protein_id gnl|my_center|LOCUS_5340 26313 25003 gene locus_tag LOCUS_5350 gene der 26313 25003 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254303.1 protein_id gnl|my_center|LOCUS_5350 27600 26392 gene locus_tag LOCUS_5360 gene rpsA 27600 26392 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547091.1 protein_id gnl|my_center|LOCUS_5360 28360 27695 gene locus_tag LOCUS_5370 gene cmk 28360 27695 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_5370 28906 28406 gene locus_tag LOCUS_5380 28906 28406 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547087.1 protein_id gnl|my_center|LOCUS_5380 29572 29000 gene locus_tag LOCUS_5390 29572 29000 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674489.1 protein_id gnl|my_center|LOCUS_5390 30502 29789 gene locus_tag LOCUS_5400 30502 29789 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547082.1 protein_id gnl|my_center|LOCUS_5400 31101 30502 gene locus_tag LOCUS_5410 gene scpB 31101 30502 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547080.1 protein_id gnl|my_center|LOCUS_5410 31833 31105 gene locus_tag LOCUS_5420 31833 31105 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547078.1 protein_id gnl|my_center|LOCUS_5420 32174 31836 gene locus_tag LOCUS_5430 32174 31836 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254301.1 protein_id gnl|my_center|LOCUS_5430 33016 32177 gene locus_tag LOCUS_5440 gene xerD 33016 32177 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_5440 33944 33066 gene locus_tag LOCUS_5450 33944 33066 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254300.1 protein_id gnl|my_center|LOCUS_5450 35839 34070 gene locus_tag LOCUS_5460 gene pyk 35839 34070 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547072.1 protein_id gnl|my_center|LOCUS_5460 36830 35871 gene locus_tag LOCUS_5470 gene pfkA 36830 35871 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547070.1 protein_id gnl|my_center|LOCUS_5470 40117 36998 gene locus_tag LOCUS_5480 40117 36998 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547069.1 protein_id gnl|my_center|LOCUS_5480 40229 40432 gene locus_tag LOCUS_5490 40229 40432 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254299.1 protein_id gnl|my_center|LOCUS_5490 40866 40483 gene locus_tag LOCUS_5500 40866 40483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 41207 40875 gene locus_tag LOCUS_5510 41207 40875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 42877 41312 gene locus_tag LOCUS_5520 42877 41312 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547066.1 protein_id gnl|my_center|LOCUS_5520 43131 42946 gene locus_tag LOCUS_5530 gene rpmF 43131 42946 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547064.1 protein_id gnl|my_center|LOCUS_5530 43492 43238 gene locus_tag LOCUS_5540 43492 43238 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547057.1 protein_id gnl|my_center|LOCUS_5540 44292 43498 gene locus_tag LOCUS_5550 44292 43498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547056.1 protein_id gnl|my_center|LOCUS_5550 45225 44296 gene locus_tag LOCUS_5560 gene rnz 45225 44296 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547055.1 protein_id gnl|my_center|LOCUS_5560 47157 45241 gene locus_tag LOCUS_5570 47157 45241 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025015105.1 protein_id gnl|my_center|LOCUS_5570 48474 47176 gene locus_tag LOCUS_5580 gene obgE 48474 47176 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_5580 50360 48558 gene locus_tag LOCUS_5590 gene uvrC 50360 48558 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547051.1 protein_id gnl|my_center|LOCUS_5590 50478 51089 gene locus_tag LOCUS_5600 50478 51089 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_5600 51259 51495 gene locus_tag LOCUS_5610 51259 51495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 51739 51933 gene locus_tag LOCUS_5620 51739 51933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 51998 53380 gene locus_tag LOCUS_5630 51998 53380 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613351.1 protein_id gnl|my_center|LOCUS_5630 53446 54384 gene locus_tag LOCUS_5640 53446 54384 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254272.1 protein_id gnl|my_center|LOCUS_5640 55398 54589 gene locus_tag LOCUS_5650 55398 54589 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_5650 55764 56459 gene locus_tag LOCUS_5660 55764 56459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5660 56368 56679 gene locus_tag LOCUS_5670 56368 56679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5670 56679 57461 gene locus_tag LOCUS_5680 56679 57461 CDS product PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721639.1 protein_id gnl|my_center|LOCUS_5680 57451 58251 gene locus_tag LOCUS_5690 57451 58251 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728733.1 protein_id gnl|my_center|LOCUS_5690 60798 58399 gene locus_tag LOCUS_5700 60798 58399 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546985.1 protein_id gnl|my_center|LOCUS_5700 61854 60847 gene