>Feature sequence001 185 1981 gene locus_tag LOCUS_00010 185 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2052 4148 gene locus_tag LOCUS_00020 2052 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4935 5096 gene locus_tag LOCUS_00030 4935 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5262 5504 gene locus_tag LOCUS_00040 5262 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5693 5992 gene locus_tag LOCUS_00050 5693 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6024 6464 gene locus_tag LOCUS_00060 6024 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7079 8293 gene locus_tag LOCUS_00070 7079 8293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8694 9995 gene locus_tag LOCUS_00080 8694 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11232 10063 gene locus_tag LOCUS_00090 11232 10063 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_00090 11901 11251 gene locus_tag LOCUS_00100 11901 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13371 13228 gene locus_tag LOCUS_00110 13371 13228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13847 13704 gene locus_tag LOCUS_00120 13847 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14866 14231 gene locus_tag LOCUS_00130 14866 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 15249 15118 gene locus_tag LOCUS_00140 15249 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00140 16891 17418 gene locus_tag LOCUS_00150 16891 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00150 17620 17868 gene locus_tag LOCUS_00160 17620 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18392 18132 gene locus_tag LOCUS_00170 18392 18132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18578 18402 gene locus_tag LOCUS_00180 18578 18402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19096 18836 gene locus_tag LOCUS_00190 19096 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19271 19083 gene locus_tag LOCUS_00200 19271 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20102 19788 gene locus_tag LOCUS_00210 20102 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22129 21869 gene locus_tag LOCUS_00220 22129 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24570 24298 gene locus_tag LOCUS_00230 24570 24298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26564 26421 gene locus_tag LOCUS_00240 26564 26421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27218 26778 gene locus_tag LOCUS_00250 27218 26778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28769 28131 gene locus_tag LOCUS_00260 28769 28131 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_00260 28891 29796 gene locus_tag LOCUS_00270 28891 29796 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 protein_id gnl|my_center|LOCUS_00270 31344 29899 gene locus_tag LOCUS_00280 31344 29899 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_00280 32711 31341 gene locus_tag LOCUS_00290 gene trkA 32711 31341 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_00290 33803 32955 gene locus_tag LOCUS_00300 33803 32955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34341 34189 gene locus_tag LOCUS_00310 34341 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34888 34331 gene locus_tag LOCUS_00320 34888 34331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00320 35644 35087 gene locus_tag LOCUS_00330 35644 35087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 35896 35669 gene locus_tag LOCUS_00340 35896 35669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00340 36267 38846 gene locus_tag LOCUS_00350 36267 38846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 >Feature sequence002 813 568 gene locus_tag LOCUS_00360 813 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 1030 803 gene locus_tag LOCUS_00370 1030 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 1361 1014 gene locus_tag LOCUS_00380 1361 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1619 1437 gene locus_tag LOCUS_00390 1619 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 1846 1619 gene locus_tag LOCUS_00400 1846 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2058 1858 gene locus_tag LOCUS_00410 2058 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2352 2062 gene locus_tag LOCUS_00420 2352 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 2558 2349 gene locus_tag LOCUS_00430 2558 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 2797 2621 gene locus_tag LOCUS_00440 2797 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2837 3598 gene locus_tag LOCUS_00450 2837 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 3617 4072 gene locus_tag LOCUS_00460 3617 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 4270 4908 gene locus_tag LOCUS_00470 4270 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5084 4893 gene locus_tag LOCUS_00480 5084 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 5287 5105 gene locus_tag LOCUS_00490 5287 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 5653 6219 gene locus_tag LOCUS_00500 5653 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 6216 7343 gene locus_tag LOCUS_00510 6216 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 7901 7548 gene locus_tag LOCUS_00520 7901 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 8285 7914 gene locus_tag LOCUS_00530 8285 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 8722 8300 gene locus_tag LOCUS_00540 8722 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 9631 8846 gene locus_tag LOCUS_00550 9631 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 9911 9693 gene locus_tag LOCUS_00560 9911 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10362 9892 gene locus_tag LOCUS_00570 10362 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10745 10362 gene locus_tag LOCUS_00580 10745 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 11080 10832 gene locus_tag LOCUS_00590 11080 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 11792 11094 gene locus_tag LOCUS_00600 11792 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 12013 11789 gene locus_tag LOCUS_00610 12013 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 12273 12037 gene locus_tag LOCUS_00620 12273 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 12607 12278 gene locus_tag LOCUS_00630 12607 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 13067 12639 gene locus_tag LOCUS_00640 13067 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 14573 13071 gene locus_tag LOCUS_00650 14573 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 15058 14570 gene locus_tag LOCUS_00660 15058 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 16104 15121 gene locus_tag LOCUS_00670 16104 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 16466 16104 gene locus_tag LOCUS_00680 16466 16104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 16848 16471 gene locus_tag LOCUS_00690 16848 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 17510 16848 gene locus_tag LOCUS_00700 17510 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 17660 17517 gene locus_tag LOCUS_00710 17660 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 17859 17662 gene locus_tag LOCUS_00720 17859 17662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18155 17859 gene locus_tag LOCUS_00730 18155 17859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 19635 18172 gene locus_tag LOCUS_00740 19635 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 20024 19632 gene locus_tag LOCUS_00750 20024 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 22303 20021 gene locus_tag LOCUS_00760 22303 20021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 22891 22316 gene locus_tag LOCUS_00770 22891 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 23295 22870 gene locus_tag LOCUS_00780 23295 22870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 23842 23309 gene locus_tag LOCUS_00790 23842 23309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 24300 23845 gene locus_tag LOCUS_00800 24300 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 24700 24290 gene locus_tag LOCUS_00810 24700 24290 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989950.1 protein_id gnl|my_center|LOCUS_00810 25155 24700 gene locus_tag LOCUS_00820 25155 24700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 25574 25134 gene locus_tag LOCUS_00830 25574 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26595 25729 gene locus_tag LOCUS_00840 26595 25729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 27191 26598 gene locus_tag LOCUS_00850 27191 26598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 28470 27277 gene locus_tag LOCUS_00860 28470 27277 CDS product phage minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989954.1 protein_id gnl|my_center|LOCUS_00860 29916 28513 gene locus_tag LOCUS_00870 29916 28513 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989955.1 protein_id gnl|my_center|LOCUS_00870 31180 29921 gene locus_tag LOCUS_00880 31180 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 31571 31155 gene locus_tag LOCUS_00890 31571 31155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 31797 31564 gene locus_tag LOCUS_00900 31797 31564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 32283 31993 gene locus_tag LOCUS_00910 32283 31993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 32801 32280 gene locus_tag LOCUS_00920 32801 32280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 33031 32798 gene locus_tag LOCUS_00930 33031 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 33351 33016 gene locus_tag LOCUS_00940 33351 33016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 33860 33351 gene locus_tag LOCUS_00950 33860 33351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 34392 33838 gene locus_tag LOCUS_00960 34392 33838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 34610 34389 gene locus_tag LOCUS_00970 34610 34389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 34873 34607 gene locus_tag LOCUS_00980 34873 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 35117 34866 gene locus_tag LOCUS_00990 35117 34866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 35650 35114 gene locus_tag LOCUS_01000 35650 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 36291 35638 gene locus_tag LOCUS_01010 36291 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 36812 36288 gene locus_tag LOCUS_01020 36812 36288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096301.1 protein_id gnl|my_center|LOCUS_01020 37020 36793 gene locus_tag LOCUS_01030 37020 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 37868 37017 gene locus_tag LOCUS_01040 37868 37017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 38035 37865 gene locus_tag LOCUS_01050 38035 37865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 38301 38032 gene locus_tag LOCUS_01060 38301 38032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 39209 38298 gene locus_tag LOCUS_01070 39209 38298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 39633 39220 gene locus_tag LOCUS_01080 gene ssb 39633 39220 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934759.1 protein_id gnl|my_center|LOCUS_01080 40254 39634 gene locus_tag LOCUS_01090 40254 39634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence003 2 1495 gene locus_tag LOCUS_01100 2 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1643 3478 gene locus_tag LOCUS_01110 1643 3478 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_01110 3471 4139 gene locus_tag LOCUS_01120 3471 4139 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_01120 4152 5549 gene locus_tag LOCUS_01130 gene miaB 4152 5549 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_01130 5565 8159 gene locus_tag LOCUS_01140 gene mutS 5565 8159 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_01140 8220 10223 gene locus_tag LOCUS_01150 gene mutL 8220 10223 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_01150 10240 11181 gene locus_tag LOCUS_01160 gene miaA 10240 11181 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_01160 11217 11462 gene locus_tag LOCUS_01170 gene hfq 11217 11462 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_01170 11482 12771 gene locus_tag LOCUS_01180 11482 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12768 13493 gene locus_tag LOCUS_01190 12768 13493 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965420.1 protein_id gnl|my_center|LOCUS_01190 13514 14014 gene locus_tag LOCUS_01200 gene sepF 13514 14014 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_01200 14072 14302 gene locus_tag LOCUS_01210 14072 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 14398 14991 gene locus_tag LOCUS_01220 14398 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 15368 15622 gene locus_tag LOCUS_01230 15368 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 15615 15944 gene locus_tag LOCUS_01240 15615 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 16148 17821 gene locus_tag LOCUS_01250 16148 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 17883 18353 gene locus_tag LOCUS_01260 gene lspA 17883 18353 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_01260 18356 19276 gene locus_tag LOCUS_01270 18356 19276 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_01270 19273 20085 gene locus_tag LOCUS_01280 19273 20085 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700602.1 protein_id gnl|my_center|LOCUS_01280 20983 20399 gene locus_tag LOCUS_01290 gene pdxT 20983 20399 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_01290 21857 20985 gene locus_tag LOCUS_01300 gene pdxS 21857 20985 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_01300 23955 22036 gene locus_tag LOCUS_01310 23955 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 24529 24017 gene locus_tag LOCUS_01320 24529 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 25214 24660 gene locus_tag LOCUS_01330 25214 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01330 27615 26605 gene locus_tag LOCUS_01340 27615 26605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 27757 27903 gene locus_tag LOCUS_01350 27757 27903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 28572 28057 gene locus_tag LOCUS_01360 28572 28057 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986111.1 protein_id gnl|my_center|LOCUS_01360 29083 28589 gene locus_tag LOCUS_01370 gene nrdG 29083 28589 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693470.1 protein_id gnl|my_center|LOCUS_01370 31209 29089 gene locus_tag LOCUS_01380 gene nrdD 31209 29089 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_01380 31657 31893 gene locus_tag LOCUS_01390 31657 31893 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence004 1322 339 gene locus_tag LOCUS_01400 gene dusB 1322 339 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_01400 1984 1475 gene locus_tag LOCUS_01410 1984 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 2362 2102 gene locus_tag LOCUS_01420 2362 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4684 2423 gene locus_tag LOCUS_01430 4684 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7477 5552 gene locus_tag LOCUS_01440 7477 5552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_01440 9207 7477 gene locus_tag LOCUS_01450 9207 7477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_01450 9713 9207 gene locus_tag LOCUS_01460 9713 9207 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_01460 10063 9791 gene locus_tag LOCUS_01470 10063 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10896 10387 gene locus_tag LOCUS_01480 10896 10387 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_01480 11422 11108 gene locus_tag LOCUS_01490 11422 11108 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_01490 11803 13146 gene locus_tag LOCUS_01500 gene gdhA 11803 13146 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_01500 15181 13586 gene locus_tag LOCUS_01510 15181 13586 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_01510 16162 16022 gene locus_tag LOCUS_01520 16162 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 16349 16125 gene locus_tag LOCUS_01530 16349 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 16583 16410 gene locus_tag LOCUS_01540 16583 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 17561 17397 gene locus_tag LOCUS_01550 17561 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 21838 19448 gene locus_tag LOCUS_01560 21838 19448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 22188 22517 gene locus_tag LOCUS_01570 22188 22517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 22677 22922 gene locus_tag LOCUS_01580 22677 22922 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894075.1 protein_id gnl|my_center|LOCUS_01580 23323 25338 gene locus_tag LOCUS_01590 23323 25338 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_01590 25406 25882 gene locus_tag LOCUS_01600 25406 25882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 26157 26327 gene locus_tag LOCUS_01610 26157 26327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 26751 27098 gene locus_tag LOCUS_01620 26751 27098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 28477 27710 gene locus_tag LOCUS_01630 gene rsmA 28477 27710 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01630 29093 28566 gene locus_tag LOCUS_01640 gene raiA 29093 28566 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_01640 30131 29289 gene locus_tag LOCUS_01650 30131 29289 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_01650 31300 30128 gene locus_tag LOCUS_01660 31300 30128 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence005 900 730 gene locus_tag LOCUS_01670 900 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1227 976 gene locus_tag LOCUS_01680 1227 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01680 1415 1215 gene locus_tag LOCUS_01690 1415 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 1944 1402 gene locus_tag LOCUS_01700 1944 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 2181 2393 gene locus_tag LOCUS_01710 2181 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3475 3356 gene locus_tag LOCUS_01720 3475 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3627 3487 gene locus_tag LOCUS_01730 3627 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4065 3886 gene locus_tag LOCUS_01740 4065 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5370 4852 gene locus_tag LOCUS_01750 5370 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 7000 6833 gene locus_tag LOCUS_01760 7000 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 7186 7040 gene locus_tag LOCUS_01770 7186 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7707 7348 gene locus_tag LOCUS_01780 7707 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01780 8387 7749 gene locus_tag LOCUS_01790 8387 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01790 9146 8394 gene locus_tag LOCUS_01800 9146 8394 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_01800 10186 9191 gene locus_tag LOCUS_01810 gene rlmN 10186 9191 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_01810 11757 10408 gene locus_tag LOCUS_01820 gene rsmB 11757 10408 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_01820 12457 11747 gene locus_tag LOCUS_01830 12457 11747 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_01830 13545 12625 gene locus_tag LOCUS_01840 gene fmt 13545 12625 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_01840 14036 13545 gene locus_tag LOCUS_01850 gene def 14036 13545 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_01850 14640 14041 gene locus_tag LOCUS_01860 14640 14041 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_01860 16547 14676 gene locus_tag LOCUS_01870 gene priA 16547 14676 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01870 18596 17397 gene locus_tag LOCUS_01880 gene coaBC 18596 17397 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_01880 18998 18600 gene locus_tag LOCUS_01890 18998 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 19625 19068 gene locus_tag LOCUS_01900 gene gmk 19625 19068 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_01900 19881 19618 gene locus_tag LOCUS_01910 19881 19618 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_01910 20787 19912 gene locus_tag LOCUS_01920 20787 19912 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_01920 21312 20806 gene locus_tag LOCUS_01930 21312 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 21946 21314 gene locus_tag LOCUS_01940 21946 21314 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_01940 22733 21933 gene locus_tag LOCUS_01950 22733 21933 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963968.1 protein_id gnl|my_center|LOCUS_01950 23201 22788 gene locus_tag LOCUS_01960 23201 22788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 24176 23892 gene locus_tag LOCUS_01970 24176 23892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 26108 24342 gene locus_tag LOCUS_01980 26108 24342 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_01980 27202 26105 gene locus_tag LOCUS_01990 27202 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 28241 27423 gene locus_tag LOCUS_02000 gene cdaA 28241 27423 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_02000 29298 28663 gene locus_tag LOCUS_02010 29298 28663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence006 1985 2197 gene locus_tag LOCUS_02020 1985 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 3132 2929 gene locus_tag LOCUS_02030 3132 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02030 3375 3211 gene locus_tag LOCUS_02040 3375 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4072 3533 gene locus_tag LOCUS_02050 4072 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 4503 4087 gene locus_tag LOCUS_02060 4503 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5299 4607 gene locus_tag LOCUS_02070 5299 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 5792 5352 gene locus_tag LOCUS_02080 5792 5352 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_02080 6023 7348 gene locus_tag LOCUS_02090 6023 7348 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_02090 7681 7535 gene locus_tag LOCUS_02100 7681 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8487 8119 gene locus_tag LOCUS_02110 8487 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 8961 8500 gene locus_tag LOCUS_02120 8961 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9347 9186 gene locus_tag LOCUS_02130 9347 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11570 9687 gene locus_tag LOCUS_02140 gene ftsH 11570 9687 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_02140 12150 11596 gene locus_tag LOCUS_02150 gene hpt 12150 11596 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_02150 13492 12140 gene locus_tag LOCUS_02160 gene tilS 13492 12140 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_02160 14863 13496 gene locus_tag LOCUS_02170 14863 13496 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_02170 15672 15226 gene locus_tag LOCUS_02180 gene rplI 15672 15226 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_02180 17042 15816 gene locus_tag LOCUS_02190 17042 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 18191 17997 gene locus_tag LOCUS_02200 18191 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19024 19386 gene locus_tag LOCUS_02210 19024 19386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 20276 20103 gene locus_tag LOCUS_02220 20276 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 21164 20334 gene locus_tag LOCUS_02230 21164 20334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 21970 21800 gene locus_tag LOCUS_02240 21970 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 22119 21967 gene locus_tag LOCUS_02250 22119 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 22932 22339 gene locus_tag LOCUS_02260 22932 22339 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_02260 24132 22987 gene locus_tag LOCUS_02270 gene rodA 24132 22987 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_02270 24412 26082 gene locus_tag LOCUS_02280 24412 26082 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_02280 26169 27101 gene locus_tag LOCUS_02290 26169 27101 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence007 1220 639 gene locus_tag LOCUS_02300 gene yqeK 1220 639 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221169.1 protein_id gnl|my_center|LOCUS_02300 1966 1373 gene locus_tag LOCUS_02310 1966 1373 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_02310 3014 2451 gene locus_tag LOCUS_02320 3014 2451 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_02320 3739 3014 gene locus_tag LOCUS_02330 3739 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02330 4694 3726 gene locus_tag LOCUS_02340 4694 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4940 4737 gene locus_tag LOCUS_02350 4940 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8538 4963 gene locus_tag LOCUS_02360 gene smc 8538 4963 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_02360 9347 8679 gene locus_tag LOCUS_02370 gene rnc 9347 8679 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_02370 10074 9370 gene locus_tag LOCUS_02380 10074 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 11081 10413 gene locus_tag LOCUS_02390 11081 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 11473 11123 gene locus_tag LOCUS_02400 11473 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02400 12290 12126 gene locus_tag LOCUS_02410 12290 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 12617 12291 gene locus_tag LOCUS_02420 12617 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02420 13063 12578 gene locus_tag LOCUS_02430 13063 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02430 13325 13074 gene locus_tag LOCUS_02440 13325 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02440 13635 13417 gene locus_tag LOCUS_02450 13635 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 14828 14460 gene locus_tag LOCUS_02460 14828 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 15121 14825 gene locus_tag LOCUS_02470 15121 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02470 16508 15924 gene locus_tag LOCUS_02480 16508 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02480 17161 16505 gene locus_tag LOCUS_02490 17161 16505 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_02490 18623 17253 gene locus_tag LOCUS_02500 18623 17253 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_02500 20789 19416 gene locus_tag LOCUS_02510 20789 19416 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_02510 21328 20786 gene locus_tag LOCUS_02520 21328 20786 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812635.1 protein_id gnl|my_center|LOCUS_02520 22542 21391 gene locus_tag LOCUS_02530 22542 21391 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812637.1 protein_id gnl|my_center|LOCUS_02530 23636 22635 gene locus_tag LOCUS_02540 23636 22635 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061678.1 protein_id gnl|my_center|LOCUS_02540 24544 23819 gene locus_tag LOCUS_02550 24544 23819 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_02550 26010 24538 gene locus_tag LOCUS_02560 26010 24538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence008 657 313 gene locus_tag LOCUS_02570 gene rplQ 657 313 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_02570 1686 739 gene locus_tag LOCUS_02580 1686 739 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_02580 2364 1771 gene locus_tag LOCUS_02590 gene rpsD 2364 1771 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_02590 2787 2383 gene locus_tag LOCUS_02600 gene rpsK 