locus_tag LOCUS_5710 gene asnA 61854 60847 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_5710 62659 62204 gene locus_tag LOCUS_5720 62659 62204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 62931 62743 gene locus_tag LOCUS_5730 62931 62743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 >Feature sequence07 1524 442 gene locus_tag LOCUS_5740 1524 442 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549489.1 protein_id gnl|my_center|LOCUS_5740 1716 2471 gene locus_tag LOCUS_5750 1716 2471 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475684.1 protein_id gnl|my_center|LOCUS_5750 3864 2527 gene locus_tag LOCUS_5760 gene glnA 3864 2527 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003627067.1 protein_id gnl|my_center|LOCUS_5760 5365 4118 gene locus_tag LOCUS_5770 5365 4118 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548246.1 protein_id gnl|my_center|LOCUS_5770 6278 5358 gene locus_tag LOCUS_5780 gene miaA 6278 5358 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548247.1 protein_id gnl|my_center|LOCUS_5780 6347 6526 gene locus_tag LOCUS_5790 6347 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 7017 6616 gene locus_tag LOCUS_5800 7017 6616 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548248.1 protein_id gnl|my_center|LOCUS_5800 7271 7062 gene locus_tag LOCUS_5810 7271 7062 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548250.1 protein_id gnl|my_center|LOCUS_5810 7960 7271 gene locus_tag LOCUS_5820 7960 7271 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_5820 8555 7998 gene locus_tag LOCUS_5830 8555 7998 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548253.1 protein_id gnl|my_center|LOCUS_5830 8749 8600 gene locus_tag LOCUS_5840 gene rpmG 8749 8600 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548272.1 protein_id gnl|my_center|LOCUS_5840 10951 8825 gene locus_tag LOCUS_5850 10951 8825 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254485.1 protein_id gnl|my_center|LOCUS_5850 11062 13620 gene locus_tag LOCUS_5860 11062 13620 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548276.1 protein_id gnl|my_center|LOCUS_5860 14162 13686 gene locus_tag LOCUS_5870 gene greA 14162 13686 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_5870 16637 14229 gene locus_tag LOCUS_5880 gene pheT 16637 14229 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548294.1 protein_id gnl|my_center|LOCUS_5880 17687 16638 gene locus_tag LOCUS_5890 gene pheS 17687 16638 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548296.1 protein_id gnl|my_center|LOCUS_5890 18336 17986 gene locus_tag LOCUS_5900 18336 17986 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254487.1 protein_id gnl|my_center|LOCUS_5900 19176 18409 gene locus_tag LOCUS_5910 19176 18409 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_5910 19262 19537 gene locus_tag LOCUS_5920 19262 19537 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548299.1 protein_id gnl|my_center|LOCUS_5920 19594 20568 gene locus_tag LOCUS_5930 gene yidC 19594 20568 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254488.1 protein_id gnl|my_center|LOCUS_5930 21208 20603 gene locus_tag LOCUS_5940 21208 20603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476593.1 protein_id gnl|my_center|LOCUS_5940 22314 21211 gene locus_tag LOCUS_5950 22314 21211 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476594.1 protein_id gnl|my_center|LOCUS_5950 23070 22333 gene locus_tag LOCUS_5960 23070 22333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476595.1 protein_id gnl|my_center|LOCUS_5960 23942 23073 gene locus_tag LOCUS_5970 23942 23073 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476596.1 protein_id gnl|my_center|LOCUS_5970 25639 24071 gene locus_tag LOCUS_5980 25639 24071 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254489.1 protein_id gnl|my_center|LOCUS_5980 26336 25614 gene locus_tag LOCUS_5990 26336 25614 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548305.1 protein_id gnl|my_center|LOCUS_5990 27056 26511 gene locus_tag LOCUS_6000 27056 26511 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548307.1 protein_id gnl|my_center|LOCUS_6000 28210 27056 gene locus_tag LOCUS_6010 28210 27056 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548309.1 protein_id gnl|my_center|LOCUS_6010 28560 28213 gene locus_tag LOCUS_6020 gene rsfS 28560 28213 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548311.1 protein_id gnl|my_center|LOCUS_6020 29171 28563 gene locus_tag LOCUS_6030 gene yqeK 29171 28563 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548313.1 protein_id gnl|my_center|LOCUS_6030 29793 29164 gene locus_tag LOCUS_6040 29793 29164 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_6040 30916 29807 gene locus_tag LOCUS_6050 gene yqeH 30916 29807 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548317.1 protein_id gnl|my_center|LOCUS_6050 31431 30901 gene locus_tag LOCUS_6060 31431 30901 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254490.1 protein_id