2787 2383 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_02600 3172 2804 gene locus_tag LOCUS_02610 gene rpsM 3172 2804 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_02610 3926 3708 gene locus_tag LOCUS_02620 gene infA 3926 3708 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_02620 4224 3946 gene locus_tag LOCUS_02630 4224 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4988 4224 gene locus_tag LOCUS_02640 gene map 4988 4224 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_02640 5619 4990 gene locus_tag LOCUS_02650 5619 4990 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_02650 6940 5639 gene locus_tag LOCUS_02660 gene secY 6940 5639 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_02660 7382 6942 gene locus_tag LOCUS_02670 gene rplO 7382 6942 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_02670 7568 7386 gene locus_tag LOCUS_02680 gene rpmD 7568 7386 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966394.1 protein_id gnl|my_center|LOCUS_02680 8089 7586 gene locus_tag LOCUS_02690 gene rpsE 8089 7586 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_02690 8466 8107 gene locus_tag LOCUS_02700 gene rplR 8466 8107 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_02700 9033 8488 gene locus_tag LOCUS_02710 gene rplF 9033 8488 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_02710 9446 9048 gene locus_tag LOCUS_02720 gene rpsH 9446 9048 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_02720 12220 10571 gene locus_tag LOCUS_02730 12220 10571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_02730 12900 12217 gene locus_tag LOCUS_02740 12900 12217 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_02740 13589 12921 gene locus_tag LOCUS_02750 gene phoU 13589 12921 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_02750 14347 13589 gene locus_tag LOCUS_02760 gene pstB 14347 13589 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_02760 14483 14355 gene locus_tag LOCUS_02770 14483 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 14703 14464 gene locus_tag LOCUS_02780 14703 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02780 14949 14743 gene locus_tag LOCUS_02790 14949 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02790 15133 14978 gene locus_tag LOCUS_02800 15133 14978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02800 16115 15855 gene locus_tag LOCUS_02810 16115 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 17084 16182 gene locus_tag LOCUS_02820 17084 16182 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_02820 19721 18123 gene locus_tag LOCUS_02830 19721 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 20233 19727 gene locus_tag LOCUS_02840 20233 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 20381 20220 gene locus_tag LOCUS_02850 20381 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 21487 20585 gene locus_tag LOCUS_02860 gene ispE 21487 20585 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_02860 22310 21507 gene locus_tag LOCUS_02870 22310 21507 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_02870 23216 22323 gene locus_tag LOCUS_02880 23216 22323 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993974.1 protein_id gnl|my_center|LOCUS_02880 24503 23292 gene locus_tag LOCUS_02890 24503 23292 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_02890 24669 25976 gene locus_tag LOCUS_02900 24669 25976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence009 1485 2375 gene locus_tag LOCUS_02910 1485 2375 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_02910 2753 2427 gene locus_tag LOCUS_02920 2753 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2856 4124 gene locus_tag LOCUS_02930 2856 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 5562 4168 gene locus_tag LOCUS_02940 gene mgtE 5562 4168 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 protein_id gnl|my_center|LOCUS_02940 6187 7758 gene locus_tag LOCUS_02950 gene hcp 6187 7758 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_02950 7854 8261 gene locus_tag LOCUS_02960 7854 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 8505 9086 gene locus_tag LOCUS_02970 8505 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9316 10968 gene locus_tag LOCUS_02980 9316 10968 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_02980 11255 11437 gene locus_tag LOCUS_02990 11255 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11434 12378 gene locus_tag LOCUS_03000 11434 12378 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_03000 12371 13807 gene locus_tag LOCUS_03010 12371 13807 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288002.1 protein_id gnl|my_center|LOCUS_03010 13804 15363 gene locus_tag LOCUS_03020 13804 15363 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_03020 15513 16679 gene locus_tag LOCUS_03030 15513 16679 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975243.1 protein_id gnl|my_center|LOCUS_03030 16861 18060 gene locus_tag LOCUS_03040 16861 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18090 21395 gene locus_tag LOCUS_03050 18090 21395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 21797 21540 gene locus_tag LOCUS_03060 21797 21540 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_03060 23677 21812 gene locus_tag LOCUS_03070 23677 21812 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625706.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence010 14 583 gene locus_tag LOCUS_03080 14 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 617 1909 gene locus_tag LOCUS_03090 gene serS 617 1909 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_03090 1943 2335 gene locus_tag LOCUS_03100 1943 2335 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090189.1 protein_id gnl|my_center|LOCUS_03100 2468 2385 gene locus_tag LOCUS_t00010 2468 2385 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3093 3350 gene locus_tag LOCUS_03110 3093 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3497 4387 gene locus_tag LOCUS_03120 3497 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4651 4962 gene locus_tag LOCUS_03130 4651 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 5070 7178 gene locus_tag LOCUS_03140 5070 7178 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_03140 7721 7296 gene locus_tag LOCUS_03150 7721 7296 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_03150 8497 7751 gene locus_tag LOCUS_03160 8497 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 8932 8522 gene locus_tag LOCUS_03170 8932 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 9091 10443 gene locus_tag LOCUS_03180 9091 10443 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_03180 11061 11573 gene locus_tag LOCUS_03190 11061 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 11539 12075 gene locus_tag LOCUS_03200 11539 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03200 12627 13523 gene locus_tag LOCUS_03210 12627 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 13520 14665 gene locus_tag LOCUS_03220 13520 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 14682 15695 gene locus_tag LOCUS_03230 14682 15695 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_03230 16370 17491 gene locus_tag LOCUS_03240 16370 17491 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_03240 17699 18421 gene locus_tag LOCUS_03250 17699 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 18709 19728 gene locus_tag LOCUS_03260 18709 19728 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_03260 19715 20368 gene locus_tag LOCUS_03270 19715 20368 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817223.1 protein_id gnl|my_center|LOCUS_03270 20440 21291 gene locus_tag LOCUS_03280 20440 21291 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_03280 21880 21614 gene locus_tag LOCUS_03290 21880 21614 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398814.1 protein_id gnl|my_center|LOCUS_03290 22387 21914 gene locus_tag LOCUS_03300 22387 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 22756 22394 gene locus_tag LOCUS_03310 22756 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 22894 23043 gene locus_tag LOCUS_03320 22894 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 23857 24174 gene locus_tag LOCUS_03330 23857 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 24241 24684 gene locus_tag LOCUS_03340 24241 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence011 5045 4701 gene locus_tag LOCUS_03350 5045 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6217 5768 gene locus_tag LOCUS_03360 6217 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6784 6233 gene locus_tag LOCUS_03370 6784 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323448.1 protein_id gnl|my_center|LOCUS_03370 7500 6781 gene locus_tag LOCUS_03380 7500 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7715 7527 gene locus_tag LOCUS_03390 7715 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 7621 8232 gene locus_tag LOCUS_03400 7621 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8581 8432 gene locus_tag LOCUS_03410 8581 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 11959 8690 gene locus_tag LOCUS_03420 11959 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 13157 12222 gene locus_tag LOCUS_03430 13157 12222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 13938 13111 gene locus_tag LOCUS_03440 13938 13111 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_03440 14333 14007 gene locus_tag LOCUS_03450 14333 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 16502 14997 gene locus_tag LOCUS_03460 gene lysS 16502 14997 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_03460 17091 16618 gene locus_tag LOCUS_03470 gene greA 17091 16618 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_03470 18385 17222 gene locus_tag LOCUS_03480 18385 17222 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_03480 19703 18447 gene locus_tag LOCUS_03490 19703 18447 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_03490 20620 19733 gene locus_tag LOCUS_03500 gene ftsX 20620 19733 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645028.1 protein_id gnl|my_center|LOCUS_03500 21297 20617 gene locus_tag LOCUS_03510 gene ftsE 21297 20617 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082104.1 protein_id gnl|my_center|LOCUS_03510 22597 21506 gene locus_tag LOCUS_03520 22597 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 23541 22822 gene locus_tag LOCUS_03530 23541 22822 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_03530 24211 23723 gene locus_tag LOCUS_03540 24211 23723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 <24925 24301 gene locus_tag LOCUS_03550 <24925 24301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003384427.1:magnesium transporter CorA family protein >Feature sequence012 608 213 gene locus_tag LOCUS_03560 608 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 782 922 gene locus_tag LOCUS_03570 782 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2528 1179 gene locus_tag LOCUS_03580 2528 1179 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_03580 3102 2518 gene locus_tag LOCUS_03590 3102 2518 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031763.1 protein_id gnl|my_center|LOCUS_03590 3284 4411 gene locus_tag LOCUS_03600 3284 4411 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966934.1 protein_id gnl|my_center|LOCUS_03600 4600 5661 gene locus_tag LOCUS_03610 4600 5661 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798095.1 protein_id gnl|my_center|LOCUS_03610 5705 7090 gene locus_tag LOCUS_03620 5705 7090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_03620 7102 8070 gene locus_tag LOCUS_03630 7102 8070 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_03630 8091 8339 gene locus_tag LOCUS_03640 8091 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9239 9691 gene locus_tag LOCUS_03650 9239 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9830 10126 gene locus_tag LOCUS_03660 9830 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10131 10325 gene locus_tag LOCUS_03670 10131 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 12204 10525 gene locus_tag LOCUS_03680 12204 10525 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 protein_id gnl|my_center|LOCUS_03680 13456 12440 gene locus_tag LOCUS_03690 13456 12440 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_03690 14478 13534 gene locus_tag LOCUS_03700 14478 13534 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 protein_id gnl|my_center|LOCUS_03700 15578 14571 gene locus_tag LOCUS_03710 15578 14571 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817367.1 protein_id gnl|my_center|LOCUS_03710 16814 15891 gene locus_tag LOCUS_03720 16814 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 21400 17936 gene locus_tag LOCUS_03730 gene mfd 21400 17936 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_03730 22059 21625 gene locus_tag LOCUS_03740 gene nifU 22059 21625 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_03740 22941 22177 gene locus_tag LOCUS_03750 22941 22177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 23995 23654 gene locus_tag LOCUS_03760 23995 23654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence013 1363 1872 gene locus_tag LOCUS_03770 1363 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03770 1915 2220 gene locus_tag LOCUS_03780 1915 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03780 2246 2626 gene locus_tag LOCUS_03790 2246 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03790 3364 2753 gene locus_tag LOCUS_03800 3364 2753 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_03800 4609 3695 gene locus_tag LOCUS_03810 gene argF 4609 3695 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03810 5877 4696 gene locus_tag LOCUS_03820 5877 4696 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_03820 6815 5943 gene locus_tag LOCUS_03830 gene argB 6815 5943 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_03830 8067 6859 gene locus_tag LOCUS_03840 gene argJ 8067 6859 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03840 9009 8089 gene locus_tag LOCUS_03850 gene argC 9009 8089 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_03850 10393 8999 gene locus_tag LOCUS_03860 gene argH 10393 8999 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_03860 11717 10464 gene locus_tag LOCUS_03870 11717 10464 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393768.1 protein_id gnl|my_center|LOCUS_03870 11970 13412 gene locus_tag LOCUS_03880 11970 13412 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_03880 13687 14895 gene locus_tag LOCUS_03890 13687 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 15838 14942 gene locus_tag LOCUS_03900 15838 14942 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_03900 16183 16524 gene locus_tag LOCUS_03910 16183 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 16690 17145 gene locus_tag LOCUS_03920 16690 17145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 17142 18980 gene locus_tag LOCUS_03930 gene ftsH 17142 18980 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_03930 19651 19064 gene locus_tag LOCUS_03940 19651 19064 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_03940 20036 19728 gene locus_tag LOCUS_03950 20036 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 20237 20073 gene locus_tag LOCUS_03960 20237 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 20423 20755 gene locus_tag LOCUS_03970 20423 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 21814 21017 gene locus_tag LOCUS_03980 21814 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 22574 21891 gene locus_tag LOCUS_03990 gene rpe 22574 21891 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence014 1007 792 gene locus_tag LOCUS_04000 1007 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2354 1095 gene locus_tag LOCUS_04010 2354 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4000 2402 gene locus_tag LOCUS_04020 4000 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4102 5865 gene locus_tag LOCUS_04030 4102 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6217 9609 gene locus_tag LOCUS_04040 6217 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9551 9766 gene locus_tag LOCUS_04050 9551 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9923 10204 gene locus_tag LOCUS_04060 9923 10204 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814556.1 protein_id gnl|my_center|LOCUS_04060 10191 10511 gene locus_tag LOCUS_04070 10191 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 11167 10586 gene locus_tag LOCUS_04080 11167 10586 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_04080 11223 11885 gene locus_tag LOCUS_04090 11223 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11903 12076 gene locus_tag LOCUS_04100 11903 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 13363 12425 gene locus_tag LOCUS_04110 13363 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14441 13365 gene locus_tag LOCUS_04120 14441 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14707 14492 gene locus_tag LOCUS_04130 14707 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15963 15028 gene locus_tag LOCUS_04140 15963 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16075 16299 gene locus_tag LOCUS_04150 16075 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16743 20108 gene locus_tag LOCUS_04160 16743 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 20663 20226 gene locus_tag LOCUS_04170 20663 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 20743 22818 gene locus_tag LOCUS_04180 20743 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence015 1072 1512 gene locus_tag LOCUS_04190 1072 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 2244 1588 gene locus_tag LOCUS_04200 2244 1588 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_04200 2816 2283 gene locus_tag LOCUS_04210 2816 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 3441 2713 gene locus_tag LOCUS_04220 3441 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04220 5470 3548 gene locus_tag LOCUS_04230 5470 3548 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964289.1 protein_id gnl|my_center|LOCUS_04230 6636 5791 gene locus_tag LOCUS_04240 6636 5791 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_04240 7169 6663 gene locus_tag LOCUS_04250 7169 6663 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_04250 7345 7611 gene locus_tag LOCUS_04260 7345 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7624 7989 gene locus_tag LOCUS_04270 7624 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8003 8236 gene locus_tag LOCUS_04280 8003 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8901 8404 gene locus_tag LOCUS_04290 gene greA 8901 8404 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399078.1 protein_id gnl|my_center|LOCUS_04290 9208 10851 gene locus_tag LOCUS_04300 9208 10851 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_04300 11052 11174 gene locus_tag LOCUS_04310 11052 11174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 11308 11381 gene locus_tag LOCUS_t00020 11308 11381 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12170 11535 gene locus_tag LOCUS_04320 12170 11535 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_04320 12358 14487 gene locus_tag LOCUS_04330 12358 14487 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_04330 15348 14827 gene locus_tag LOCUS_04340 15348 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 16826 15813 gene locus_tag LOCUS_04350 16826 15813 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_04350 17136 17531 gene locus_tag LOCUS_04360 17136 17531 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_04360 18780 17533 gene locus_tag LOCUS_04370 18780 17533 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_04370 20094 18904 gene locus_tag LOCUS_04380 20094 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 21550 20099 gene locus_tag LOCUS_04390 gene pyk 21550 20099 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence016 1161 2240 gene locus_tag LOCUS_04400 1161 2240 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_04400 3945 2662 gene locus_tag LOCUS_04410 3945 2662 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_04410 4167 5294 gene locus_tag LOCUS_04420 4167 5294 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_04420 5325 6011 gene locus_tag LOCUS_04430 5325 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6017 6403 gene locus_tag LOCUS_04440 6017 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6427 7596 gene locus_tag LOCUS_04450 gene thiI 6427 7596 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_04450 7653 8882 gene locus_tag LOCUS_04460 7653 8882 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_04460 9126 11369 gene locus_tag LOCUS_04470 gene glgB 9126 11369 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04470 11463 12671 gene locus_tag LOCUS_04480 11463 12671 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968049.1 protein_id gnl|my_center|LOCUS_04480 12687 13814 gene locus_tag LOCUS_04490 gene glgD 12687 13814 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_04490 14007 15443 gene locus_tag LOCUS_04500 gene glgA 14007 15443 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_04500 15738 18185 gene locus_tag LOCUS_04510 15738 18185 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_04510 19373 18414 gene locus_tag LOCUS_04520 gene spoIID 19373 18414 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_04520 19530 19772 gene locus_tag LOCUS_04530 19530 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 19750 20067 gene locus_tag LOCUS_04540 19750 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 <21579 20419 gene locus_tag LOCUS_04550 <21579 20419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966296.1:phosphomethylpyrimidine synthase ThiC >Feature sequence017 801 430 gene locus_tag LOCUS_04560 801 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 901 2211 gene locus_tag LOCUS_04570 901 2211 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_04570 4351 2261 gene locus_tag LOCUS_04580 4351 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 5395 4598 gene locus_tag LOCUS_04590 5395 4598 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_04590 5504 6496 gene locus_tag LOCUS_04600 5504 6496 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680895.1 protein_id gnl|my_center|LOCUS_04600 6534 7070 gene locus_tag LOCUS_04610 6534 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 8792 7134 gene locus_tag LOCUS_04620 8792 7134 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_04620 9447 10163 gene locus_tag LOCUS_04630 9447 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 12448 11168 gene locus_tag LOCUS_04640 12448 11168 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_04640 13637 13467 gene locus_tag LOCUS_04650 13637 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 13932 13759 gene locus_tag LOCUS_04660 13932 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 15088 14681 gene locus_tag LOCUS_04670 gene rpsI 15088 14681 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_04670 15531 15103 gene locus_tag LOCUS_04680 gene rplM 15531 15103 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_04680 15794 16528 gene locus_tag LOCUS_04690 15794 16528 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_04690 16565 17302 gene locus_tag LOCUS_04700 16565 17302 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_04700 17299 18567 gene locus_tag LOCUS_04710 17299 18567 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_04710 20006 18666 gene locus_tag LOCUS_04720 20006 18666 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_04720 20315 21181 gene locus_tag LOCUS_04730 20315 21181 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941466.