gnl|my_center|LOCUS_6060 33351 31519 gene locus_tag LOCUS_6070 33351 31519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6070 34115 33444 gene locus_tag LOCUS_6080 34115 33444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6080 34705 34349 gene locus_tag LOCUS_6090 gene rplT 34705 34349 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548326.1 protein_id gnl|my_center|LOCUS_6090 34949 34749 gene locus_tag LOCUS_6100 gene rpmI 34949 34749 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548328.1 protein_id gnl|my_center|LOCUS_6100 35452 34976 gene locus_tag LOCUS_6110 gene infC 35452 34976 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075917325.1 protein_id gnl|my_center|LOCUS_6110 37645 35714 gene locus_tag LOCUS_6120 gene thrS 37645 35714 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548338.1 protein_id gnl|my_center|LOCUS_6120 39890 37935 gene locus_tag LOCUS_6130 39890 37935 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547843.1 protein_id gnl|my_center|LOCUS_6130 40829 39915 gene locus_tag LOCUS_6140 gene dnaI 40829 39915 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254494.1 protein_id gnl|my_center|LOCUS_6140 42176 40833 gene locus_tag LOCUS_6150 42176 40833 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548343.1 protein_id gnl|my_center|LOCUS_6150 42660 42193 gene locus_tag LOCUS_6160 gene nrdR 42660 42193 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548345.1 protein_id gnl|my_center|LOCUS_6160 43252 42638 gene locus_tag LOCUS_6170 gene coaE 43252 42638 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548347.1 protein_id gnl|my_center|LOCUS_6170 44079 43252 gene locus_tag LOCUS_6180 gene mutM 44079 43252 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548349.1 protein_id gnl|my_center|LOCUS_6180 46749 44092 gene locus_tag LOCUS_6190 gene polA 46749 44092 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548351.1 protein_id gnl|my_center|LOCUS_6190 48160 46853 gene locus_tag LOCUS_6200 gene murC 48160 46853 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548413.1 protein_id gnl|my_center|LOCUS_6200 50332 48257 gene locus_tag LOCUS_6210 50332 48257 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254156.1 protein_id gnl|my_center|LOCUS_6210 51434 50433 gene locus_tag LOCUS_6220 51434 50433 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550130.1 protein_id gnl|my_center|LOCUS_6220 52477 51431 gene locus_tag LOCUS_6230 52477 51431 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550128.1 protein_id gnl|my_center|LOCUS_6230 53636 52470 gene locus_tag LOCUS_6240 53636 52470 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550126.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence08 4943 849 gene locus_tag LOCUS_6250 4943 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 5887 4910 gene locus_tag LOCUS_6260 5887 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 7930 6395 gene locus_tag LOCUS_6270 7930 6395 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548190.1 protein_id gnl|my_center|LOCUS_6270 9160 7943 gene locus_tag LOCUS_6280 9160 7943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254474.1 protein_id gnl|my_center|LOCUS_6280 9362 10318 gene locus_tag LOCUS_6290 9362 10318 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548202.1 protein_id gnl|my_center|LOCUS_6290 11254 10367 gene locus_tag LOCUS_6300 11254 10367 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548210.1 protein_id gnl|my_center|LOCUS_6300 13163 11265 gene locus_tag LOCUS_6310 13163 11265 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548211.1 protein_id gnl|my_center|LOCUS_6310 14457 13156 gene locus_tag LOCUS_6320 14457 13156 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254478.1 protein_id gnl|my_center|LOCUS_6320 15917 14472 gene locus_tag LOCUS_6330 15917 14472 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254481.1 protein_id gnl|my_center|LOCUS_6330 17034 16024 gene locus_tag LOCUS_6340 17034 16024 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548226.1 protein_id gnl|my_center|LOCUS_6340 17171 18004 gene locus_tag LOCUS_6350 17171 18004 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548228.1 protein_id gnl|my_center|LOCUS_6350 17997 18941 gene locus_tag LOCUS_6360 17997 18941 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548230.1 protein_id gnl|my_center|LOCUS_6360 18956 20275 gene locus_tag LOCUS_6370 18956 20275 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548232.1 protein_id gnl|my_center|LOCUS_6370 20591 20896 gene locus_tag LOCUS_6380 20591 20896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 21922 20942 gene locus_tag LOCUS_6390 21922 20942 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563822.1 protein_id gnl|my_center|LOCUS_6390 22787 21924 gene locus_tag LOCUS_6400 22787 21924 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382920.1 protein_id gnl|my_center|LOCUS_6400 24898 22964 gene locus_tag LOCUS_6410 24898 22964 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102081.1 