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence018 3175 2927 gene locus_tag LOCUS_04740 3175 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3745 3305 gene locus_tag LOCUS_04750 3745 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04750 3995 4120 gene locus_tag LOCUS_04760 3995 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4216 5019 gene locus_tag LOCUS_04770 4216 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 5430 5846 gene locus_tag LOCUS_04780 5430 5846 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963521.1 protein_id gnl|my_center|LOCUS_04780 5864 6526 gene locus_tag LOCUS_04790 5864 6526 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_04790 7715 6720 gene locus_tag LOCUS_04800 7715 6720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_04800 8669 7719 gene locus_tag LOCUS_04810 8669 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10119 9832 gene locus_tag LOCUS_04820 10119 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04820 11539 10385 gene locus_tag LOCUS_04830 11539 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04830 11670 11527 gene locus_tag LOCUS_04840 11670 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 13946 13743 gene locus_tag LOCUS_04850 13946 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04850 14444 13992 gene locus_tag LOCUS_04860 14444 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 14779 14477 gene locus_tag LOCUS_04870 14779 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 15601 14801 gene locus_tag LOCUS_04880 gene etfB 15601 14801 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_04880 16765 15623 gene locus_tag LOCUS_04890 16765 15623 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965998.1 protein_id gnl|my_center|LOCUS_04890 17549 17163 gene locus_tag LOCUS_04900 17549 17163 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_04900 19011 17986 gene locus_tag LOCUS_04910 gene iolG 19011 17986 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_04910 19351 20373 gene locus_tag LOCUS_04920 19351 20373 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067007.1 protein_id gnl|my_center|LOCUS_04920 20387 20581 gene locus_tag LOCUS_04930 20387 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 20592 20858 gene locus_tag LOCUS_04940 20592 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 20889 21050 gene locus_tag LOCUS_04950 20889 21050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence019 1447 596 gene locus_tag LOCUS_04960 1447 596 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_04960 1850 1608 gene locus_tag LOCUS_04970 1850 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2079 2888 gene locus_tag LOCUS_04980 2079 2888 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_04980 2973 3755 gene locus_tag LOCUS_04990 2973 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3742 4464 gene locus_tag LOCUS_05000 3742 4464 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071300.1 protein_id gnl|my_center|LOCUS_05000 5184 8924 gene locus_tag LOCUS_05010 gene rpoB 5184 8924 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_05010 8978 12652 gene locus_tag LOCUS_05020 gene rpoC 8978 12652 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_05020 13240 13482 gene locus_tag LOCUS_05030 13240 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 13549 13968 gene locus_tag LOCUS_05040 gene rpsL 13549 13968 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_05040 14289 14759 gene locus_tag LOCUS_05050 gene rpsG 14289 14759 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_05050 14799 16904 gene locus_tag LOCUS_05060 gene fusA 14799 16904 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05060 16996 18198 gene locus_tag LOCUS_05070 gene tuf 16996 18198 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_05070 18314 18532 gene locus_tag LOCUS_05080 18314 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 18734 19033 gene locus_tag LOCUS_05090 18734 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence020 1342 374 gene locus_tag LOCUS_05100 1342 374 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_05100 1518 2027 gene locus_tag LOCUS_05110 1518 2027 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_05110 2073 2258 gene locus_tag LOCUS_05120 gene rpmF 2073 2258 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_05120 2577 3905 gene locus_tag LOCUS_05130 gene der 2577 3905 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_05130 3918 4553 gene locus_tag LOCUS_05140 gene plsY 3918 4553 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811145.1 protein_id gnl|my_center|LOCUS_05140 4555 5568 gene locus_tag LOCUS_05150 4555 5568 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_05150 5739 5814 gene locus_tag LOCUS_t00030 5739 5814 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7777 6518 gene locus_tag LOCUS_05160 7777 6518 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495419.1 protein_id gnl|my_center|LOCUS_05160 8256 7903 gene locus_tag LOCUS_05170 gene rplT 8256 7903 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720097.1 protein_id gnl|my_center|LOCUS_05170 8498 8295 gene locus_tag LOCUS_05180 gene rpmI 8498 8295 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_05180 9054 8545 gene locus_tag LOCUS_05190 gene infC 9054 8545 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_05190 9450 9722 gene locus_tag LOCUS_05200 9450 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 10487 10179 gene locus_tag LOCUS_05210 10487 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 10696 10502 gene locus_tag LOCUS_05220 10696 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10790 11023 gene locus_tag LOCUS_05230 10790 11023 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_05230 12667 11435 gene locus_tag LOCUS_05240 12667 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 14322 12799 gene locus_tag LOCUS_05250 14322 12799 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_05250 14641 18201 gene locus_tag LOCUS_05260 gene nifJ 14641 18201 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_05260 18832 19665 gene locus_tag LOCUS_05270 18832 19665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 19678 20514 gene locus_tag LOCUS_05280 19678 20514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence021 174 545 gene locus_tag LOCUS_05290 174 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1380 1646 gene locus_tag LOCUS_05300 1380 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05300 1643 1861 gene locus_tag LOCUS_05310 1643 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2278 2616 gene locus_tag LOCUS_05320 2278 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05320 3051 2719 gene locus_tag LOCUS_05330 3051 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3992 4507 gene locus_tag LOCUS_05340 3992 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4802 12859 gene locus_tag LOCUS_05350 4802 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 13022 13876 gene locus_tag LOCUS_05360 13022 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 13869 14231 gene locus_tag LOCUS_05370 13869 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 14236 14931 gene locus_tag LOCUS_05380 14236 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 15018 15422 gene locus_tag LOCUS_05390 15018 15422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 15682 16449 gene locus_tag LOCUS_05400 15682 16449 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_05400 16471 17727 gene locus_tag LOCUS_05410 16471 17727 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_05410 17769 19208 gene locus_tag LOCUS_05420 17769 19208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence022 1380 142 gene locus_tag LOCUS_05430 1380 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2957 1464 gene locus_tag LOCUS_05440 gene malQ 2957 1464 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_05440 3408 4067 gene locus_tag LOCUS_05450 gene trmB 3408 4067 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_05450 5172 4534 gene locus_tag LOCUS_05460 5172 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6078 5233 gene locus_tag LOCUS_05470 6078 5233 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_05470 6375 7673 gene locus_tag LOCUS_05480 6375 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7702 8442 gene locus_tag LOCUS_05490 7702 8442 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966854.1 protein_id gnl|my_center|LOCUS_05490 8439 8750 gene locus_tag LOCUS_05500 8439 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8734 9180 gene locus_tag LOCUS_05510 8734 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 9751 10275 gene locus_tag LOCUS_05520 9751 10275 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947901.1 protein_id gnl|my_center|LOCUS_05520 10950 10570 gene locus_tag LOCUS_05530 10950 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 11119 11682 gene locus_tag LOCUS_05540 11119 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289506.1 protein_id gnl|my_center|LOCUS_05540 11993 11730 gene locus_tag LOCUS_05550 11993 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 14962 14780 gene locus_tag LOCUS_05560 14962 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15290 15000 gene locus_tag LOCUS_05570 15290 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 15471 15310 gene locus_tag LOCUS_05580 15471 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 16383 16859 gene locus_tag LOCUS_05590 16383 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 17918 17568 gene locus_tag LOCUS_05600 17918 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 18155 17964 gene locus_tag LOCUS_05610 18155 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 18709 18843 gene locus_tag LOCUS_05620 18709 18843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence023 1683 775 gene locus_tag LOCUS_05630 1683 775 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_05630 3738 1828 gene locus_tag LOCUS_05640 gene htpG 3738 1828 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_05640 4255 4926 gene locus_tag LOCUS_05650 4255 4926 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_05650 5176 6108 gene locus_tag LOCUS_05660 gene cysK 5176 6108 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_05660 7673 6582 gene locus_tag LOCUS_05670 7673 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8527 7880 gene locus_tag LOCUS_05680 8527 7880 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393576.1 protein_id gnl|my_center|LOCUS_05680 8795 8511 gene locus_tag LOCUS_05690 8795 8511 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_05690 9028 8795 gene locus_tag LOCUS_05700 9028 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9456 9193 gene locus_tag LOCUS_05710 gene rpsT 9456 9193 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05710 9596 10480 gene locus_tag LOCUS_05720 gene gpr 9596 10480 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_05720 10552 11223 gene locus_tag LOCUS_05730 10552 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 11201 11617 gene locus_tag LOCUS_05740 11201 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 11850 12284 gene locus_tag LOCUS_05750 11850 12284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 12426 13157 gene locus_tag LOCUS_05760 12426 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05760 13154 13780 gene locus_tag LOCUS_05770 13154 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13773 14603 gene locus_tag LOCUS_05780 13773 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 14771 15106 gene locus_tag LOCUS_05790 14771 15106 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_05790 15278 15730 gene locus_tag LOCUS_05800 15278 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 17202 15838 gene locus_tag LOCUS_05810 17202 15838 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_05810 17538 17269 gene locus_tag LOCUS_05820 17538 17269 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_05820 18762 17620 gene locus_tag LOCUS_05830 gene hemW 18762 17620 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_05830 <19406 18749 gene locus_tag LOCUS_05840 <19406 18749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357725.1:translation elongation factor 4 >Feature sequence024 508 663 gene locus_tag LOCUS_05850 508 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1225 899 gene locus_tag LOCUS_05860 1225 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1649 1251 gene locus_tag LOCUS_05870 1649 1251 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_05870 3046 1649 gene locus_tag LOCUS_05880 gene atpD 3046 1649 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_05880 4017 3064 gene locus_tag LOCUS_05890 gene atpG 4017 3064 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_05890 5513 4005 gene locus_tag LOCUS_05900 gene atpA 5513 4005 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_05900 6034 5528 gene locus_tag LOCUS_05910 6034 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6522 6031 gene locus_tag LOCUS_05920 6522 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6753 6538 gene locus_tag LOCUS_05930 6753 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7472 6786 gene locus_tag LOCUS_05940 7472 6786 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_05940 7718 9292 gene locus_tag LOCUS_05950 7718 9292 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216448.1 protein_id gnl|my_center|LOCUS_05950 9305 9979 gene locus_tag LOCUS_05960 9305 9979 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816493.1 protein_id gnl|my_center|LOCUS_05960 10400 12256 gene locus_tag LOCUS_05970 10400 12256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12263 14599 gene locus_tag LOCUS_05980 12263 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05980 14596 15210 gene locus_tag LOCUS_05990 14596 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 15418 15780 gene locus_tag LOCUS_06000 15418 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16179 15943 gene locus_tag LOCUS_06010 16179 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 16094 16861 gene locus_tag LOCUS_06020 16094 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence025 1135 980 gene locus_tag LOCUS_06030 1135 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1563 3995 gene locus_tag LOCUS_06040 1563 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4289 5668 gene locus_tag LOCUS_06050 4289 5668 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_06050 7054 5831 gene locus_tag LOCUS_06060 7054 5831 CDS product IS110-like element ISDha12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808714.1 protein_id gnl|my_center|LOCUS_06060 7403 9202 gene locus_tag LOCUS_06070 7403 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 9409 9251 gene locus_tag LOCUS_06080 9409 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10251 9613 gene locus_tag LOCUS_06090 10251 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11174 10248 gene locus_tag LOCUS_06100 11174 10248 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964780.1 protein_id gnl|my_center|LOCUS_06100 11896 11171 gene locus_tag LOCUS_06110 11896 11171 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_06110 12839 11952 gene locus_tag LOCUS_06120 12839 11952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_06120 13624 12836 gene locus_tag LOCUS_06130 13624 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13836 13624 gene locus_tag LOCUS_06140 13836 13624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14726 13863 gene locus_tag LOCUS_06150 14726 13863 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_06150 15783 15376 gene locus_tag LOCUS_06160 15783 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06160 16211 17890 gene locus_tag LOCUS_06170 16211 17890 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_06170 18133 17945 gene locus_tag LOCUS_06180 18133 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 <18881 18204 gene locus_tag LOCUS_06190 <18881 18204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000174221.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence026 516 1292 gene locus_tag LOCUS_06200 516 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1414 1490 gene locus_tag LOCUS_t00040 1414 1490 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1500 1574 gene locus_tag LOCUS_t00050 1500 1574 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1578 1653 gene locus_tag LOCUS_t00060 1578 1653 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2910 1807 gene locus_tag LOCUS_06210 2910 1807 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_06210 3488 3051 gene locus_tag LOCUS_06220 3488 3051 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092482714.1 protein_id gnl|my_center|LOCUS_06220 4124 3492 gene locus_tag LOCUS_06230 4124 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 4337 4552 gene locus_tag LOCUS_06240 4337 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4549 4788 gene locus_tag LOCUS_06250 4549 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4818 5429 gene locus_tag LOCUS_06260 4818 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 5516 5860 gene locus_tag LOCUS_06270 5516 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5863 6117 gene locus_tag LOCUS_06280 5863 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 6117 6530 gene locus_tag LOCUS_06290 6117 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 6530 7690 gene locus_tag LOCUS_06300 6530 7690 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714175.1 protein_id gnl|my_center|LOCUS_06300 7723 8340 gene locus_tag LOCUS_06310 7723 8340 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_06310 8368 10353 gene locus_tag LOCUS_06320 8368 10353 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_06320 10366 10668 gene locus_tag LOCUS_06330 10366 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10655 10864 gene locus_tag LOCUS_06340 10655 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10861 11208 gene locus_tag LOCUS_06350 10861 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11192 11431 gene locus_tag LOCUS_06360 11192 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11446 11787 gene locus_tag LOCUS_06370 11446 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 11784 11936 gene locus_tag LOCUS_06380 11784 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11933 12094 gene locus_tag LOCUS_06390 11933 12094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 12091 12675 gene locus_tag LOCUS_06400 12091 12675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 12668 12952 gene locus_tag LOCUS_06410 12668 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12939 13286 gene locus_tag LOCUS_06420 12939 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13361 15790 gene locus_tag LOCUS_06430 13361 15790 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_06430 16105 16299 gene locus_tag LOCUS_06440 16105 16299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 16296 16592 gene locus_tag LOCUS_06450 16296 16592 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_06450 16573 17958 gene locus_tag LOCUS_06460 16573 17958 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_06460 17955 18362 gene locus_tag LOCUS_06470 17955 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence027 1969 1127 gene locus_tag LOCUS_06480 1969 1127 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789270.1 protein_id gnl|my_center|LOCUS_06480 2844 2149 gene locus_tag LOCUS_06490 gene rplA 2844 2149 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_06490 3368 2943 gene locus_tag LOCUS_06500 gene rplK 3368 2943 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_06500 4009 3473 gene locus_tag LOCUS_06510 gene nusG 4009 3473 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_06510 4257 4027 gene locus_tag LOCUS_06520 4257 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4425 4276 gene locus_tag LOCUS_06530 gene rpmG 4425 4276 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_06530 4721 5137 gene locus_tag LOCUS_06540 gene ruvX 4721 5137 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_06540 5335 6675 gene locus_tag LOCUS_06550 5335 6675 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113204.1 protein_id gnl|my_center|LOCUS_06550 7249 6881 gene locus_tag LOCUS_06560 7249 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7420 8718 gene locus_tag LOCUS_06570 7420 8718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 9372 8950 gene locus_tag LOCUS_06580 9372 8950 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_06580 9498 10142 gene locus_tag LOCUS_06590 gene catA 9498 10142 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668557.1 protein_id gnl|my_center|LOCUS_06590 10622 10188 gene locus_tag LOCUS_06600 10622 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11722 10640 gene locus_tag LOCUS_06610 11722 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12721 12125 gene locus_tag LOCUS_06620 12721 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 14152 14580 gene locus_tag LOCUS_06630 14152 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 14632 14880 gene locus_tag LOCUS_06640 14632 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 15375 15599 gene locus_tag LOCUS_06650 15375 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 15587 16171 gene locus_tag LOCUS_06660 15587 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06660 16202 16762 gene locus_tag LOCUS_06670 16202 16762 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence028 1104 256 gene locus_tag LOCUS_06680 1104 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1655 1122 gene locus_tag LOCUS_06690 1655 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1989 1690 gene locus_tag LOCUS_06700 1989 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3074 1926 gene locus_tag LOCUS_06710 3074 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 3710 3243 gene locus_tag LOCUS_06720 3710 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4788 3856 gene locus_tag LOCUS_06730 gene hprK 4788 3856 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228097.1 protein_id gnl|my_center|LOCUS_06730 5053 5241 gene locus_tag LOCUS_06740 gene rpmB 5053 5241 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_06740 5331 6017 gene locus_tag LOCUS_06750 5331 6017 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_06750 6020 6349 gene locus_tag LOCUS_06760 gene azlD 6020 6349 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_06760 6506 6581 gene locus_tag LOCUS_t00070 6506 6581 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6603 6687 gene locus_tag LOCUS_t00080 6603 6687 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7981 7721 gene locus_tag LOCUS_06770 7981 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8531 8004 gene locus_tag LOCUS_06780 8531 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 8700 8515 gene locus_tag LOCUS_06790 8700 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8873 8679 gene locus_tag LOCUS_06800 8873 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 9156 8854 gene locus_tag LOCUS_06810 9156 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 9617 9171 gene locus_tag LOCUS_06820 9617 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 10697 9834 gene locus_tag LOCUS_06830 10697 9834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_06830 11065 10694 gene locus_tag LOCUS_06840 gene ytrA 11065 10694 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_06840 14121 11770 gene locus_tag LOCUS_06850 14121 11770 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_06850 16005 14794 gene locus_tag LOCUS_06860 gene ilvA 16005 14794 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_06860 16559 17305 gene locus_tag LOCUS_06870 16559 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 17308 17862 gene locus_tag LOCUS_06880 17308 17862 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence029 147 356 gene locus_tag LOCUS_06890 147 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 368 613 gene locus_tag LOCUS_06900 368 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06900 916 2373 gene locus_tag LOCUS_06910 916 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3005 3193 gene locus_tag LOCUS_06920 3005 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3102 3341 gene locus_tag LOCUS_06930 3102 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3722 4045 gene locus_tag LOCUS_06940 3722 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7406 6813 gene locus_tag LOCUS_06950 7406 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7683 8456 gene locus_tag LOCUS_06960 7683 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8458 10290 gene locus_tag LOCUS_06970 8458 10290 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_06970 10327 11454 gene locus_tag LOCUS_06980 gene ugpC 10327 11454 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_06980 11520 12755 gene locus_tag LOCUS_06990 11520 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12839 13276 gene locus_tag LOCUS_07000 12839 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 13288 14334 gene locus_tag LOCUS_07010 13288 14334 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 protein_id gnl|my_center|LOCUS_07010 14337 15248 gene locus_tag LOCUS_07020 14337 15248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 15347 16048 gene locus_tag LOCUS_07030 15347 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 16217 17866 gene locus_tag LOCUS_07040 16217 17866 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence030 333 884 gene locus_tag LOCUS_07050 gene rsmD 333 884 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07050 890 1375 gene locus_tag LOCUS_07060 gene coaD 890 1375 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_07060 1378 1833 gene locus_tag LOCUS_07070 1378 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2680 3099 gene locus_tag LOCUS_07080 gene mraZ 2680 3099 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_07080 3117 4052 gene locus_tag LOCUS_07090 gene rsmH 3117 4052 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_07090 4090 4587 gene locus_tag LOCUS_07100 4090 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4677 7076 gene locus_tag LOCUS_07110 4677 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7086 8519 gene locus_tag LOCUS_07120 7086 8519 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_07120 8876 10258 gene locus_tag LOCUS_07130 8876 10258 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_07130 10248 11237 gene locus_tag LOCUS_07140 gene mraY 10248 11237 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_07140 11260 11484 gene locus_tag LOCUS_07150 11260 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 11460 12536 gene locus_tag LOCUS_07160 gene spoVE 11460 12536 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_07160 12838 13026 gene locus_tag LOCUS_07170 12838 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 13098 14237 gene locus_tag LOCUS_07180 gene murG 13098 14237 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_07180 14256 15359 gene locus_tag LOCUS_07190 14256 15359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 15617 16771 gene locus_tag LOCUS_07200 gene ftsZ 15617 16771 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence031 1061 1537 gene locus_tag LOCUS_07210 1061 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1534 2079 gene locus_tag LOCUS_07220 1534 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2110 2640 gene locus_tag LOCUS_07230 2110 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2744 3190 gene locus_tag LOCUS_07240 2744 3190 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_07240 3347 3826 gene locus_tag LOCUS_07250 gene nusB 3347 3826 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_07250 3819 4748 gene locus_tag LOCUS_07260 3819 4748 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_07260 4847 6121 gene locus_tag LOCUS_07270 gene xseA 4847 6121 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246103.1 protein_id gnl|my_center|LOCUS_07270 6123 6359 gene locus_tag LOCUS_07280 6123 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6356 7240 gene locus_tag LOCUS_07290 6356 7240 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_07290 8102 8686 gene locus_tag LOCUS_07300 8102 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_07300 8733 10610 gene locus_tag LOCUS_07310 gene dxs 8733 10610 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_07310 10603 11406 gene locus_tag LOCUS_07320 10603 11406 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_07320 11403 12254 gene locus_tag LOCUS_07330 11403 12254 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_07330 12288 12743 gene locus_tag LOCUS_07340 12288 12743 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_07340 12762 14582 gene locus_tag LOCUS_07350 gene recN 12762 14582 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_07350 14688 15911 gene locus_tag LOCUS_07360 gene tyrS 14688 15911 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_07360 16874 15996 gene locus_tag LOCUS_07370 16874 15996 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence032 <1 933 gene locus_tag LOCUS_07380 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965138.1:methionine gamma-lyase family protein 1461 3215 gene locus_tag LOCUS_07390 gene thrS 1461 3215 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_07390 3310 5076 gene locus_tag LOCUS_07400 3310 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5076 6515 gene locus_tag LOCUS_07410 gene proS 5076 6515 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_07410 6821 6633 gene locus_tag LOCUS_07420 6821 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 7785 6859 gene locus_tag LOCUS_07430 7785 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9053 7920 gene locus_tag LOCUS_07440 9053 7920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243283.1 protein_id gnl|my_center|LOCUS_07440 10075 9074 gene locus_tag LOCUS_07450 10075 9074 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817367.1 protein_id gnl|my_center|LOCUS_07450 11009 10185 gene locus_tag LOCUS_07460 11009 10185 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_07460 12323 11121 gene locus_tag LOCUS_07470 12323 11121 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_07470 12458 12631 gene locus_tag LOCUS_07480 12458 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14240 12888 gene locus_tag LOCUS_07490 14240 12888 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_07490 15263 14328 gene locus_tag LOCUS_07500 15263 14328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence033 <1 3092 gene locus_tag LOCUS_07510 <1 3092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042338787.1:cell wall-binding repeat-containing protein 3249 3324 gene locus_tag LOCUS_t00090 3249 3324 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4408 4232 gene locus_tag LOCUS_07520 4408 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5034 5471 gene locus_tag LOCUS_07530 5034 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5473 5661 gene locus_tag LOCUS_07540 5473 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5977 5714 gene locus_tag LOCUS_07550 5977 5714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6198 6122 gene