protein_id gnl|my_center|LOCUS_6410 26561 24900 gene locus_tag LOCUS_6420 26561 24900 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674766.1 protein_id gnl|my_center|LOCUS_6420 27601 26609 gene locus_tag LOCUS_6430 27601 26609 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102083.1 protein_id gnl|my_center|LOCUS_6430 28569 27673 gene locus_tag LOCUS_6440 28569 27673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 28682 30166 gene locus_tag LOCUS_6450 28682 30166 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_6450 31502 30324 gene locus_tag LOCUS_6460 31502 30324 CDS product IS256-like element ISEf1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997695.1 protein_id gnl|my_center|LOCUS_6460 33106 31586 gene locus_tag LOCUS_6470 33106 31586 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431416.1 protein_id gnl|my_center|LOCUS_6470 34953 33118 gene locus_tag LOCUS_6480 34953 33118 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721858.1 protein_id gnl|my_center|LOCUS_6480 35866 35030 gene locus_tag LOCUS_6490 35866 35030 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439998.1 protein_id gnl|my_center|LOCUS_6490 37350 36043 gene locus_tag LOCUS_6500 37350 36043 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798146.1 protein_id gnl|my_center|LOCUS_6500 38725 37364 gene locus_tag LOCUS_6510 38725 37364 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102004.1 protein_id gnl|my_center|LOCUS_6510 38848 39555 gene locus_tag LOCUS_6520 38848 39555 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254276.1 protein_id gnl|my_center|LOCUS_6520 40616 39630 gene locus_tag LOCUS_6530 40616 39630 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548215.1 protein_id gnl|my_center|LOCUS_6530 41593 40637 gene locus_tag LOCUS_6540 gene rbsC 41593 40637 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209687196.1 protein_id gnl|my_center|LOCUS_6540 43073 41595 gene locus_tag LOCUS_6550 43073 41595 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254479.1 protein_id gnl|my_center|LOCUS_6550 43490 43095 gene locus_tag LOCUS_6560 gene rbsD 43490 43095 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254480.1 protein_id gnl|my_center|LOCUS_6560 44416 43490 gene locus_tag LOCUS_6570 gene rbsK 44416 43490 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548221.1 protein_id gnl|my_center|LOCUS_6570 45629 44616 gene locus_tag LOCUS_6580 45629 44616 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548226.1 protein_id gnl|my_center|LOCUS_6580 46630 45653 gene locus_tag LOCUS_6590 46630 45653 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_6590 48196 46730 gene locus_tag LOCUS_6600 48196 46730 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_6600 48326 49150 gene locus_tag LOCUS_6610 48326 49150 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254454.1 protein_id gnl|my_center|LOCUS_6610 51219 49237 gene locus_tag LOCUS_6620 51219 49237 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289252.1 protein_id gnl|my_center|LOCUS_6620 51920 51222 gene locus_tag LOCUS_6630 51920 51222 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358533.1 protein_id gnl|my_center|LOCUS_6630 52073 52885 gene locus_tag LOCUS_6640 52073 52885 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_6640 >Feature sequence09 150 785 gene locus_tag LOCUS_6650 150 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 785 1705 gene locus_tag LOCUS_6660 785 1705 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101571.1 protein_id gnl|my_center|LOCUS_6660 1706 2575 gene locus_tag LOCUS_6670 1706 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 2577 3287 gene locus_tag LOCUS_6680 2577 3287 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546169.1 protein_id gnl|my_center|LOCUS_6680 3386 5032 gene locus_tag LOCUS_6690 3386 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 5990 6286 gene locus_tag LOCUS_6700 5990 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 6390 6659 gene locus_tag LOCUS_6710 gene rpsN 6390 6659 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674890.1 protein_id gnl|my_center|LOCUS_6710 6674 7090 gene locus_tag LOCUS_6720 6674 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095803611.1 protein_id gnl|my_center|LOCUS_6720 7968 8648 gene locus_tag LOCUS_6730 7968 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 8770 9273 gene locus_tag LOCUS_6740 8770 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 9515 10393 gene locus_tag LOCUS_6750 9515 10393 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002923661.1 protein_id gnl|my_center|LOCUS_6750 10371 10715 gene locus_tag LOCUS_6760 10371 10715 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836781.1 protein_id gnl|my_center|LOCUS_6760 10736 12145 gene locus_tag LOCUS_6770 gene lacG 10736 12145 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429432.1 protein_id gnl|my_center|LOCUS_6770 12161 13864 gene locus_tag LOCUS_6780 12161 13864 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359747.1 protein_id gnl|my_center|LOCUS_6780 13892 15175 gene locus_tag LOCUS_6790 13892 15175 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014554396.1 protein_id gnl|my_center|LOCUS_6790 15195 17081 gene locus_tag LOCUS_6800 15195 17081 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236914.1 protein_id gnl|my_center|LOCUS_6800 17356 17886 gene locus_tag LOCUS_6810 17356 17886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 18015 18362 gene locus_tag LOCUS_6820 18015 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 18370 20046 gene locus_tag LOCUS_6830 18370 20046 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254358.1 protein_id gnl|my_center|LOCUS_6830 20046 20504 gene locus_tag LOCUS_6840 gene lspA 20046 20504 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613370.1 protein_id gnl|my_center|LOCUS_6840 20504 21409 gene locus_tag LOCUS_6850 20504 21409 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254356.1 protein_id gnl|my_center|LOCUS_6850 21418 22476 gene locus_tag LOCUS_6860 21418 22476 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547524.1 protein_id gnl|my_center|LOCUS_6860 22478 25651 gene locus_tag LOCUS_6870 22478 25651 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254355.1 protein_id gnl|my_center|LOCUS_6870 25755 25928 gene locus_tag LOCUS_6880 25755 25928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 26172 27617 gene locus_tag LOCUS_6890 26172 27617 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476432.1 protein_id gnl|my_center|LOCUS_6890 27637 28662 gene locus_tag LOCUS_6900 27637 28662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 29128 29277 gene locus_tag LOCUS_6910 29128 29277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 29442 29663 gene locus_tag LOCUS_6920 29442 29663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 29791 30075 gene locus_tag LOCUS_6930 29791 30075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 31107 32114 gene locus_tag LOCUS_6940 gene xerS 31107 32114 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547513.1 protein_id gnl|my_center|LOCUS_6940 32329 32697 gene locus_tag LOCUS_6950 32329 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6950 34241 32739 gene locus_tag LOCUS_6960 34241 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549986.1 protein_id gnl|my_center|LOCUS_6960 35060 34395 gene locus_tag LOCUS_6970 35060 34395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 36125 35145 gene locus_tag LOCUS_6980 36125 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 36717 36250 gene locus_tag LOCUS_6990 36717 36250 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297290.1 protein_id gnl|my_center|LOCUS_6990 37042 36797 gene locus_tag LOCUS_7000 37042 36797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 38033 37149 gene locus_tag LOCUS_7010 38033 37149 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254353.1 protein_id gnl|my_center|LOCUS_7010 38520 38107 gene locus_tag LOCUS_7020 38520 38107 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254354.1 protein_id gnl|my_center|LOCUS_7020 38800 40488 gene locus_tag LOCUS_7030 38800 40488 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547519.1 protein_id gnl|my_center|LOCUS_7030 41154 40555 gene locus_tag LOCUS_7040 41154 40555 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547484.1 protein_id gnl|my_center|LOCUS_7040 42156 41221 gene locus_tag LOCUS_7050 42156 41221 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547481.1 protein_id gnl|my_center|LOCUS_7050 >Feature sequence10 518 345 gene locus_tag LOCUS_7060 518 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 998 588 gene locus_tag LOCUS_7070 998 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 1080 1220 gene locus_tag LOCUS_7080 1080 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 1828 1238 gene locus_tag LOCUS_7090 gene yihA 1828 1238 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_7090 3095 1812 gene locus_tag LOCUS_7100 gene clpX 3095 1812 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546864.1 protein_id gnl|my_center|LOCUS_7100 4522 3209 gene locus_tag LOCUS_7110 gene tig 4522 3209 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546863.1 protein_id gnl|my_center|LOCUS_7110 5914 4724 gene locus_tag LOCUS_7120 gene tuf 5914 4724 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546862.1 protein_id gnl|my_center|LOCUS_7120 6922 6089 gene locus_tag LOCUS_7130 6922 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254267.1 protein_id gnl|my_center|LOCUS_7130 8654 6915 gene locus_tag LOCUS_7140 8654 6915 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546860.1 protein_id gnl|my_center|LOCUS_7140 9065 8796 gene locus_tag LOCUS_7150 gene rpsO 9065 8796 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546859.1 protein_id gnl|my_center|LOCUS_7150 9272 9523 gene locus_tag LOCUS_7160 gene rpsT 9272 9523 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546858.1 protein_id gnl|my_center|LOCUS_7160 10561 9575 gene locus_tag LOCUS_7170 