locus_tag LOCUS_t00100 6198 6122 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6480 7892 gene locus_tag LOCUS_07560 6480 7892 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_07560 8262 9554 gene locus_tag LOCUS_07570 8262 9554 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_07570 10464 9748 gene locus_tag LOCUS_07580 10464 9748 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_07580 11109 10588 gene locus_tag LOCUS_07590 11109 10588 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787224.1 protein_id gnl|my_center|LOCUS_07590 11292 12896 gene locus_tag LOCUS_07600 11292 12896 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_07600 12896 13261 gene locus_tag LOCUS_07610 12896 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 13417 13863 gene locus_tag LOCUS_07620 13417 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 13876 14799 gene locus_tag LOCUS_07630 13876 14799 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_07630 14952 15326 gene locus_tag LOCUS_07640 14952 15326 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence034 1477 104 gene locus_tag LOCUS_07650 1477 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3228 1480 gene locus_tag LOCUS_07660 3228 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3784 5154 gene locus_tag LOCUS_07670 3784 5154 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_07670 5530 6180 gene locus_tag LOCUS_07680 5530 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7749 6406 gene locus_tag LOCUS_07690 7749 6406 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_07690 8990 8094 gene locus_tag LOCUS_07700 8990 8094 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681428.1 protein_id gnl|my_center|LOCUS_07700 9149 10252 gene locus_tag LOCUS_07710 gene yedE 9149 10252 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_07710 10274 10495 gene locus_tag LOCUS_07720 10274 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10495 10731 gene locus_tag LOCUS_07730 10495 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 11734 10781 gene locus_tag LOCUS_07740 11734 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13111 12287 gene locus_tag LOCUS_07750 13111 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 14001 13111 gene locus_tag LOCUS_07760 14001 13111 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_07760 14137 13994 gene locus_tag LOCUS_07770 14137 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 14467 15141 gene locus_tag LOCUS_07780 14467 15141 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence035 284 1480 gene locus_tag LOCUS_07790 284 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1580 1729 gene locus_tag LOCUS_07800 1580 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1742 3439 gene locus_tag LOCUS_07810 1742 3439 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_07810 4519 3830 gene locus_tag LOCUS_07820 4519 3830 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_07820 4923 4507 gene locus_tag LOCUS_07830 4923 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 6132 4936 gene locus_tag LOCUS_07840 6132 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6279 7346 gene locus_tag LOCUS_07850 6279 7346 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_07850 8039 7476 gene locus_tag LOCUS_07860 gene yfcE 8039 7476 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_07860 9145 8036 gene locus_tag LOCUS_07870 gene mnmA 9145 8036 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07870 9317 9241 gene locus_tag LOCUS_t00110 9317 9241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9421 9345 gene locus_tag LOCUS_t00120 9421 9345 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10326 9508 gene locus_tag LOCUS_07880 10326 9508 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_07880 11626 10340 gene locus_tag LOCUS_07890 11626 10340 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_07890 12136 11645 gene locus_tag LOCUS_07900 12136 11645 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_07900 13389 12805 gene locus_tag LOCUS_07910 gene sigE 13389 12805 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_07910 14347 13523 gene locus_tag LOCUS_07920 14347 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 15635 14631 gene locus_tag LOCUS_07930 15635 14631 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence036 2 277 gene locus_tag LOCUS_07940 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 280 1002 gene locus_tag LOCUS_07950 280 1002 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 protein_id gnl|my_center|LOCUS_07950 1008 2174 gene locus_tag LOCUS_07960 1008 2174 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_07960 2184 2567 gene locus_tag LOCUS_07970 2184 2567 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244460.1 protein_id gnl|my_center|LOCUS_07970 2580 3335 gene locus_tag LOCUS_07980 2580 3335 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_07980 3328 3690 gene locus_tag LOCUS_07990 3328 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4031 5176 gene locus_tag LOCUS_08000 4031 5176 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_08000 5324 5734 gene locus_tag LOCUS_08010 5324 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_08010 6105 6335 gene locus_tag LOCUS_08020 6105 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 6341 6715 gene locus_tag LOCUS_08030 6341 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6720 7442 gene locus_tag LOCUS_08040 gene atpB 6720 7442 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_08040 7497 7754 gene locus_tag LOCUS_08050 gene atpE 7497 7754 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_08050 7887 8390 gene locus_tag LOCUS_08060 7887 8390 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457122.1 protein_id gnl|my_center|LOCUS_08060 8397 8945 gene locus_tag LOCUS_08070 8397 8945 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947988.1 protein_id gnl|my_center|LOCUS_08070 8951 10453 gene locus_tag LOCUS_08080 gene atpA 8951 10453 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_08080 10475 11338 gene locus_tag LOCUS_08090 gene atpG 10475 11338 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_08090 11438 12835 gene locus_tag LOCUS_08100 gene atpD 11438 12835 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_08100 12837 13238 gene locus_tag LOCUS_08110 12837 13238 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_08110 13401 14111 gene locus_tag LOCUS_08120 13401 14111 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_08120 14115 14915 gene locus_tag LOCUS_08130 14115 14915 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_08130 <15780 15051 gene locus_tag LOCUS_08140 <15780 15051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102247.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence037 <1 689 gene locus_tag LOCUS_08150 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948480.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 696 1205 gene locus_tag LOCUS_08160 696 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1202 2029 gene locus_tag LOCUS_08170 gene thiM 1202 2029 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_08170 2107 2775 gene locus_tag LOCUS_08180 gene tenA 2107 2775 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_08180 2779 3534 gene locus_tag LOCUS_08190 2779 3534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256797.1 protein_id gnl|my_center|LOCUS_08190 3531 4280 gene locus_tag LOCUS_08200 3531 4280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088660.1 protein_id gnl|my_center|LOCUS_08200 4344 5360 gene locus_tag LOCUS_08210 4344 5360 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670421.1 protein_id gnl|my_center|LOCUS_08210 6355 5411 gene locus_tag LOCUS_08220 6355 5411 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257547.1 protein_id gnl|my_center|LOCUS_08220 6472 7725 gene locus_tag LOCUS_08230 6472 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 7777 8475 gene locus_tag LOCUS_08240 gene cwlD 7777 8475 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_08240 8486 9841 gene locus_tag LOCUS_08250 gene radA 8486 9841 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_08250 9903 11000 gene locus_tag LOCUS_08260 9903 11000 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816850.1 protein_id gnl|my_center|LOCUS_08260 10997 12169 gene locus_tag LOCUS_08270 10997 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12258 13322 gene locus_tag LOCUS_08280 gene pyrB 12258 13322 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_08280 14585 13533 gene locus_tag LOCUS_08290 14585 13533 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_08290 14715 15239 gene locus_tag LOCUS_08300 14715 15239 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence038 1544 501 gene locus_tag LOCUS_08310 1544 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3209 2061 gene locus_tag LOCUS_08320 3209 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 3439 3573 gene locus_tag LOCUS_08330 3439 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3769 4746 gene locus_tag LOCUS_08340 3769 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6487 4994 gene locus_tag LOCUS_08350 6487 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7302 6502 gene locus_tag LOCUS_08360 7302 6502 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_08360 8054 7299 gene locus_tag LOCUS_08370 8054 7299 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_08370 8288 8803 gene locus_tag LOCUS_08380 8288 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 10265 10570 gene locus_tag LOCUS_08390 10265 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13570 11717 gene locus_tag LOCUS_08400 13570 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15123 13582 gene locus_tag LOCUS_08410 15123 13582 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_08410 15350 15123 gene locus_tag LOCUS_08420 15350 15123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence039 14 355 gene locus_tag LOCUS_08430 14 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 946 392 gene locus_tag LOCUS_08440 946 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2388 1450 gene locus_tag LOCUS_08450 2388 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3484 2390 gene locus_tag LOCUS_08460 3484 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3796 3509 gene locus_tag LOCUS_08470 3796 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4985 4131 gene locus_tag LOCUS_08480 4985 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5210 6142 gene locus_tag LOCUS_08490 5210 6142 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315826.1 protein_id gnl|my_center|LOCUS_08490 6253 7431 gene locus_tag LOCUS_08500 6253 7431 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244015.1 protein_id gnl|my_center|LOCUS_08500 7521 8531 gene locus_tag LOCUS_08510 7521 8531 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973347.1 protein_id gnl|my_center|LOCUS_08510 8651 10282 gene locus_tag LOCUS_08520 8651 10282 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087114.1 protein_id gnl|my_center|LOCUS_08520 13013 10389 gene locus_tag LOCUS_08530 13013 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 14105 13128 gene locus_tag LOCUS_08540 14105 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 15064 14300 gene locus_tag LOCUS_08550 15064 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence040 2720 1086 gene locus_tag LOCUS_08560 2720 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3591 3097 gene locus_tag LOCUS_08570 3591 3097 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_08570 4413 3730 gene locus_tag LOCUS_08580 4413 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08580 6296 4413 gene locus_tag LOCUS_08590 6296 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08590 7268 6447 gene locus_tag LOCUS_08600 7268 6447 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277403.1 protein_id gnl|my_center|LOCUS_08600 7433 7645 gene locus_tag LOCUS_08610 7433 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7666 8940 gene locus_tag LOCUS_08620 7666 8940 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_08620 8956 9147 gene locus_tag LOCUS_08630 8956 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9137 10669 gene locus_tag LOCUS_08640 9137 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 10669 11172 gene locus_tag LOCUS_08650 10669 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 11188 12294 gene locus_tag LOCUS_08660 11188 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12647 13015 gene locus_tag LOCUS_08670 12647 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 13015 14835 gene locus_tag LOCUS_08680 13015 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence041 1046 579 gene locus_tag LOCUS_08690 gene recX 1046 579 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 protein_id gnl|my_center|LOCUS_08690 2218 1046 gene locus_tag LOCUS_08700 gene recA 2218 1046 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_08700 2781 2398 gene locus_tag LOCUS_08710 2781 2398 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_08710 3407 2937 gene locus_tag LOCUS_08720 3407 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3988 3734 gene locus_tag LOCUS_08730 3988 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6454 5723 gene locus_tag LOCUS_08740 6454 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 6749 6507 gene locus_tag LOCUS_08750 6749 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 7195 6887 gene locus_tag LOCUS_08760 7195 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7781 7557 gene locus_tag LOCUS_08770 7781 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8249 9343 gene locus_tag LOCUS_08780 gene aguA 8249 9343 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_08780 10448 9387 gene locus_tag LOCUS_08790 gene trpS 10448 9387 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_08790 11029 10463 gene locus_tag LOCUS_08800 11029 10463 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896761.1 protein_id gnl|my_center|LOCUS_08800 14239 11282 gene locus_tag LOCUS_08810 14239 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 14902 15162 gene locus_tag LOCUS_08820 14902 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence042 378 58 gene locus_tag LOCUS_08830 378 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2840 618 gene locus_tag LOCUS_08840 2840 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 6938 2958 gene locus_tag LOCUS_08850 6938 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 7215 8246 gene locus_tag LOCUS_08860 7215 8246 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_08860 8435 9598 gene locus_tag LOCUS_08870 8435 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 9600 10652 gene locus_tag LOCUS_08880 9600 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10802 11047 gene locus_tag LOCUS_08890 10802 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 11090 11266 gene locus_tag LOCUS_08900 11090 11266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 12295 11267 gene locus_tag LOCUS_08910 12295 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 15045 12307 gene locus_tag LOCUS_08920 15045 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence043 1 660 gene locus_tag LOCUS_08930 1 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1902 745 gene locus_tag LOCUS_08940 1902 745 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_08940 2958 2086 gene locus_tag LOCUS_08950 2958 2086 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_08950 3100 2951 gene locus_tag LOCUS_08960 3100 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 4072 3140 gene locus_tag LOCUS_08970 4072 3140 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965936.1 protein_id gnl|my_center|LOCUS_08970 5727 4093 gene locus_tag LOCUS_08980 5727 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 6353 7540 gene locus_tag LOCUS_08990 6353 7540 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048226.1 protein_id gnl|my_center|LOCUS_08990 7618 8193 gene locus_tag LOCUS_09000 7618 8193 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_09000 8190 9608 gene locus_tag LOCUS_09010 8190 9608 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_09010 10172 9885 gene locus_tag LOCUS_09020 10172 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 10655 10392 gene locus_tag LOCUS_09030 10655 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09030 12312 11935 gene locus_tag LOCUS_09040 12312 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09040 12873 12688 gene locus_tag LOCUS_09050 12873 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09050 13214 13414 gene locus_tag LOCUS_09060 13214 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13411 14379 gene locus_tag LOCUS_09070 13411 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 >Feature sequence044 1081 11 gene locus_tag LOCUS_09080 1081 11 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_09080 1299 1616 gene locus_tag LOCUS_09090 1299 1616 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_09090 1613 2272 gene locus_tag LOCUS_09100 1613 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2269 3198 gene locus_tag LOCUS_09110 2269 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3245 3454 gene locus_tag LOCUS_09120 3245 3454 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_09120 3495 3944 gene locus_tag LOCUS_09130 3495 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4771 4037 gene locus_tag LOCUS_09140 gene trmD 4771 4037 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_09140 5274 4768 gene locus_tag LOCUS_09150 gene rimM 5274 4768 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870156.1 protein_id gnl|my_center|LOCUS_09150 6191 5943 gene locus_tag LOCUS_09160 6191 5943 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_09160 6430 6188 gene locus_tag LOCUS_09170 gene rpsP 6430 6188 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_09170 7853 6495 gene locus_tag LOCUS_09180 gene ffh 7853 6495 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_09180 8226 7855 gene locus_tag LOCUS_09190 8226 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 11385 8392 gene locus_tag LOCUS_09200 11385 8392 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_09200 12852 11428 gene locus_tag LOCUS_09210 12852 11428 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_09210 13218 13748 gene locus_tag LOCUS_09220 13218 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 14098 13760 gene locus_tag LOCUS_09230 14098 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 14264 14174 gene locus_tag LOCUS_t00130 14264 14174 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 530 454 gene locus_tag LOCUS_t00140 530 454 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1897 755 gene locus_tag LOCUS_09240 1897 755 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09240 2122 1946 gene locus_tag LOCUS_09250 2122 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09250 4021 3851 gene locus_tag LOCUS_09260 4021 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 4275 5243 gene locus_tag LOCUS_09270 4275 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5326 6612 gene locus_tag LOCUS_09280 5326 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7210 6884 gene locus_tag LOCUS_09290 7210 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10796 7716 gene locus_tag LOCUS_09300 10796 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09300 11004 11933 gene locus_tag LOCUS_09310 11004 11933 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_09310 12577 12344 gene locus_tag LOCUS_09320 12577 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09320 13106 12798 gene locus_tag LOCUS_09330 13106 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence046 766 1776 gene locus_tag LOCUS_09340 gene pta 766 1776 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_09340 1874 2302 gene locus_tag LOCUS_09350 1874 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2305 2697 gene locus_tag LOCUS_09360 2305 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3603 3088 gene locus_tag LOCUS_09370 3603 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3740 4588 gene locus_tag LOCUS_09380 3740 4588 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_09380 4655 5281 gene locus_tag LOCUS_09390 4655 5281 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940854.1 protein_id gnl|my_center|LOCUS_09390 5519 6886 gene locus_tag LOCUS_09400 5519 6886 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_09400 7893 6964 gene locus_tag LOCUS_09410 7893 6964 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244504.1 protein_id gnl|my_center|LOCUS_09410 8285 9301 gene locus_tag LOCUS_09420 8285 9301 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_09420 9531 11036 gene locus_tag LOCUS_09430 gene gguA 9531 11036 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_09430 11029 12012 gene locus_tag LOCUS_09440 11029 12012 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551207.1 protein_id gnl|my_center|LOCUS_09440 13715 12699 gene locus_tag LOCUS_09450 13715 12699 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083937.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence047 1532 561 gene locus_tag LOCUS_09460 1532 561 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_09460 2399 1548 gene locus_tag LOCUS_09470 2399 1548 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098118.1 protein_id gnl|my_center|LOCUS_09470 2993 3748 gene locus_tag LOCUS_09480 gene iolR 2993 3748 CDS product myo-inositol utilization transcriptional regulator IolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227050.1 protein_id gnl|my_center|LOCUS_09480 4476 4027 gene locus_tag LOCUS_09490 4476 4027 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890655.1 protein_id gnl|my_center|LOCUS_09490 5184 4528 gene locus_tag LOCUS_09500 5184 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6029 5181 gene locus_tag LOCUS_09510 6029 5181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_09510 6406 6026 gene locus_tag LOCUS_09520 6406 6026 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_09520 7755 7408 gene locus_tag LOCUS_09530 7755 7408 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_09530 9953 7902 gene locus_tag LOCUS_09540 9953 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 10651 9956 gene locus_tag LOCUS_09550 10651 9956 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_09550 11264 11124 gene locus_tag LOCUS_09560 11264 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11951 11876 gene locus_tag LOCUS_t00150 11951 11876 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12068 11982 gene locus_tag LOCUS_t00160 12068 11982 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12548 12411 gene locus_tag LOCUS_09570 12548 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12851 12714 gene locus_tag LOCUS_09580 12851 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 13216 13040 gene locus_tag LOCUS_09590 13216 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13722 13588 gene locus_tag LOCUS_09600 13722 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence048 1680 943 gene locus_tag LOCUS_09610 gene nagB 1680 943 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_09610 2613 1702 gene locus_tag LOCUS_09620 2613 1702 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_09620 3984 2617 gene locus_tag LOCUS_09630 3984 2617 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703822.1 protein_id gnl|my_center|LOCUS_09630 4643 3999 gene locus_tag LOCUS_09640 4643 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5758 4658 gene locus_tag LOCUS_09650 gene ugpC 5758 4658 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_09650 6625 5774 gene locus_tag LOCUS_09660 6625 5774 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_09660 7513 6641 gene locus_tag LOCUS_09670 7513 6641 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_09670 8904 7585 gene locus_tag LOCUS_09680 8904 7585 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_09680 9245 10945 gene locus_tag LOCUS_09690 9245 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10939 12531 gene locus_tag LOCUS_09700 10939 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence049 423 199 gene locus_tag LOCUS_09710 423 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 918 436 gene locus_tag LOCUS_09720 gene rlmH 918 436 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_09720 1709 900 gene locus_tag LOCUS_09730 1709 900 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_09730 2175 1732 gene locus_tag LOCUS_09740 2175 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3555 2269 gene locus_tag LOCUS_09750 3555 2269 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_09750 4571 3744 gene locus_tag LOCUS_09760 4571 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5911 4595 gene locus_tag LOCUS_09770 5911 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7683 5908 gene locus_tag LOCUS_09780 gene walK 7683 5908 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755367.1 protein_id gnl|my_center|LOCUS_09780 8382 7687 gene locus_tag LOCUS_09790 gene yycF 8382 7687 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_09790 8962 8423 gene locus_tag LOCUS_09800 8962 8423 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_09800 10886 8976 gene locus_tag LOCUS_09810 10886 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11411 11103 gene locus_tag LOCUS_09820 11411 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 12236 11424 gene locus_tag LOCUS_09830 12236 11424 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_09830 12607 12233 gene locus_tag LOCUS_09840 12607 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence050 3357 2725 gene locus_tag LOCUS_09850 3357 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4751 3354 gene locus_tag LOCUS_09860 4751 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4937 6286 gene locus_tag LOCUS_09870 4937 6286 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_09870 7423 6473 gene locus_tag LOCUS_09880 7423 6473 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_09880 8007 9146 gene locus_tag LOCUS_09890 gene prfB 8007 9146 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_09890 11007 10816 gene locus_tag LOCUS_09900 11007 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11075 11206 gene locus_tag LOCUS_09910 11075 11206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12044 13357 gene locus_tag LOCUS_09920 12044 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09920 >Feature sequence051 760 53 gene locus_tag LOCUS_09930 760 53 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_09930 1536 778 gene locus_tag LOCUS_09940 1536 778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_09940 2622 1540 gene locus_tag LOCUS_09950 2622 1540 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_09950 3516 2635 gene locus_tag LOCUS_09960 3516 2635 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_09960 5002 3818 gene locus_tag LOCUS_09970 5002 3818 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_09970 5639 5884 gene locus_tag LOCUS_09980 5639 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5934 6161 gene locus_tag LOCUS_09990 5934 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 7331 8041 gene locus_tag LOCUS_10000 7331 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7972 8445 gene locus_tag LOCUS_10010 gene ispF 7972 8445 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_10010 8525 8719 gene locus_tag LOCUS_10020 8525 8719 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_10020 8799 9473 gene locus_tag LOCUS_10030 gene udp 8799 9473 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 9470 10051 gene locus_tag LOCUS_10040 9470 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 10009 11448 gene locus_tag LOCUS_10050 10009 11448 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_10050 <13346 12602 gene locus_tag LOCUS_10060 <13346 12602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027546.1:methionine adenosyltransferase >Feature sequence052 1584 448 gene locus_tag LOCUS_10070 gene cbiD 1584 448 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_10070 1810 2007 gene locus_tag LOCUS_10080 1810 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2050 2430 gene locus_tag LOCUS_10090 2050 2430 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_10090 2557 4203 gene locus_tag LOCUS_10100 2557 4203 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_10100 4482 4844 gene locus_tag LOCUS_10110 4482 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10110 4863 5894 gene locus_tag LOCUS_10120 4863 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 7210 6260 gene locus_tag LOCUS_10130 7210 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8364 7222 gene locus_tag LOCUS_10140 8364 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 8767 9078 gene locus_tag LOCUS_10150 8767 9078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10780 10565 gene locus_tag LOCUS_10160 10780 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 11292 10885 gene locus_tag LOCUS_10170 11292 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 13139 11574 gene locus_tag LOCUS_10180 13139 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence053 607 873 gene locus_tag LOCUS_10190 607 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1053 1490 gene locus_tag LOCUS_10200 1053 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1506 1706 gene locus_tag LOCUS_10210 1506 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2203 1928 gene locus_tag LOCUS_10220 2203 1928 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_10220 2810 2280 gene locus_tag LOCUS_10230 2810 2280 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_10230 4854 3016 gene locus_tag LOCUS_10240 gene glmS 4854 3016 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_10240 6815 5454 gene locus_tag LOCUS_10250 gene glmM 6815 5454 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048332.1 protein_id gnl|my_center|LOCUS_10250 7895 6855 gene locus_tag LOCUS_10260 gene ruvB 7895 6855 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_10260 8545 7937 gene locus_tag LOCUS_10270 gene ruvA 8545 7937 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_10270 9054 8557 gene locus_tag LOCUS_10280 gene ruvC 9054 8557 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_10280 10162 9221 gene locus_tag LOCUS_10290 10162 9221 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_10290 11052 10159 gene locus_tag LOCUS_10300 gene yidA 11052 10159 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175130.1 protein_id gnl|my_center|LOCUS_10300 11583 11068 gene locus_tag LOCUS_10310 11583 11068 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_10310 12454 11585 gene locus_tag LOCUS_10320 12454 11585 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_10320 12658 12742 gene locus_tag LOCUS_t00170 12658 12742 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 <1 1300 gene locus_tag LOCUS_10330 <1 1300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391557.1:DNA gyrase subunit A 1991 1392 gene locus_tag LOCUS_10340 1991 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3082 2210 gene locus_tag LOCUS_10350 3082 2210 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_10350 3486 3160 gene locus_tag LOCUS_10360 3486 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4423 3617 gene locus_tag LOCUS_10370 gene proC 4423 3617 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704543.1 protein_id gnl|my_center|LOCUS_10370 4861 6639 gene locus_tag LOCUS_10380 4861 6639 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_10380 6551 6853 gene locus_tag LOCUS_10390 6551 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 7233 6889 gene locus_tag LOCUS_10400 7233 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 7604 7245 gene locus_tag LOCUS_10410 7604 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 8328 7657 gene locus_tag LOCUS_10420 gene cysE 8328 7657 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_10420 8531 9730 gene locus_tag LOCUS_10430 gene wecC 8531 9730 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942497.1 protein_id gnl|my_center|LOCUS_10430 9812 11260 gene locus_tag LOCUS_10440 9812 11260 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869880.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence055 16 276 gene locus_tag LOCUS_10450 16 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 312 485 gene locus_tag LOCUS_10460 312 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 685 1149 gene locus_tag LOCUS_10470 685 1149 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_10470 1171 2235 gene locus_tag LOCUS_10480 gene nusA 1171 2235 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_10480 2258 2539 gene locus_tag LOCUS_10490 2258 2539 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_10490 2529 3344 gene locus_tag LOCUS_10500 2529 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3555 5864 gene locus_tag LOCUS_10510 3555 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6210 6545 gene locus_tag LOCUS_10520 gene rbfA 6210 6545 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965109.1 protein_id gnl|my_center|LOCUS_10520 6542 7501 gene locus_tag LOCUS_10530 6542 7501 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_10530 7488 8405 gene locus_tag LOCUS_10540 gene truB 7488 8405 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 protein_id gnl|my_center|LOCUS_10540 8557 9465 gene locus_tag LOCUS_10550 gene ribF 8557 9465 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_10550 9595 10116 gene locus_tag LOCUS_10560 9595 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10819 11265 gene locus_tag LOCUS_10570 10819 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence056 <1 1318 gene locus_tag LOCUS_10580 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase 1712 2200 gene locus_tag LOCUS_10590 1712 2200 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_10590 2194 3363 gene locus_tag LOCUS_10600 2194 3363 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_10600 3476 3856 gene locus_tag LOCUS_10610 3476 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4605 3901 gene locus_tag LOCUS_10620 4605 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5299 4637 gene locus_tag LOCUS_10630 gene pyrE 5299 4637 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_10630 5549 6250 gene locus_tag LOCUS_10640 5549 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6247 6915 gene locus_tag LOCUS_10650 6247 6915 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640258.1 protein_id gnl|my_center|LOCUS_10650 6912 7217 gene locus_tag LOCUS_10660 6912 7217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7269 8615 gene locus_tag LOCUS_10670 7269 8615 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_10670 9816 10730 gene locus_tag LOCUS_10680 gene murB 9816 10730 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_10680 10791 11648 gene locus_tag LOCUS_10690 gene rapZ 10791 11648 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence057 159 1094 gene locus_tag LOCUS_10700 159 1094 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_10700 1100 2065 gene locus_tag LOCUS_10710 1100 2065 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_10710 2085 2972 gene locus_tag LOCUS_10720 gene prmC 2085 2972 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_10720 3637 3152 gene locus_tag LOCUS_10730 3637 3152 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_10730 5607 3838 gene locus_tag LOCUS_10740 5607 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6995 5625 gene locus_tag LOCUS_10750 6995 5625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_10750 9520 7211 gene locus_tag LOCUS_10760 9520 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 10857 10000 gene locus_tag LOCUS_10770 10857 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 <11781 10904 gene locus_tag LOCUS_10780 <11781 10904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005679031.1:ADP-ribosylglycohydrolase family protein >Feature sequence058 1648 632 gene locus_tag LOCUS_10790 1648 632 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083937.1 protein_id gnl|my_center|LOCUS_10790 1947 2954 gene locus_tag LOCUS_10800 1947 2954 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704222.1 protein_id gnl|my_center|LOCUS_10800 3598 3011 gene locus_tag LOCUS_10810 3598 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4716 3697 gene locus_tag LOCUS_10820 4716 3697 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 protein_id gnl|my_center|LOCUS_10820 5022 6068 gene locus_tag LOCUS_10830 gene hrcA 5022 6068 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_10830 6097 6624 gene locus_tag LOCUS_10840 gene grpE 6097 6624 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_10840 6681 8528 gene locus_tag LOCUS_10850 gene dnaK 6681 8528 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_10850 8696 9847 gene locus_tag LOCUS_10860 gene dnaJ 8696 9847 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_10860 10117 10335 gene locus_tag LOCUS_10870 10117 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11153 10692 gene locus_tag LOCUS_10880 gene ribE 11153 10692 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence059 2164 770 gene locus_tag LOCUS_10890 2164 770 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_10890 2775 2191 gene locus_tag LOCUS_10900 gene coaE 2775 2191 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_10900 3719 2781 gene locus_tag LOCUS_10910 3719 2781 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_10910 4277 3723 gene locus_tag LOCUS_10920 4277 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 4753 4202 gene locus_tag LOCUS_10930 4753 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10930 5086 5271 gene locus_tag LOCUS_10940 5086 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 6982 6740 gene locus_tag LOCUS_10950 6982 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9137 8034 gene locus_tag LOCUS_10960 9137 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 10518 9172 gene locus_tag LOCUS_10970 10518 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 11322 10678 gene locus_tag LOCUS_10980 11322 10678 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence060 <1 707 gene locus_tag LOCUS_10990 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016931.1:acyl-CoA dehydratase activase note possible pseudo, frameshifted 784 969 gene locus_tag LOCUS_11000 784 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1381 2034 gene locus_tag LOCUS_11010 1381 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11010 2743 2537 gene locus_tag LOCUS_11020 2743 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3013 2798 gene locus_tag LOCUS_11030 3013 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3296 2988 gene locus_tag LOCUS_11040 3296 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4195 3848 gene locus_tag LOCUS_11050 4195 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 6591 4210 gene locus_tag LOCUS_11060 6591 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8683 6857 gene locus_tag LOCUS_11070 8683 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 8931 8692 gene locus_tag LOCUS_11080 8931 8692 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_11080 9051 9989 gene locus_tag LOCUS_11090 9051 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <11350 10214 gene locus_tag LOCUS_11100 <11350 10214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964978.1:replication-associated recombination protein A >Feature sequence061 63 647 gene locus_tag LOCUS_11110 63 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1569 1060 gene locus_tag LOCUS_11120 gene nrdG 1569 1060 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_11120 1763 1569 gene locus_tag LOCUS_11130 1763 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4139 1785 gene locus_tag LOCUS_11140 4139 1785 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_11140 5503 4535 gene locus_tag LOCUS_11150 5503 4535 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_11150 5764 7005 gene locus_tag LOCUS_11160 5764 7005 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_11160 7106 7786 gene locus_tag LOCUS_11170 7106 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7804 8463 gene locus_tag LOCUS_11180 7804 8463 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436215.1 protein_id gnl|my_center|LOCUS_11180 10302 8641 gene locus_tag LOCUS_11190 10302 8641 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_11190 <11256 10438 gene locus_tag LOCUS_11200 <11256 10438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225984.1:glutamate--tRNA ligase family protein >Feature sequence062 1120 80 gene locus_tag LOCUS_11210 gene purM 1120 80 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_11210 2754 1282 gene locus_tag LOCUS_11220 gene purF 2754 1282 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_11220 3507 2797 gene locus_tag LOCUS_11230 3507 2797 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_11230 4333 3842 gene locus_tag LOCUS_11240 gene purE 4333 3842 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_11240 5798 4611 gene locus_tag LOCUS_11250 5798 4611 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_11250 8092 5861 gene locus_tag LOCUS_11260 8092 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8376 9821 gene locus_tag LOCUS_11270 8376 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence063 <1 794 gene locus_tag LOCUS_11280 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002261888.1:ABC transporter permease subunit 788 1567 gene locus_tag LOCUS_11290 788 1567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817405.1 protein_id gnl|my_center|LOCUS_11290 1639 2817 gene locus_tag LOCUS_11300 1639 2817 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261890.1 protein_id gnl|my_center|LOCUS_11300 2845 3504 gene locus_tag LOCUS_11310 2845 3504 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_11310 4591 3686 gene locus_tag LOCUS_11320 4591 3686 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658271.1 protein_id gnl|my_center|LOCUS_11320 5304 4771 gene locus_tag LOCUS_11330 5304 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11330 6037 5519 gene locus_tag LOCUS_11340 6037 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 6731 6453 gene locus_tag LOCUS_11350 gene rpmA 6731 6453 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_11350 7053 6718 gene locus_tag LOCUS_11360 7053 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7369 7058 gene locus_tag LOCUS_11370 gene rplU 7369 7058 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229668.1 protein_id gnl|my_center|LOCUS_11370 8445 7531 gene locus_tag LOCUS_11380 8445 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9151 8474 gene locus_tag LOCUS_11390 gene rpiA 9151 8474 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 protein_id gnl|my_center|LOCUS_11390 10452 9598 gene locus_tag LOCUS_11400 gene folD 10452 9598 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_11400 <11149 10480 gene locus_tag LOCUS_11410 <11149 10480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897834.1:prolipoprotein diacylglyceryl transferase >Feature sequence064 2 181 gene locus_tag LOCUS_11420 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 306 1427 gene locus_tag LOCUS_11430 306 1427 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_11430 4441 4202 gene locus_tag LOCUS_11440 4441 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4736 5062 gene locus_tag LOCUS_11450 4736 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5659 5892 gene locus_tag LOCUS_11460 5659 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5925 7193 gene locus_tag LOCUS_11470 5925 7193 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905867.1 protein_id gnl|my_center|LOCUS_11470 8006 9790 gene locus_tag LOCUS_11480 8006 9790 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_11480 <11052 9984 gene locus_tag LOCUS_11490 <11052 9984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811628.1:M23 family metallopeptidase >Feature sequence065 4187 1167 gene locus_tag LOCUS_11500 4187 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 5160 4453 gene locus_tag LOCUS_11510 5160 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 5763 5506 gene locus_tag LOCUS_11520 5763 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 9009 6529 gene locus_tag LOCUS_11530 9009 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 10291 9140 gene locus_tag LOCUS_11540 10291 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 <10832 10288 gene locus_tag LOCUS_11550 <10832 10288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920607.1:response regulator transcription factor >Feature sequence066 207 821 gene locus_tag LOCUS_11560 207 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1263 859 gene locus_tag LOCUS_11570 1263 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3385 1667 gene locus_tag LOCUS_11580 3385 1667 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087120.1 protein_id gnl|my_center|LOCUS_11580 5804 3801 gene locus_tag LOCUS_11590 5804 3801 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_11590 7689 5878 gene locus_tag LOCUS_11600 gene aspS 7689 5878 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_11600 8132 7923 gene locus_tag LOCUS_11610 8132 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 8978 9217 gene locus_tag LOCUS_11620 8978 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9592 9140 gene locus_tag LOCUS_11630 9592 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10082 9711 gene locus_tag LOCUS_11640 10082 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 <10684 10123 gene locus_tag LOCUS_11650 <10684 10123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057852.1:septum site-determining protein MinD >Feature sequence067 1511 837 gene locus_tag LOCUS_11660 1511 837 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_11660 3435 1501 gene locus_tag LOCUS_11670 3435 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5997 3913 gene locus_tag LOCUS_11680 gene fusA 5997 3913 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_11680 7860 6622 gene locus_tag LOCUS_11690 gene rpoD 7860 6622 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_11690 9623 7857 gene locus_tag LOCUS_11700 gene dnaG 9623 7857 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_11700 <10673 9682 gene locus_tag LOCUS_11710 <10673 9682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392159.1:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence068 598 726 gene locus_tag LOCUS_11720 598 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3144 775 gene locus_tag LOCUS_11730 3144 775 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_11730 3794 3150 gene locus_tag LOCUS_11740 3794 3150 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_11740 4651 3791 gene locus_tag LOCUS_11750 gene metF 4651 3791 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_11750 4821 5723 gene locus_tag LOCUS_11760 4821 5723 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_11760 5725 6519 gene locus_tag LOCUS_11770 gene thiD 5725 6519 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_11770 7973 6756 gene locus_tag LOCUS_11780 gene hydF 7973 6756 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_11780 9434 7986 gene locus_tag LOCUS_11790 gene hydG 9434 7986 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_11790 <10524 9507 gene locus_tag LOCUS_11800 <10524 9507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108014.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydE >Feature sequence069 1571 3277 gene locus_tag LOCUS_11810 1571 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3360 4385 gene locus_tag LOCUS_11820 gene queA 3360 4385 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_11820 4408 5550 gene locus_tag LOCUS_11830 gene tgt 4408 5550 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_11830 5625 6908 gene locus_tag LOCUS_11840 gene brnQ 5625 6908 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389948.1 protein_id gnl|my_center|LOCUS_11840 10187 7185 gene locus_tag LOCUS_11850 10187 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence070 1031 129 gene locus_tag LOCUS_11860 1031 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2631 1792 gene locus_tag LOCUS_11870 2631 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2926 3630 gene locus_tag LOCUS_11880 2926 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11880 4629 4850 gene locus_tag LOCUS_11890 4629 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5022 5207 gene locus_tag LOCUS_11900 5022 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5829 5999 gene locus_tag LOCUS_11910 5829 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6283 6639 gene locus_tag LOCUS_11920 6283 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11920 6655 7662 gene locus_tag LOCUS_11930 6655 7662 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102247.1 protein_id gnl|my_center|LOCUS_11930 7751 8746 gene locus_tag LOCUS_11940 7751 8746 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704222.1 protein_id gnl|my_center|LOCUS_11940 8874 9869 gene locus_tag LOCUS_11950 8874 9869 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708271.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence071 <1 649 gene locus_tag LOCUS_11960 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002303625.1:amino acid ABC transporter permease 662 1450 gene locus_tag LOCUS_11970 662 1450 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829838.1 protein_id gnl|my_center|LOCUS_11970 1736 2917 gene locus_tag LOCUS_11980 1736 2917 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 protein_id gnl|my_center|LOCUS_11980 3027 4472 gene locus_tag LOCUS_11990 gene abfD 3027 4472 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_11990 4577 4852 gene locus_tag LOCUS_12000 4577 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430736.1 protein_id gnl|my_center|LOCUS_12000 4897 6453 gene locus_tag LOCUS_12010 4897 6453 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_12010 6645 7835 gene locus_tag LOCUS_12020 6645 7835 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_12020 8101 8919 gene locus_tag LOCUS_12030 8101 8919 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_12030 9037 9912 gene locus_tag LOCUS_12040 9037 9912 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_12040 10298 10074 gene locus_tag LOCUS_12050 10298 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence072 58 510 gene locus_tag LOCUS_12060 gene dtd 58 510 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_12060 687 1319 gene locus_tag LOCUS_12070 687 1319 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_12070 1316 2785 gene locus_tag LOCUS_12080 1316 2785 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_12080 2832 3755 gene locus_tag LOCUS_12090 2832 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3926 4318 gene locus_tag LOCUS_12100 3926 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 4448 6028 gene locus_tag LOCUS_12110 4448 6028 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_12110 6044 6841 gene locus_tag LOCUS_12120 6044 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 6853 7134 gene locus_tag LOCUS_12130 6853 7134 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_12130 7131 7370 gene locus_tag LOCUS_12140 7131 7370 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_12140 7392 7511 gene locus_tag LOCUS_12150 7392 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7586 7870 gene locus_tag LOCUS_12160 7586 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7913 8335 gene locus_tag LOCUS_12170 7913 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 8382 8663 gene locus_tag LOCUS_12180 8382 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8697 9161 gene locus_tag LOCUS_12190 8697 9161 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence073 4143 2401 gene locus_tag LOCUS_12200 4143 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4463 4747 gene locus_tag LOCUS_12210 4463 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4751 6514 gene locus_tag LOCUS_12220 4751 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6685 6900 gene locus_tag LOCUS_12230 6685 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 7017 8813 gene locus_tag LOCUS_12240 7017 8813 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_12240 8863 9225 gene locus_tag LOCUS_12250 8863 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9222 9578 gene locus_tag LOCUS_12260 gene spoVAE 9222 9578 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_12260 9831 9643 gene locus_tag LOCUS_12270 9831 9643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence074 243 155 gene locus_tag LOCUS_t00180 243 155 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 670 323 gene locus_tag LOCUS_12280 670 323 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_12280 1527 688 gene locus_tag LOCUS_12290 1527 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3025 1799 gene locus_tag LOCUS_12300 3025 1799 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_12300 3356 3222 gene locus_tag LOCUS_12310 3356 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 4668 4498 gene locus_tag LOCUS_12320 4668 4498 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_12320 4986 5441 gene locus_tag LOCUS_12330 4986 5441 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371678.1 protein_id gnl|my_center|LOCUS_12330 5652 6197 gene locus_tag LOCUS_12340 5652 6197 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_12340 6194 7198 gene locus_tag LOCUS_12350 6194 7198 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_12350 7348 9843 gene locus_tag LOCUS_12360 7348 9843 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048366.