gene holA 10561 9575 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546856.1 protein_id gnl|my_center|LOCUS_7170 12827 10575 gene locus_tag LOCUS_7180 12827 10575 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546854.1 protein_id gnl|my_center|LOCUS_7180 13446 12796 gene locus_tag LOCUS_7190 13446 12796 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546852.1 protein_id gnl|my_center|LOCUS_7190 14557 13526 gene locus_tag LOCUS_7200 14557 13526 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546849.1 protein_id gnl|my_center|LOCUS_7200 15044 14547 gene locus_tag LOCUS_7210 gene coaD 15044 14547 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546847.1 protein_id gnl|my_center|LOCUS_7210 15597 15046 gene locus_tag LOCUS_7220 gene rsmD 15597 15046 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_7220 15926 15594 gene locus_tag LOCUS_7230 15926 15594 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546844.1 protein_id gnl|my_center|LOCUS_7230 17116 15923 gene locus_tag LOCUS_7240 17116 15923 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254265.1 protein_id gnl|my_center|LOCUS_7240 19068 17224 gene locus_tag LOCUS_7250 gene typA 19068 17224 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254264.1 protein_id gnl|my_center|LOCUS_7250 19302 19856 gene locus_tag LOCUS_7260 gene def 19302 19856 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546838.1 protein_id gnl|my_center|LOCUS_7260 20035 20259 gene locus_tag LOCUS_7270 20035 20259 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546835.1 protein_id gnl|my_center|LOCUS_7270 20263 21945 gene locus_tag LOCUS_7280 20263 21945 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546834.1 protein_id gnl|my_center|LOCUS_7280 24407 22053 gene locus_tag LOCUS_7290 24407 22053 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546830.1 protein_id gnl|my_center|LOCUS_7290 25048 24407 gene locus_tag LOCUS_7300 25048 24407 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546828.1 protein_id gnl|my_center|LOCUS_7300 25707 25048 gene locus_tag LOCUS_7310 25707 25048 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546826.1 protein_id gnl|my_center|LOCUS_7310 26613 25726 gene locus_tag LOCUS_7320 26613 25726 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287470.1 protein_id gnl|my_center|LOCUS_7320 26717 27115 gene locus_tag LOCUS_7330 26717 27115 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594334.1 protein_id gnl|my_center|LOCUS_7330 27127 27435 gene locus_tag LOCUS_7340 27127 27435 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130024.1 protein_id gnl|my_center|LOCUS_7340 <30432 27532 gene locus_tag LOCUS_7350 <30432 27532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548049.1:YSIRK-type signal peptide-containing protein >Feature sequence11 2531 51 gene locus_tag LOCUS_7360 gene parC 2531 51 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547478.1 protein_id gnl|my_center|LOCUS_7360 4487 2544 gene locus_tag LOCUS_7370 gene parE 4487 2544 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547476.1 protein_id gnl|my_center|LOCUS_7370 4572 5192 gene locus_tag LOCUS_7380 gene plsY 4572 5192 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547474.1 protein_id gnl|my_center|LOCUS_7380 6145 5261 gene locus_tag LOCUS_7390 6145 5261 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547149.1 protein_id gnl|my_center|LOCUS_7390 7541 6159 gene locus_tag LOCUS_7400 gene hslU 7541 6159 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254308.1 protein_id gnl|my_center|LOCUS_7400 8072 7542 gene locus_tag LOCUS_7410 gene hslV 8072 7542 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254307.1 protein_id gnl|my_center|LOCUS_7410 8983 8075 gene locus_tag LOCUS_7420 8983 8075 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547143.1 protein_id gnl|my_center|LOCUS_7420 10295 8976 gene locus_tag LOCUS_7430 gene trmFO 10295 8976 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_7430 12482 10395 gene locus_tag LOCUS_7440 gene topA 12482 10395 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547140.1 protein_id gnl|my_center|LOCUS_7440 13486 12644 gene locus_tag LOCUS_7450 gene dprA 13486 12644 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547135.1 protein_id gnl|my_center|LOCUS_7450 14450 13557 gene locus_tag LOCUS_7460 14450 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 14994 15422 gene locus_tag LOCUS_7470 14994 15422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101834.1 protein_id gnl|my_center|LOCUS_7470 16227 15469 gene locus_tag LOCUS_7480 16227 15469 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254306.1 protein_id gnl|my_center|LOCUS_7480 17066 16224 gene locus_tag LOCUS_7490 gene ylqF 17066 16224 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547131.1 protein_id gnl|my_center|LOCUS_7490 17963 17232 gene locus_tag LOCUS_7500 17963 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7500 18766 18017 gene locus_tag LOCUS_7510 18766 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7510 