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence075 906 1457 gene locus_tag LOCUS_12370 906 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2724 1516 gene locus_tag LOCUS_12380 2724 1516 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_12380 3688 3275 gene locus_tag LOCUS_12390 3688 3275 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_12390 4596 3688 gene locus_tag LOCUS_12400 4596 3688 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_12400 5223 4612 gene locus_tag LOCUS_12410 gene rsxA 5223 4612 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_12410 5847 5224 gene locus_tag LOCUS_12420 5847 5224 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_12420 6470 5862 gene locus_tag LOCUS_12430 6470 5862 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_12430 7487 6474 gene locus_tag LOCUS_12440 7487 6474 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_12440 8914 7502 gene locus_tag LOCUS_12450 gene rsxC 8914 7502 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence076 312 34 gene locus_tag LOCUS_12460 312 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 696 565 gene locus_tag LOCUS_12470 696 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1316 1185 gene locus_tag LOCUS_12480 1316 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1498 1313 gene locus_tag LOCUS_12490 1498 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2647 1781 gene locus_tag LOCUS_12500 2647 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2841 2659 gene locus_tag LOCUS_12510 2841 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3026 2838 gene locus_tag LOCUS_12520 3026 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2968 3135 gene locus_tag LOCUS_12530 2968 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3257 3745 gene locus_tag LOCUS_12540 3257 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 5799 5581 gene locus_tag LOCUS_12550 5799 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6368 6228 gene locus_tag LOCUS_12560 6368 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6587 6417 gene locus_tag LOCUS_12570 6587 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7302 6871 gene locus_tag LOCUS_12580 7302 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12580 8023 7721 gene locus_tag LOCUS_12590 8023 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12590 9461 7986 gene locus_tag LOCUS_12600 9461 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 >Feature sequence077 1683 1423 gene locus_tag LOCUS_12610 1683 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3085 2219 gene locus_tag LOCUS_12620 gene recF 3085 2219 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 3368 3162 gene locus_tag LOCUS_12630 3368 3162 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_12630 4470 3361 gene locus_tag LOCUS_12640 gene dnaN 4470 3361 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_12640 6174 4897 gene locus_tag LOCUS_12650 gene dnaA 6174 4897 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_12650 7864 8001 gene locus_tag LOCUS_12660 7864 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8233 8814 gene locus_tag LOCUS_12670 8233 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence078 1012 452 gene locus_tag LOCUS_12680 1012 452 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_12680 3045 1012 gene locus_tag LOCUS_12690 3045 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 3353 3042 gene locus_tag LOCUS_12700 3353 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3641 4441 gene locus_tag LOCUS_12710 gene proB 3641 4441 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_12710 4566 4880 gene locus_tag LOCUS_12720 4566 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12720 5430 5801 gene locus_tag LOCUS_12730 5430 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 5801 6406 gene locus_tag LOCUS_12740 5801 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 6578 7795 gene locus_tag LOCUS_12750 6578 7795 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_12750 7957 9453 gene locus_tag LOCUS_12760 gene putP 7957 9453 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence079 78 629 gene locus_tag LOCUS_12770 78 629 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_12770 616 1188 gene locus_tag LOCUS_12780 616 1188 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_12780 1175 2065 gene locus_tag LOCUS_12790 1175 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2090 3343 gene locus_tag LOCUS_12800 2090 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 3336 4568 gene locus_tag LOCUS_12810 3336 4568 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_12810 4871 5881 gene locus_tag LOCUS_12820 gene trpS 4871 5881 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_12820 5900 6988 gene locus_tag LOCUS_12830 5900 6988 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_12830 6981 8129 gene locus_tag LOCUS_12840 gene wecB 6981 8129 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080488.1 protein_id gnl|my_center|LOCUS_12840 8126 9061 gene locus_tag LOCUS_12850 8126 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence080 799 527 gene locus_tag LOCUS_12860 799 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3669 823 gene locus_tag LOCUS_12870 gene uvrA 3669 823 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_12870 5777 3822 gene locus_tag LOCUS_12880 gene uvrB 5777 3822 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_12880 6653 5949 gene locus_tag LOCUS_12890 gene radC 6653 5949 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_12890 7396 6797 gene locus_tag LOCUS_12900 7396 6797 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_12900 7657 8211 gene locus_tag LOCUS_12910 7657 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8208 8585 gene locus_tag LOCUS_12920 8208 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8578 9270 gene locus_tag LOCUS_12930 8578 9270 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence081 <1 1017 gene locus_tag LOCUS_12940 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948198.1:helicase-exonuclease AddAB subunit AddA 1657 3162 gene locus_tag LOCUS_12950 1657 3162 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_12950 3251 4543 gene locus_tag LOCUS_12960 3251 4543 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_12960 4664 5320 gene locus_tag LOCUS_12970 4664 5320 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_12970 5431 6819 gene locus_tag LOCUS_12980 5431 6819 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_12980 6816 7274 gene locus_tag LOCUS_12990 6816 7274 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_12990 7362 7565 gene locus_tag LOCUS_13000 gene rpmE 7362 7565 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence082 54 404 gene locus_tag LOCUS_13010 54 404 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_13010 407 1369 gene locus_tag LOCUS_13020 407 1369 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_13020 1470 2963 gene locus_tag LOCUS_13030 gene thrC 1470 2963 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_13030 2963 3664 gene locus_tag LOCUS_13040 2963 3664 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_13040 3743 5062 gene locus_tag LOCUS_13050 gene tig 3743 5062 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_13050 5228 5809 gene locus_tag LOCUS_13060 gene clpP 5228 5809 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_13060 5863 7179 gene locus_tag LOCUS_13070 gene clpX 5863 7179 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence083 351 611 gene locus_tag LOCUS_13080 351 611 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_13080 1708 1448 gene locus_tag LOCUS_13090 1708 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1814 2122 gene locus_tag LOCUS_13100 1814 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13100 2364 2546 gene locus_tag LOCUS_13110 2364 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2951 3139 gene locus_tag LOCUS_13120 2951 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 3155 4267 gene locus_tag LOCUS_13130 gene nagA 3155 4267 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_13130 4725 4369 gene locus_tag LOCUS_13140 4725 4369 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935678.1 protein_id gnl|my_center|LOCUS_13140 5737 4697 gene locus_tag LOCUS_13150 5737 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6281 6595 gene locus_tag LOCUS_13160 6281 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 6832 6756 gene locus_tag LOCUS_t00190 6832 6756 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7262 6930 gene locus_tag LOCUS_13170 7262 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7673 7597 gene locus_tag LOCUS_t00200 7673 7597 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8942 8715 gene locus_tag LOCUS_13180 8942 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence084 1101 247 gene locus_tag LOCUS_13190 1101 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13190 1687 1424 gene locus_tag LOCUS_13200 1687 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2295 2074 gene locus_tag LOCUS_13210 2295 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4896 5120 gene locus_tag LOCUS_13220 4896 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5485 5952 gene locus_tag LOCUS_13230 5485 5952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 6165 6383 gene locus_tag LOCUS_13240 6165 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7080 6712 gene locus_tag LOCUS_13250 7080 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7439 7041 gene locus_tag LOCUS_13260 7439 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7738 7436 gene locus_tag LOCUS_13270 7738 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence085 1400 498 gene locus_tag LOCUS_13280 1400 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1540 2643 gene locus_tag LOCUS_13290 gene ychF 1540 2643 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_13290 3136 3909 gene locus_tag LOCUS_13300 3136 3909 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_13300 3922 4470 gene locus_tag LOCUS_13310 3922 4470 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810955.1 protein_id gnl|my_center|LOCUS_13310 4477 4713 gene locus_tag LOCUS_13320 4477 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 6576 4951 gene locus_tag LOCUS_13330 6576 4951 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_13330 8058 6823 gene locus_tag LOCUS_13340 gene fabF 8058 6823 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_13340 8540 8280 gene locus_tag LOCUS_13350 8540 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 8800 8955 gene locus_tag LOCUS_13360 8800 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence086 598 523 gene locus_tag LOCUS_t00210 598 523 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1016 693 gene locus_tag LOCUS_13370 1016 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2360 1158 gene locus_tag LOCUS_13380 2360 1158 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948034.1 protein_id gnl|my_center|LOCUS_13380 2646 3362 gene locus_tag LOCUS_13390 2646 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13390 3851 4405 gene locus_tag LOCUS_13400 3851 4405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13400 4543 4779 gene locus_tag LOCUS_13410 4543 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13410 5376 5236 gene locus_tag LOCUS_13420 5376 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5854 5627 gene locus_tag LOCUS_13430 5854 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 5987 5796 gene locus_tag LOCUS_13440 5987 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6403 6167 gene locus_tag LOCUS_13450 6403 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 6777 6433 gene locus_tag LOCUS_13460 6777 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13460 7012 6725 gene locus_tag LOCUS_13470 7012 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13470 8364 7129 gene locus_tag LOCUS_13480 8364 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence087 <1 560 gene locus_tag LOCUS_13490 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966178.1:D-alanine--D-alanine ligase family protein 553 1350 gene locus_tag LOCUS_13500 gene murI 553 1350 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_13500 1381 1824 gene locus_tag LOCUS_13510 1381 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1865 3562 gene locus_tag LOCUS_13520 gene argS 1865 3562 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_13520 3610 5094 gene locus_tag LOCUS_13530 3610 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 5149 6180 gene locus_tag LOCUS_13540 5149 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6485 7588 gene locus_tag LOCUS_13550 gene prmA 6485 7588 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_13550 7658 8392 gene locus_tag LOCUS_13560 7658 8392 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence088 619 3003 gene locus_tag LOCUS_13570 gene feoB 619 3003 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_13570 3017 3160 gene locus_tag LOCUS_13580 3017 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3803 3258 gene locus_tag LOCUS_13590 3803 3258 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_13590 4244 3834 gene locus_tag LOCUS_13600 4244 3834 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_13600 4928 5410 gene locus_tag LOCUS_13610 4928 5410 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_13610 5407 6426 gene locus_tag LOCUS_13620 5407 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7023 6478 gene locus_tag LOCUS_13630 7023 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 8453 7176 gene locus_tag LOCUS_13640 8453 7176 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence089 1778 1143 gene locus_tag LOCUS_13650 1778 1143 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_13650 2863 1778 gene locus_tag LOCUS_13660 gene ribD 2863 1778 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284101.1 protein_id gnl|my_center|LOCUS_13660 3511 7032 gene locus_tag LOCUS_13670 gene addB 3511 7032 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence090 472 113 gene locus_tag LOCUS_13680 472 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 717 469 gene locus_tag LOCUS_13690 717 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 902 708 gene locus_tag LOCUS_13700 902 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1703 918 gene locus_tag LOCUS_13710 1703 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2021 1704 gene locus_tag LOCUS_13720 2021 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 3811 2033 gene locus_tag LOCUS_13730 3811 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 4423 3824 gene locus_tag LOCUS_13740 4423 3824 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286552.1 protein_id gnl|my_center|LOCUS_13740 4681 4427 gene locus_tag LOCUS_13750 4681 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4860 4678 gene locus_tag LOCUS_13760 4860 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4991 5593 gene locus_tag LOCUS_13770 4991 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5596 6975 gene locus_tag LOCUS_13780 5596 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7194 7119 gene locus_tag LOCUS_t00220 7194 7119 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7401 7913 gene locus_tag LOCUS_13790 7401 7913 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 >Feature sequence091 1725 406 gene locus_tag LOCUS_13800 gene eno 1725 406 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_13800 3664 1916 gene locus_tag LOCUS_13810 gene gpmI 3664 1916 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_13810 4550 3780 gene locus_tag LOCUS_13820 gene tpiA 4550 3780 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_13820 5853 4663 gene locus_tag LOCUS_13830 5853 4663 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_13830 6955 6077 gene locus_tag LOCUS_13840 6955 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7452 6967 gene locus_tag LOCUS_13850 gene trmL 7452 6967 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence092 1069 632 gene locus_tag LOCUS_13860 gene spoIIAB 1069 632 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_13860 1389 1069 gene locus_tag LOCUS_13870 gene spoIIAA 1389 1069 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398633.1 protein_id gnl|my_center|LOCUS_13870 2851 1547 gene locus_tag LOCUS_13880 2851 1547 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_13880 3475 3035 gene locus_tag LOCUS_13890 3475 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4290 3472 gene locus_tag LOCUS_13900 4290 3472 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_13900 6079 5381 gene locus_tag LOCUS_13910 gene pflA 6079 5381 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_13910 <8411 6890 gene locus_tag LOCUS_13920 <8411 6890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000195472.1:formate C-acetyltransferase >Feature sequence093 86 355 gene locus_tag LOCUS_13930 86 355 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047831.1 protein_id gnl|my_center|LOCUS_13930 514 747 gene locus_tag LOCUS_13940 514 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2371 884 gene locus_tag LOCUS_13950 gene glpK 2371 884 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_13950 2504 3136 gene locus_tag LOCUS_13960 2504 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3246 4661 gene locus_tag LOCUS_13970 3246 4661 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485281.1 protein_id gnl|my_center|LOCUS_13970 5489 4719 gene locus_tag LOCUS_13980 5489 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5707 5498 gene locus_tag LOCUS_13990 5707 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7150 5720 gene locus_tag LOCUS_14000 7150 5720 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence094 2755 1736 gene locus_tag LOCUS_14010 gene pheS 2755 1736 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_14010 3825 3640 gene locus_tag LOCUS_14020 3825 3640 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_14020 4385 3840 gene locus_tag LOCUS_14030 gene rplE 4385 3840 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_14030 4722 4405 gene locus_tag LOCUS_14040 gene rplX 4722 4405 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_14040 5106 4738 gene locus_tag LOCUS_14050 gene rplN 5106 4738 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_14050 5376 5119 gene locus_tag LOCUS_14060 gene rpsQ 5376 5119 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_14060 5598 5395 gene locus_tag LOCUS_14070 gene rpmC 5598 5395 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_14070 6020 5595 gene locus_tag LOCUS_14080 gene rplP 6020 5595 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_14080 6787 6020 gene locus_tag LOCUS_14090 gene rpsC 6787 6020 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_14090 7136 6801 gene locus_tag LOCUS_14100 gene rplV 7136 6801 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_14100 7435 7154 gene locus_tag LOCUS_14110 gene rpsS 7435 7154 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_14110 8287 7454 gene locus_tag LOCUS_14120 gene rplB 8287 7454 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence095 41 553 gene locus_tag LOCUS_14130 41 553 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263504.1 protein_id gnl|my_center|LOCUS_14130 546 1406 gene locus_tag LOCUS_14140 546 1406 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_14140 1467 1901 gene locus_tag LOCUS_14150 gene aroQ 1467 1901 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_14150 1921 2985 gene locus_tag LOCUS_14160 gene pepQ 1921 2985 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_14160 3173 3835 gene locus_tag LOCUS_14170 3173 3835 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480059.1 protein_id gnl|my_center|LOCUS_14170 5709 4996 gene locus_tag LOCUS_14180 5709 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5907 6713 gene locus_tag LOCUS_14190 5907 6713 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_14190 6725 8188 gene locus_tag LOCUS_14200 gene rmuC 6725 8188 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence096 500 2869 gene locus_tag LOCUS_14210 500 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3395 3018 gene locus_tag LOCUS_14220 3395 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5438 3525 gene locus_tag LOCUS_14230 5438 3525 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_14230 7054 5435 gene locus_tag LOCUS_14240 7054 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 <8152 6990 gene locus_tag LOCUS_14250 <8152 6990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181932.1:DUF4084 domain-containing protein >Feature sequence097 1144 458 gene locus_tag LOCUS_14260 gene queC 1144 458 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_14260 1638 1141 gene locus_tag LOCUS_14270 gene queF 1638 1141 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_14270 2159 1662 gene locus_tag LOCUS_14280 2159 1662 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_14280 2585 3328 gene locus_tag LOCUS_14290 2585 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3438 3701 gene locus_tag LOCUS_14300 3438 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5058 3859 gene locus_tag LOCUS_14310 5058 3859 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_14310 5220 6749 gene locus_tag LOCUS_14320 gene cls 5220 6749 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_14320 6768 7532 gene locus_tag LOCUS_14330 6768 7532 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_14330 7529 7984 gene locus_tag LOCUS_14340 7529 7984 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence098 342 1742 gene locus_tag LOCUS_14350 342 1742 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_14350 2649 1969 gene locus_tag LOCUS_14360 gene mocA 2649 1969 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362242.1 protein_id gnl|my_center|LOCUS_14360 2917 2576 gene locus_tag LOCUS_14370 2917 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3056 3820 gene locus_tag LOCUS_14380 3056 3820 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902983.1 protein_id gnl|my_center|LOCUS_14380 3833 4306 gene locus_tag LOCUS_14390 3833 4306 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434060.1 protein_id gnl|my_center|LOCUS_14390 4303 6738 gene locus_tag LOCUS_14400 4303 6738 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_14400 7554 6838 gene locus_tag LOCUS_14410 7554 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence099 609 788 gene locus_tag LOCUS_14420 609 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2264 1428 gene locus_tag LOCUS_14430 2264 1428 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868944.1 protein_id gnl|my_center|LOCUS_14430 2576 3985 gene locus_tag LOCUS_14440 2576 3985 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_14440 4132 5175 gene locus_tag LOCUS_14450 4132 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5265 5990 gene locus_tag LOCUS_14460 5265 5990 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_14460 6004 6696 gene locus_tag LOCUS_14470 6004 6696 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 protein_id gnl|my_center|LOCUS_14470 7113 7616 gene locus_tag LOCUS_14480 7113 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 7840 8016 gene locus_tag LOCUS_14490 7840 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence100 369 2321 gene locus_tag LOCUS_14500 gene iolD 369 2321 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_14500 2432 3223 gene locus_tag LOCUS_14510 2432 3223 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_14510 3238 4359 gene locus_tag LOCUS_14520 3238 4359 CDS product 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964882.1 protein_id gnl|my_center|LOCUS_14520 4409 5683 gene locus_tag LOCUS_14530 4409 5683 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454645.1 protein_id gnl|my_center|LOCUS_14530 5693 5983 gene locus_tag LOCUS_14540 5693 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5988 7433 gene locus_tag LOCUS_14550 gene abfD 5988 7433 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence101 402 1427 gene locus_tag LOCUS_14560 402 1427 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_14560 1866 1450 gene locus_tag LOCUS_14570 1866 1450 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_14570 1901 2083 gene locus_tag LOCUS_14580 1901 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2920 2132 gene locus_tag LOCUS_14590 2920 2132 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_14590 4667 3018 gene locus_tag LOCUS_14600 4667 3018 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087145.1 protein_id gnl|my_center|LOCUS_14600 5802 4792 gene locus_tag LOCUS_14610 gene iolG 5802 4792 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_14610 7219 6071 gene locus_tag LOCUS_14620 7219 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence102 1610 558 gene locus_tag LOCUS_14630 1610 558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_14630 2299 3219 gene locus_tag LOCUS_14640 2299 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3915 5381 gene locus_tag LOCUS_14650 gene cysS 3915 5381 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_14650 5671 7056 gene locus_tag LOCUS_14660 5671 7056 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_14660 7140 7517 gene locus_tag LOCUS_14670 7140 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence103 <1 690 gene locus_tag LOCUS_14680 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462325.1:DUF554 domain-containing protein 766 1809 gene locus_tag LOCUS_14690 766 1809 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109299.1 protein_id gnl|my_center|LOCUS_14690 3451 1922 gene locus_tag LOCUS_14700 3451 1922 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_14700 3865 4356 gene locus_tag LOCUS_14710 3865 4356 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_14710 4542 5342 gene locus_tag LOCUS_14720 4542 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 5299 5445 gene locus_tag LOCUS_14730 5299 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 <7666 5974 gene locus_tag LOCUS_14740 <7666 5974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458860.1:S-layer homology domain-containing protein >Feature sequence104 <1 1029 gene locus_tag LOCUS_14750 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966994.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 1404 3290 gene locus_tag LOCUS_14760 gene mnmG 1404 3290 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_14760 3287 3991 gene locus_tag LOCUS_14770 gene rsmG 3287 3991 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_14770 4253 5086 gene locus_tag LOCUS_14780 gene noc 4253 5086 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966991.1 protein_id gnl|my_center|LOCUS_14780 5746 6522 gene locus_tag LOCUS_14790 5746 6522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_14790 6522 7397 gene locus_tag LOCUS_14800 6522 7397 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence105 <1 559 gene locus_tag LOCUS_14810 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428267.1:D-alanyl-D-alanine carboxypeptidase family protein 711 1442 gene locus_tag LOCUS_14820 711 1442 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_14820 1574 2443 gene locus_tag LOCUS_14830 1574 2443 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_14830 2440 3669 gene locus_tag LOCUS_14840 2440 3669 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_14840 3669 4349 gene locus_tag LOCUS_14850 gene cmk 3669 4349 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_14850 4346 4591 gene locus_tag LOCUS_14860 4346 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5637 5849 gene locus_tag LOCUS_14870 5637 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5836 6057 gene locus_tag LOCUS_14880 5836 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 6222 6695 gene locus_tag LOCUS_14890 6222 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14890 >Feature sequence106 674 354 gene locus_tag LOCUS_14900 674 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 996 661 gene locus_tag LOCUS_14910 996 661 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_14910 1175 1666 gene locus_tag LOCUS_14920 1175 1666 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_14920 1787 1873 gene locus_tag LOCUS_t00230 1787 1873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1919 1994 gene locus_tag LOCUS_t00240 1919 1994 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2182 2667 gene locus_tag LOCUS_14930 gene moaC 2182 2667 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_14930 2664 3599 gene locus_tag LOCUS_14940 2664 3599 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144034111.1 protein_id gnl|my_center|LOCUS_14940 3706 4527 gene locus_tag LOCUS_14950 3706 4527 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 protein_id gnl|my_center|LOCUS_14950 4514 5833 gene locus_tag LOCUS_14960 4514 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14960 6522 6752 gene locus_tag LOCUS_14970 6522 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14970 7068 6829 gene locus_tag LOCUS_14980 7068 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence107 333 1124 gene locus_tag LOCUS_14990 gene yqeB 333 1124 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_14990 1153 2019 gene locus_tag LOCUS_15000 gene modA 1153 2019 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_15000 2081 2422 gene locus_tag LOCUS_15010 2081 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15010 3021 3788 gene locus_tag LOCUS_15020 3021 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 3794 4741 gene locus_tag LOCUS_15030 gene moaA 3794 4741 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943757.1 protein_id gnl|my_center|LOCUS_15030 4944 5378 gene locus_tag LOCUS_15040 4944 5378 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_15040 5375 6397 gene locus_tag LOCUS_15050 5375 6397 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_15050 6399 6908 gene locus_tag LOCUS_15060 gene mog 6399 6908 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence108 31 106 gene locus_tag LOCUS_t00250 31 106 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 415 107 gene locus_tag LOCUS_15070 415 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1712 654 gene locus_tag LOCUS_15080 1712 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3384 3148 gene locus_tag LOCUS_15090 3384 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4066 3800 gene locus_tag LOCUS_15100 4066 3800 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_15100 5106 4063 gene locus_tag LOCUS_15110 5106 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15110 6747 5122 gene locus_tag LOCUS_15120 6747 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15120 >Feature sequence109 401 643 gene locus_tag LOCUS_15130 401 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 4069 884 gene locus_tag LOCUS_15140 gene carB 4069 884 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_15140 5163 4069 gene locus_tag LOCUS_15150 gene carA 5163 4069 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_15150 6282 5365 gene locus_tag LOCUS_15160 gene pyrF 6282 5365 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_15160 6845 6315 gene locus_tag LOCUS_15170 gene pyrR 6845 6315 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156491.1 protein_id gnl|my_center|LOCUS_15170 7145 7327 gene locus_tag LOCUS_15180 7145 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence110 325 122 gene locus_tag LOCUS_15190 325 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2592 388 gene locus_tag LOCUS_15200 2592 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3379 2606 gene locus_tag LOCUS_15210 gene rlmB 3379 2606 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_15210 3614 4174 gene locus_tag LOCUS_15220 3614 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 5330 4236 gene locus_tag LOCUS_15230 5330 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5558 6052 gene locus_tag LOCUS_15240 5558 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6039 7040 gene locus_tag LOCUS_15250 6039 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence111 762 220 gene locus_tag LOCUS_15260 762 220 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_15260 1942 956 gene locus_tag LOCUS_15270 1942 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2934 2173 gene locus_tag LOCUS_15280 gene spo0A 2934 2173 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_15280 4341 3334 gene locus_tag LOCUS_15290 gene spoIVB 4341 3334 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_15290 5149 4520 gene locus_tag LOCUS_15300 5149 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6013 5240 gene locus_tag LOCUS_15310 6013 5240 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_15310 6451 6098 gene locus_tag LOCUS_15320 6451 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence112 1173 592 gene locus_tag LOCUS_15330 1173 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1663 1166 gene locus_tag LOCUS_15340 1663 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3245 1653 gene locus_tag LOCUS_15350 3245 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3616 3245 gene locus_tag LOCUS_15360 3616 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 <7265 3616 gene locus_tag LOCUS_15370 <7265 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989949.1:tape measure protein >Feature sequence113 428 87 gene locus_tag LOCUS_15380 428 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 640 425 gene locus_tag LOCUS_15390 640 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 846 643 gene locus_tag LOCUS_15400 846 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1753 839 gene locus_tag LOCUS_15410 1753 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2608 1868 gene locus_tag LOCUS_15420 2608 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475630.1 protein_id gnl|my_center|LOCUS_15420 3004 2630 gene locus_tag LOCUS_15430 3004 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3143 2997 gene locus_tag LOCUS_15440 3143 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3857 3156 gene locus_tag LOCUS_15450 3857 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4504 3854 gene locus_tag LOCUS_15460 4504 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 6414 4501 gene locus_tag LOCUS_15470 6414 4501 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_15470 6630 6487 gene locus_tag LOCUS_15480 6630 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 6810 6631 gene locus_tag LOCUS_15490 6810 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7076 6807 gene locus_tag LOCUS_15500 7076 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence114 2448 232 gene locus_tag LOCUS_15510 gene gyrA 2448 232 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_15510 3454 2411 gene locus_tag LOCUS_15520 3454 2411 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395264.1 protein_id gnl|my_center|LOCUS_15520 5472 3478 gene locus_tag LOCUS_15530 gene gyrB 5472 3478 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_15530 6647 6117 gene locus_tag LOCUS_15540 6647 6117 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence115 1603 260 gene locus_tag LOCUS_15550 1603 260 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_15550 2049 1624 gene locus_tag LOCUS_15560 gene fabZ 2049 1624 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_15560 2749 2279 gene locus_tag LOCUS_15570 2749 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3981 2752 gene locus_tag LOCUS_15580 gene fabF 3981 2752 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_15580 4970 4242 gene locus_tag LOCUS_15590 gene fabG 4970 4242 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_15590 5981 5034 gene locus_tag LOCUS_15600 gene fabK 5981 5034 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_15600 7115 6126 gene locus_tag LOCUS_15610 7115 6126 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence116 1864 212 gene locus_tag LOCUS_15620 1864 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3142 1886 gene locus_tag LOCUS_15630 3142 1886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_15630 4017 3139 gene locus_tag LOCUS_15640 4017 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 5950 4031 gene locus_tag LOCUS_15650 5950 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 6540 6806 gene locus_tag LOCUS_15660 6540 6806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence117 1489 596 gene locus_tag LOCUS_15670 1489 596 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810614.1 protein_id gnl|my_center|LOCUS_15670 2306 1593 gene locus_tag LOCUS_15680 2306 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2565 3830 gene locus_tag LOCUS_15690 2565 3830 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_15690 3916 5022 gene locus_tag LOCUS_15700 3916 5022 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_15700 5036 6013 gene locus_tag LOCUS_15710 5036 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 6952 6095 gene locus_tag LOCUS_15720 6952 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence118 701 1324 gene locus_tag LOCUS_15730 701 1324 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_15730 1543 1364 gene locus_tag LOCUS_15740 1543 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3716 1560 gene locus_tag LOCUS_15750 3716 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4050 3745 gene locus_tag LOCUS_15760 4050 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 4517 5089 gene locus_tag LOCUS_15770 4517 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5766 5302 gene locus_tag LOCUS_15780 5766 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5823 6149 gene locus_tag LOCUS_15790 5823 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6539 6736 gene locus_tag LOCUS_15800 6539 6736 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence119 1256 1933 gene locus_tag LOCUS_15810 1256 1933 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_15810 1930 2268 gene locus_tag LOCUS_15820 1930 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2796 2464 gene locus_tag LOCUS_15830 2796 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4359 4186 gene locus_tag LOCUS_15840 4359 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4619 4413 gene locus_tag LOCUS_15850 4619 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4763 5500 gene locus_tag LOCUS_15860 4763 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 6786 6079 gene locus_tag LOCUS_15870 6786 6079 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15870 >Feature sequence120 1045 551 gene locus_tag LOCUS_15880 1045 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2523 1144 gene locus_tag LOCUS_15890 gene scfB 2523 1144 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048084.1 protein_id gnl|my_center|LOCUS_15890 2737 2594 gene locus_tag LOCUS_15900 gene scfA 2737 2594 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15900 3166 2750 gene locus_tag LOCUS_15910 3166 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3580 3227 gene locus_tag LOCUS_15920 gene yajC 3580 3227 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_15920 3750 4457 gene locus_tag LOCUS_15930 gene sigK 3750 4457 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428359.1 protein_id gnl|my_center|LOCUS_15930 4591 4664 gene locus_tag LOCUS_t00260 4591 4664 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4790 5254 gene locus_tag LOCUS_15940 4790 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5376 6599 gene locus_tag LOCUS_15950 5376 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15950 >Feature sequence121 802 727 gene locus_tag LOCUS_t00270 802 727 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2428 902 gene locus_tag LOCUS_15960 2428 902 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_15960 3105 2425 gene locus_tag LOCUS_15970 3105 2425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965730.1 protein_id gnl|my_center|LOCUS_15970 <6756 3582 gene locus_tag LOCUS_15980 <6756 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461151.1:M56 family metallopeptidase >Feature sequence122 514 756 gene locus_tag LOCUS_15990 514 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 743 2287 gene locus_tag LOCUS_16000 743 2287 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_16000 2396 3136 gene locus_tag LOCUS_16010 2396 3136 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_16010 3133 4059 gene locus_tag LOCUS_16020 gene glcK 3133 4059 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_16020 <6539 4738 gene locus_tag LOCUS_16030 <6539 4738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084053047.1:S-layer homology domain-containing protein >Feature sequence123 2012 1461 gene locus_tag LOCUS_16040 2012 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3554 2115 gene locus_tag LOCUS_16050 3554 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4642 3920 gene locus_tag LOCUS_16060 4642 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 5425 4847 gene locus_tag LOCUS_16070 5425 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 5795 5592 gene locus_tag LOCUS_16080 5795 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16080 6437 6267 gene locus_tag LOCUS_16090 6437 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence124 <1 696 gene locus_tag LOCUS_16100 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385464.1:ribokinase 744 932 gene locus_tag LOCUS_16110 744 932 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943805.1 protein_id gnl|my_center|LOCUS_16110 1165 2184 gene locus_tag LOCUS_16120 1165 2184 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536378.1 protein_id gnl|my_center|LOCUS_16120 2317 2499 gene locus_tag LOCUS_16130 2317 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2496 3347 gene locus_tag LOCUS_16140 2496 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 5836 3545 gene locus_tag LOCUS_16150 5836 3545 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_16150 5909 6202 gene locus_tag LOCUS_16160 5909 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence125 1067 312 gene locus_tag LOCUS_16170 1067 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1964 1068 gene locus_tag LOCUS_16180 gene era 1964 1068 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_16180 2561 2094 gene locus_tag LOCUS_16190 2561 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3056 2565 gene locus_tag LOCUS_16200 gene ybeY 3056 2565 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047996.1 protein_id gnl|my_center|LOCUS_16200 4204 3056 gene locus_tag LOCUS_16210 4204 3056 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16210 4940 4758 gene locus_tag LOCUS_16220 4940 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6184 4961 gene locus_tag LOCUS_16230 6184 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence126 492 241 gene locus_tag LOCUS_16240 492 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 899 705 gene locus_tag LOCUS_16250 899 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1431 913 gene locus_tag LOCUS_16260 1431 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2321 1425 gene locus_tag LOCUS_16270 gene spoIIIAA 2321 1425 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358945.1 protein_id gnl|my_center|LOCUS_16270 3088 4104 gene locus_tag LOCUS_16280 gene aroF 3088 4104 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_16280 4244 5428 gene locus_tag LOCUS_16290 gene aroB 4244 5428 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147236.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence127 746 333 gene locus_tag LOCUS_16300 746 333 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_16300 2884 950 gene locus_tag LOCUS_16310 gene metG 2884 950 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_16310 3726 5237 gene locus_tag LOCUS_16320 3726 5237 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence128 152 943 gene locus_tag LOCUS_16330 152 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1109 1432 gene locus_tag LOCUS_16340 1109 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2562 1483 gene locus_tag LOCUS_16350 2562 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2955 3983 gene locus_tag LOCUS_16360 gene gap 2955 3983 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_16360 4148 4582 gene locus_tag LOCUS_16370 4148 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4584 5360 gene locus_tag LOCUS_16380 4584 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 5499 5335 gene locus_tag LOCUS_16390 5499 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5852 5755 gene locus_tag LOCUS_r00010 5852 5755 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6010 5936 gene locus_tag LOCUS_t00280 6010 5936 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6155 6080 gene locus_tag LOCUS_t00290 6155 6080 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 36 2423 gene locus_tag LOCUS_16400 36 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2817 3542 gene locus_tag LOCUS_16410 gene sigI 2817 3542 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002082432.1 protein_id gnl|my_center|LOCUS_16410 3530 4207 gene locus_tag LOCUS_16420 3530 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence130 59 1060 gene locus_tag LOCUS_16430 59 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1620 1105 gene locus_tag LOCUS_16440 1620 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2181 1726 gene locus_tag LOCUS_16450 2181 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3507 2242 gene locus_tag LOCUS_16460 3507 2242 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_16460 3650 4150 gene locus_tag LOCUS_16470 3650 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4196 4402 gene locus_tag LOCUS_16480 4196 4402 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382327.1 protein_id gnl|my_center|LOCUS_16480 4402 5736 gene locus_tag LOCUS_16490 4402 5736 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence131 35 304 gene locus_tag LOCUS_16500 35 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 371 721 gene locus_tag LOCUS_16510 371 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1397 1933 gene locus_tag LOCUS_16520 1397 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1920 3596 gene locus_tag LOCUS_16530 1920 3596 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296487.1 protein_id gnl|my_center|LOCUS_16530 3610 4842 gene locus_tag LOCUS_16540 3610 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4839 5429 gene locus_tag LOCUS_16550 4839 5429 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687903.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence132 24 635 gene locus_tag LOCUS_16560 24 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1764 916 gene locus_tag LOCUS_16570 1764 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 1915 3624 gene locus_tag LOCUS_16580 1915 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3828 5015 gene locus_tag LOCUS_16590 3828 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5102 5192 gene locus_tag LOCUS_t00300 5102 5192 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5790 5874 gene locus_tag LOCUS_t00310 5790 5874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 1028 456 gene locus_tag LOCUS_16600 1028 456 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681165.1 protein_id gnl|my_center|LOCUS_16600 2545 1394 gene locus_tag LOCUS_16610 2545 1394 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_16610 2947 2561 gene locus_tag LOCUS_16620 2947 2561 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_16620 3291 2962 gene locus_tag LOCUS_16630 3291 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4670 3294 gene locus_tag LOCUS_16640 4670 3294 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_16640 4918 4994 gene locus_tag LOCUS_t00320 4918 4994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5272 5571 gene locus_tag LOCUS_16650 5272 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 5564 5791 gene locus_tag LOCUS_16660 5564 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence134 525 1316 gene locus_tag LOCUS_16670 525 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1536 2633 gene locus_tag LOCUS_16680 1536 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2659 3894 gene locus_tag LOCUS_16690 gene codB 2659 3894 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063403.1 protein_id gnl|my_center|LOCUS_16690 4279 4455 gene locus_tag LOCUS_16700 4279 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 <5559 4779 gene locus_tag LOCUS_16710 <5559 4779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054278179.1:site-specific integrase >Feature sequence135 1159 527 gene locus_tag LOCUS_16720 1159 527 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_16720 1293 1171 gene locus_tag LOCUS_16730 1293 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1530 1312 gene locus_tag LOCUS_16740 1530 1312 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760147.1 protein_id gnl|my_center|LOCUS_16740 1956 2801 gene locus_tag LOCUS_16750 1956 2801 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700996.1 protein_id gnl|my_center|LOCUS_16750 2903 3760 gene locus_tag LOCUS_16760 2903 3760 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_16760 4561 3818 gene locus_tag LOCUS_16770 4561 3818 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence136 754 1140 gene locus_tag LOCUS_16780 754 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1257 3650 gene locus_tag LOCUS_16790 1257 3650 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_16790 3890 4153 gene locus_tag LOCUS_16800 3890 4153 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence137 643 434 gene locus_tag LOCUS_16810 643 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2867 1107 gene locus_tag LOCUS_16820 2867 1107 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_16820 4693 2861 gene locus_tag LOCUS_16830 4693 2861 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence138 2030 864 gene locus_tag LOCUS_16840 2030 864 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_16840 2311 2027 gene locus_tag LOCUS_16850 2311 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3440 2511 gene locus_tag LOCUS_16860 3440 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4146 3565 gene locus_tag LOCUS_16870 4146 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4294 4884 gene locus_tag LOCUS_16880 4294 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence139 2376 406 gene locus_tag LOCUS_16890 gene iolD 2376 406 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_16890 2947 2702 gene locus_tag LOCUS_16900 2947 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3627 2854 gene locus_tag LOCUS_16910 3627 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3997 4878 gene locus_tag LOCUS_16920 3997 4878 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074572.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence140 193 333 gene locus_tag LOCUS_16930 193 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 446 1630 gene locus_tag LOCUS_16940 446 1630 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_16940 1805 2089 gene locus_tag LOCUS_16950 1805 2089 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_16950 2110 3735 gene locus_tag LOCUS_16960 gene groL 2110 3735 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_16960 5303 4065 gene locus_tag LOCUS_16970 5303 4065 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294099.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence141 1379 2476 gene locus_tag LOCUS_16980 1379 2476 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_16980 2476 3981 gene locus_tag LOCUS_16990 2476 3981 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_16990 4001 4729 gene locus_tag LOCUS_17000 4001 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence142 739 1419 gene locus_tag LOCUS_17010 gene tsaA 739 1419 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_17010 3400 1526 gene locus_tag LOCUS_17020 3400 1526 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_17020 4518 3730 gene locus_tag LOCUS_17030 4518 3730 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence143 312 169 gene locus_tag LOCUS_17040 312 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3697 3284 gene locus_tag LOCUS_17050 3697 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17050 3963 3700 gene locus_tag LOCUS_17060 3963 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4181 4106 gene locus_tag LOCUS_t00330 4181 4106 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4336 4263 gene locus_tag LOCUS_t00340 4336 4263 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 246 1163 gene locus_tag LOCUS_17070 gene fabD 246 1163 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_17070 1784 1221 gene locus_tag LOCUS_17080 1784 1221 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_17080 2643 4013 gene locus_tag LOCUS_17090 2643 4013 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964280.1 protein_id gnl|my_center|LOCUS_17090 4027 4761 gene locus_tag LOCUS_17100 4027 4761 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948177.