19037 18813 gene locus_tag LOCUS_7520 19037 18813 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547128.1 protein_id gnl|my_center|LOCUS_7520 19987 19145 gene locus_tag LOCUS_7530 19987 19145 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254305.1 protein_id gnl|my_center|LOCUS_7530 20136 20801 gene locus_tag LOCUS_7540 20136 20801 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254304.1 protein_id gnl|my_center|LOCUS_7540 21347 20865 gene locus_tag LOCUS_7550 21347 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 22726 21536 gene locus_tag LOCUS_7560 22726 21536 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547116.1 protein_id gnl|my_center|LOCUS_7560 22812 23717 gene locus_tag LOCUS_7570 22812 23717 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547115.1 protein_id gnl|my_center|LOCUS_7570 26137 24767 gene locus_tag LOCUS_7580 26137 24767 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254451.1 protein_id gnl|my_center|LOCUS_7580 27431 26370 gene locus_tag LOCUS_7590 27431 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 >Feature sequence12 <1 2300 gene locus_tag LOCUS_7600 <1 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_180947057.1:GA module-containing protein 2744 2472 gene locus_tag LOCUS_7610 2744 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 3268 4104 gene locus_tag LOCUS_7620 3268 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 4125 4340 gene locus_tag LOCUS_7630 4125 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 4542 5774 gene locus_tag LOCUS_7640 4542 5774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288985.1 protein_id gnl|my_center|LOCUS_7640 5792 6700 gene locus_tag LOCUS_7650 5792 6700 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254443.1 protein_id gnl|my_center|LOCUS_7650 7176 6733 gene locus_tag LOCUS_7660 7176 6733 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288290.1 protein_id gnl|my_center|LOCUS_7660 7281 8300 gene locus_tag LOCUS_7670 7281 8300 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642147.1 protein_id gnl|my_center|LOCUS_7670 9116 10291 gene locus_tag LOCUS_7680 9116 10291 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475867.1 protein_id gnl|my_center|LOCUS_7680 10423 11280 gene locus_tag LOCUS_7690 10423 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 11679 12116 gene locus_tag LOCUS_7700 11679 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 12528 13406 gene locus_tag LOCUS_7710 12528 13406 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_7710 13508 13687 gene locus_tag LOCUS_7720 13508 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 14138 15592 gene locus_tag LOCUS_7730 14138 15592 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641299.1 protein_id gnl|my_center|LOCUS_7730 16992 15988 gene locus_tag LOCUS_7740 16992 15988 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137626186.1 protein_id gnl|my_center|LOCUS_7740 17166 17891 gene locus_tag LOCUS_7750 17166 17891 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674084.1 protein_id gnl|my_center|LOCUS_7750 17913 19586 gene locus_tag LOCUS_7760 17913 19586 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057757224.1 protein_id gnl|my_center|LOCUS_7760 19607 20038 gene locus_tag LOCUS_7770 19607 20038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 20010 20498 gene locus_tag LOCUS_7780 20010 20498 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426364.1 protein_id gnl|my_center|LOCUS_7780 20735 22783 gene locus_tag LOCUS_7790 20735 22783 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012737.1 protein_id gnl|my_center|LOCUS_7790 22780 23391 gene locus_tag LOCUS_7800 22780 23391 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963716.1 protein_id gnl|my_center|LOCUS_7800 23404 23868 gene locus_tag LOCUS_7810 23404 23868 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288286.1 protein_id gnl|my_center|LOCUS_7810 23880 24161 gene locus_tag LOCUS_7820 gene sgcB 23880 24161 CDS product PTS sugar transporter subunit IIB SgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722973.1 protein_id gnl|my_center|LOCUS_7820 24177 25556 gene locus_tag LOCUS_7830 24177 25556 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674984.1 protein_id gnl|my_center|LOCUS_7830 25572 26717 gene locus_tag LOCUS_7840 gene dgoD 25572 26717 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_7840 26692 27171 gene locus_tag LOCUS_7850 26692 27171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7850 >Feature sequence13 326 868 gene locus_tag LOCUS_7860 gene dhaS 326 868 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704309.1 protein_id gnl|my_center|LOCUS_7860 973 1968 gene locus_tag LOCUS_7870 gene dhaK 973 1968 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548125.1 protein_id gnl|my_center|LOCUS_7870 1981 2562 gene locus_tag LOCUS_7880 gene dhaL 1981 2562 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704296.1 protein_id gnl|my_center|LOCUS_7880 2562 2936 gene locus_tag LOCUS_7890 gene