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence145 <1 599 gene locus_tag LOCUS_17110 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047820.1:tyrosine-type recombinase/integrase 618 977 gene locus_tag LOCUS_17120 618 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 977 1114 gene locus_tag LOCUS_17130 977 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1136 1378 gene locus_tag LOCUS_17140 1136 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1392 1715 gene locus_tag LOCUS_17150 1392 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1726 1995 gene locus_tag LOCUS_17160 1726 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2039 2824 gene locus_tag LOCUS_17170 2039 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence146 1067 2803 gene locus_tag LOCUS_17180 1067 2803 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_17180 4029 2953 gene locus_tag LOCUS_17190 gene leuB 4029 2953 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_17190 4525 4034 gene locus_tag LOCUS_17200 gene leuD 4525 4034 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_17200 <5095 4543 gene locus_tag LOCUS_17210 <5095 4543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966450.1:3-isopropylmalate dehydratase large subunit >Feature sequence147 790 2151 gene locus_tag LOCUS_17220 gene murD 790 2151 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_17220 3924 2614 gene locus_tag LOCUS_17230 3924 2614 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_17230 4702 4079 gene locus_tag LOCUS_17240 4702 4079 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence148 1985 435 gene locus_tag LOCUS_17250 1985 435 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_17250 3227 2538 gene locus_tag LOCUS_17260 3227 2538 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_17260 4629 3295 gene locus_tag LOCUS_17270 4629 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence149 568 756 gene locus_tag LOCUS_17280 568 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1062 2885 gene locus_tag LOCUS_17290 1062 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3274 3077 gene locus_tag LOCUS_17300 3274 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3890 3204 gene locus_tag LOCUS_17310 3890 3204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_17310 4966 3887 gene locus_tag LOCUS_17320 4966 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence150 244 1689 gene locus_tag LOCUS_17330 244 1689 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_17330 1751 2074 gene locus_tag LOCUS_17340 1751 2074 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_17340 2071 2952 gene locus_tag LOCUS_17350 2071 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2982 4115 gene locus_tag LOCUS_17360 2982 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 <5005 4225 gene locus_tag LOCUS_17370 <5005 4225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054278179.1:site-specific integrase >Feature sequence151 1928 525 gene locus_tag LOCUS_17380 1928 525 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366303.1 protein_id gnl|my_center|LOCUS_17380 3614 2664 gene locus_tag LOCUS_17390 3614 2664 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209812.1 protein_id gnl|my_center|LOCUS_17390 4071 3607 gene locus_tag LOCUS_17400 4071 3607 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence152 <1 1018 gene locus_tag LOCUS_17410 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048020.1:LCP family protein 1086 1451 gene locus_tag LOCUS_17420 gene rsfS 1086 1451 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_17420 1537 3945 gene locus_tag LOCUS_17430 gene leuS 1537 3945 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_17430 4116 4298 gene locus_tag LOCUS_17440 4116 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence153 3 275 gene locus_tag LOCUS_17450 3 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 397 1023 gene locus_tag LOCUS_17460 397 1023 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_17460 1478 1568 gene locus_tag LOCUS_t00350 1478 1568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1923 2888 gene locus_tag LOCUS_17470 1923 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2946 4037 gene locus_tag LOCUS_17480 2946 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence154 783 1550 gene locus_tag LOCUS_17490 783 1550 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_17490 2011 1595 gene locus_tag LOCUS_17500 2011 1595 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_17500 <4849 2220 gene locus_tag LOCUS_17510 <4849 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272602.1:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence155 147 1829 gene locus_tag LOCUS_17520 147 1829 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_17520 2103 2969 gene locus_tag LOCUS_17530 2103 2969 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287872.1 protein_id gnl|my_center|LOCUS_17530 2966 3811 gene locus_tag LOCUS_17540 gene panB 2966 3811 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_17540 3832 4680 gene locus_tag LOCUS_17550 gene panC 3832 4680 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence156 530 1018 gene locus_tag LOCUS_17560 530 1018 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_17560 1042 1680 gene locus_tag LOCUS_17570 gene pth 1042 1680 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_17570 1694 2110 gene locus_tag LOCUS_17580 1694 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2127 2717 gene locus_tag LOCUS_17590 2127 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3795 3538 gene locus_tag LOCUS_17600 3795 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence157 681 1856 gene locus_tag LOCUS_17610 681 1856 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_17610 1856 2389 gene locus_tag LOCUS_17620 1856 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2390 3640 gene locus_tag LOCUS_17630 gene purD 2390 3640 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_17630 3767 4291 gene locus_tag LOCUS_17640 3767 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence158 2047 707 gene locus_tag LOCUS_17650 2047 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2254 3630 gene locus_tag LOCUS_17660 2254 3630 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence159 <1 543 gene locus_tag LOCUS_17670 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013583026.1:alpha/beta hydrolase 546 1040 gene locus_tag LOCUS_17680 546 1040 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_17680 1179 1487 gene locus_tag LOCUS_17690 1179 1487 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_17690 1481 1822 gene locus_tag LOCUS_17700 1481 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3375 2833 gene locus_tag LOCUS_17710 3375 2833 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_17710 3842 3441 gene locus_tag LOCUS_17720 3842 3441 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 protein_id gnl|my_center|LOCUS_17720 4414 3845 gene locus_tag LOCUS_17730 4414 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence160 <1 667 gene locus_tag LOCUS_17740 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970101.1:AraC family transcriptional regulator 737 2959 gene locus_tag LOCUS_17750 737 2959 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_17750 2963 4015 gene locus_tag LOCUS_17760 2963 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4012 4623 gene locus_tag LOCUS_17770 4012 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence161 2159 1314 gene locus_tag LOCUS_17780 gene dapF 2159 1314 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_17780 2908 2336 gene locus_tag LOCUS_17790 2908 2336 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_17790 4265 2946 gene locus_tag LOCUS_17800 gene glnA 4265 2946 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence162 1705 1079 gene locus_tag LOCUS_17810 1705 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2945 1692 gene locus_tag LOCUS_17820 2945 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3982 3206 gene locus_tag LOCUS_17830 gene truA 3982 3206 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence163 <1 856 gene locus_tag LOCUS_17840 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392075.1:rod shape-determining protein MreC 860 1372 gene locus_tag LOCUS_17850 860 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1399 3735 gene locus_tag LOCUS_17860 1399 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence164 899 2521 gene locus_tag LOCUS_17870 gene uxuB 899 2521 CDS product D-mannonate dehydrogenase UxuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082564.1 protein_id gnl|my_center|LOCUS_17870 4459 3164 gene locus_tag LOCUS_17880 4459 3164 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence165 16 1002 gene locus_tag LOCUS_17890 16 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2805 1111 gene locus_tag LOCUS_17900 2805 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2950 3906 gene locus_tag LOCUS_17910 2950 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence166 1493 693 gene locus_tag LOCUS_17920 1493 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2834 1500 gene locus_tag LOCUS_17930 gene rimO 2834 1500 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_17930 3372 3001 gene locus_tag LOCUS_17940 gene rplL 3372 3001 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_17940 4018 3452 gene locus_tag LOCUS_17950 gene rplJ 4018 3452 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence167 2173 1355 gene locus_tag LOCUS_17960 2173 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 3718 2183 gene locus_tag LOCUS_17970 3718 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence168 9 83 gene locus_tag LOCUS_t00360 9 83 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 246 343 gene locus_tag LOCUS_r00020 246 343 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 485 2008 gene locus_tag LOCUS_17980 485 2008 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_17980 2001 2705 gene locus_tag LOCUS_17990 2001 2705 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_17990 2963 4147 gene locus_tag LOCUS_18000 2963 4147 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence169 906 211 gene locus_tag LOCUS_18010 906 211 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_18010 1930 2598 gene locus_tag LOCUS_18020 1930 2598 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_18020 2625 3989 gene locus_tag LOCUS_18030 gene pepV 2625 3989 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence170 1532 516 gene locus_tag LOCUS_18040 gene iolG 1532 516 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_18040 3461 1845 gene locus_tag LOCUS_18050 3461 1845 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087114.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence171 153 791 gene locus_tag LOCUS_18060 153 791 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_18060 795 1508 gene locus_tag LOCUS_18070 gene scpA 795 1508 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_18070 1492 2130 gene locus_tag LOCUS_18080 gene scpB 1492 2130 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_18080 2137 2769 gene locus_tag LOCUS_18090 2137 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2802 3242 gene locus_tag LOCUS_18100 gene ytfJ 2802 3242 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350003.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence172 1938 1006 gene locus_tag LOCUS_18110 gene tsf 1938 1006 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_18110 2783 2058 gene locus_tag LOCUS_18120 gene rpsB 2783 2058 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_18120 3141 4001 gene locus_tag LOCUS_18130 3141 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence173 598 212 gene locus_tag LOCUS_18140 598 212 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937263.1 protein_id gnl|my_center|LOCUS_18140 2529 703 gene locus_tag LOCUS_18150 gene typA 2529 703 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393394.1 protein_id gnl|my_center|LOCUS_18150 2763 3872 gene locus_tag LOCUS_18160 2763 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence174 3097 1703 gene locus_tag LOCUS_18170 3097 1703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence175 124 477 gene locus_tag LOCUS_18180 124 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 478 657 gene locus_tag LOCUS_18190 478 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 644 850 gene locus_tag LOCUS_18200 644 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1225 1536 gene locus_tag LOCUS_18210 1225 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1554 1823 gene locus_tag LOCUS_18220 1554 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1870 3216 gene locus_tag LOCUS_18230 1870 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3534 3271 gene locus_tag LOCUS_18240 3534 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3823 3738 gene locus_tag LOCUS_t00370 3823 3738 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3930 3846 gene locus_tag LOCUS_t00380 3930 3846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 322 1341 gene locus_tag LOCUS_18250 gene iolG 322 1341 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_18250 1446 2828 gene locus_tag LOCUS_18260 1446 2828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_18260 2842 3675 gene locus_tag LOCUS_18270 gene iolI 2842 3675 CDS product 2-keto-myo-inositol isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244546.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence177 136 1251 gene locus_tag LOCUS_18280 136 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1834 1610 gene locus_tag LOCUS_18290 1834 1610 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_18290 2658 1840 gene locus_tag LOCUS_18300 2658 1840 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048421.1 protein_id gnl|my_center|LOCUS_18300 3667 2651 gene locus_tag LOCUS_18310 gene accD 3667 2651 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773830.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence178 19 2532 gene locus_tag LOCUS_18320 19 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2564 2719 gene locus_tag LOCUS_18330 2564 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence179 854 231 gene locus_tag LOCUS_18340 gene rplD 854 231 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_18340 1571 873 gene locus_tag LOCUS_18350 gene rplC 1571 873 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_18350 2006 1695 gene locus_tag LOCUS_18360 gene rpsJ 2006 1695 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_18360 3468 2509 gene locus_tag LOCUS_18370 3468 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence180 537 962 gene locus_tag LOCUS_18380 537 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 959 1681 gene locus_tag LOCUS_18390 gene tsaB 959 1681 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_18390 1861 2490 gene locus_tag LOCUS_18400 gene upp 1861 2490 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_18400 2566 2931 gene locus_tag LOCUS_18410 2566 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3003 3587 gene locus_tag LOCUS_18420 3003 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence181 <1 1093 gene locus_tag LOCUS_18430 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816732.1:biosynthetic-type acetolactate synthase large subunit 1107 1583 gene locus_tag LOCUS_18440 gene ilvN 1107 1583 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_18440 1737 2732 gene locus_tag LOCUS_18450 gene ilvC 1737 2732 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence182 1066 134 gene locus_tag LOCUS_18460 gene gluQRS 1066 134 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_18460 1401 1072 gene locus_tag LOCUS_18470 1401 1072 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_18470 2054 1401 gene locus_tag LOCUS_18480 2054 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2361 2600 gene locus_tag LOCUS_18490 2361 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2522 2830 gene locus_tag LOCUS_18500 2522 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3295 3504 gene locus_tag LOCUS_18510 3295 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence183 <1 613 gene locus_tag LOCUS_18520 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966206.1:sulfur carrier protein ThiS adenylyltransferase ThiF 1079 666 gene locus_tag LOCUS_18530 gene mscL 1079 666 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_18530 1158 1922 gene locus_tag LOCUS_18540 1158 1922 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_18540 1972 3162 gene locus_tag LOCUS_18550 gene thiH 1972 3162 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence184 1332 439 gene locus_tag LOCUS_18560 1332 439 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_18560 2576 1449 gene locus_tag LOCUS_18570 2576 1449 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 protein_id gnl|my_center|LOCUS_18570 <3726 3191 gene locus_tag LOCUS_18580 <3726 3191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889106.1:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase >Feature sequence185 1080 316 gene locus_tag LOCUS_18590 gene speD 1080 316 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_18590 1868 2551 gene locus_tag LOCUS_18600 1868 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence186 1555 917 gene locus_tag LOCUS_18610 gene nth 1555 917 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_18610 1799 3040 gene locus_tag LOCUS_18620 1799 3040 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence187 717 2342 gene locus_tag LOCUS_18630 717 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2357 2710 gene locus_tag LOCUS_18640 2357 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 2710 3309 gene locus_tag LOCUS_18650 gene recR 2710 3309 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence188 358 1275 gene locus_tag LOCUS_18660 358 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1396 2463 gene locus_tag LOCUS_18670 1396 2463 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_18670 2595 3548 gene locus_tag LOCUS_18680 2595 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence189 2093 1416 gene locus_tag LOCUS_18690 2093 1416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_18690 3032 2241 gene locus_tag LOCUS_18700 3032 2241 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence190 1010 210 gene locus_tag LOCUS_18710 gene pgeF 1010 210 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_18710 1518 2546 gene locus_tag LOCUS_18720 1518 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18720 2525 3061 gene locus_tag LOCUS_18730 2525 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18730 3609 3118 gene locus_tag LOCUS_18740 3609 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence191 1918 884 gene locus_tag LOCUS_18750 1918 884 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_18750 3267 2116 gene locus_tag LOCUS_18760 3267 2116 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence192 <1 895 gene locus_tag LOCUS_18770 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815132.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 907 1929 gene locus_tag LOCUS_18780 907 1929 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence193 1023 1373 gene locus_tag LOCUS_18790 1023 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2479 1565 gene locus_tag LOCUS_18800 2479 1565 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368532.1 protein_id gnl|my_center|LOCUS_18800 2663 3529 gene locus_tag LOCUS_18810 2663 3529 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811435.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence194 <1 516 gene locus_tag LOCUS_18820 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861247.1:DUF1836 domain-containing protein 522 998 gene locus_tag LOCUS_18830 522 998 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_18830 1100 1717 gene locus_tag LOCUS_18840 1100 1717 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_18840 1751 2305 gene locus_tag LOCUS_18850 1751 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2327 2959 gene locus_tag LOCUS_18860 gene thiE 2327 2959 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence195 549 1301 gene locus_tag LOCUS_18870 549 1301 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_18870 1307 2077 gene locus_tag LOCUS_18880 gene thyX 1307 2077 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_18880 2146 3012 gene locus_tag LOCUS_18890 2146 3012 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence196 2507 522 gene locus_tag LOCUS_18900 gene recQ 2507 522 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_18900 2683 2531 gene locus_tag LOCUS_18910 2683 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence197 <1 945 gene locus_tag LOCUS_18920 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357703.1:phenylalanine--tRNA ligase subunit beta 2829 1000 gene locus_tag LOCUS_18930 2829 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence198 862 635 gene locus_tag LOCUS_18940 862 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1234 2436 gene locus_tag LOCUS_18950 1234 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence199 17 904 gene locus_tag LOCUS_18960 gene cas7c 17 904 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_18960 985 1554 gene locus_tag LOCUS_18970 gene cas4 985 1554 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_18970 1551 2582 gene locus_tag LOCUS_18980 gene cas1c 1551 2582 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_18980 2592 2882 gene locus_tag LOCUS_18990 gene cas2 2592 2882 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_18990 3069 >3292 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctcccttcgcgggagcgtggattgaaat >Feature sequence200 501 307 gene locus_tag LOCUS_19000 gene thiS 501 307 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_19000 775 2130 gene locus_tag LOCUS_19010 775 2130 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_19010 3204 2164 gene locus_tag LOCUS_19020 3204 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816022.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence201 2637 1273 gene locus_tag LOCUS_19030 2637 1273 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_19030 <3227 2631 gene locus_tag LOCUS_19040 <3227 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010819485.1:phage terminase large subunit >Feature sequence202 195 16 gene locus_tag LOCUS_19050 195 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 397 957 gene locus_tag LOCUS_19060 397 957 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_19060 965 1669 gene locus_tag LOCUS_19070 965 1669 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902869.1 protein_id gnl|my_center|LOCUS_19070 1695 1949 gene locus_tag LOCUS_19080 1695 1949 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_19080 2653 1994 gene locus_tag LOCUS_19090 2653 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3164 2763 gene locus_tag LOCUS_19100 gene mutT 3164 2763 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence203 2741 1272 gene locus_tag LOCUS_19110 gene gatA 2741 1272 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_19110 3044 2757 gene locus_tag LOCUS_19120 gene gatC 3044 2757 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034582121.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence204 9 1343 gene locus_tag LOCUS_19130 9 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1751 1479 gene locus_tag LOCUS_19140 gene rpsR 1751 1479 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_19140 2264 1773 gene locus_tag LOCUS_19150 2264 1773 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131953.1 protein_id gnl|my_center|LOCUS_19150 2575 2279 gene locus_tag LOCUS_19160 gene rpsF 2575 2279 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_19160 2762 2837 gene locus_tag LOCUS_t00390 2762 2837 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence205 1809 31 gene locus_tag LOCUS_19170 1809 31 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_19170 2598 1822 gene locus_tag LOCUS_19180 2598 1822 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 protein_id gnl|my_center|LOCUS_19180 <3153 2595 gene locus_tag LOCUS_19190 <3153 2595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166854628.1:tRNA (adenine(22)-N(1))-methyltransferase TrmK >Feature sequence206 1042 1812 gene locus_tag LOCUS_19200 1042 1812 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_19200 1838 2647 gene locus_tag LOCUS_19210 gene licT 1838 2647 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence207 68 790 gene locus_tag LOCUS_19220 gene pyrH 68 790 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_19220 790 1344 gene locus_tag LOCUS_19230 gene frr 790 1344 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_19230 1642 2391 gene locus_tag LOCUS_19240 1642 2391 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence208 652 948 gene locus_tag LOCUS_19250 652 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1020 2378 gene locus_tag LOCUS_19260 1020 2378 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903185.1 protein_id gnl|my_center|LOCUS_19260 2993 2442 gene locus_tag LOCUS_19270 2993 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence209 322 789 gene locus_tag LOCUS_19280 gene recX 322 789 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294863.1 protein_id gnl|my_center|LOCUS_19280 917 2716 gene locus_tag LOCUS_19290 gene pepF 917 2716 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_19290 2962 2840 gene locus_tag LOCUS_19300 2962 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence210 952 14 gene locus_tag LOCUS_19310 952 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2050 956 gene locus_tag LOCUS_19320 2050 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2368 2081 gene locus_tag LOCUS_19330 2368 2081 CDS product DUF960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002501910.1 protein_id gnl|my_center|LOCUS_19330 <3105 2503 gene locus_tag LOCUS_19340 <3105 2503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084053047.1:S-layer homology domain-containing protein >Feature sequence211 <1 1119 gene locus_tag LOCUS_19350 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142972.1:M56 family metallopeptidase 1332 1257 gene locus_tag LOCUS_t00400 1332 1257 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1938 1375 gene locus_tag LOCUS_19360 gene efp 1938 1375 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_19360 <3043 2527 gene locus_tag LOCUS_19370 <3043 2527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943204.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence212 112 1383 gene locus_tag LOCUS_19380 gene aroA 112 1383 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_19380 1387 2772 gene locus_tag LOCUS_19390 1387 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence213 284 976 gene locus_tag LOCUS_19400 284 976 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence214 <1 2243 gene locus_tag LOCUS_19410 <1 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase <2939 2403 gene locus_tag LOCUS_19420 <2939 2403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017171.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence215 1268 1044 gene locus_tag LOCUS_19430 1268 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence216 1710 382 gene locus_tag LOCUS_19440 1710 382 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_19440 2298 2041 gene locus_tag LOCUS_19450 2298 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2404 2285 gene locus_tag LOCUS_19460 2404 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence217 300 1022 gene locus_tag LOCUS_19470 300 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2431 1064 gene locus_tag LOCUS_19480 2431 1064 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence218 2235 868 gene locus_tag LOCUS_19490 2235 868 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence219 1198 434 gene locus_tag LOCUS_19500 gene dapB 1198 434 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_19500 2104 1214 gene locus_tag LOCUS_19510 gene dapA 2104 1214 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_19510 <2739 2123 gene locus_tag LOCUS_19520 <2739 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963889.1:aspartate-semialdehyde dehydrogenase >Feature sequence220 <1 858 gene locus_tag LOCUS_19530 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018307517.1:sodium:alanine symporter family protein >Feature sequence221 27 1094 gene locus_tag LOCUS_19540 27 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_19540 1145 1777 gene locus_tag LOCUS_19550 1145 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2503 1922 gene locus_tag LOCUS_19560 2503 1922 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence222 2117 132 gene locus_tag LOCUS_19570 gene ligA 2117 132 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_19570 2613 2191 gene locus_tag LOCUS_19580 2613 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence223 1641 964 gene locus_tag LOCUS_19590 1641 964 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_19590 1888 1634 gene locus_tag LOCUS_19600 1888 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2388 1876 gene locus_tag LOCUS_19610 2388 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19610 >Feature sequence224 333 1580 gene locus_tag LOCUS_19620 333 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence225 1026 2336 gene locus_tag LOCUS_19630 1026 2336 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence226 >Feature sequence227 <1 1249 gene locus_tag LOCUS_19640 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000853230.1:zinc-binding dehydrogenase 1266 2018 gene locus_tag LOCUS_19650 1266 2018 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045166.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence228 1145 606 gene locus_tag LOCUS_19660 1145 606 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_19660 1589 1206 gene locus_tag LOCUS_19670 1589 1206 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_19670 2442 1789 gene locus_tag LOCUS_19680 2442 1789 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence229 2051 1374 gene locus_tag LOCUS_19690 2051 1374 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence230 337 903 gene locus_tag LOCUS_19700 gene lepB 337 903 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_19700 905 1762 gene locus_tag LOCUS_19710 gene ylqF 905 1762 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_19710 1819 2436 gene locus_tag LOCUS_19720 1819 2436 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_19720