dhaM 2562 2936 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641765.1 protein_id gnl|my_center|LOCUS_7890 2938 3183 gene locus_tag LOCUS_7900 2938 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7900 3449 3643 gene locus_tag LOCUS_7910 3449 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 3771 4619 gene locus_tag LOCUS_7920 3771 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 5301 7112 gene locus_tag LOCUS_7930 gene glmS 5301 7112 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546133.1 protein_id gnl|my_center|LOCUS_7930 7384 7536 gene locus_tag LOCUS_7940 gene rpmG 7384 7536 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358586.1 protein_id gnl|my_center|LOCUS_7940 7552 8520 gene locus_tag LOCUS_7950 7552 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 8628 9773 gene locus_tag LOCUS_7960 8628 9773 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367172.1 protein_id gnl|my_center|LOCUS_7960 9922 10287 gene locus_tag LOCUS_7970 9922 10287 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254569.1 protein_id gnl|my_center|LOCUS_7970 10550 11668 gene locus_tag LOCUS_7980 10550 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 11714 12682 gene locus_tag LOCUS_7990 11714 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 13007 12768 gene locus_tag LOCUS_8000 13007 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 13245 13036 gene locus_tag LOCUS_8010 13245 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 13426 17112 gene locus_tag LOCUS_8020 13426 17112 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025079793.1 protein_id gnl|my_center|LOCUS_8020 >Feature sequence14 195 1655 gene locus_tag LOCUS_8030 195 1655 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112459.1 protein_id gnl|my_center|LOCUS_8030 1822 2238 gene locus_tag LOCUS_8040 1822 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 2313 2978 gene locus_tag LOCUS_8050 2313 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8050 3061 5580 gene locus_tag LOCUS_8060 3061 5580 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254312.1 protein_id gnl|my_center|LOCUS_8060 5656 6141 gene locus_tag LOCUS_8070 5656 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 6134 7513 gene locus_tag LOCUS_8080 6134 7513 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675048.1 protein_id gnl|my_center|LOCUS_8080 7565 8800 gene locus_tag LOCUS_8090 7565 8800 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548972.1 protein_id gnl|my_center|LOCUS_8090 9466 8816 gene locus_tag LOCUS_8100 9466 8816 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549229.1 protein_id gnl|my_center|LOCUS_8100 9990 9469 gene locus_tag LOCUS_8110 9990 9469 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665103.1 protein_id gnl|my_center|LOCUS_8110 10725 10000 gene locus_tag LOCUS_8120 10725 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 >Feature sequence15 157 1149 gene locus_tag LOCUS_8130 157 1149 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702191.1 protein_id gnl|my_center|LOCUS_8130 1167 1964 gene locus_tag LOCUS_8140 1167 1964 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254158.1 protein_id gnl|my_center|LOCUS_8140 1988 2905 gene locus_tag LOCUS_8150 1988 2905 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254159.1 protein_id gnl|my_center|LOCUS_8150 2908 3264 gene locus_tag LOCUS_8160 2908 3264 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546115.1 protein_id gnl|my_center|LOCUS_8160 4692 3313 gene locus_tag LOCUS_8170 4692 3313 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546123.1 protein_id gnl|my_center|LOCUS_8170 4892 4817 gene locus_tag LOCUS_t0070 4892 4817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5019 4947 gene locus_tag LOCUS_t0080 5019 4947 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5108 5434 gene locus_tag LOCUS_8180 gene qacH 5108 5434 CDS product quaternary ammonium compound efflux SMR transporter QacH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010730188.1 protein_id gnl|my_center|LOCUS_8180 5676 6449 gene locus_tag LOCUS_8190 5676 6449 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546204.1 protein_id gnl|my_center|LOCUS_8190 6569 7138 gene locus_tag LOCUS_8200 6569 7138 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546208.1 protein_id gnl|my_center|LOCUS_8200 7235 7308 gene locus_tag LOCUS_t0090 7235 7308 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7403 8275 gene locus_tag LOCUS_8210 7403 8275 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548290.1 protein_id gnl|my_center|LOCUS_8210 8357 8438 gene locus_tag LOCUS_t0100 8357 8438 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 57 148 gene locus_tag LOCUS_t0110 57 148 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1178 240 gene locus_tag LOCUS_8220 1178 240 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_8220 1374 4112 gene locus_tag LOCUS_8230 1374 4112 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118395.1 protein_id gnl|my_center|LOCUS_8230